WO2020079256A1

WO2020079256A1 - Modulation, monitoring and prediction of the immune response directed against aav gene therapy vectors

Info

Publication number: WO2020079256A1
Application number: PCT/EP2019/078434
Authority: WO
Inventors: Federico Mingozzi; Klaudia KURANDA
Original assignee: Genethon; Institut National De La Sante Et De La Recherche Medicale; Sorbonne Université; Association Institut De Myologie
Priority date: 2018-10-19
Filing date: 2019-10-18
Publication date: 2020-04-23

Abstract

The present invention relates to the modulation, the monitoring and the prediction of the immune response directed against AAV gene therapy vectors. In particular, the present inventors have identified novel markers of immune system activation in response to rAAV vectors that can be used for inhibiting, monitoring and predicting said immune response to AAV vectors.

Description

MODULATION, MONITORING AND PREDICTION OF THE IMMUNE RESPONSE DIRECTED AGAINST AAV GENE THERAPY VECTORS

BACKGROUND OF THE INVENTION

Adeno-associated vims (AAV) is a non-enveloped, single-stranded DNA vims with a genome of ~5 kb. It is a member of Parvoviridae family and requires a helper vims such as adenovims or herpes simplex vims for replication. Despite a limited packaging capacity (<4.7 kb), AAV has many attractive features for use as a vector for in vivo gene therapy, including the ability to transduce a variety of cells and the ability to establish long-term expression of the transgene in vivo.

With several successful AAV vector-based gene therapy clinical trials (George et al., 2017, N Engl J Med., 377(23):2215-27 ; Mendell et al., 2017, N Engl J Med., 377(18): 1713-22 ; Rangarajan et ah, 2017, N Engl J Med., 377(26):2519-30 ; Miesbach et al., 2018, Blood, Mar 1;131(9): 1022-1031) and the recent Food and Dmg Administration (FDA) approval of a gene therapy for congenital blindness ( Russell et ah, 2017, Lancet., 390(10097):849-60), the promise of a permanent cure for numerous genetic diseases is becoming a reality. Despite the dazzling progress in the field, the adverse immune responses to the vector capsid remain the main obstacle for a widespread use of this technology and in some cases to the achievement of long-lasting efficacy. Except for reports of activation of T cells (Manno et ah, 2006, Nat Med., 12(3):342-7 ; Mingozzi, 2007, Nat Med., 13(4):419-22), not much is known about the mechanisms underlying cellular and humoral immune response to the AAV capsid in humans. Key questions are how AAV activates the innate immune system, how to predict the risk of cytotoxic reactions against transduced cells and how to control both T and B cell responses triggered by AAV vector administration. In particular, humoral responses to the AAV capsid remain an important obstacle to the wide-spread application of AAV-mediated gene therapy. Indeed, a considerable part of population is naturally exposed to the wild type vims, from which AAV vectors are derived, which leads to the acquisition of immunological memory that can directly modulate the outcome of gene transfer. Humoral responses to the AAV gene therapy vector also limit the ability to repeat administration of the vector when needed. Transient depletion of B cells and T cells, has been shown to at least partially address the issue (Monahan et al., 2010, Mol Ther.,18(l 1):1907-16 ; Mingozzi et al., 2012, Mol Ther., 20(7):1410- 6 ; Mingozzi et al., 2013, Gene Ther., 20(4):417-24 ; Corti et al., 2014, Mol Ther Methods Clin Dev., 1). Yet global immunosuppression is not without risks for patients, since it increases the susceptibility to infections, leads to reactivation of viruses, and can inhibit regulatory T cells that provide transgene tolerance following AAV gene transfer. Therefore, targeted regimens that could be applied during gene therapy and would selectively target antigen-specific B cells without inducing profound suppression are needed. Additionally, targeted immunomodulatory agents modulating innate immunity to AAV will impact adaptive immunity to the capsid globally, thus will help avoiding detrimental cytotoxic immune responses which have been responsible in some cases for the increase in liver (Manno et al., 2006, Nat Med., 12(3):342-7 ; Nathwani et al., 2014, N Engl J Med., 371(21):1994-2004 ; George et al., 2017, N Engl J Med., 377(23):2215-27 ; Mendell et al., 2017, N Engl J Med., 377(18): 1713-22) and muscle enzymes and the loss of transgene expression in clinical trials of AAV gene therapy.

SUMMARY OF THE INVENTION

The present invention relates to an agent able to inhibit IL- 1 , in particular IL- 1 b, and/or IL-6, for use in the inhibition of the immune response directed against a recombinant AAV gene therapy vector.

In a particular embodiment, the agent of the invention inhibits the secretion or the activity of IL-1, in particular IL-Ib, and/or IL-6. In a further particular embodiment the agent of the invention inhibits the secretion of IL-1, in particular IL-I b, and/or IL-6 by monocyte-related dendritic cells or other immune cells.

In a particular embodiment, the agent of the invention neutralizes IL-1, in particular IL-Ib, and/or IL-6. In particular, the agent is an anti-IL-1 neutralizing antibody or an anti-IL-6 neutralizing antibody.

In a particular embodiment, the recombinant AAV vector has an AAV2 or AAV8 capsid. In a particular embodiment, the recombinant AAV vector has an AAV8 capsid.

In a particular embodiment, the invention relates to an anti-IL-1 neutralizing antibody such as an anti- IL-1 b neutralizing antibody or an anti-IL-6 neutralizing antibody, for use in the inhibition of the immune response directed against a recombinant AAV8 gene therapy vector.

In particular, the agent is administered to the subject before, during or within a short period after the recombinant AAV vector is administered. The agent of the invention can be administered to the subject via enteral or parenteral routes. In a particular embodiment, the agent is administered orally, intravenously, intra-arterially, subcutaneously, intramuscularly, intracerebrally, intracerebroventricularly, intrathecally, or intraperitoneally.

The present invention also relates to an agent able to inhibit the activation of monocyte-related dendritic cells by a recombinant AAV gene therapy vector, for use in the inhibition of the immune response directed against said recombinant AAV gene therapy vector. In a further particular embodiment, the invention relates to an agent able to inhibit the activation of monocyte-related dendritic cells by a recombinant AAV8 gene therapy vector, for use in the inhibition of the immune response directed against said recombinant AAV8 gene therapy vector. The present invention further relates to a pharmaceutical composition comprising:

an agent able to inhibit IL- 1 , in particular IL- 1 b, and/or IL-6;

a recombinant AAV gene therapy vector; and

a pharmaceutically acceptable carrier.

In a particular embodiment, the pharmaceutical composition comprises :

an agent able to inhibit IL- 1 , in particular IL- 1 b, and/or IL-6;

a recombinant AAV8 gene therapy vector; and

a pharmaceutically acceptable carrier.

In a particular embodiment, the pharmaceutical composition comprises :

an anti-IL-1 neutralizing antibody such as an anti-IL-Ib neutralizing antibody, and/or an anti- IL-6 neutralizing antibody ;

a recombinant AAV8 gene therapy vector; and

a pharmaceutically acceptable carrier.

The invention further relates to a pharmaceutical composition comprising:

an agent able to inhibit the activation of monocyte -related dendritic cells;

a recombinant AAV gene therapy vector; and

a pharmaceutically acceptable carrier.

In a particular embodiment, the composition comprises:

an agent able to inhibit the activation of monocyte -related dendritic cells;

a recombinant AAV8 gene therapy vector; and

a pharmaceutically acceptable carrier.

The present invention also relates to a kit of parts comprising:

a first pharmaceutical composition comprising an agent able to inhibit IL- 1 , in particular IL- 1 b, and/or IL-6; or an agent able to inhibit the activation of monocyte-related dendritic cells; and

a second pharmaceutical composition comprising a recombinant AAV gene therapy vector; for simultaneous, separate or sequential administration.

In a particular embodiment, the kit of parts comprises :

a second pharmaceutical composition comprising a recombinant AAV8 gene therapy vector; for simultaneous, separate or sequential administration. In a particular embodiment, the kit of parts comprises :

a first pharmaceutical composition comprising an anti-IL-1 neutralizing antibody such as an anti-IL-Ib neutralizing antibody, and/or an anti-IL-6 neutralizing antibody; or an agent able to inhibit the activation of monocyte-related dendritic cells; and

a second pharmaceutical composition comprising a recombinant AAV8 gene therapy vector; for simultaneous, separate or sequential administration.

Another aspect of the invention relates to a method for monitoring the immune response against a recombinant AAV gene therapy vector in a subject comprising the detection, in a sample from the subject of:

(i) the level of IL-1 in particular IL-1 b and/or IL6; and/or

(ii) the level of IFNy ; and /or

(iii) the level of TNFa.

In a particular embodiment, the sample from the subject can be selected from the group consisting of : blood sample, serum sample, plasma sample, lymph sample, sample of cells isolated from blood, spleen or lymph nodes, and a sample of isolated peripheral blood mononuclear cells (PBMC). In a particular embodiment, the recombinant AAV gene therapy vector is a rAAV8 gene therapy vector.

Another aspect of the invention relates to a method for predicting recombinant AAV gene therapy vector immunogenicity or for predicting the immune response of a subject against a recombinant AAV gene therapy vector in vitro, comprising the steps of :

(i) contacting immune cells with the recombinant AAV gene therapy vector ; and

(ii) measuring :

the level of IL-1 in particular IL-1 b and/or IL6 ; and/or

the level

In particular, the immune cells can be selected in the group consisting of: B-cells, T cells (in particular CD8+ T cells), PBMC cells, dendritic cells in particular mo-DCs, macrophages and/or NBC cells, preferably the cells are PBMC cells, mo-DCs, CD8+ T cells, and/or NK cells. In a particular embodiment, the recombinant AAV gene therapy vector is a rAAV8 gene therapy vector.

A further aspect of the invention relates to a method for identifying subjects in need of an agent inhibiting the immune response directed against a recombinant AAV gene therapy vector, comprising the steps of :

(i) contacting a sample from the subject with the recombinant AAV gene therapy vector ; and

(ii) measuring the level of IL-1 in particular IL-1 b and/or IL6. In particular, the sample from the subject can be selected from the group consisting of : blood sample, serum sample, plasma sample, lymph sample, sample of cells isolated from blood, spleen or lymph nodes, and a sample of isolated peripheral blood mononuclear cells (PBMC). In a particular embodiment, the recombinant AAV gene therapy vector is a rAAV8 gene therapy vector.

LEGENDS TO THE FIGURES

Figure 1. AAV capsid triggers IL-Ib and IL-6 secretion in human monocyte-derived DCs. (A) Fold change of IL-Ib and IL-6 concentration in antigen-treated PBMC cultures vs. controls w/o antigen, measured by Luminex 24 hours after restimulation. (B) Representative flow cytometry plot showing the phenotype of DC populations analyzed in C, D, E and F. Adherent cells were gated on single, live, CD3 CD19^~HLA-DR⁺ cells. (C) Percentage of cytokine-positive cells in a given DC subset measured by the ICS assay 24h after restimulation. (D) Representative flow cytometry plots showing IL-I b or IL-6 staining in moDCs and the percentage of positive cells. Stimulation with lipopolysaccharide (LPS) was used as a positive control. (E) Heat map representing fold changes of mean fluorescence intensity (MFI) for CD86 staining in indicated DC populations measured by flow cytometry 24h after restimulation. HD, healthy donor. (F) Percentage of cytokine-positive cells in moDC subsets measured by ICS assay 24h after restimulation with either peptides or whole AAV2 capsid. In A, C and F histograms represent means and symbols individual sample values. Dashed lines represent positive cutoff. P values were calculated using non-parametric Kruskal- Wallis one-way ANOVA with Dunn’s multiple comparison test ns, not significant. *P< 0.05; **/^J<0.01 ; ***P<0.001 ; ****R<0.0001. (G) Fold change of IL-I b and IL-6 concentration in PBMCs cultures restimulated with the AAV2 pool of peptides, obtained from seronegative (n = 4) or seropositive (n = 7) donors. Boxplots show median ±SD. ns- not significant by two-tailed Student’s t test. (H) Percentage of IL-6-positive cells in a given DC subset measured by the ICS assay 24h after restimulation with indicated antigens (n = 7). Histograms represent means and open symbols individual sample values. Only samples in which IL-6 secretion was detected in any of the cellular subsets are shown.

Figure 2. CyTOF high-dimensional analysis of response to the AAV capsid in immune populations present in blood. CyTOF plots showing analyzed cellular subsets (CM, central memory, EM, effector memory, EMRA, effector memory RA, N, naive, REG, regulatory T, NK or B cells).

