WO2020075186A1

WO2020075186A1 - Process for purifying emulsion pcr mixture, and implementations thereof

Info

Publication number: WO2020075186A1
Application number: PCT/IN2019/050742
Authority: WO
Inventors: Vaishali VERMA; Amita Gupta; Vijay Kumar Chaudhary
Original assignee: University Of Delhi South Campus
Priority date: 2018-10-08
Filing date: 2019-10-07
Publication date: 2020-04-16

Abstract

The present disclosure discloses a simplified process for purifying emulsion PCR mixture which is devoid of any hazardous chemicals like hexane, butanol, diethyl ether (DEE), octanol, and sodium dodecyl sulphate. The process does not involve multiple steps for purifying the emulsion PCR mixture, thereby, making it a simple process which gives purified PCR products which performs at par with PCR products purified using cumbersome, hazardous and low-throughput conventional methodologies.

Description

PROCESS FOR PURIFYING EMULSION PCR MIXTURE, AND IMPLEMENTATIONS THEREOF

FIELD OF INVENTION

[001] The present disclosure broadly relates to the field of emulsion PCR (Polymerase Chain Reaction), and specifically discloses a process for extracting and purifying emulsion PCR mixture to obtain purified PCR product.

BACKGROUND OF THE INVENTION

[002] Polymerase Chain Reaction (PCR) is extensively used for the amplification of targets to obtain DNA products in larger quantities for analytical or synthetic applications including construction of complex libraries, such as, antibody libraries. However, due to the presence of similar sequences in the PCR mixture, there is formation of unproductive chimera and other artifacts that in turn reduces the specificity of the reaction and output of final specific product. To address the problem of artifacts and chimeric products, emulsion PCR (ePCR) was developed.

[003] The ePCR is a commonly used technology for the amplification of DNA molecules in physically separated picoliter volume water-in-oil droplets serving as miniaturized reaction compartments (Williams R, et al., Nat Methods. 2006;3(7):545-50. Epub 2006/06/23. doi: l0.l038/nmeth896). By controlling the template DNA concentration, it can be easily ensured that majority of the droplets do not receive more than one template DNA molecule. The compartmentalization of individual DNA molecules in distinct reaction droplets allows the amplification of DNA molecules independently of one another, thereby preventing the formation of chimeric by-products and reducing the overall amplification bias. DNA amplification using ePCR has been widely exploited for numerous applications including directed evolution of DNA polymerases, NGS, genome-scale DNA library constructions, digital droplet PCR, etc. Over the past few years, several protocols have been described to optimize the use of ePCR (Hori M, et al., Biochem Biophys Res Commun. 2007;352(2):323-8; Kanagal-Shamanna R. Emulsion PCR: Techniques and Applications. Methods Mol Biol. 2016; 1392:33- 42).

[004] Williams et al. have described an ePCR-based method for the faithful amplification of complex gene libraries followed by purification of PCR products from the mixture after the amplification process. However, these protocols employ large volumes of reagents for carrying out emulsion PCR followed by multiple extractions using hazardous organic solvent like diethyl ether for breaking the emulsion before the product is purified using silica-based column. This makes the overall process cumbersome, hazardous, and low-throughput (Turchaninova MA., et al. Eur J Immunol. 20l3;43(9):2507-l5).

[005] Therefore, there exists a need for developing an efficient and simple method for purifying PCR products from emulsion PCR mixture. SUMMARY OF INVENTION

[006] These and other features, aspects, and advantages of the present subject matter will be better understood with reference to the following description and appended claims. This summary is provided to introduce a selection of concepts in a simplified form. This summary is not intended to identify key features or essential features of the claimed subject matter, nor is it intended to be used to limit the scope of the claimed subject matter.

[007] In an aspect of the present disclosure, there is provided a process to obtain purified PCR product from an emulsion PCR mixture, said process comprising: (a) mixing emulsion PCR mixture with a solution-I, to obtain a first mixture, and (b) purifying the first mixture on a silica-based column, to obtain purified PCR product from the emulsion PCR mixture, wherein the solution-I is selected from a group consisting of: a solution comprising guanidine thiocyanate, a solution comprising guanidium hydrochloride, a solution comprising guanidine hydrochloride and isopropanol, and a solution comprising guanidine thiocyanate and isopropanol, and combinations thereof.

[008] In another aspect of the present disclosure, there is provided a process to obtain purified PCR product from an emulsion PCR mixture, said process comprising: (a) mixing emulsion PCR mixture with a solution-I, to obtain a first mixture, wherein the solution-I is selected from a group consisting of guanidine thiocyanate, a mixture of guanidine hydrochloride and isopropanol, a mixture of guanidine thiocyanate and isopropanol, and guanidine hydrochloride, and wherein when the solution-I is either guanidine hydrochloride or guanidine thiocyanate, isopropanol is added to the emulsion PCR mixture prior to addition of the solution- I or after addition of the solution-I to the emulsion PCR mixture; and (b) purifying the first mixture on a silica-based column, to obtain purified PCR product from the emulsion PCR mixture.

BRIEF DESCRIPTION OF ACCOMPANYING DRAWINGS

[009] The following drawings form a part of the present specification and are included to further illustrate aspects of the present disclosure. The disclosure may be better understood by reference to the drawings in combination with the detailed description of the specific embodiments presented herein.

[0010] Figure 1 depicts a model for generation of spurious PCR by-products during conventional PCR-based amplification of a mixture of different DNA molecules sharing same/similar sequences. PCR-based amplification of a mixture of different DNA molecules in the aqueous reaction leads to the generation of partially single-stranded DNA molecules (Al-Al’, A2-A2’, Bl-Bl’, and B2-B2’), in accordance with an embodiment of the present disclosure.

[0011] Figure 2 depicts amplification of MPT64 (Rvl980c) overlapping gene fragments using emulsion and conventional PCR, in accordance with an embodiment of the present disclosure. [0012] Figure 3 depicts the effect of concentration of DMSO on ePCR and cPCR, in accordance with an embodiment of the present disclosure.

[0013] Figure 4 depicts the products obtained after purification by different methods, in accordance with an embodiment of the present disclosure.