Figure 3. Identification of capsid-specific IFNy⁺ CD16^br‘^8htCD56^dim NK cells in AAV-seronegative individuals. (A) Flow cytometry plots showing IFNy and TNFa staining of NK cells, 24hrs after stimulation of PBMCs with the AAV2 pool of peptides or in control cultures without antigen (No Ag). (B) Fold change of IFNy concentration in the culture medium of PBMCs, measured by Luminex assay 24hrs after stimulation with the AAV2 pool of peptides. (C) Kinetics of IFNy and TNFa secretion and CD107a levels in CD16^bnshtCD56^dim NK cells 6, 24 and 48 hours after stimulation with the AAV2 pool of peptides (n = 4). Boxplots show median ±standard deviation (SD). (D) Percentage of cytokine positive CDl6^bnghtCD56^dim NK cells 24hrs after restimulation with the indicated antigens. (E) Heat map representing the percentage of IRNg⁺ or TNFof CD16^bnghtCD56^dim NK cells 24hrs after stimulation with the AAV2 pool of peptides. Percentage of healthy donors (HD) in each category is shown. (F) Percentage of fFNy⁺ or TNFof CDl6^bnghtCD56^dim NK cells 24hrs after stimulation with the AAV2 pool of peptides measured in AAV2 seronegative or seropositive donors. Boxplots show median ±SD. In B and D, histograms represent means and symbols individual sample values. Dashed lines represent the cutoff for positivity. P values were calculated Wilcoxon Signed Rank test in A, by non-parametric Kruskal-Wallis one-way ANOVA with Dunn’s multiple comparison test in D and by non-parametric Mann- Whitney test in F. ns, not significant. *P<0.05; ****P<0.000l.

Figure 4. Identification of capsid-specific TNFa⁺ CD8⁺ T cells in AAV-seropositive individuals. (A and B) Percentage of positive cells for a given marker in CD8⁺ T cells measured with the ICS assay. Background, as measured in the control cultures without antigen (No Ag), was subtracted. Histograms represent means and open symbols individual sample values. Dashed lines represent positive cutoff. P values were calculated by bi-tailed Student’s t test ns-not significant. In (A) measured ex vivo 6h after restimulation of PBMCs. In (B) measured after 1 cycle of expansion in vitro with indicated antigens and a recall with antigen-loaded autologous DCs. (C) Percentage of positive cells for a given marker in the dextramer (DMr)-positive CD8⁺ T cells. Measured after 1 cycle of expansion in vitro with an AAV2 peptide, VPI_372-380, or with a control EBV peptide EBNA_247-255 and a recall with an HLA-matched antigen-pulsed cell line. (D) Cytokine secretion measured by ELISpot, expressed as number of spot forming units (SFU) per 10⁶ of PBMCs. Cells were stimulated for 24hrs with indicated antigens. Black open symbols- negative response; red closed symbols- positive response; red open symbols- positive response with SFU too numerous to count (TNTC). (E) Percentage of AAV2 capsid-specific TNFof CD8⁺ T cells measured ex vivo in PBMCs from seropositive or seronegative donors. (F) Percentage of AAV2 capsid-specific IFNy NK cells in PBMCs comprising or not the capsid-specific TNFa⁺CD8⁺ T cells. In E and F, boxplots show median ±SD. P values were calculated by non-parametric Kruskal- Wallis one-way ANOVA with Dunn’s multiple comparison test in A, B, D and by non-parametric Mann- Whitney test in E, F. ns-not significant ns, not significant. *P<0.05; **P<0.01; ***P<0.001;

****p<0 0001.

Figure 5. AAV capsid triggers II-ίb-dependent B-cell differentiation in vitro and in vivo. (A) Percentage of antibody-secreting cells (ASC) defined as CD3 CDl9⁺fgD CD24 CD27⁺CD38⁺⁺ relative to the control cell cultures w/o antigen (No Ag), measured by flow cytometry («=8). (B) Percentage of AAV2-specific ASCs in PBMCs from seropositive vs. seronegative donors. (C) Percentage of AAV2-specific TNFa⁺CD8⁺ T cells in PBMCs comprising or not capsid-specific ASCs. (D) Percentage of AAV2-specific IFNy NK cells in PBMCs comprising or not capsid-specific ASCs. (E) Concentration of anti-AAV2 IgM secreted in PBMC cultures, stimulated or not with the AAV2 capsid particles. PBMCs obtained from AAV2-seropositive donors. (F) Percentage of B-cell differentiation in PBMCs obtained from AAV2-seropositive donors, stimulated with antigen pool of peptides and supplemented with cytokine-neutralizing Abs or isotype control (±SD). Numbers of ASCs in cultures with the isotype control were considered as 100 % of antigen-specific B cell differentiation (n= 4). (G) Concentration of anti-AAV2 IgM secreted in PBMC cultures, stimulated with the AAV2 capsid particles and supplemented with cytokine-neutralizing Abs or isotype control. PBMCs obtained from AAV2-seropositive donors (n= 3). (H) Experimental design of results in panels I and J. On the day -2, -1, 0, 1, 2 and 7 mice were injected IP with 1 mg/kg of anti-IL-I b, anti-IL-6 neutralizing antibodies or corresponding isotype control (Ab). All mice received AAV8-F.IX i.v. injection (10⁹vg) on day 0. Blood was collected on day 21. (I) Effect of anti-IL-Ib, anti-IL-6 neutralizing Abs on the anti-AAV8 antibody titers in mouse blood. Anti-AAV8 IgG titers were measured by ELISA, 3 weeks after AAV8-F.IX injection (n= 5 /group). (J) Vector genome copy number (VGCN) per cell, measured in mouse liver 3 months post vector injection by qPCR. Values were normalized to the number of copies of titin measured in each sample. In B, C, D, I and J boxplots show median ±SD. All P values were calculated by non-parametric Kruskal- Wallis one-way ANOVA with Dunn’s multiple comparison test in A, F, G, I, J and by non-parametric Mann- Whitney test in B, C, D, E. ns, not significant. *P<0.05; ***P<0.001.

DETAILED DESCRIPTION OF THE INVENTION

The human parvovirus Adeno-Associated Virus (AAV) is a dependovirus that is naturally defective for replication, which is able to integrate into the genome of the infected cell to establish a latent infection. AAV vectors have arisen considerable interest as potential vectors for human gene therapy. Among the favorable properties of the virus are its lack of association with any human disease, its ability to infect both dividing and non-dividing cells, and the wide range of cell lines derived from different tissues that can be infected.

In the context of the present invention, "AAV vector" refers to any AAV vector, in particular any AAV vector useful for gene therapy. Many methods were established for efficient production of recombinant AAV (rAAV) vectors that are capable of expressing foreign genes, in particular therapeutic genes, in mammalian cells. The terms "adeno-associated virus" (AAV) and "recombinant adeno-associated virus" (rAAV) are used interchangeably herein and refer to an AAV whose genome was modified, as compared to a wild-type (wt) AAV genome, by replacement of a part of the wt genome with a transgene of interest.

The term "transgene" refers to a gene whose nucleic acid sequence is non-naturally occurring in an AAV genome. In particular, the rAAV vector is to be used in gene therapy. As used herein, the term "gene therapy" refers to the transfer of genetic material (e.g., DNA or RNA) of interest into a host to treat or prevent a genetic or acquired disease or condition. The genetic material of interest encodes a product (e.g., a polypeptide or functional RNA ) whose production in vivo is desired. For example, the genetic material of interest can encode a hormone, receptor, enzyme or polypeptide of therapeutic value. Alternatively, the genetic material of interest can encode a functional RNA of therapeutic value, such as an antisense RNA or a shRNA of therapeutic value.

Recombinant AAVs may be engineered using conventional molecular biology techniques, making it possible to optimize these particles for cell specific delivery of nucleic acid sequences, for minimizing immunogenicity, for tuning stability and particle lifetime, for efficient degradation, for accurate delivery to the nucleus. Desirable AAV elements for assembly into vectors include the cap proteins, including the vpl, vp2, vp3 and hypervariable regions, the rep proteins, including rep 78, rep 68, rep 52, and rep 40, and the sequences encoding these proteins. These elements may be readily used in a variety of vector systems and host cells.

In the present invention, the capsid of the AAV vector may be derived from a naturally or non-naturally- occurring serotype. In a particular embodiment, the serotype of the capsid of the AAV vector is selected from AAV natural serotypes. Alternatively to using AAV natural serotypes, artificial AAV serotypes may be used in the context of the present invention, including, without limitation, AAV with a non- naturally occurring capsid protein. Such an artificial capsid may be generated by any suitable technique, using a selected AAV sequence (e.g., a fragment of a vpl capsid protein) in combination with heterologous sequences which may be obtained from a different selected AAV serotype, non-contiguous portions of the same AAV serotype, from a non- AAV viral source, or from a non- viral source. A capsid from an artificial AAV serotype may be, without limitation, a chimeric AAV capsid, a recombinant AAV capsid, or a "humanized" AAV capsid.

According to a particular embodiment, the capsid of the AAV vector is of the AAV-1, -2, AAV-2 variants (such as the quadruple-mutant capsid optimized AAV-2 comprising an engineered capsid with Y44+500+730F+T491V changes, disclosed in Ling et al., 2016 Jul 18, Hum Gene Ther Methods. [Epub ahead of print]), -3 and AAV-3 variants (such as the AAV3-ST variant comprising an engineered AAV3 capsid with two amino acid changes, S663V+T492V, disclosed in Vercauteren et al., 2016, Mol. Ther. Vol. 24(6), p. 1042), -3B and AAV-3B variants, -4, -5, -6 and AAV-6 variants (such as the AAV6 variant comprising the triply mutated AAV6 capsid Y731F/Y705F/T492V form disclosed in Rosario et al., 2016, Mol Ther Methods Clin Dev. 3, p.16026), -7, -8, -9 and AAV-9 variants (such as AAVhu68), -2G9, -10 such as -cylO and -rhlO, -rh39, -rh43, -rh74, -dj, Anc80, LK03, AAV.PHP, AAV2i8, porcine AAV such as AAVpo4 and AAVpo6, and tyrosine, lysine and serine capsid mutants of AAV serotypes. In addition, the capsid of other non-natural engineered variants (such as AAV-sparklOO), chimeric AAV or AAV serotypes obtained by shuffling, rationale design, error prone PCR, and machine learning technologies can also be useful. In a particular embodiment, the AAV vector has a naturally occurring capsid, such as an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV-cylO, AAVrhlO capsid. In a particular embodiment, the capsid of the AAV vector is selected from an AAV2 or AAV8 capsid. In a particular embodiment, the recombinant AAV vector has an AAV8 capsid.

In a particular embodiment, the AAV vector is an AAV vector with high tropismto the liver and muscle, such as an vector having an AAV8 capsid.

The genome of the AAV vector comprises 5'- and 3 '-AAV inverted terminal repeats (ITRs) flanking a genetic material of interest. The ITRs may be derived from any AAV genome, such as an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV-cylO or AAVrhlO genome. In a particular embodiment, the genome of the AAV vector comprises 5'- and 3'-AAV2 ITRs.

Any combination of AAV serotype capsid and ITR may be implemented in the context of the present invention, meaning that the AAV vector may comprise a capsid and ITRs derived from the same AAV serotype, or a capsid derived from a first serotype and ITRs derived from a different serotype than the first serotype. Such a vector with capsid ITRs deriving from different serotypes is also termed a "pseudotyped vector".

In the context of the present invention, the term“rAAV8 vector” refers to a recombinant AAV vector having an AAV8 capsid. Such rAAV8 vector may comprise ITRs derived from the AAV 8 serotype, or ITRs derived from a different serotype than the AAV 8 serotype.

The present invention generally relates to the immune response directed against such rAAV vectors, once administered to a subject. The term "immune response" includes any response associated with immunity including, but not limited to, increases or decreases in cytokine expression, production or secretion, cytotoxicity, immune cell activation, immune cell migration, antibody production and/or cellular immune responses. In the context of the present invention the“immune response” includes the innate immune response, the adaptative immune response, the humoral immune response, as well as the cell-mediated immune response. This immune response includes cellular or humoral systems involving, for example, B-cells and T-cells.

A first aspect of the invention relates to an agent able to inhibit immune responses to a rAAV gene therapy vector. In particular, the invention relates to the inhibition of the immune response directed against a rAAV gene therapy vector. The term "inhibition of an immune response" includes downregulation, suppression, reduction or decrease of an immune response as defined herein. The inhibition of the immune response to the rAAV gene therapy vector can be a total inhibition or a partial inhibition. Preferably, the inhibition of the immune response is a total inhibition. The inhibition of the immune response to rAAV gene therapy vector thereby leads to the inhibition of adverse immune response against the rAAV vector and to the improvement of the rAAV therapeutic efficacy.

In particular, the agent inhibits the immune response to said rAAV gene therapy vector without inhibiting the immune response directed towards some or all other viruses or undesirable antigens. In particular, the agent of the invention does not lead to the suppression of the immune response towards undesirable antigens or vimses other than AAV. In a particular embodiment, the agent of the invention does not inhibit the immune response to other types of viruses such as Influenza A virus (Flu), Epstein- Barr virus (EBV) or cytomegalovirus (CMV). In a further particular embodiment, the agent is able to inhibit cellular immune response and/or humoral immune response to rAAV gene therapy vectors.

The invention also relates to an agent able to inhibit immune responses to a rAAV gene therapy vector, for use in the treatment of a disease by gene therapy, wherein the agent is used in combination with a rAAV gene therapy vector. The invention further relates to a recombinant AAV gene therapy vector suitable for the treatment of a disease, for use in the treatment of said disease in combination with an agent able to inhibit immune responses to said rAAV gene therapy vector. The invention also relates to an agent able to inhibit IL-1 and/or IL-6, for use in the treatment of a disease by gene therapy with a rAAV gene therapy vector. The invention further relates to a recombinant AAV gene therapy vector suitable for the treatment of a disease, for use in the treatment of said disease in combination with an agent able to inhibit IL-1 and/or IL-6. Moreover, the invention relates to a method for delivering a gene to a subject in need thereof, comprising administering to said subject a recombinant AAV vector comprising said gene and administering to said subject an agent able to inhibit immune responses to said recombinant AAV vector. In a particular embodiment of this method, the delivered gene is a therapeutic gene. In addition, the invention relates to a method for delivering a gene to a subject in need thereof, comprising administering to said subject a recombinant AAV vector comprising said gene and administering to said subject an agent able to inhibit IL-1 and/or IL-6. In a particular embodiment of this method, the delivered gene is a therapeutic gene.