[0014] Figure 5 depicts a picture of emulsion PCR mixture before and after breakage with binding buffers provided with commercially available DNA purification kits. Figure 5 (A) Before breakage and Figure 5 (B) After breakage with binding buffer, in accordance with an embodiment of the present disclosure.

[0015] Figure 6 depicts an analysis of PCR products purified using Quick extraction protocol of the present disclosure with different commercially available DNA purification kits, in accordance with an embodiment of the present disclosure.

DETAILED DESCRIPTION OF THE INVENTION

[0016] Sequences in the present disclosure

[0017] SEQ ID NO: 1 depicts nucleic acid sequence of primer L3-s.

5’ CGGCAGCGAAAATCTCTACTTCCAAGGAGCATCT 3’

[0018] SEQ ID NO: 2 depicts nucleic acid sequence of primer K2-s.

5’ CTCCACCGCCAGCACCTCCTGAAGCACCACT 3’

[0019] SEQ ID NO: 3 depicts nucleic acid sequence of template MTBLIB41 Fl. CGGCAGCGAAAATCTCTACTTCCAAGGAGCATCTATCTACGACCCCGC CCAGGTGCTGAATCCGGATACCGGCCTGGCCAACGTGCTGGCGAATTT CGCCGACGCAAAAGCCGAAGGGCGGGATACCATCAACGGCCAGAAC ACCATCCGCATCAGCGGGAAGGTATCGGCACAGGCGGTGAACCAGAT AGCGCCGCCGTTCAACGCGACGCAGCCGGTGCCGGCGACCGTCTGGA TTCAGGAGACCGGCGATCATCAACTGGCACAGGCCCAGTTGGACCGC GGCTCGGGCAATTCCGTCCAGATGACCTTGTCGAAATGGGGCGAGAA GGTCCAGGTCACGAAGCCTCCTGTTAGCAGTGGTGCTTCAGGAGGTGC

TGGCGGTGGAG

[0020] SEQ ID NO: 4 depicts nucleic acid sequence of template HuAbl 184. TGGCAGCTCAGCCAGCGATGGCTCAGGCAGTGCTGACTCAGCCACCC TCGGTGTCAGTGGCCCCAGGAAAGACGGCCAGGATTACCTGTGGGGG AAACAACATTGGAAGTAAAAGTGTGCACTGGTACCAGCAGAAGCCAG GCCAGGCCCCTGTGCTGGTCGTCTATGATGATAGCGACCGGCCCTCAG GGATCCCTGAGCGATTCTCTGGCTCCAACTCTGGGAACACGGCCACCC TGACCATCAGCAGGGTCGAAGCCGGGGATGAGGCCGACTATTACTGT CAGGTGTGGGATAGTAGTAGTGATCATTGGGTGTTCGGCGGAGGCAC CAAGCTGACCGTCCTAGGTGGGGGTGGATCCGGTGGCGGTGGCTCTG GAGGCGGTGGAAGCCAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTG GTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTTAC TCCATCAGCAGTGGTTACTACTGGGGCTGGATCCGGCAGCCCCCAGG GAAGGGGCTGGAGTGGATTGGGAGTATCTATCATAGTGGGAGCACCT ACTACAACCCGTCCCTCAAGAGTCGAGTCACCATATCAGTAGACACGT CCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCTGCGGACA CGGCCGTGTATTACTGTGCGGGCACTTATTCTAACTTCGGTGCTTTTGA TATCTGGGGCCAAGGGACAATGGTCACCGTCTCCTCAGCGAGTACAA AGGGCCCTAGCG

[0021] SEQ ID NO: 5 depicts nucleic acid sequence of template HuAbl 190.

TGGCAGCTCAGCCAGCGATGGCTCAGTCTGCCCTGACTCAGCCTGCCT CCGTGTCTGGGTCTCCTGGACAGTCAGTCACCATCTCCTGCACTGGAA CCAGCAGTGACGTTGGTGGTTATAACTATGTCTCCTGGTACCAACAGC CTCCAGGCAAAGCCCCCAAACTCATGATTTATGAGGTCAGTAAGCGG CCCTCAGGGGTCCCTGATCGCTTCTCTGGCTCCAAGTCTGGCAACACG GCCTCCCTGACCATCTCTGGGCTCCAGGCTGAGGACGAGGCTGATTAT TACTGCAGCTCATATACAAGCAGCAGCGCTGTGGTATTCGGCGGAGG GACCAAGCTGACCGTCCTAGGTGGGGGTGGATCCGGTGGCGGTGGCT CTGGAGGCGGTGGAAGCCAGGTGCAGCTGCAGGAGTCGGGCCCAGGA CTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGT GGCTCCATCAGCAGTAGTAGTTACTACTGGGGCTGGATCCGCCAGCCC CCAGGGAAGGGACTGGAGTGGATTGGGTATATCTATTACAGTGGGAG C ACC A ACT AC A ACCCCTCCCTC A AG AGTCG AGTC ACC AT ATC AGT AG A CACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCTGC GGACACGGCCGTGTATTACTGTGCGAGAGCGAGTGGTTATTACTACTA CTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCT CCTCAGCGAGTACAAAGGGCCCTAGCG

The underlined sequences in SEQ ID NO: 3 to 5 denotes primer binding sites.

[0022] SEQ ID NO: 6 depicts nucleic acid sequence of primer PelBclo-51.

5’ -TGGCAGCTCAGCC AGCGATGGCT-3’

[0023] SEQ ID NO: 7 depicts nucleic acid sequence of primer HuJGclo34 5’ -CGCTAGGGCCCTTTGTACTCGCTGAGGAGAC-3’

[0024] Those skilled in the art will be aware that the present disclosure is subject to variations and modifications other than those specifically described. It is to be understood that the present disclosure includes all such variations and modifications. The disclosure also includes all such steps, features, compositions, and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations of any or more of such steps or features. Definitions

[0025] For convenience, before further description of the present disclosure, certain terms employed in the specification, and examples are delineated here. These definitions should be read in the light of the remainder of the disclosure and understood as by a person of skill in the art. The terms used herein have the meanings recognized and known to those of skill in the art, however, for convenience and completeness, particular terms and their meanings are set forth below. [0026] The articles“a”,“an” and“the” are used to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article.

[0027] The terms“comprise” and“comprising” are used in the inclusive, open sense, meaning that additional elements may be included. It is not intended to be construed as“consists of only”.

[0028] Throughout this specification, unless the context requires otherwise the word“comprise”, and variations such as“comprises” and“comprising”, will be understood to imply the inclusion of a stated element or step or group of element or steps but not the exclusion of any other element or step or group of element or steps.

[0029] The term“including” is used to mean“including but not limited to”. “Including” and“including but not limited to” are used interchangeably.

[0030] For the purposes of the present disclosure, the term“emulsion PCR mixture” is intended to indicate the emulsion mixture obtained after the completion of PCR program in a thermocycler. This is the emulsion PCR mixture, which is further purified to obtain PCR product. The PCR product can further be used for various applications. The term“conventional PCR” or“cPCR” has been used to indicate the routine PCR which is free from any emulsion. The terms“emulsion PCR” and“ePCR” have been used interchangeably throughout the disclosure. The term“purified” with respect to PCR product refers to a product which is free of any contaminants like oil, or detergents, or surfactants, PCR components such as dNTPs, primers, DNA polymerase, and other additives like DMSO, betaine. The term“conventionally known method” as described herein refers to the generally followed method for performing a particular action concerned. The term“aqueous PCR mixture” refers to the PCR mixture before the addition of oil -surfactant mix which when mixed vigorously to emulsify, produces heat-stable nanoliter vesicles that contain the contents of the aqueous PCR mixture. The terms“guanidine hydrochloride” and“guanidium hydrochloride” have been used interchangeably, also the terms“guanidine thiocyanate” and“guanidium thiocyanate” have been used interchangeably.

[0031] As discussed in the background section, ePCR can be used for numerous applications including Next Generation Sequencing (NGS), and library construction. Therefore, to ensure that the ePCR serves the purpose it is intended to, purification of the PCR products from the emulsion PCR mixture is a critical step. The problem associated with the methods described in the existing art is that the protocol for purification of the emulsion PCR mixture involves use of hazardous chemicals like hexane, butanol, diethyl ether (DEE), and sodium dodecyl sulphate and the like. It is generally advisable to minimize the use of such chemicals in the laboratory since they cannot be easily eradicated and linger on for long periods of time in the work place creating an uncomfortable and unhealthy environment. However, use of these chemicals has been an integral part of the purification process of emulsion PCR mixture. Also, with regards to the purification process involving these chemicals, lots of intermediate steps are required to completely remove these chemicals, even trace amounts of these chemicals may interfere with various downstream applications of the purified PCR products.

[0032] The well-established protocols for breaking the emulsion of PCR mixture and purifying products to obtain purified PCR products involve the use of at least one of the hazardous chemicals, such as, hexane, butanol, diethyl ether (DEE), and sodium dodecyl sulphate. A compilation of previously reported protocols which involve use of the hazardous chemicals (hexane, butanol, diethyl ether (DEE), octanol, and sodium dodecyl sulphate) has been described in the succeeding paragraphs.

[0033] Williams R, et al., describe the protocol for purification of emulsion PCR mixture comprising use of diethyl ether (DEE); Boers et al (Boers SA. et al., Scientific reports. 2015 Sep 16; 5: 14181) describe a protocol for breaking emulsion which comprises use of 2-butanol; Turchaninova et al (Turchaninova MA. et al., European journal of immunology. 2013 Sep;43(9):2507-l5) describe a protocol for emulsion PCR and purification, as per the protocol, DEE has been used for breaking the emulsion PCR mixture. Schutze et al (Schutze T. et al., Analytical biochemistry. 2011 Mar 1 ;410(1): 155-7) describe the use of isobutanol during purification of the emulsion PCR mixture; Kojima et al (Kojima T. et al., In Whole Genome Amplification 2015 (pp. 87-100). Humana Press, New York, NY) describe a method which involves addition of hexane for breaking the emulsion of the emulsion PCR mixture. In another report by Kojima et al (Kojima T. et al., Nucleic acids research. 2005;33;l7), they describe a protocol involving use of hexane for complete removal of oil from emulsion PCR sample which has been described as an essential step. Ge et al (Ge Q. et al, Analytical biochemistry. 2007 Aug 15 ;367(2): 173-8) describe a protocol comprising the use of DEE for complete removal of oil phase for purifying the PCR products from the emulsion PCR mixture; Shao et al (Shao K. et al., PloS one. 2011 Sep l5;6; 9) describe the use of ether for purifying the products from emulsion PCR mixture. In addition to the use of organic solvents for extraction of DNA post emulsion PCR, the processes described in various document also use large volumes of PCR for purification to obtain high yields. Sumida et al., (Sumida et al. J Nucleic Acids. 2012; 2012:371379) have also employed overlap-extension ePCR to link the Fab heavy and light chain. The authors used an organic solvent-independent method, which requires high speed centrifugation at 40°C to break the emulsion for recovering the lower aqueous layer with further processing steps before the DNA could be purified using QIAquick PCR purification kit. Essentially, most protocols use hazardous organic solvents or other complex procedures for breaking the emulsion post-PCR. However, during this process, the removal of hazardous solvents before recovering the amplified DNA poses a hazard and makes the whole process labour-intensive, cumbersome and low-throughput. [0034] Patent documents also disclose the use of the hazardous chemicals as mentioned before for purifying the PCR products from the emulsion PCR mixture. Following paragraphs discuss a few such patent documents in this filed.

[0035] US9803226 discloses an emulsion-based PCR amplification method, wherein the method comprises breaking the emulsion of obtained PCR amplified product by adding a breaking solution. It is further disclosed that the breaking solution comprises butanol, propanol, and water. It is also disclosed that the breaking solution may further comprise a cationic, non-ionic or a zwitter-ionic detergent along with an alkali salt.