In particular, the invention relates to an agent able to inhibit immune responses to a rAAV8 gene therapy vector, for use in the treatment of a disease by gene therapy, wherein the agent is used in combination with a rAAV8 gene therapy vector. The invention further relates to a recombinant AAV8 gene therapy vector suitable for the treatment of a disease, for use in the treatment of said disease in combination with an agent able to inhibit immune responses to said rAAV8 gene therapy vector. The invention also relates to an agent able to inhibit IL-1 and/or IL-6, for use in the treatment of a disease by gene therapy with a rAAV8 gene therapy vector. The invention further relates to a recombinant AAV8 gene therapy vector suitable for the treatment of a disease, for use in the treatment of said disease in combination with an agent able to inhibit IL-1 and/or IL-6. Moreover, the invention relates to a method for delivering a gene to a subject in need thereof, comprising administering to said subject a recombinant AAV8 vector, comprising said gene and administering to said subject an agent able to inhibit immune responses to said recombinant AAV8 vector. In a particular embodiment of this method, the delivered gene is a therapeutic gene. In addition, the invention relates to a method for delivering a gene to a subject in need thereof, comprising administering to said subject a recombinant AAV8 vector comprising said gene and administering to said subject an agent able to inhibit IL-1 and/or IL-6. In a particular embodiment of this method, the delivered gene is a therapeutic gene.

In a particular embodiment, the invention relates to an anti-IL-1 neutralizing antibody, such as an anti- IL-1 b neutralizing antibody or an anti-IL-6 neutralizing antibody, for use in the treatment of a disease by gene therapy, wherein the neutralizing antibody is used in combination with a rAAV gene therapy vector. The invention further relates to a recombinant AAV gene therapy vector suitable for the treatment of a disease, for use in the treatment of said disease in combination with an anti-IL-1 neutralizing antibody, such as an anti-IL-1 b neutralizing antibody or an anti-IL-6 neutralizing antibody. The invention also relates to an anti-IL-1 neutralizing antibody, such as an anti-IL-1 b neutralizing antibody or an anti-IL-6 neutralizing antibody, for use in the treatment of a disease by gene therapy with a rAAV gene therapy vector. The invention further relates to a recombinant AAV gene therapy vector suitable for the treatment of a disease, for use in the treatment of said disease in combination with anti- IL-1 neutralizing antibody, such as an anti-IL-1 b neutralizing antibody or an anti-IL-6 neutralizing antibody. Moreover, the invention relates to a method for delivering a gene to a subject in need thereof, comprising administering to said subject a recombinant AAV vector, comprising said gene and administering to said subject an anti-IL-1 neutralizing antibody, such as an anti-IL-1 b neutralizing antibody or an anti-IL-6 neutralizing antibody. In a particular embodiment of this method, the delivered gene is a therapeutic gene. In addition, the invention relates to a method for delivering a gene to a subject in need thereof, comprising administering to said subject a recombinant AAV vector comprising said gene and administering to said subject an anti-IL-1 neutralizing antibody, such as an anti-IL-Ib neutralizing antibody or an anti-IL-6 neutralizing antibody. In a particular embodiment of this method, the delivered gene is a therapeutic gene.

In a particular embodiment, the invention relates to an anti-IL-1 neutralizing antibody, such as an anti- IL-1 b neutralizing antibody or an anti-IL-6 neutralizing antibody, for use in the treatment of a disease by gene therapy, wherein the neutralizing antibody is used in combination with a rAAV8 gene therapy vector. The invention further relates to a recombinant AAV8 gene therapy vector suitable for the treatment of a disease, for use in the treatment of said disease in combination with an anti-IL-1 neutralizing antibody, such as an anti-IL-1 b neutralizing antibody or an anti-IL-6 neutralizing antibody. The invention also relates to an anti-IL-1 neutralizing antibody, such as an anti-IL-Ib neutralizing antibody or an anti-IL-6 neutralizing antibody, for use in the treatment of a disease by gene therapy with a rAAV8 gene therapy vector. The invention further relates to a recombinant AAV8 gene therapy vector suitable for the treatment of a disease, for use in the treatment of said disease in combination with anti- IL-1 neutralizing antibody, such as an anti-IL-1 b neutralizing antibody or an anti-IL-6 neutralizing antibody. Moreover, the invention relates to a method for delivering a gene to a subject in need thereof, comprising administering to said subject a recombinant AAV8 vector, comprising said gene and administering to said subject an anti-IL-1 neutralizing antibody, such as an anti-IL-1 b neutralizing antibody or an anti-IL-6 neutralizing antibody. In a particular embodiment of this method, the delivered gene is a therapeutic gene. In addition, the invention relates to a method for delivering a gene to a subject in need thereof, comprising administering to said subject a recombinant AAV8 vector comprising said gene and administering to said subject an anti-IL-1 neutralizing antibody, such as an anti-IL-Ib neutralizing antibody or an anti-IL-6 neutralizing antibody. In a particular embodiment of this method, the delivered gene is a therapeutic gene.

In a particular embodiment, the agent of the invention is able to inhibit a cytokine of the immune system that is involved in the immune response to rAAV gene therapy vector. The term“able to inhibit a cytokine” refers to the inhibition of the activity or the effect of the cytokine, for example by decreasing the cytokine level (e.g. intracellular or circulating level), by blocking the receptor(s) to said cytokine, by acting on the cellular components responsible for the production and/or secretion of said cytokine, by preventing said cytokine from reaching its receptor(s) or by neutralizing the biological activity of said cytokine. The inhibition of the activity or the effect of the cytokine as defined above can be a total inhibition or a partial inhibition. Preferably, the inhibition is a total inhibition. In a particular embodiment, the agent of the invention inhibits at least 50%, 60%, 70%, 80%, 90%, 95% or at least 99% of the activity of the cytokine. Assessment of cytokine inhibition may be readily done by those skilled in the art, for example by following the methods described in Yang et ah, Regulation of interleukin- 1 beta and interleukin- lb eta inhibitor release by human airway epithelial cells. Eur Respir J. 2004 Sep;24(3):360-6; Laufer et al., An in-vitro screening assay for the detection of inhibitors of proinflammatory cytokine synthesis: a useful tool for the development of new antiarthritic and disease modifying drugs, Osteoarthritis and Cartilage, Vol. 10, Issue 12, December 2012, p. 961-967; Saito et al., A new bioassay for measuring the strength of IL-6/STAT3 signal inhibition by tocilizumab in patients with rheumatoid arthritis, Arthritis Res Ther. 2017; 19: 231.

In the context of the present invention, the agent able to inhibit a cytokine may be, for example, a neutralizing molecule such as a neutralizing antibody or a soluble decoy, an antagonist of a receptor of said cytokine, a molecule directed against a component of the activation pathway triggered by said cytokine, an aptamer, an antisense RNA or a siRNA. In a particular embodiment, the agent is a neutralizing antibody. By“neutralizing antibody” is meant an antibody able to bind to the cytokine or to its receptor and that neutralizes the biological effect associated with said cytokine. In a particular embodiment, the agent is a neutralizing antibody binding to a cytokine. The agent of the invention may inhibit one or more cytokines, or may correspond to several agents, each being able to inhibit one or more cytokines. The inhibition of the cytokine may also be carried out by reducing cytokine levels ex vivo using methods such as plasmapheresis designed to specifically deplete the one or more cytokine of the immune system that is involved in the immune response to rAAV gene therapy vector, such as a plasmapheresis designed to specifically deplete IL- 1 , such as IL- 1 b, and/or IL- 6.

By cytokines is meant soluble mediators secreted by different immune cells which include, but are not limited to, TNF such as TNFa, IFN such as IFNy, interleukins IL-1 such as IL-Ia or IL-Ib, IL-2, IL-4, IL-5, IL-6, IL-10, IL-12, IL-13, IL- 18, CCL4/RANTES, and TORb. In a particular embodiment, the agent of the invention is able to inhibit IL-1, in particular IL-Ib, or IL6. Preferably, the agent of the invention is able to inhibit IL-1 b or IL-6.

In a particular embodiment, the agent is able to inhibit IL-1, more particularly IL-I b. In a particular embodiment, the agent is an IL-1 neutralizing antibody, more particularly an IL-Ib neutralizing antibody. Representative IL-1 neutralizing antibodies useful in the practice of the present invention include, without limitation, MEDI-8968 that is a human monoclonal antibody directed against IL-1 receptor. Representative IL-Ib neutralizing antibodies useful in the practice of the present invention include, without limitation, canakinumab (e.g. ®Ilaris), gevokizumab (or XOMA 052) and LY2189102 that are neutralizing human monoclonal antibodies directed against IL-1 b. Representative neutralizing antibodies directed against IL-1 a useful in the practice of the present invention include, without limitation, MABpl (e.g. Xilonix®). In a further particular embodiment, the agent is a soluble decoy of IL-1, in particular of IL-1 b. Such soluble decoys of IL-1 include, without limitation, rilonacept (e.g. Arcalyst®) which is a dimeric fusion protein consisting of the ligand-binding domain of the human IL- 1 receptor and IL-1 receptor accessory protein.

In another particular embodiment, the agent is able to inhibit IL-6. In a particular embodiment, the agent is an IL-6 neutralizing antibody. Representative IL-6 neutralizing antibodies useful in the practice of the present include, without limitation, Tocilizumab (e.g. RoActemra®) and Sarilumab (e.g. Kevzara®) that are both human monoclonal antibodies directed against the IL-6 receptor, or olokizumab, elsilimomab (also known as B-E8) and sirukumab (e.g. Plivensia) that are neutralizing human monoclonal antibodies directed against IL-6. The agent may also be a soluble decoy of IL-6. In a particular embodiment, the agent of the invention is able to inhibit cytokines produced or secreted by immune cells that specifically respond to the rAAV gene therapy vector. In particular, the agent of the invention is able to inhibit cytokines produced or secreted by dendritic cells, in particular by monocyte-related dendritic cells (mo-DCs). In particular, the agent of the invention is able to inhibit IL- 1, in particular IL-1 b, or IL-6 produced or secreted by mo-DCs.

In another embodiment, the agent is an antagonist of a receptor to a cytokine, such as an antagonist of an IL-1 receptor, in particular an IL-Ib receptor, or an antagonist of an IL-6 receptor. Anakinra (e.g. Kineret®) is a representative antagonist of the IL-1R1 receptor.

In another embodiment, the agent of the invention is able to inhibit cytokines produced or secreted by Natural Killer (NK) cells, in particular by CD16^bnght CD56^dim NK cells. In particular, the agent of the invention is able to inhibit IFNy, in particular IFNy secreted by NK cells, more particularly by CD 16^bnght CD56^dim NK cells.

In another embodiment, the agent of the invention is able to inhibit cytokines produced or secreted by T-cells, in particular by CD8+ T-cells. In particular, the agent of the invention is able to inhibit TNFa, in particular TNFa secreted by T-cells, more particularly by CD8+ T-cells.

In another embodiment, the agent is able to inhibit the activation of immune cells by rAAV gene therapy vector. In this embodiment, the agent prevents the activation of the immune cells by the rAAV vector, and thereby prevents the initiation of an immune response by said immune cells. In particular, the agent is able to inhibit the cells that are specifically activated or that specifically respond to the rAAV vector, and not to other antigens. In a particular embodiment, the agent is able to inhibit the activation of dendritic cells, in particular mo-DC. In particular, the agent is a substance that is suitable for preventing the expression or secretion of IL-1, in particular IL-1 b, or IL-6, by mo-DCs. Such an agent may be a small molecule, a polypeptide or an inhibiting RNA such as an antisense RNA or siRNA. For example the agent targeting mo-DC can be rapamycin, in particular rapamycin formulated in a nanoparticle such as a Poly(lactic-co-glycolic acid) (PLGA) nanoparticle. More generally any agent able to inactivate mo- DCs may be used in the present invention formulated into a nanoparticle, since mo-DCs intake particularly well nanoparticles.

In another embodiment, the agent is able to inhibit the activation of immune cells by rAAV8 gene therapy vector. In this embodiment, the agent prevents the activation of the immune cells by the rAAV8 vector, and thereby prevents the initiation of an immune response by said immune cells. In particular, the agent is able to inhibit the cells that are specifically activated or that specifically respond to the rAAV8 vector, and not to other antigens. In a particular embodiment, the agent is able to inhibit the activation of dendritic cells, in particular mo-DC. In particular, the agent is a substance that is suitable for preventing the expression or secretion of IL-1, in particular IL-1 b, or IL-6, by mo-DCs. Such an agent may be a small molecule, a polypeptide or an inhibiting RNA such as an antisense RNA or siRNA. For example the agent targeting mo-DC can be rapamycin, in particular rapamycin formulated in a nanoparticle such as a Poly(lactic-co-glycolic acid) (PLGA) nanoparticle. More generally any agent able to inactivate mo-DCs may be used in the present invention formulated into a nanoparticle, since mo- DCs intake particularly well nanoparticles.