[0036] US98692988 discloses methods and kits for breaking emulsion, the method includes steps of obtaining a first emulsion including a continuous hydrophobic fraction and a discontinuous aqueous fraction, and breaking the first emulsion by contacting the first emulsion with a breaking solution to separate the phases of the resulting mixture by following the steps as disclosed. The breaking solution has been disclosed to comprise organic extraction solvent including butanol, octanol, hexane or chloroform.

[0037] US8748102 discloses bead-based amplification and purification methods. It describes breaking of emulsion involving use of hazardous solvents like hexane, and subsequently multiple rounds of washing and centrifugation are involved prior to obtaining a purified product.

[0038] Therefore, it can be observed that as per the published documents, well- established protocol for purification of PCR products from the emulsion PCR mixture involves use of hazardous chemicals and subsequently processing involves multiple steps of centrifugation and clean-up for ensuring complete removal of the chemicals before purification of the PCR product. Thus, it makes the process of purification a cumbersome and labour-intensive process, demanding lots of time and requiring a particular set of skills to ensure that the purified product retains its ability for use in wide applications. [0039] The present disclosure discloses a simplified process for purifying PCR product from the emulsion PCR mixture without the use of any hazardous chemicals like hexane, butanol, diethyl ether (DEE), octanol and sodium dodecyl sulphate. Also, the process does not involve multiple steps of centrifugation for breaking the emulsion. The present disclosure discloses a process to obtain purified PCR products from an emulsion PCR mixture, said process comprising: (a) mixing emulsion PCR mixture with a solution-I, to obtain a first mixture; and (b) purifying the first mixture on a silica-based column, to obtain purified PCR product from the emulsion PCR mixture. In one aspect of the present disclosure, the solution I comprises guanidium thiocyanate. In another aspect, the solution I comprises guanidium hydrochloride. In yet another aspect, the solution I comprises a combination of guanidium hydrochloride and isopropanol. In one other aspect, the solution I comprises a combination of guanidium thiocyanate and isopropanol. In still another aspect, the solution I is selected from a group consisting of guanidium hydrochloride, guanidium thiocyanate, isopropanol, and combinations thereof. In one embodiment, where the solution I comprises guanidium thiocyanate, concentration of guanidium thiocyanate is in a range of 5-6M, in another embodiment where the solution I comprises guanidium hydrochloride, concentration of guanidium hydrochloride is in a range of 5-6M, and where if, the solution I comprises isopropanol, as per an embodiment, concentration of isopropanol in a range of 30-40% with respect to the solution I. An alternate process of the present disclosure comprises sequential addition of guanidine hydrochloride and isopropanol to obtain the first mixture. One other alternate process of the present disclosure comprises sequential addition of guanidine thiocyanate and isopropanol to obtain the first mixture. It can be contemplated that the sequence of addition of either of the two components is not significant, and it can be added in any sequence. One significant advantage of the process of the present disclosure is that the emulsion PCR mixture does not need any physical or chemical pre-treatment method prior to the addition of the solution I. In the well- established methods known in the art, the mixture is generally pre-treated by using heat or any chemical for facilitating the purification process, leading to additional number of steps required for the purification process. As per the process of the present disclosure, the emulsion PCR mixture obtained after the PCR amplification can directly be mixed with the solution I to obtain a first mixture, and the solution I is further processed on a silica-based column to obtain purified PCR product. This method is not labor-intensive and cumbersome for purification of emulsion PCR amplified products.

[0040] A point which is worthy of mentioning at this juncture, is that the purification involving silica-based column is an integral part that needs to be followed after breaking the emulsion in case of purification methods known in the art as mentioned previously. The hazardous chemicals are required for breaking the emulsion in the PCR mixture and facilitating purification in case of methods known in the art. On the other hand, the process of the present disclosure provides a solution which describes addition of the solution I (free from hazardous chemicals such as DEE, hexane, and butanol) directly to the emulsion mixture followed by purification using the silica-based column. It can be well understood by a person skilled in the art that although guanidium thiocyanate and guanidium hydrochloride are indispensable components of the solution I, but other components can also be added instead of these two and also apart from these two components.

[0041] As per the process of the present disclosure, the process of purifying the first mixture on a silica-based column is in accordance with process known in the art for purification using silica-based column. The emulsion PCR mixture was mixed with the solution-I, to obtain a first mixture. As per one aspect of the present disclosure, the process of purifying the first mixture on a silica-based column comprises the following steps: (i) loading the first mixture onto silica-based column followed by centrifugation; (ii) adding buffer W to the column followed by centrifugation; (iii) drying the column; and (iv) adding buffer E to the column followed by eluting the purified PCR products, wherein the buffer W comprises ethanol, and the buffer E comprises water or at least one buffer having a pH in a range of 8-8.5. In another embodiment of the present disclosure, the buffer W comprises ethanol having a weight percentage in a range of 70-85% with respect to the buffer W, and the buffer E comprises at least one buffer, wherein the buffer comprises 5-20 mM Tris-HCl, with or without EDTA.

[0042] Thus, the present disclosure provides a method of purifying emulsion PCR mixture which provides ease of use in case of emulsion PCR application.

[0043] The present disclosure is not to be limited in scope by the specific embodiments described herein, which are intended for the purposes of exemplification only. Functionally-equivalent products, compositions, and methods are clearly within the scope of the disclosure, as described herein.

[0044] In an embodiment of the present disclosure, there is provided a process to obtain purified PCR product from an emulsion PCR mixture, said process comprising: (a) mixing emulsion PCR mixture with a solution-I, to obtain a first mixture, and (b) purifying the first mixture on a silica-based column, to obtain purified PCR product from the emulsion PCR mixture, wherein the solution-I is selected from a group consisting of: a solution comprising guanidine thiocyanate, a solution comprising guanidium hydrochloride, a solution comprising guanidine hydrochloride and isopropanol, and a solution comprising guanidine thiocyanate and isopropanol.

[0045] In an embodiment of the present disclosure, there is provided a process to obtain purified PCR product from an emulsion PCR mixture, said process comprising: (a) mixing emulsion PCR mixture with a solution-I, to obtain a first mixture, and (b) purifying the first mixture on a silica-based column, to obtain purified PCR product from the emulsion PCR mixture, wherein the solution-I is selected from a group consisting of: a solution comprising guanidine thiocyanate, a solution comprising guanidium hydrochloride, a solution comprising guanidine hydrochloride and isopropanol, a solution comprising guanidine thiocyanate and isopropanol, and combinations thereof.

[0046] In an embodiment of the present disclosure, there is provided a process to obtain purified PCR product from an emulsion PCR mixture, said process comprising: (a) mixing emulsion PCR mixture with a solution-I, to obtain a first mixture, wherein the solution-I is selected from a group consisting of guanidine thiocyanate, a mixture of guanidine hydrochloride and isopropanol, a mixture of guanidine thiocyanate and isopropanol, and guanidine hydrochloride, and wherein when the solution-I is either guanidine hydrochloride or guanidine thiocyanate, isopropanol is added to the emulsion PCR mixture prior to addition of the solution- I or after addition of the solution-I to the emulsion PCR mixture; and (b) purifying the first mixture on a silica-based column, to obtain purified PCR product from the emulsion PCR mixture.

[0047] In an embodiment of the present disclosure, there is provided a process to obtain purified PCR product from an emulsion PCR mixture, said process comprising: (a) mixing emulsion PCR mixture with a solution-I, to obtain a first mixture, wherein the solution-I is selected from a group consisting of guanidine thiocyanate, a mixture of guanidine hydrochloride and isopropanol, a mixture of guanidine thiocyanate and isopropanol, and guanidine hydrochloride, and wherein when the solution-I is either guanidine hydrochloride or guanidine thiocyanate, isopropanol is added to the emulsion PCR mixture prior to addition of the solution- I or after addition of the solution-I to the emulsion PCR mixture; and (b) purifying the first mixture on a silica-based column, to obtain purified PCR product from the emulsion PCR mixture, wherein the solution-I is 4-5M guanidine thiocyanate. In another embodiment, the solution-I is 4-5M guanidine hydrochloride. In yet another embodiment, the solution-I is a mixture of 4-5M guanidine thiocyanate and 30-40% isopropanol. In an alternate embodiment, the solution-I is a mixture of 4- 5M guanidine hydrochloride and 30-40% isopropanol. [0048] In an embodiment of the present disclosure, there is provided a process to obtain purified PCR product from an emulsion PCR mixture, said process comprising: (a) mixing emulsion PCR mixture with a solution-I, to obtain a first mixture, wherein the solution-I is guanidine thiocyanate, and wherein isopropanol is added to the emulsion PCR mixture prior to addition of the solution-I or after addition of the solution-I to the emulsion PCR mixture; and (b) purifying the first mixture on a silica-based column, to obtain purified PCR product from the emulsion PCR mixture. In another embodiment, isopropanol is added to the emulsion PCR mixture prior to addition of the solution-I. In yet another embodiment, isopropanol is added to the emulsion PCR mixture after addition of the solution-I.

[0049] In an embodiment of the present disclosure, there is provided a process to obtain purified PCR product from an emulsion PCR mixture, said process comprising: (a) mixing emulsion PCR mixture with a solution-I, to obtain a first mixture, wherein the solution-I is guanidine hydrochloride, and wherein isopropanol is added to the emulsion PCR mixture prior to addition of the solution- I or after addition of the solution-I to the emulsion PCR mixture; and (b) purifying the first mixture on a silica-based column, to obtain purified PCR product from the emulsion PCR mixture. In another embodiment, isopropanol is added to the emulsion PCR mixture prior to addition of the solution-I. In yet another embodiment, isopropanol is added to the emulsion PCR mixture after addition of the solution-I.

[0050] In an embodiment of the present disclosure, there is provided a process to obtain purified PCR product from an emulsion PCR mixture as described herein, wherein the solution-I is a solution comprising guanidine thiocyanate. In another embodiment of the present disclosure, the solution-I is a solution comprising 5-6M guanidium thiocyanate.

[0051] In an embodiment of the present disclosure, there is provided a process to obtain purified PCR product from an emulsion PCR mixture as described herein, wherein the solution-I is a solution comprising guanidine hydrochloride. In another embodiment of the present disclosure, the solution-I is a solution comprising 5-6M guanidium hydrochloride.

[0052] In an embodiment of the present disclosure, there is provided a process to obtain purified PCR product from an emulsion PCR mixture as described herein, wherein the solution-I is a solution comprising guanidine hydrochloride and isopropanol. In another embodiment of the present disclosure, the solution-I is a solution comprising 5-6M guanidine hydrochloride and 30-40% isopropanol.

[0053] In an embodiment of the present disclosure, there is provided a process to obtain purified PCR product from an emulsion PCR mixture as described herein, wherein the solution-I is a solution comprising guanidine thiocyanate and isopropanol. In another embodiment of the present disclosure, the solution-I is a solution comprising 5-6M guanidine thiocyanate and 30-40% isopropanol.

[0054] In an embodiment of the present disclosure, there is provided a process to obtain purified PCR product from an emulsion PCR mixture as described herein, wherein the process optionally involves a step for removing oil layer from the emulsion PCR mixture before mixing with the solution-I.

[0055] In an embodiment of the present disclosure, there is provided a process to obtain purified PCR product from an emulsion PCR mixture as described herein, wherein the process optionally involves a centrifugation step after obtaining the first mixture.

[0056] In an embodiment of the present disclosure, there is provided a process to obtain purified PCR product from an emulsion PCR mixture as described herein, wherein the process is devoid of use of hazardous chemicals selected from a group consisting of diethyl ether (DEE), hexane, 1 -butanol, 2-butanol, octanol, and sodium dodecyl sulphate.

[0057] In an embodiment of the present disclosure, there is provided a process to obtain purified PCR product from an emulsion PCR mixture as described herein, wherein in step (a), mixing involves a step selected from a group consisting of vortexing, pipetting, vigorous shaking, and combinations thereof.

[0058] In an embodiment of the present disclosure, there is provided a process to obtain purified PCR product from an emulsion PCR mixture as described herein, wherein the emulsion PCR mixture comprises a water-in-oil emulsion, and wherein the water-in-oil emulsion comprises biomolecules.