In another embodiment, the agent inhibits the TLR2/CD14 pathway. For example, the agent can be OxPAPC, an agent known for blocking the signaling of TLR2. The agent can also be an antibody directed against TLR2 or an antibody directed against CD14. In a particular embodiment, the agent inhibits an intracellular component involved in the TLR2/CD14 pathway, such as TIRAP (Toll- Interleukin 1 Receptor Domain Containing Adaptor Protein), MyD88, NLRP3 (NACHT, LRR and PYD domains-containing protein 3), ASC (Apoptosis-associated speck-like protein containing CARD), CARD8 (caspase activation and recruitment domain 8), pro-caspase 1, caspase 1 or IL-1 b. For example, the agent inhibiting an intracellular component involved in the TLR2/CD14 pathway can be Pepinh- MYD, Isoliquiritigenin, Parthenolide, Z-VAD-FMK (N-Benzyloxycarbonyl-Val-Ala-Asp(O-Me) fluoromethyl ketone) or VX-765 (Belnacasan).

In another embodiment, the agent of the invention is able to inhibit the activation of NK cells by the rAAV vector, in particular CD16^brisht CD56^dim NK cells, in particular CD16^bright CD56^dim NK cells secreting IFNy.

In another embodiment, the agent of the invention is able to inhibit the activation of T-cells by the rAAV vector, in particular CD8+ T-cells, in particular CD8+ T-cells secreting TNFot. In a particular embodiment, the agent is a TNF inhibitor such as infliximab (e.g. Remicade®), etanercept (e.g. Embrel®), adalimumab (Humira®), certolizumab pegol (Cimzia®) or golimumab (Simponi®).

The present invention also provides pharmaceutical compositions comprising the agent of the invention able to inhibit the immune response directed against a rAAV gene therapy vector. In a particular embodiment, the agent is an anti-IL-1 neutralizing antibody, such as an anti-IL-Ib neutralizing antibody or an anti-IL-6 neutralizing antibody. Such compositions comprise an effective amount of the agent of the invention and a pharmaceutically acceptable carrier. In a specific embodiment, the term "pharmaceutically acceptable" means approved by a regulatory agency of the Federal or a state government or listed in the U.S. or European Pharmacopeia or other generally recognized pharmacopeia for use in animals, and humans. The term "carrier" refers to a diluent, adjuvant, excipient, or vehicle with which the therapeutic is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water is a preferred carrier when the pharmaceutical composition is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions. Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene glycol, water, ethanol and the like. Examples of suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences" by E. W. Martin. Such compositions will contain a therapeutically effective amount of the therapeutic, preferably in purified form, together with a suitable amount of carrier so as to provide the form for proper administration to the subject.

In a particular embodiment, the composition comprises one or more agent(s) of the invention, each agent targeting the same or a different component of the immune response, in particular each agent targeting a different component of the immune response. For example, the composition can comprise an agent inhibiting IL-I b associated to an agent inhibiting IL-6, such as an anti-IL-I b neutralizing antibody associated to an anti-IL-6 neutralizing antibody.

In another particular embodiment, the composition comprises one or more agent(s) of the invention and one or more rAAV gene therapy vector(s). For example, the composition can comprise (i) an agent able to inhibit IL-1, such as IL-Ib, or IL-6 and/or an agent able to inhibit the activation of an immune cell by a rAAV gene therapy vector, such as monocyte-related dendritic cells, and (ii) a recombinant AAV gene therapy vector.

In another particular embodiment, the composition comprises (i) an anti-IL-1 neutralizing antibody, such as an anti-IL-1 b neutralizing antibody or an anti-IL-6 neutralizing antibody, and (ii) a rAAV8 gene therapy vector. For example, the composition can comprise (i) an anti-IL-1 neutralizing antibody, such as an anti-IL-1 b neutralizing antibody or an anti-IL-6 neutralizing antibody and/or an agent able to inhibit the activation of an immune cell by a rAAV8 gene therapy vector, such as monocyte-related dendritic cells, and (ii) a recombinant AAV8 gene therapy vector.

The composition, if desired, can also contain minor amounts of other ingredients such as wetting or emulsifying agents, or pH buffering agents. These compositions can take the form of solutions, suspensions, emulsions, tablets, pills, capsules, powders, sustained-release formulations and the like.

The pharmaceutical composition is adapted for any type of administration to a mammal, in particular a human being, and is formulated in accordance with routine procedures. The composition is formulated by using suitable conventional pharmaceutical carrier, diluent and/or excipient. Administration of the composition may be via any common route so long as the target molecule or cell is available via that route. This includes for example oral, nasal, intradermal, subcutaneous, intramuscular, intraperitoneal or intravenous administration. In particular, the agent is administered to the subject via enteral or parenteral routes, in particular the agent is administered intravenously, intra-arterially, subcutaneously, intramuscularly, intracerebrally, intracerebroventricularly, intrathecally, or intraperitoneally. Preferably, the composition is formulated as a pharmaceutical composition adapted for intravenous administration to human beings. Typically, compositions for intravenous administration are solutions in sterile isotonic aqueous buffer.

The amount of the agent of the invention which will be effective in the inhibition of the immune response to rAAV gene therapy vector can be determined by standard clinical techniques. In addition, in vivo and/or in vitro assays may optionally be employed to help predict optimal dosage ranges. The precise dose to be employed in the formulation will also depend on the route of administration and should be decided according to the judgment of the practitioner and each patient's circumstances.

In another aspect, the present invention also relates to a kit suitable for use in achieving immune tolerance to a rAAV gene therapy vector in a subject in need thereof, the kit comprising (i) an agent of the invention as defined above, and (ii) another substance able to inhibit the immune response to said rAAV gene therapy vector. The other substance may also be selected from selective inhibitors of Janus kinase. Components (i) and (ii) of the kit are for simultaneous, separate or sequential administration. Suitable other substances include, without limitation, T cell targeting drugs such as rapamycin (in particular rapamycin nanoparticles, such as those disclosed in Meliani et al., Nature Communications (2018) 9: 4098), tacrolymus and cyclosporine A, and B cell targeting drugs such as rituximab, Baff inhibitors, ibrutinib and proteasome inhibitors like bortezomib.

The present invention also relates to a kit of parts comprising (i) a first pharmaceutical composition comprising an agent able to inhibit the immune response to rAAV gene therapy vector, and (ii) a second pharmaceutical composition comprising a recombinant AAV gene therapy vector, for simultaneous, separate or sequential administration. For example, the present invention relates to a kit of parts comprising (i) a first pharmaceutical composition comprising an agent able to inhibit IL-1, such as IL- 1 b, or IL-6, or an agent able to inhibit the activation of an immune cell by a rAAV gene therapy vector, such as monocyte-related dendritic cells, and (ii) a second pharmaceutical composition comprising a recombinant AAV gene therapy vector, for simultaneous, separate or sequential administration. In a further embodiment, the kit of parts may further include another substance able to inhibit the immune response to an rAAV gene therapy vector, as described above. The kit of parts may further include instructions to be followed for implementing the treatment disclosed herein. For example, the present invention relates to a kit of parts comprising (i) a first pharmaceutical composition comprising an anti-IL-1 neutralizing antibody, such as an anti-IL-Ib neutralizing antibody or an anti-IL-6 neutralizing antibody and (ii) a second pharmaceutical composition comprising a recombinant AAV8 gene therapy vector, for simultaneous, separate or sequential administration.

The present invention also relates to an agent of the invention as described above for use as a medicament.

The invention further relates to an agent as described above for use in a method for inhibiting the immune response to rAAV gene therapy vector. The invention thereby relates to an agent for use in a method for reducing, alleviating or avoiding adverse events related to the immune response to the rAAV gene therapy vector.

In particular, the invention relates to an agent as described above for use in a method for inhibiting the immune response to rAAV8 gene therapy vector. The invention thereby relates to an agent for use in a method for reducing, alleviating or avoiding adverse events related to the immune response to the rAAV8 gene therapy vector.

In particular, the invention relates to an anti-IL-1 neutralizing antibody, such as an anti-IL-1 b neutralizing antibody or an anti-IL-6 neutralizing antibody, for use in a method for inhibiting the immune response to rAAV gene therapy vector. The invention thereby relates to an anti-IL-1 neutralizing antibody, such as an anti-IL-1 b neutralizing antibody or an anti-IL-6 neutralizing antibody, for use in a method for reducing, alleviating or avoiding adverse events related to the immune response to the rAAV gene therapy vector.

In particular, the invention relates to an anti-IL-1 neutralizing antibody, such as an anti-IL-1 b neutralizing antibody or an anti-IL-6 neutralizing antibody, for use in a method for inhibiting the immune response to rAAV8 gene therapy vector. The invention thereby relates to an anti-IL-1 neutralizing antibody, such as an anti-IL-1 b neutralizing antibody or an anti-IL-6 neutralizing antibody, for use in a method for reducing, alleviating or avoiding adverse events related to the immune response to the rAAV8 gene therapy vector.

In a particular embodiment, the invention relates to an agent as described above for use in a method for improving the therapeutic efficacy of a rAAV gene therapy vector. Indeed, the immune response against rAAV gene therapy vectors leads to the loss of therapeutic gene expression and consequently to the loss of rAAV therapeutic efficacy. Therefore, the agent of the invention, able to inhibit the immune response to rAAV gene therapy vector, can be used for reducing the cellular immune response to the rAAV vector, for prolonging transgene expression, reducing inflammation and/or improving the safety and efficacy of AAV vectors for gene therapy in animals, more particularly in humans.

In particular, the agent of the invention can be used to improve the efficacy of AAV vectors for treating any disease or disorder that can be treated by gene therapy.

The disorder treated by gene therapy may be any disorder for which expression of a given gene may be desirable. The disorder is in particular an inherited or acquired disorder, such as an inherited or acquired neuromuscular disease. Of course, the therapeutic transgene delivered by the AAV will be selected in view of the disorder to be treated.

In a particular embodiment, the disorder is a lysosomal storage disease (LSD), such as mucopolysaccharidosis type I to VII (MPSI-VII), Sandhoff disease, Pompe and Fabry disease and Tay- Sachs.

In another particular embodiment, the disorder is a metabolic disease, such as Maple syrup disease (MSUD), Methylmalonic academia (MMA), glycogenosis type I and III (GSDI and III), Niemann-Pick disease (NPC), Canavan disease and Phenylketonuria (PKU).

In another particular embodiment, the disorder is a clotting factor deficiency, such as hemophilia A and B, factor V, VII, and X deficiency and von Willebrand factor deficiency.

In a particular embodiment, the disorder is a neuro -muscular disorder. The term“neuromuscular disorder” encompasses diseases and ailments that impair the functioning of the muscles, either directly, being pathologies of the voluntary muscle, or indirectly, being pathologies of nerves or neuromuscular junctions. Illustrative neuromuscular disorders include, without limitation, muscular dystrophies (e.g. myotonic dystrophy (Steinert disease), Duchenne muscular dystrophy, Becker muscular dystrophy, limb-girdle muscular dystrophy, facioscapulohumeral muscular dystrophy, congenital muscular dystrophy, oculopharyngeal muscular dystrophy, distal muscular dystrophy, Emery-Dreifuss muscular dystrophy, motor neuron diseases (e.g. amyotrophic lateral sclerosis (ALS), spinal muscular atrophy (Infantile progressive spinal muscular atrophy (type 1, Werdnig- Hoffmann disease), intermediate spinal muscular atrophy (Type 2), juvenile spinal muscular atrophy (Type 3, Kugelberg-Welander disease), adult spinal muscular atrophy (Type 4)), spinal-bulbar muscular atrophy (Kennedy disease)), inflammatory Myopathies (e.g. polymyositis dermatomyositis, inclusion-body myositis), diseases of neuromuscular junction (e.g. myasthenia gravis, Lambert-Eaton (myasthenic) syndrome, congenital myasthenic syndromes), diseases of peripheral nerve (e.g. Charcot-Marie-Tooth disease, Friedreich's ataxia, Dejerine-Sottas disease), metabolic diseases of muscle (e.g. phosphorylase deficiency (McArdle disease) acid maltase deficiency (Pompe disease) phosphofructokinase deficiency (Tarui disease) debrancher enzyme deficiency (Cori or Forbes disease) mitochondrial myopathy, carnitine deficiency, carnitine palmityl transferase deficiency, phosphogly cerate kinase deficiency, phosphoglycerate mutase deficiency, lactate dehydrogenase deficiency, myoadenylate deaminase deficiency), myopathies due to endocrine abnormalities (e.g. hyperthyroid myopathy, hypothyroid myopathy), and other myopathies (e.g. myotonia congenital, paramyotonia congenital, central core disease, nemaline myopathy, myotubular myopathy, periodic paralysis).