[0059] In an embodiment of the present disclosure, there is provided a process to obtain purified PCR product from an emulsion PCR mixture as described herein, wherein the emulsion PCR mixture comprises a water-in-oil emulsion, and wherein the water-in-oil emulsion comprises biomolecules, and wherein the biomolecules are polynucleotides.

[0060] In an embodiment of the present disclosure, there is provided a process to obtain purified PCR product from an emulsion PCR mixture as described herein, wherein the emulsion PCR mixture comprises a water-in-oil emulsion, and wherein the water-in-oil emulsion comprises biomolecules, and wherein the biomolecules are either attached to a substrate or are present in a free form, and wherein the biomolecules are polynucleotides.

[0061] In an embodiment of the present disclosure, there is provided a process to obtain purified PCR product from an emulsion PCR mixture as described herein, wherein the process is essentially devoid of any physical or chemical method of pre-treating the emulsion PCR mixture.

[0062] In an embodiment of the present disclosure, there is provided a process to obtain purified PCR product from an emulsion PCR mixture as described herein, wherein the PCR mixture comprises dimethyl sulfoxide (DMSO) having a weight percentage in a range of 0-10% with respect to the aqueous PCR mixture before emulsification.

[0063] In an embodiment of the present disclosure, there is provided a process to obtain purified PCR product from an emulsion PCR mixture as described herein, wherein the purified PCR product is used for an application selected from a group consisting of NGS (Next Generation Sequencing), cloning, DNA fragment library construction, aptamer library construction, and antibody fragment library construction.

[0064] In an embodiment of the present disclosure, there is provided a process to obtain purified PCR product from an emulsion PCR mixture as described herein, wherein purifying the first mixture on a silica-based column is done by conventionally known method for purification using a silica-based column.

[0065] In an embodiment of the present disclosure, there is provided a process to obtain purified PCR product from an emulsion PCR mixture as described herein, wherein purifying the first mixture comprises: (i) loading the first mixture onto silica-based column followed by centrifugation; (ii) adding buffer W to the column followed by centrifugation; (iii) drying the column; and (iv) adding buffer E to the column followed by eluting the purified PCR product, wherein the buffer W comprises ethanol, and the buffer E comprises water or at least one buffer having a pH in a range of 8-8.5. In another embodiment of the present disclosure, the buffer W comprises ethanol having a weight percentage in a range of 70-85% with respect to the buffer W, and the buffer E comprises at least one buffer, wherein the buffer comprises Tris-HCl, with and without EDTA.

[0066] In an embodiment of the present disclosure, there is provided a process to obtain purified PCR product from an emulsion PCR mixture, said process comprising: (a) mixing emulsion PCR mixture with a solution-I, to obtain a first mixture, and (b) purifying the first mixture on a silica-based column, to obtain purified PCR product from the emulsion PCR mixture, wherein the solution-I is selected from a group consisting of: a solution comprising guanidine thiocyanate, a solution comprising guanidium hydrochloride, a solution comprising guanidine hydrochloride and isopropanol, and a solution comprising guanidine thiocyanate and isopropanol, and wherein the process is devoid of use of hazardous chemicals selected from a group consisting of diethyl ether (DEE), hexane, 1 -butanol, 2- butanol, octanol, and sodium dodecyl sulphate. [0067] In an embodiment of the present disclosure, there is provided a process to obtain purified PCR product from an emulsion PCR mixture, said process comprising: (a) mixing emulsion PCR mixture with a solution-I, to obtain a first mixture, and (b) purifying the first mixture on a silica-based column, to obtain purified PCR product from the emulsion PCR mixture, wherein the solution-I is selected from a group consisting of: a solution comprising guanidine thiocyanate, a solution comprising guanidium hydrochloride, a solution comprising guanidine hydrochloride and isopropanol, and a solution comprising guanidine thiocyanate and isopropanol, and wherein the process is devoid of use of hazardous chemicals selected from a group consisting of diethyl ether (DEE), hexane, 1 -butanol, 2- butanol, octanol, and sodium dodecyl sulphate, and wherein the purified PCR product is used for an application selected from a group consisting of NGS (Next Generation Sequencing), cloning, DNA fragment library construction, aptamer library construction, and antibody fragment library construction, and wherein mixing involves a step selected from a group consisting of vortexing, pipetting, vigorous shaking, and combinations thereof.

[0068] In an embodiment of the present disclosure, there is provided a process to obtain purified PCR product from an emulsion PCR mixture, said process comprising: (a) mixing emulsion PCR mixture with a solution-I, to obtain a first mixture, wherein the solution-I is selected from a group consisting of guanidine thiocyanate, a mixture of guanidine hydrochloride and isopropanol, a mixture of guanidine thiocyanate and isopropanol, and guanidine hydrochloride, and wherein when the solution-I is either guanidine hydrochloride or guanidine thiocyanate, isopropanol is added to the emulsion PCR mixture prior to addition of the solution- I or after addition of the solution-I to the emulsion PCR mixture; and (b) purifying the first mixture on a silica-based column, to obtain purified PCR product from the emulsion PCR mixture, and wherein the process is devoid of use of hazardous chemicals selected from a group consisting of diethyl ether (DEE), hexane, 1- butanol, 2-butanol, octanol, and sodium dodecyl sulphate. [0069] In an embodiment of the present disclosure, there is provided a process to obtain purified PCR product from an emulsion PCR mixture, said process comprising: (a) removing oil layer from the emulsion PCR mixture; (b) mixing the emulsion PCR mixture obtained in step (a) with a solution-I, to obtain a first mixture, and (c) purifying the first mixture on a silica-based column, to obtain purified PCR product from the emulsion PCR mixture, wherein the solution-I is selected from a group consisting of: a solution comprising guanidine thiocyanate, a solution comprising guanidium hydrochloride, a solution comprising guanidine hydrochloride and isopropanol, and a solution comprising guanidine thiocyanate and isopropanol.

[0070] In an embodiment of the present disclosure, there is provided a process to obtain purified PCR product from an emulsion PCR mixture, said process comprising: (a) removing oil layer from the emulsion PCR mixture; (b) mixing the emulsion PCR mixture obtained in step (a) with a solution-I, to obtain a first mixture, and (c) purifying the first mixture on a silica-based column, to obtain purified PCR product from the emulsion PCR mixture, wherein the solution-I is selected from a group consisting of: a solution comprising guanidine thiocyanate, a solution comprising guanidium hydrochloride, a solution comprising guanidine hydrochloride and isopropanol, and a solution comprising guanidine thiocyanate and isopropanol.

[0071] In an embodiment of the present disclosure, there is provided a process to obtain purified PCR product from an emulsion PCR mixture, said process comprising: (a) mixing emulsion PCR mixture with a solution-I, to obtain a first mixture, and (b) purifying the first mixture on a silica-based column, to obtain purified PCR product from the emulsion PCR mixture, wherein the solution-I is selected from a group consisting of: a solution comprising guanidine thiocyanate, a solution comprising guanidium hydrochloride, a solution comprising guanidine hydrochloride and isopropanol, and a solution comprising guanidine thiocyanate and isopropanol, and wherein the process is devoid of use of hazardous chemicals selected from a group consisting of diethyl ether (DEE), hexane, 1 -butanol, 2- butanol, octanol, and sodium dodecyl sulphate, and wherein the purified PCR product is used for an application selected from a group consisting of NGS (Next Generation Sequencing), cloning, DNA fragment library construction, aptamer library construction, and antibody fragment library construction, and wherein mixing involves a step selected from a group consisting of vortexing, pipetting, vigorous shaking, and combinations thereof.

[0072] In an embodiment of the present disclosure, there is provided a process to obtain purified PCR product from an emulsion PCR mixture, said process comprising: (a) mixing emulsion PCR mixture with a solution-I, to obtain a first mixture, wherein the solution-I is selected from a group consisting of guanidine thiocyanate, a mixture of guanidine hydrochloride and isopropanol, a mixture of guanidine thiocyanate and isopropanol, and guanidine hydrochloride, and wherein when the solution-I is either guanidine hydrochloride or guanidine thiocyanate, isopropanol is added to the emulsion PCR mixture prior to addition of the solution- I or after addition of the solution-I to the emulsion PCR mixture; and (b) purifying the first mixture on a silica-based column, to obtain purified PCR product from the emulsion PCR mixture, wherein the process is devoid of use of hazardous chemicals selected from a group consisting of diethyl ether (DEE), hexane, 1- butanol, 2-butanol, octanol, and sodium dodecyl sulphate, and wherein the purified PCR product is used for an application selected from a group consisting of NGS (Next Generation Sequencing), cloning, DNA fragment library construction, aptamer library construction, and antibody fragment library construction, and wherein mixing involves a step selected from a group consisting of vortexing, pipetting, vigorous shaking, and combinations thereof.

[0073] Although the subject matter has been described with reference to specific embodiments, this description is not meant to be construed in a limiting sense. Various modifications of the disclosed embodiments, as well as alternate embodiments of the subject matter, will become apparent to persons skilled in the art upon reference to the description of the subject matter. It is therefore contemplated that such modifications can be made without departing from the spirit or scope of the present subject matter as defined.

[0074] While the invention is broadly as defined above, it will be appreciated by those persons skilled in the art that it is not limited thereto and that it also includes embodiments of which the following description gives examples.

EXAMPLES

[0075] The disclosure will now be illustrated with working examples, which is intended to illustrate the working of disclosure and not intended to take restrictively to imply any limitations on the scope of the present disclosure. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this disclosure belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice of the disclosed methods and compositions, the exemplary methods, devices and materials are described herein. It is to be understood that this disclosure is not limited to particular methods, and experimental conditions described, as such methods and conditions may vary.

[0076] The examples below provide the methods of performing emulsion PCR and provides a simplified method for purifying the PCR products from the emulsion PCR mixture devoid of any hazardous chemicals and also devoid of multiple processing steps.

Materials

[0077] Span 80, Tween 80, Triton X-100, and mineral oil were obtained from

Sigma-Aldrich, Bangalore, India. PfuUltra II Fusion HS DNA polymerase was from Agilent Technologies, Santa Clara, US. BSA (Fraction V), dNTPs were from Roche, Mannheim, Germany. All other standard chemicals were from Affymetrix, CA, USA. Escherichia coli strain TOP10F’ (F¹ [laclq TnlO (tetR)] mcrA A(mrr- hsdRMS-mcrBC) cp801acZAM 15 AlacX74 deoR nupG recAl araDl39 A(ara- leu)7697 galU galK rpsL(StrR) endAl l-) was obtained from Thermo Fisher Scientific, USA. Vectors fdtet9.62MPT645 l3l, fdtet9.62MPT645232, fdtet9.62MPT645333, and fdtet9.62MPT645434 used a template during optimization of ePCR-based experiments were available in the laboratory. Different DNA purification kits namely, QIAquick PCR purification Kit (Qiagen; Cat no. 28106 and Column Lot no. 154038931, Buffer Lot no. 157011841), PureLink Quick PCR purification kit (Thermo Fisher Scientific; Cat no. K310001 and Lot no. 00654132), Monarch PCR and DNA Cleanup kit (NEB; Cat no. T1030S and Lot no. 10020890), DNA Clean & Concentrator - 5 (Zymo Research;

Cat no. D4003 and Lot no. ZRC203516), QuickClean II PCR extraction kit (GenScript; Cat no. L00419-50 and Lot no. C70011806), QIAquick Gel extraction kit (Qiagen; Cat no. 28706 and Column Lot no. 154038931, Buffer Lot no. 148019900), GenElute PCR Clean-Up Kit (Sigma-Aldrich; Cat no. NA1020-1KT and Lot no. SLBW1595), NucleoSpin Gel and PCR Clean-up (Macherey-Nagel; Cat no. 740609.50 and Lot no. 1812/004), NucleoTraPCR (Macherey-Nagel; Cat no. 740587 and Lot no. 1904/001), Wizard SV Gel and PCR Clean-Up System (Promega; Cat no. A9281 and Lot no. 0000354719), GeneJET PCR purification kit (Thermo scientific; Cat no. K0701 and Lot no. 00705184) were from respective manufacturers.