In a particular embodiment, the disorder is a glycogen storage disease. The expression“glycogen storage disease” denotes a group of inherited metabolic disorders involving enzymes responsible for the synthesis and degradation of glycogen. In a more particular embodiment, the glycogen storage disease may be GSDI (von Gierke's disease), GSDII (Pompe disease), GSDIII (Cori disease), GSDIV, GSDV, GSDVI, GSDVII, GSDVIII or lethal congenital glycogen storage disease of the heart. The disorder may be any GAA-deficient conditions, or other conditions associated by accumulation of glycogen. In a further particular embodiment, the disorder is Pompe disease and the therapeutic transgene is a gene encoding an acid alpha-glucosidase (GAA) or a variant thereof. Such variants of GAA are in particular disclosed in applications PCT/2017/072942, PCT/EP2017/072945 and PCT/EP2017/072944, which are incorporated herein by reference in their entirety. In a particular embodiment, the disorder is infantile- onset Pompe disease (IOPD) or late onset Pompe disease (LOPD). Preferably, the disorder is IOPD.

Other diseases of interest include, without limitation: hemophilia A, MPSI, Alzheimer's Disease, Parkinson's Disease, Huntington's Disease, Tourette Syndrome, schizophrenia, Sly disease, Hunter's disease, dementia, paranoia, obsessive compulsive disorder, learning disabilities, ALS, Charcot-Marie Tooth disease, Kennedy's disease, glioblastoma, neuroblastoma, autism, Gaucher's disease, Hurler's disease, Krabbe's disease, altered behaviors (e. g., disorders in sleeping, perception or cognition),

One skilled in the art is aware of the transgene of interest useful in the treatment of these and other disorders by gene therapy. For example, the therapeutic transgene is: FVIII for hemophilia A, lysosomal enzymes a-L-iduronidase [IDUA (alphase - Liduronidase)], for MPSI, acid-a-glucosidase (GAA) for Pompe disease, Glycogen Debranching Enzyme (GDE) for Cori disease (GSDIII), G6P for GSDI, alpha- sarcoglycan (SGCA) for LGMD2D; dystrophin or its shortened forms for DMD; and SMN1 for SMA. The rAAV gene therapy vector may also comprise a transgene of interest that provides other therapeutic properties than providing a missing protein or a RNA suppressing the expression of a given protein. For example, the rAAV gene therapy vector may include, without limitation, a transgene that may increase muscle strength, that may reduce apoptosis in the CNS, that may produce antibodies or nanobodies directed against receptors or enzymes or proteins or pathogens, or transgenes that may specifically kill cancer cells. The agent of the invention can also be used for inhibiting the humoral response to the rAAV gene therapy vector by preventing the production of neutralizing antibodies directed against the rAAV vector. In particular, the agent of the invention may prevent the differentiation of specific memory B-cells into antibody- secreting cells and/or prevents the production of anti-rAAV vector antibody. Reduction or prevention of the production of anti-rAAV neutralizing antibodies will allow for re-administration of the vector if needed. Indeed, the humoral response to rAAV remains an important obstacle to the long term treatment requiring repeated dosing of the rAAV gene therapy vector. In a particular embodiment, the agent of the invention can be administered concomitantly with the first administration of the rAAV gene therapy vector thereby preventing the production of neutralizing antibodies that would limit the efficacy of the rAAV vector, in particular during the following administrations. The agent of the invention is thus used for improving the long-term efficacy of the gene therapy using rAAV vector.

In particular, the agent of the invention can be used for inhibiting the humoral response to the rAAV8 gene therapy vector by preventing the production of neutralizing antibodies directed against the rAAV8 vector. In particular, the agent of the invention may prevent the differentiation of specific memory B- cells into antibody-secreting cells and/or prevents the production of anti-rAAV8 vector antibody. Reduction or prevention of the production of anti-rAAV8 neutralizing antibodies will allow for re administration of the vector if needed. In a particular embodiment, the agent of the invention can be administered concomitantly with the first administration of the rAAV8 gene therapy vector thereby preventing the production of neutralizing antibodies that would limit the efficacy of the rAAV8 vector, in particular during the following administrations. The agent of the invention is thus used for improving the long-term efficacy of the gene therapy using rAAV vector8. In a particular embodiment, the agent is an anti-IL-1 neutralizing antibody, such as an anti-IL-I b neutralizing antibody or an anti-IL-6 neutralizing antibody.

In particular, the present inventors have proved that an inhibitor of IL-Ib or IL-6, for example an anti- IL-1 b neutralizing antibody or an anti-IL-6 neutralizing antibody, is able to greatly diminish the level of AAV specific antibodies. Importantly, as shown in an assay comparing their effect on rAAV and influenza immunity, said IL-Ib or IL-6 inhibitor does not affect the levels of antibodies directed to viral antigens different than AAV antigens. Therefore, the agent of the invention can be used for inhibiting specifically the humoral response directed to rAAV gene therapy vectors without inducing profound global immunosuppression that would be at risks for patients. In particular, the agent of the invention can be used for inhibiting specifically the humoral response directed to rAAV8 gene therapy vector without inducing profound global immunosuppression that would be at risks for patients

The invention further relates to a method for inhibiting immune response to rAAV gene therapy vector or for improving the therapeutic efficacy of the rAAV gene therapy vector, comprising administering to a subject in need thereof an effective amount of the agent as described above. The agent may administered to the subject before, during or after the recombinant AAV vector is administered. In a particular embodiment, the agent is administered to the subject within a short period before the recombinant AAV vector is administered, for example less than one month, less than 20, 15, 10, 5 days or even less than 1 day before the recombinant AAV vector is administered, such as less than 24, 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 hour before. In a particular embodiment, the agent and the recombinant AAV vector are administered the same day, the agent being administered before recombinant AAV vector. In another particular embodiment, the agent is administered to the subject within a short period after the recombinant AAV vector is administered, for example less than one month, less than 20, 15, 10, 5 days or even less than 1 day before the recombinant AAV vector is administered, such as less than 24, 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 hour after. In a particular embodiment, the agent and the recombinant AAV vector are administered the same day, the agent being administered after recombinant AAV vector. In a further particular embodiment, the agent and the recombinant AAV vector are administered simultaneously.

In a particular embodiment, the agent of the invention is administered in combination with another substance known to inhibit the immune response against rAAV vectors. In particular, the agent of the invention may be administered in combination with a substance selected from T cell targeting drugs such as rapamycin (in particular rapamycin nanoparticles, such as those disclosed in Meliani et al., Nature Communications (2018) 9: 4098), tacrolymus and cyclosporine A, and B cell targeting drugs such as rituximab, Baff inhibitors, ibrutinib and proteasome inhibitors like bortezomib. The other substance may also be selected from selective inhibitors of Janus kinase.. The term“administered in combination” includes simultaneous, separate or sequential administration.

Another aspect of the invention relates to a method for monitoring the immune response against a rAAV gene therapy vector in a subject. In particular, the invention relates to a method for monitoring the immune response against a rAAV8 gene therapy vector in a subject.

In the context of the present invention, the term "subject" and "patient" are used interchangeably and refer to both human and nonhuman animals. The term "nonhuman animals" of the disclosure includes all vertebrates, e.g., mammals and non-mammals. Preferably, the subject is a mammal. More preferably, the subject is a human patient. The subject of the invention can be a patient that has been treated, that is being treated, or that will be treated with a recombinant AAV gene therapy vector.

The present invention thus relates to a method for monitoring the immune response against rAAV comprising a step of detection, in a sample from the subject, of a marker of the immune response directed against said rAAV. In particular, the method comprises the detection of a marker that is specific to the immune response directed to said rAAV. In other words, the method of the invention can be used for monitoring the immune response specific to rAAV vector, without monitoring the immune response directed to antigens other than rAAV vector antigens.

In a particular embodiment, the method comprises determining the level of the marker of the immune response directed against said rAAV and then comparing said level with a reference level. The reference level can correspond to the level of said marker in a sample from a subject that is immunotolerant with respect to the rAAV vector or a patient that has not been exposed to the rAAV vector.

In particular, the present invention relates to a method for monitoring the immune response against rAAV8 comprising a step of detection, in a sample from the subject, of a marker of the immune response directed against said rAAV8. In particular, the method comprises the detection of a marker that is specific to the immune response directed to said rAAV8. In other words, the method of the invention can be used for monitoring the immune response specific to rAAV8 vector, without monitoring the immune response directed to antigens other than rAAV8 vector antigens.

In a particular embodiment, the method comprises determining the level of the marker of the immune response directed against said rAAV8 and then comparing said level with a reference level. The reference level can correspond to the level of said marker in a sample from a subject that is immunotolerant with respect to the rAAV8 vector or a patient that has not been exposed to the rAAV8 vector.

In a particular embodiment, the method comprises a step of collecting the sample from the subject.

The sample from the subject can be any sample comprising immune cells. In particular, the sample is a blood sample such as a total peripheral blood sample, or a serum, plasma or lymph sample. The sample from the subject can also comprise or consist of immune cells isolated from tissues such as spleen, lymph nodes and blood.

The sample can also be a sample comprising or consisting of peripheral blood mononuclear cells (PBMC). In a particular embodiment, the method comprises a step of isolating peripheral blood mononuclear cells (PBMC) from the sample of the patient.

In a first embodiment, the method for monitoring the immune response against rAAV comprises the detection of the activation of dendritic cells (DCs), in particular of mo-DCs, in response to the rAAV vector. In particular, the method comprises the detection of the production and/or secretion of cytokines by DCs, in particular by mo-DCs. In particular, the method comprises the detection of the production and/or secretion of IL-1 b and/or IL6 by DCs, in particular by mo-DCs. The invention also relates to mo- DC for use in a method for monitoring the immune response against a recombinant AAV gene therapy vector. In a particular embodiment, the rAAV vector is a rAAV8 vector.

In another embodiment, the method for monitoring the immune response against rAAV comprises the detection of the activation of NK cells, in particular the activation of CD16^bnght CD56^dim NK cells, in particular CD16^bnghtCD56^dim NK cells secreting IFNy. In particular, the method comprises the detection of the production and/or secretion of cytokines, in particular IFNy by NK cells.

In a particular embodiment, the method for monitoring the immune response against rAAV, comprising the detection of the activation of NK cells as defined above, is carried out from a subject that is seronegative to the rAAV vector. By“seronegative” is meant a subject whose the blood or serum does not contain antibodies specific to said rAAV vector. In a particular embodiment, the rAAV vector is a rAAV8 vector.

In another embodiment, the method for monitoring the immune response against rAAV comprises the detection of the activation of T-cells, in particular the activation of CD8+ T-cells, in particular CD8+ T- cells secreting TNFa. In particular, the method comprises the detection of the production and/or secretion of cytokines, in particular TNFa by CD8+ T-cells. In a particular embodiment, the rAAV vector is a rAAV8 vector.

In a particular embodiment, the method for monitoring the immune response against rAAV comprising the detection of the activation of CD8+ T-cells as defined above, is carried out from a subject that is seropositive to the rAAV vector. By“seropositive” is meant a subject whose the blood or serum contains antibodies specific to said rAAV vector. In a particular embodiment, the rAAV vector is a rAAV8 vector.

In the context of the present invention, cytokine level measurements can be done by any available method including without limitation flow cytometry, Luminex assay, ELISA assay, ELISpot assay or by measuring gene expression of gene encoding the cytokine. For example, gene expression can be measured in bulk restimulated PBMCs.

Another aspect of the invention relates to a method for predicting rAAV gene therapy vector immunogenicity or for predicting the immune response of a subject against a recombinant AAV gene therapy vector in vitro. In particular, the invention relates to a method for predicting rAAV8 gene therapy vector immunogenicity or for predicting the immune response of a subject against a recombinant AAV gene therapy vector in vitro.

In particular the method for predicting rAAV vector immunogenicity or for predicting the immune response of a subject against a recombinant AAV gene therapy vector comprises (i) a step of contacting a cell sample with said rAAV vector and (ii) a step of detecting the immune response directed to said rAAV gene therapy vector. In a particular embodiment, the rAAV vector is a rAAV8 vector.

The cell sample can be any sample comprising immune cells. In a particular embodiment, the sample can comprise an immune cell line commercially available or any cell line or engineered cell line that can express TLR, IL-1 b and/or IL-6 in response to exposure to the rAAV vector. Such cells can be used for example for evaluating the general immunogenicity of a rAAV vector under development. In a particular embodiment, the rAAV vector is a rAAV8 vector.

In another particular embodiment, the sample is obtained from a subject. In particular, the sample is a blood sample such as a total peripheral blood sample, or a serum, plasma or lymph sample. The sample can also comprise or consist of immune cells isolated from tissues such as spleen, lymph nodes and blood.

In a particular embodiment, the cells are B-cells, T cells in particular CD8+ T cells, PBMC cells, dendritic cells in particular mo-DCs, macrophages or NK cells. In a preferred embodiment, cells are PBMC cells, mo-DCs, CD8+ T cells, or NK cells.

For example, the method for predicting rAAV immunogenicity or for predicting the immune response of a subject against a recombinant AAV gene therapy vector comprises (i) a step of contacting immune cells for example PBMC, DCs or mo-DCs cells with rAAV vector and (ii) a step of detecting the activation of DCs, in particular mo-Dcs, in response to said rAAV vector. In particular, the method comprises a step detecting the production and/or secretion by DCs, in particular mo-DCs of cytokines, in particular IL-1 b and/or IL-6. In a particular embodiment, the rAAV vector is a rAAV8 vector.

In another embodiment, the method for predicting rAAV immunogenicity or for predicting the immune response of a subject against a recombinant AAV gene therapy vector comprises (i) a step of contacting cells, for example NK cells, with rAAV vector and (ii) a step of detecting the activation of NK cells, in particular CD16^bright CD56^dim NK cells, in response to said rAAV vector. In particular, the method comprises a step a detecting the production and/or secretion by NK cells of cytokines, in particular IFNy. In a particular embodiment, the rAAV vector is a rAAV8 vector.

In another embodiment, the method for predicting rAAV immunogenicity or for predicting the immune response of a subject against a recombinant AAV gene therapy vector comprises (i) a step of contacting cells, for example T cells, in particular CD8+ T-cells with rAAV vector and (ii) a step of detecting the activation of CD8+ T-cells, in response to said rAAV vector. In particular, the method comprises a step a detecting the production and/or secretion by CD8+T cells of cytokines, in particular TNFa. In a particular embodiment, the rAAV vector is a rAAV8 vector.

In another embodiment, the invention relates to a method for predicting the immune response of a subject susceptible to be exposed to an rAAV vector. In particular, the method comprises the detection of the production or secretion of IL-lb, IL-6, IFNy and/or TNFa in a sample from the subject, after contacting the sample to the rAAV vector. The invention also relates to mo-DC for use in a method for predicting the immune response of a subject susceptible to be exposed to a recombinant AAV gene therapy vector. In a particular embodiment, the rAAV vector is a rAAV8 vector.

In another aspect, the invention relates to a method for identifying subjects in need of a treatment of an agent of the invention, wherein the subject is a patient in need of an rAAV gene therapy. In this aspect, the activation of mo-DCs is determined with respect to their production of IL-I b and/or IL-6. The detection of the production of IL-Ib and/or IL-6 may be indicative of a likeliness that the subject will develop an immune response against the rAAV vector intended to be administered to treat the subject’s disease. In particular, the production level of IL-Ib and/or IL-6 is compared to a reference level, such as the production level in unstimulated immune cells. The invention thus also relates to an rAAV gene therapy vector, for use in a method for treating a disease, wherein the rAAV vector is administered in combination to an agent of the invention to a subject who was identified according to the method of this aspect.

In particular, the invention relates to a method for identifying subjects in need of a treatment of an agent of the invention, wherein the subject is a patient in need of an rAAV8 gene therapy. In this aspect, the activation of mo-DCs is determined with respect to their production of IL-1 b and/or IL-6. The detection of the production of IL- 1 b and / or IL-6 may be indicative of a likeliness that the subject will develop an immune response against the rAAV8 vector intended to be administered to treat the subject’s disease. In particular, the production level of IL-Ib and/or IL-6 is compared to a reference level, such as the production level in unstimulated immune cells. The invention thus also relates to an rAAV8 gene therapy vector, for use in a method for treating a disease, wherein the rAAV8 vector is administered in combination to an agent of the invention to a subject who was identified according to the method of this aspect.

In particular, the invention also relates to an rAAV8 gene therapy vector, for use in a method for treating a disease, wherein the rAAV8 vector is administered in combination to an anti-IL-1 neutralizing antibody, such as an anti-IL-1 b neutralizing antibody or an anti-IL-6 neutralizing antibody, to a subject who was identified according to the method of this aspect. Another aspect of the invention relates to a method for identifying subjects in need of the agent of the invention that is able to inhibit the immune response directed to rAAV vector. In particular the subjects are seronegative subjects. In a particular embodiment, the rAAV vector is a rAAV8 vector.

In particular, the method comprises (i) a step of contacting a sample from a subject with a rAAV gene therapy vector and (ii) a step of determining the immune response to said rAAV gene therapy vector.

In a particular embodiment, the method comprises (i) a step of contacting a sample from a subject with a rAAV8 gene therapy vector and (ii) a step of determining the immune response to said rAAV8 gene therapy vector.

The sample can be any sample comprising immune cells. In particular, the sample is a blood sample such as a total peripheral blood sample, or a serum, plasma or lymph sample. The sample can also comprise or consist of immune cells isolated from tissues such as spleen, lymph nodes and blood.

In a particular embodiment, the step of determining the immune response to said rAAV gene therapy vector comprises the detection of activation of DCs cells in particular mo-DC cells by the rAAV vector. In particular, the detection of activation of the cells is carried out by measuring the production and/or secretion by DCs, in particular mo-DCs of cytokines, in particular IL-Ib and/or IL-6. In a particular embodiment, the rAAV vector is a rAAV8 vector.

EXAMPLES

The invention is further described in detail by reference to the following experimental examples and the attached figures. These examples are provided for purposes of illustration only, and are not intended to be limiting.

MATERIAL AND METHODS

Human primary cells and cell lines.

Cryopreserved peripheral blood mononuclear cells (PBMC) were purchased from Cellular Technology Limited (CTL), and buffy coats were purchased from Etablissement francais du sang (EFS). PBMCs were isolated with Ficoll-Hypaque gradient centrifugation as per standard protocols and cryopreserved in liquid nitrogen vapor until assayed. In total, 44 normal donors were analyzed. Average donor’s age was 33 years old (±14; Range 18 to 65 years). The average age in AAV2 seropositive donors tended to be higher than in the AAV2 seronegative group, but the difference was not statistically significant (AAV2 seropositive, 40 ± 16 years (n = 13) vs. AAV2 seronegative, 30 ± 14 years ( n = 12)).

The HLA-B*0702 cell line (ATCC-CRL-2371) purchased from LGC Standards and pulsed with appropriate peptides was used as antigen presenting cells for expanded antigen-specific CD8⁺ T cells.

AA V vectors and antigens.

The AAY8 vector carrying the cDNA encoding for human factor IX (hF.IX) under control of a liver- specific promoter (AAV8-hAAT-F.IX) (Manno et al., 2006, Nat Med., 12(3):342-7) and empty-AAV capsids were produced using a slight modification of the adenovirus-free transient transfection method previously described (Matsushita et al., Gene Ther. 1998;5(7):938-45 ; Ayuso et al.. Gene Ther. 2010;17(4):503-10). Briefly, HEK293 cells were transfected and harvested 72 hours thereafter. After sonication and benzonase treatment, vectors were purified using two successive ultracentrifugation rounds in cesium chloride density gradients. The AAV8-hAAT-F.IX genome was quantified using quantitative real-time PCR (qPCR). Empty AAV capsids were used for PBMCs stimulation at concentration 10 pg/mL.

Peptide pools consisted of 15-mer sequences with 11 amino acids overlap, covering the complete sequence of a chosen viral protein. Human influenza A vims (Flu) NP protein (Miltenyi), Epstein - Barr vims (EBV) BMLF-1 protein (Miltenyi), VP1 capsid protein from AAV2, AAV8 (ChinaPeptides) or AAV5 (Mimotopes) were used at 1 pg of each peptide/mL. As a positive control a pool of 23 MHC class I-restricted viral peptides from human cytomegalovirus, EBV and influenza vims (CEF) was used at 2 pg of each peptide/mL (Mabtech).

The HLA-B*0702-restricted peptides AAV2 VPI372-380 (VPQYGYLTL) or control peptide EBV EBNA 3 A247-255 (RPPIFIRRL) were purchased from ChinaPeptides and used at 10 pM concentration. Where indicated, for unspecific stimulation phorbol myristate acetate (PMA) and ionomycin (used at 50 ng/mL and 1 pg/mL, respectively) or 5 pg/mL of lipopolysaccharide (LPS) were used (Sigma Aldrich).

Cell culture.

PBMCs were maintained in AIM-V Glutamax medium (Gibco) for 6 (T cell assays), 24 and 48 hours (NK and DC assays) or for 7 days (B cell assays).

T cell expansion.

Antigen-specific CD8⁺ T cell expansion was performed as described (Martinuzzi et al., Blood. 2011 ; 118(8):2128-37.). Briefly, PBMC were stimulated with AAV2 or EBV HLA-B*0702-restricted peptides on day 0 in AIMV medium supplemented with 1000 U/mL GM-CSF and 500 U/mL IL-4. After

24 hours (day 1), maturation cocktail was added (TNF-a 1000 U/mL, IL-I b 10 ng/mL, PGE2 1 pM, IL- 7 0.5 ng/mL), then cells were maintained in RPMI medium (Gibco) supplemented with 10% FBS,

25 ng/mL IL-15, 100 U/mL IL-2 and 5 ng/mL IL-7 for two weeks. Mass cytometry (CyTOF).

PBMCs obtained from four healthy donors were stained and analyzed 48 hours after restimulation with empty AAV2 capsid particles or 6 hours after stimulation with PMA/ Ionomycin. Cytokine secretion in cell cultures was blocked by the addition of GolgiPlug/GolgiStop (BD) for 5 hours prior to cell harvest and staining. The MaxPar® Cytoplasmic/Secreted Antigen Staining Protocol (PRD017 V2 02/14) was used with the only modification that for the cellular permeabilization and intracellular staining the Cytofix/Cyto-Perm Kit from BD was used. Staining antibodies were validated by manufacturer, DVS Science. Cell surface was stained with following antibodies: CD3 (Cat No. 3154003C), CD4 (3145001C), CD8a (3146001 C), CD16 (3148004C), CD19 (3142001C), CD25 (3169003C), CD27 (3162009C), CD38 (3167001 C), CD45 (3141009C), CD45RA (3153001C), CD45RO (3165011C), CD57 (3172009C), HLA-DR (3174001C). Then intracellular staining was performed with anti- Granzyme B (3171002C), IFNy (3168005C), IL-2 (3158007C), IL-5 (3143003C), IL-10 (3166008C), IL-17A (3164002C), TNFa (3152002C). FoxP3 was detected by PE-conjugated anti-FoxP3 antibody (320208) from BioLegend and a secondary anti-PE antibody (3156005B) from DVS Science. Data were collected on a CyTOF2 mass cytometer (Fluidigm, software version 6.0.626) with dual count calibration, noise reduction, cell length threshold between 10 and 150 pushes, and a lower convolution threshold equal to 10. Resulting flow cytometry standard (fes) files were normalized with the MatLab Compiler normalizer using a signal from the 4-Element EQ beads (Fluidigm). Fes files were analyzed using FlowJo software (Tree Star, Inc).

Intracellular cytokine staining (ICS) assay and flow cytometry.

PBMCs were seeded at 2.5 or 5 * 10⁶ cells per well. When pertinent, cytokine secretion in cell cultures was blocked by the addition of GolgiPlug/GolgiStop (BD) for 5 hours and the anti-human CD107a (328624) from Biolegend was added at this step as described by the manufacturer. Prior to cell staining, the FcR binding inhibitor (eBiosciences) was used. Dead cells were stained with Zombie Yellow Fixable Viability kit (Biolegend) or LIVE/DEAD Fixable Aqua Dead Cell Stain Kit (LifeTechnologies). Cells surface was stained with chosen anti-human antibodies: CD4 (Cat no. 317414), CD16 (302028) from Biolegend, CD3 (A07748), CD8 (B00067), CD19 (IM2708U), CD56 (B46024) from Beckman Coulter, HLA-DR (560743), IgG (564229), IgD (561302), CD14 (563698), CD19 (555412), CD24 (562788), CD25 (564034), CD27 (555441), CD38 (560677), CD80 (555683), CD86 (561129) from BD Bioscience, or CDl lc (12-0116-42) eBiosciences. Prior to intracellular staining, cells were fixed with the BD Cytofix/Cyto-Perm kit (BD Bioscience) for 30 minutes and stained with chosen antibodies as needed: IFNy (45-7319-42 or 12-7319-82) and IL-6 (17-7069-42) from eBiosciences and/or Granzyme B (515408), IFNy (502506), IL-Ib (511710), IL-2 (500310), TNFa (502909) from Biolegend. Data were collected on Cytoflex S (Beckman Coulter) or Canto II (BD) and analyzed with FlowJo software (Tree Star, Inc). Quantification of antibodies in plasma or culture supernatants.

Anti-AAV antibody titers were measured using standard Enzyme-Linked Immunosorbent Assay (ELISA) using 96-well Nunc maxisorp Immunoplates (Dutscher) coated overnight with AAV2 or AAV8 in a carbonate buffer at final concentration of 10 pg/niL. Plates were blocked with PBS containing 2 % bovine serum albumin. We used anti-human or anti-mouse IgG antibodies conjugated with horseradish peroxidase (HRP) (Southern Biotech). The enzymatic reaction was developed with 3,3’,5,5’-tetramethylbenzidine (TMB from Becton Dickinson) stopped with H2SO4 3M solution. Optical density (OD) was measured at 450 nm using ENSPIRE microplate reader (Perkin Elmer). Sera of healthy donors were considered seropositive when titers were higher than 1 :3.

Human anti-AAV2 IgM measurements were performed in conditioned medium 7 days after stimulation of PBMCs with the AAV2 or Flu pools of peptides and compared to the level of non-stimulated cultures. We used human biotin-conjugated anti-IgM antibodies (Sigma-Aldrich), the enzymatic reaction was developed with Streptavidin Alkaline Phosphatase and Alkaline Phosphatase Yellow (pNPP) Liquid Substrate (Sigma). OD was measured at 405 nm using Spark microplate reader (Tecan).

Anti-Flu antibodies in plasma of healthy donors were measured using Anti-Influenza virus A IgG Human ELISA Kit from Abeam according to manufacturer’s protocol. Samples were considered positive if the absorbance value was greater than 10% over the cut-off value of control (OD^o_nm = 1) provided with the kit.

Cytokine multiplex assays.

Supernatants from 24-hour PBMC cultures, stimulated with the pools of AAV2 or Flu peptides, were analyzed on a Luminex platform (Bio-Plex 200; Bio-Rad) using Pro-human cytokine 17-plex immunoassay (M5000031YV-BioRad) according to manufacturer’s instructions.

Autologous DC preparation and recall.

On day 10 of the antigen-specific T-cell expansion in vitro, PBMCs from the same donor were thawed and plastic-adherent cells were stimulated with indicated antigens (Figure 3B) in AIMV medium supplemented with 1000 U/mL GM-CSF and 500 U/mL IL-4. On day 12, maturation cocktail was added (TNF-a 1000 U/mL, IL-Ib 10 ng/mL, PGE2 1 mM, IL-7 0.5 ng/mL) to the wells. 24 hours later obtained antigen- loaded DCs were washed with PBS and covered with the suspension of expanded T cells.

HLA dextramer (DMr) assays.

Prior to staining, PBMCs were incubated in PBS with 50nM reversible protein kinase inhibitor (PKI), dasatinib (Clinisciences) ( Lissina et al., J Immunol Methods. 2009;340(1):11 -24.). PE-labeled HLA- B*0702 DMrs loaded with VP I 372-380 or control peptide EBNA 3 A 247-255 were used according to the manufacturers’ instructions (Immudex) then intracellular cytokine staining was performed as in described ICS assay.

ELISpot assay.

Dual color FluoroSpot was performed according to the manufacturer protocol (C.T.L., Inc.) and a previously described protocol (Nathwani NEJM 2014). Briefly, PBMCs were seeded in triplicates (3xl0⁵ cells/well) in AIM-Y Glutamax medium (Gibco) into an IFNy/TNFa-coated 96-well ELISPOT precoated plate and stimulated with the AAV2 pool of peptides (145 peptides pooled, final concentration 1 pg/ml/peptide), CEF (32 peptides pooled, final concentration 1 pg/ml/peptide) or PMA/Ionomycin. 24 hours later, plates were washed with 0.05% Tween-20 in PBS and tertiary antibodies were added and incubated 2 hours at room temperature. Plates were then washed again with 0.05% Tween-PBS and air- dried. Fluorescent spots were counted using a CTL FluoroSpot reader (CTL). Results are expressed as spot- forming units (SFU)/10⁶ cells. Response was considered positive for SFU > 50 and at least 3 times higher than SFU in the non- stimulated (No Ag) control.

In vitro blockade of IL-Ib and IL-6 cytokines.

Human PBMCs stimulated with the AAV2 or Flu pools of peptides, were cultivated for 7 days in medium supplemented with IL-6 antibody (Cat No. MAB206-100), IL-1 b antibody (MAB601-100) or IgGl isotype control (MAB002) from R&D Systems, at final concentration of 7.5 pg/mL.

Blockade of IL-Ib and IL-6 cytokines in vivo.

6-week old male C57BL/6J mice were purchased from Charles River Laboratories. 10⁹ vg of AAV8- hAAT-F.IX vector were administered via the tail vein on day 0 to all animals. On the day -2, -1, 0, 1, 2 and 7 mice were injected intraperitoneally with lmg/kg of anti-IL-Ib (BE0246), anti-IL-6 (BE0046) neutralizing antibodies or corresponding isotype IgG control (BE0290 or BE0091) from BioXcell (5 mice/group). Blood was collected on day 21 and livers 3 months post vector injection.

Viral vector genome copy number (VGCN) analysis.

Total DNA was extracted from 100 mg of frozen liver tissue by using the MagNA Pure 96 DNA and viral DNA small volume kit (Roche Diagnosis) according to manufacturer’s instructions. VGCN measured by qPCR was normalized by the copies of titin gene measured in each sample. qPCR was performed on an ABI PRISM 7900 HT Sequence Detector (Agilent Technologies) using Absolute ROX mix (Thermo Fisher Scientific) and the following specific primers for the vector genome: forward 5’- GCCACTAAGGATTCTGCAGT’3’, reverse 5’-CTGCACTTACCGAAAGGAGT=3’; for mouse titin, mTTN: forward 5’-AAAACGAGCAGTGACGTGAGC’3’ , reverse 5’-

TTCAGTCATGCTGCTAGCGC-3’ . Statistical analysis.

Statistical analyses were performed using Prism version 7.00 (GraphPad Software). Normal distribution of the samples was tested with D'Agostino and Pearson normality test. All the data shown were analyzed by non-parametric tests. Mann- Whitney test was used for the comparison of datasets composed of two groups except in figure 3B where Wilcoxon signed rank test was used due to the absence of variance in control group. Non-parametric Kruskal- Wallis one-way ANOYA with Dunn’s multiple comparison test was used for the analysis of all the datasets containing more than two groups. P values below 0.05 were considered significant.

RESULTS

AAV capsid triggers IL-Ib and IL-6 secretion in monocyte-related DCs.

First, we measured IL-1 b and IL-6 levels in the PBMC cultures stimulated 24 hours with AAV2 or Flu pools of peptides. Compared to unstimulated cultures, we found that AAV2 triggered 4.8 (± 3.4) fold increase of IL-1 b and 8.5 (± 9.7) fold increase of the IL-6 concentration in conditioned medium (Figure 1A). Increase of IL-Ib and IL-6 secretion occurred in 72 % of tested samples (8 out of 11) (Figure 1A) and was not related to the AAV2 serology status of donors (Figure 1 G). Further, to identify the cellular subset responsible for IL-I b and IL-6 secretion in the same experimental setting, we performed an intracellular cytokine staining (ICS) assay. We analyzed the adherent CD3-CD19-HLA-DR+CDl lc+ cell fraction of PBMC that includes three subsets of myeloid DCs: CDl lchi, CDl lclo, and CD14+ moDCs (Figure IB) (38). IL-Ib secretion in response to AAV2, could be principally attributed to the moDC subset (Figure 1C), since the average size of the IL- 1 b- subpopulation was the highest in moDCs (12 %) and IL-1 b was most frequently detected in this subset of DCs (70 % of donors) (Figure 1C). IL-6 secretion was less frequently detected in the intracellular cytokine secretion (ICS) assay compared to the direct measurement in conditioned media. This could be due to the shorter cytokine accumulation time in the ICS assay (5 hours) vs. that of the Luminex assay (24 hours), or to the different measurement time windows (between 24 to 29 hours after restimulation in ICS vs. 0 to 24 hours in the Luminex assay). Nevertheless, increased IL-6 secretion in response to the AAV capsid was also detected by flow cytometry (Figure ID) in 6 out of 17 donors and the moDC were again the main cell population producing this cytokine (% IL-6+ cells in each DC subset: CDl lclo 0.6 % ± 1.1; CD1 lchi 0.2 % ± 0.3; moDC 6.0 % ± 8.1) (Figure 1H).

The control Influenza A (Flu) pool of peptides did not trigger significant changes in IL-Ib or in IL-6 secretion (Figure 1A, C and D), despite the fact several subjects presented antibodies to both AAV and Flu. Conversely, when we measured the maturation state of DCs in the same conditions we found that Flu, but not AAV2, triggered CD86 upregulation in three DC subsets (Figure IE). These results suggest that the AAV and Flu interact differently with the host immune system. PBMCs were also restimulated in parallel with the AAV2 pool of peptides or with empty AAV2 capsid particles. The following ICS assay confirmed that intact capsid particles elicited similar responses to those observed upon restimulation with the pool of capsid peptides (Figure IF).

Collectively, these data identify moDCs as the main innate responders to the AAV capsid in human peripheral blood.

High-dimensional analysis of immune response to AA V healthy donors highlights distinct populations of capsid-reactive immune cells. To identify cellular subsets involved in the immune response to the AAV2 capsid, we stimulated PBMCs isolated from four healthy donors with empty AAV2 viral particles for 48 hours in vitro, followed with cytometry by Time-of-Flight (CyTOF) analysis. We measured concomitant cytokine secretion (TNFa, IFNy, IL-2, IL-5, IL-10 and IL-17a), activation (CD25, HLA-DR) and recent activation/exhaustion (PD-1, CD57) markers in 11 cellular subsets shown in Figure 2A. Our results showed that AAV2 capsid triggered a response in CD8+ T cells Multi-parametric analysis permitted to characterize precisely this CD8+ T cell subset as effector memory (EM) cells (CD45+CD3+CD8+CD45RO-CD45RA-). IFNy secretion was neither detectable in CD8+ nor in CD4+ T cells, while its robust secretion was observed in the positive control, represented by PBMC treated with PMA/Ionomycin (data not shown). Importantly, in three out of four donors tested, AAV capsid triggered the secretion of TNFa and IFNy as well as the upregulation of HLA-DR in NK cells (CD45+CD3-CD19-CD16+) (Figure 2B), indicating the activation of this immune cell population. Only 2 out of 11 immune populations tested responded to capsid antigen stimulation, confirming the overall low immunogenicity of AAVs. Interestingly, NK cells appeared to be involved in the immune recognition of the AAV2 capsid.

Identification of capsid-specific IFNy- H CD16^brightCD56^dim NK cells in AA V-seronegative individuals. Since CyTOF analysis pointed to the activation of NK cells in response to the AAV2 capsid, we sought to further characterize this immune cell subset. To facilitate internalization, processing and presentation of the AAV capsid by antigen presenting cells (APC), we used a peptide pool spanning full sequence of the AAV2 capsid protein, VP1, for PBMC stimulation. An ICS assay, followed by a conventional flow cytometry, confirmed CyTOF results and showed that both IFNy and TNFa were secreted by a small subset of CD16brightCD56dim NK cells (Figure 3 A). On average, IFNy-i- cells constituted 0.2 % ± 0.05 and TNFa+ cells 0.3 % ± 0.16 of the total CD16brightCD56dim NK population. Secretion of IFNy in conditioned media from PBMC cultures stimulated with the AAV2 peptide pool were confirmed by an independent assay, using the Luminex technology (positive in 57% of donors, Figure 3B). Capsid- responding NK cells did not seem to be cytotoxic, as suggested by unchanged granzyme B (Figure 2B) and CD107a levels (Figure 3C), and secreted IFNy and TNFa transiently, with a peak 24 hours after antigen stimulation (Figure 3C). Further, to verify whether the observed NK-cell activation was specific to AAV, we stimulated PBMCs in parallel with AAV serotypes 5 and 8, which share, respectively, 57 % and 83 % of homology with the AAV2 VP1 sequence (Daya et al., Clin Microbiol Rev. 2008;21(4):583-93.), or with different peptide pools derived from other viruses common in the population, such as Influenza A (Flu), Epstein-Barr vims (EBV) or cytomegalovirus (CMV). This experiment showed that I FNy secretion was triggered in CD16brightCD56dim NK cells only by the peptide pools of AAV serotypes 2, 5 and 8 but not by other viral antigens, demonstrating that reactivity was specific to the AAV capsid (Figure 3D). Overall, in the examined cohort of healthy donors (n = 17) AAV2-induced IFNy secretion in NK cells was observed in 53 % of donors, of which 66 % secreted simultaneously TNFa (Figure 3E).

While seropositivity is a general indication of a previous exposure to a vims, we verified whether NK activation could be related to the AAV serology status of donors tested. We measured anti-capsid antibody titers in sera of donors focusing on AAV2, as it naturally infects humans and thus is the most seroprevalent of all AAV serotypes (Boutin HGT 2010). Strikingly, capsid-specific IFNy+ CD16brightCD56dim NK cells were detected only in PBMCs isolated from seronegative donors, likely not exposed to the wild-type vims (Figure 3F).

Together, these results suggest that seronegative individuals react to the AAV2 capsid with the transient activation of NK cells.

Identification of capsid-specific TNFa+ CD 8+ T cells in AAV2-seropositive individuals. TNFa appeared to be the main cytokine secreted by CD8+ T cells in response to the AAV capsid (Figure 4A). To confirm this result on a higher number of healthy individuals, we isolated PBMCs from eleven donors and analyzed them using conventional flow cytometry. PBMC cultures were stimulated with AAV2 or Flu pools of peptides for 6 hours and then an ICS assay was performed, measuring levels of TNFa, IFNy, IL-2 and CD 107a. This experiment showed significant (> 0.1 % positive cutoff) increase in TNFa secretion in 54 % of samples tested (Figure 4A). Furthermore, in order to analyze a higher number of AAV2-specific CD8+ T cells and possibly to increase the sensitivity of the ICS assay, we expanded antigen-specific T cells for 2 weeks in vitro. PBMC were incubated with AAV2 and EBV peptide pools, or AAV-1 and -2 empty capsid particles. After expansion, we restimulated cells with autologous DCs loaded with the cognate antigens. Background levels were measured in cultures in which expanded T cells were mixed with autologous DCs not exposed to antigens. While the percentage of capsid-specific TNFa+ CD8+ T cells increased on average from 0.16 % before to 1.4 % after expansion (~8 fold) and additionally we detected increased numbers of IL-2- and CD 107a- positive cells in few donors, the expansion did not allow the detection of IFNy-l- cells (Figure 4B). Further, we addressed the same question using MHC class I dextramers (DMr), to identify more precisely an antigen-specific T-cell populations. We used phycoerythrin-conjugated human leukocyte antigen (HLA)-B*0702 dextramers loaded with the B*0702-restricted AAV2 immunodominant peptide, VP1372-380 or a control EBV peptide, EBNA 3A247-255. PBMCs from an HLA-B*0702 donor were expanded for 2 weeks and restimulated with an HLA-B*0702 cell line pulsed with a relevant antigen or irrelevant one used as a negative control. This experiment confirmed that expanded capsid-specific CD8+ T cells were able to secrete TNFot, IL-2 and degranulate in the presence of target cells but did not secrete IFNy (Figure 4 C). Furthermore, unexpanded PBMCs from healthy donors were analyzed by dual-color IFNy/TNFa FluoroSpot assay, in which secreted cytokines are captured for 24 hours on an antibody-coated polyvinyl membrane. This experiment confirmed the lack of IFNy+ secretion in response to the AAV capsid (Figure 4D). Altogether, these results demonstrate that, when tested ex vivo, TNFa secretion is the main trait of the capsid-specific CD8+ T cells isolated from healthy donors.

Finally, we verified whether the ex vivo detection of capsid-specific TNFa+ CD8+ T cells was related to the AAV2 serology status of donors. We detected capsid-specific TNFa+ CD8+ T cells only in PBMCs from seropositive donors (Figure 4E) and thus lacking capsid-specific IFNy I NK cells (Figure 4F). These results combined with the results of CyTOF suggest that the capsid-specific memory CD8+ T cell responses are characterized by TNFa secretion and can be found in seropositive,“AAV- experienced”, individuals.

AA V capsid triggers IL-Ib- and IL-6-dependent B-cell differentiation in vitro. The AAV capsid is known to induce humoral responses in human and in animal models (Nathwani et al., N Engl J Med. 2011 ;365(25):2357-65 ; Chirmule et al., J Virol. 2000;74(5):2420-5 ; Scallan et al., Blood. 2006;107(5):1810-7 ; Calcedo et al., Hum Gene Ther Clin Dev. 2016;27(2):79-82 ; Nathwani et al., Blood. 2007;109(4):1414-21 ; Flotte et al., Hum Gene Ther. 2011;22(10):1239-47). To study these responses in vitro, human PBMC cultures were stimulated with pools of AAV2 or Flu peptides, and immunophenotyping of B cells was performed 7 days later using flow cytometry. Treatment with both antigen pools increased B cell differentiation, illustrated by an increase in the number of antibody- secreting cells (ASCs: E03^019¾0 024TΉ27¾038⁺⁺) in cell cultures (Figure 5A). Comparison of these results with the serum levels of the anti-AAV2 antibodies in the corresponding donors showed 7-fold higher frequency of AAV2-specific ASCs in the seropositive donors compared to the seronegative ones (Figure 5B). Given these results, and the fact that seronegative individuals probably carry only naive B cells, it is plausible that in this experimental setting the AAV capsid could stimulate only AAV2-specific memory B cells. In agreement with our results on T cell and NK cell responses, AAV2 triggered B cell differentiation in AAV2-seropositive donors in which we also identified capsid- specific TNFa⁺ CD8⁺ T cells (Figure 5C) but not in AAV2-seronegative who carried capsid-specific IFNy⁺ CD16^brigitCD56^dim NK cells (Figure 5D).

Further, we stimulated PBMCs from three AAV2-seropositive donors, using empty AAV2 particles and measured anti-AAV2 IgM levels secreted to the culture medium. We focused on IgM immunoglobulins as they are the first one produced in response to infection and can be rapidly secreted, even prior to isotype switching and they do not require T-cell help. The levels of anti-AAV2 IgM increased on average 1.5-fold when compared to basal levels in unstimulated cultures (Figure 5E), showing that increased AAV-specific ASCs frequency coincided with higher anti-AAV2 antibody levels. No significant change in anti-AAV2 IgG secretion levels was observed in these donors in response to capsid restimulation, reflecting the prior exposure to AAV.

Since we demonstrated that the AAV2 capsid triggered IL-6 and IL-1 b secretion from moDCs in vitro, we tested whether their neutralization could have any effect on B cell differentiation. We demonstrated that the addition of IL-1 b or IL-6 neutralizing antibodies to the cell cultures blocked AAV capsid- induced but not Flu-induced B-cell differentiation (Figure 5F). Accordingly, in these conditions, we observed a reduction of secreted anti-AAV2 IgM (Figure 5G). Once again, these results highlighted divergent immune responses to AAV when compared with other viral antigens.

These results support a model in which the AAV capsid induces B cell differentiation into ASCs and anti-AAV antibodies production in vitro. This process is dependent on IL-1 b and IL-6 secretion and can be inhibited by antibodies neutralizing these cytokines.

IL-Ib neutralizing antibodies control humoral response to the AAV capsid in vivo. Unlike for cell- mediated immune responses (Mingozzi 2007; Li 2007; Li 2007; Wang 2007), humoral response to AAV are robustly elicited in small and large animal models upon vector administration (Jiang, Blood 2006; Meliani, Blood Advances 2017). To test whether blocking of IL-Ib and IL-6 in vivo could have an effect on anti-AAV antibody formation similar to that observed in vitro with human cells, we performed an AAV-based gene transfer experiment in immunocompetent C56BL/6 mice. We used the AAV8 serotype, highly homologous to AAV2 (Gao et al., Proc Natl Acad Sci U S A. 2002;99(18):11854-9.) but with higher capacity to transduce murine hepatocytes (Lisowski et al., Nature. 2014;506(7488):382- 6.). Both serotypes are known to elicit similar immune responses in vitro and in vivo (Hosel et al., Hepatology. 2012;55(l):287-97 ; Manno et al., Nat Med. 2006;12(3):342-7 ; Nathwani et al., N Engl J Med. 2014;371 (21): 1994-2004 ; Nathwani et al., N Engl J Med. 2011;365(25):2357-65) also in the terms of antibody production ( Sudres et al., Mol Ther. 2012;20(8): 1571 -81.). Three groups of mice were injected intravenously (IV) with an AAV8 vector encoding for human Factor IX (F.IX). A group of animals received in parallel anti-IL-Ib neutralizing antibodies, a second group received anti-IL-6 neutralizing antibodies, and a third group an isotype control (Figure 5H). Three weeks after vector injection, anti-AAV8 IgG antibody levels were tested in blood and showed significant decrease in the group treated with anti-IL-Ib neutralizing antibodies (Figure 51). At the same time, vector genome copy numbers (VGCN) in the liver confirmed that all groups of mice received equal doses of the vector and that the transduction of hepatocytes was successful in all groups (Figure 5J).

These results demonstrate that IL-I b neutralizing antibodies can be a useful tool to reduce capsid immunogenicity in AAV vector-mediated gene transfer. DISCUSSION

Aiming to understand the mechanisms underlying cellular and humoral immune response to the AAV capsid in humans, we identified previously unknown AAV-responding populations, i.e. NK cells and monocyte-related (mo) DCs.

Our results demonstrate that the main signature of the immune response to the AAV capsid in blood of healthy individuals is characterized by the secretion of IL-Ib and IL-6 cytokines by moDCs, observed in 72 % of donors, irrespectively of the donors’ AAV-serology status.

Further, using high-dimensional CyTOF analysis and conventional flow cytometry, we demonstrated that PBMCs isolated from AAV-seronegative donors contained capsid-specific IFNy CD16^bnsitCD56^dim NK cells. We have also shown that all AAV serotypes (2, 5 and 8) tested, but no other viral antigens (Flu, EBV or CMV), triggered the secretion of IFNy in this population.

We also provided evidence that memory capsid-specific CD8⁺ T cells can be readily detected ex vivo by tracking TNFa secretion, these cells being detected only in AAV-seropositive individuals. Our experiments confirmed the lack of IFN⁺ secretion by CD8+ T cells in response to the AAV. These results have clear implications for immunomonitoring performed in the context of AAV gene therapy trials, as they underscore the potential limitation of the IFNy ELISpot assay currently used to detect cytotoxic responses.

In addition, our findings uncover a previously unknown role of IL-Ib and IL-6 in the anti-capsid antibody formation, providing a new approach to curtail humoral immune response to AAV vector with direct clinical application. Indeed, our results demonstrate that neutralization of IL-Ib and IL-6 in PBMC cultures in vitro does not affect Flu-specific ASCs, whereas it greatly diminishes the frequency of AAV-specific ASCs and anti-AAV2 antibody levels. The interest of the approach to anti-AAV blockade presented here offers the advantage of not requiring complete B-cell depletion. IL-Ib neutralizing antibodies were also efficient in our mouse model of AAV8-based gene transfer, which further supports efficacy of this approach in vivo. Additionally, the measurement of release of cytokines such as IL-Ib and IL-6 in immune cells may allow to provide insight into innate immune responses to AAV vectors in humans undergoing gene transfer.

Finally, in our study we associated the immune readouts with the AAV-serology of donors. This approach highlighted existence of two distinct profiles of host immune response to the AAV capsid. The first profile, observed only in seronegative individuals, is associated with the transient activation of CD16^bngitCD56^dim NK cells. The second profile, observed only in seropositive and hence“AAV- experienced individuals”, based on the presence of memory capsid-specific CD8+ T cells and antibody- secreting cells (ASCs).

These novel insights into the immune response to the AAV are crucial as they suggest an innovative method to control adverse humoral response in AAV-based gene therapy subj ects as well as they provide new ways to monitor or predict vector immunogenicity in pre-clinical development and clinical trials.

Claims

1. An agent able to inhibit IL-1 and/or IL-6, for use in the inhibition of the immune response directed against a recombinant AAV gene therapy vector.

2. The agent for use according to claim 1 , wherein the agent inhibits the secretion or the activity of IL- 1 and/or IL-6, in particular the secretion by monocyte-related dendritic cells and other immune cells.

3. The agent for use according to claim 1, wherein the agent neutralizes IL-1 and/or IL-6.

4. The agent for use according to claim 3, wherein the agent is an anti-IL-1 neutralizing antibody or an anti-IL-6 neutralizing antibody.

5. The agent for use according to any one of claims 1-4, wherein the IL-1 is IL-I b.

6. The agent for use according to any one of claims 1-5, wherein the recombinant AAV vector has an AAV2 or AAV8 capsid.

7. The agent for use according to any one of claims 1-6, wherein the agent is administered to the subject before, during or within a short period after the recombinant AAV vector is administered.

8. The agent for use according to any one of claims 1-7, wherein the agent is administered to the subject via enteral or parenteral routes, in particular the agent is administered orally, intravenously, intra arterially, subcutaneously, intramuscularly, intracerebrally, intracerebroventricularly, intrathecally, or intraperitoneally.

9. An agent able to inhibit the activation of monocyte-related dendritic cells by a recombinant AAV gene therapy vector, for use in the inhibition of the immune response directed against said recombinant AAV gene therapy vector.

10. A pharmaceutical composition comprising an agent able to inhibit IL-1 and/or IL-6 as defined in claims 1-8 or an agent able to inhibit the activation of monocyte-related dendritic cells as defined in claim 9, and a recombinant AAV gene therapy vector.

11. A kit of parts comprising a first pharmaceutical composition comprising an agent able to inhibit IL- 1 and/or IL-6 as defined in claims 1-8 or an agent able to inhibit the activation of monocyte-related dendritic cells as defined in claim 9 and a second pharmaceutical composition comprising a recombinant AAV gene therapy vector, for simultaneous, separate or sequential administration.

12. A method for monitoring the immune response against a recombinant AAV gene therapy vector in a subject comprising the detection, in a sample from the subject of:

(i) the level of IL-1 in particular IL-1 b and/or IL6; and/or

(ii) the level of IFNy ; and /or

(iii) the level of TNFa.

13. The method according to claim 12, wherein the sample from the subject is selected from the group consisting of : blood sample, serum sample, plasma sample, lymph sample, sample of cells isolated from blood, spleen or lymph nodes, and a sample of isolated peripheral blood mononuclear cells (PBMC).

14. A method for predicting recombinant AAV gene therapy vector immunogenicity or for predicting the immune response against a recombinant AAV gene therapy vector in vitro, comprising the steps of

(i) contacting immune cells with the recombinant AAV gene therapy vector ; and

(ii) measuring :

the level of IL-1 in particular IL-1 b and/or IL6 ; and/or

the level of IFNy ; and /or

the level of TNFa.

15. The method according to claim 14, wherein the immune cells are selected in the group consisting of: B-cells, T cells in particular CD8+ T cells, PBMC cells, dendritic cells in particular mo-DCs, macrophages and/or NK cells, preferably the cells are PBMC cells, mo-DCs, CD8+ T cells, and/or NK cells.

16. A method for identifying subjects in need of an agent inhibiting the immune response directed against a recombinant AAV gene therapy vector, comprising the steps of :

(ii) measuring the level of IL-1 in particular IL-1 b and/or IL6.

17. The method according to claim 16, wherein the sample from the subject is selected from the group consisting of : blood sample, serum sample, plasma sample, lymph sample, sample of cells isolated from blood, spleen or lymph nodes, and a sample of isolated peripheral blood mononuclear cells (PBMC).