Methods

[0078] Emulsion PCR (ePCR) was optimized using purified double stranded DNA of phage -based vectors, fdtet9.62MPT645l3 l, fdtet9.62MPT645232, fdtet9.62MPT645333, and fdtet9.62MPT645434 as the template. These vectors contain overlapping segments of M. tuberculosis gene Rvl980c (MPT64) with incremental 60 bp truncations [MPT645131, 629 bp (Ll); MPT645232, 509 bp (F2); MPT645333, 389 bp (F3); MPT645434, 269 bp (F4)]. For the purposes of the present disclosure, these four templates will be referred to as MPT64 Fl, MPT64 F2, MPT64 F3 and MPT64 F4, which produce amplicons of 675 bp, 555 bp, 435 bp, and 315 bp, respectively, following PCR using primers Fdtet9.62short5l and Fdtet9.62short3l.

[0079] Although the present study has used the above-mentioned templates and reagents for carrying out the emulsion PCR, it is well understood to a person skilled in the art that the process of purifying PCR products from emulsion PCR mixture as disclosed herein, applies to emulsion PCR and can be applied to any kind of templates usable in emulsion PCR method. Also, the present disclosure shows an exemplification with respect to the free-form of nucleotides, but the process of the present disclosure can also be applied to bound-form of nucleotides.

Example 1

Protocol followed for ePCR

[0080] The ePCR was performed as described earlier (Williams R, et al., Nat Methods. 2006;3(7):545-50. Epub 2006/06/23. doi: l0. l038/nmeth896). The efficiency of ePCR amplification was tested using individual genes. Briefly, 260 mΐ of aqueous PCR mixture containing 10 mg/ml BSA (Roche), 200 m M dNTPs (Roche), 78 pmoles each of 5’ primer Fdtet9.62short5l and 3’ primer Fdtet9.62short3l, 6 ng purified template DNA (containing 6 x 10⁸ - 10 x 10⁸ DNA molecules) and 5.6 U of PfuUltra II Fusion HS polymerase in 1 x PfuUltra II Fusion HS polymerase buffer was prepared. An oil-surfactant mixture containing 4.5 % Span 80 (v/v), 0.4 % Tween 80 (v/v) and 0.05 % Triton X-100 (v/v) was prepared in mineral oil for the emulsification of aqueous PCR. For emulsification, 200 mΐ aqueous PCR mixture was added drop-wise over a period of 2 min to 400 mΐ oil- surfactant mixture with constant stirring using a 2 x 6 mm magnetic flea (Tarsons, India) at 1000 rpm at RT (room temperature) in a 1.8 ml round bottom cryo tube (Nunc, Thermo Fisher Scientific, USA). The stirring was continued for additional 5 min after complete addition of the aqueous PCR mix. The creamy white emulsion was transferred to 0.2 ml PCR tubes (50 pl/tube; total 12 tubes) and overlaid with 50 mΐ mineral oil. Three sets of four PCR tubes each were subjected to PCR with initial denaturation at 95°C for 2 min followed by thermocycling for 20, 30 or 40 cycles comprising of denaturation at 95°C for 30 sec, annealing at 55°C for 30 sec and polymerization at 72°C for 12 sec followed by final polymerization at 72°C for 2 min. Simultaneously, 10 mΐ of the remaining aqueous PCR mixture (without emulsification) was also subjected to cPCR under same conditions. Following PCR, emulsion from each of the 4 tubes from different sets amplified for 20, 30 or 40 cycles, were pooled separately, and centrifuged at l3,000g for 5 mins at 25°C. The top oil layer was carefully removed, and the emulsion was broken using 1 ml of water-saturated diethyl ether (DEE). The solution was centrifuged at 12,000 rpm for 1 min at RT, and upper diethyl ether layer was carefully removed. This step was repeated twice, and leftover DEE was removed using a centrifugal evaporator. Following this, PCR product extraction was performed using QIAquick PCR purification kit as per manufacturer’s protocol and PCR product was eluted in 50 mΐ EB.

Example 2

Determination of the effect of DMSO on ePCR

[0081] Three aqueous PCR mixture of 260 mΐ each containing final concentration of 0/1/2 % DMSO and equimolar mix of 4 template DNA encoding MPT64 Fl - F4 (~ 6 x 10⁸ - 10 x 10⁸ DNA molecules) were subjected to ePCR along with corresponding ePCR as described above, and the products were analyzed on agarose gel. Example 3

Process as disclosed in the present disclosure for extraction and purification of PCR products after ePCR

[0082] The processes as disclosed in the present disclosure has been compared with the conventional known process for purification of ePCR. The efficiency of different protocols for extraction and purification of PCR products after ePCR was tested using plasmid pVCMTBLIB4lFl36006 as a template DNA, which carries a 389 bp DNA fragment flanked by known adapter sequences. Aqueous PCR was set up in a volume of 350 mΐ containing 10 mg/ml BSA, 200 mM dNTPs, 105 pmoles each of 5’ primer L3-s and 3’ primer K2-s, 4 x 10⁹ template DNA molecules and 8.4 U of PfuUltra II Fusion HS polymerase in 1 x PfuUltra II Fusion HS polymerase buffer. 300 mΐ aqueous PCR mixture was added drop-wise over a period of 2 min to 600 mΐ oil- surfactant mixture (4.5 % Span 80 (v/v), 0.4 % Tween 80 (v/v) and 0.05 % Triton X-100 (v/v) in mineral oil) with constant stirring using a 2 x 6 mm magnetic flea (Tarsons, India) at 1000 rpm at RT in a 1.8 ml round bottom cryo tube (Nunc, Thermo Fisher Scientific, USA). The stirring was continued for additional 5 min after complete addition of the aqueous PCR mix and the emulsion was divided (~ 100 mΐ) into nine 0.2 ml PCR tubes and overlaid with 30 mΐ mineral oil. The emulsion containing tubes (ePCR) were subjected to thermocycling for 30 cycles as per manufacturer’s instructions for the use of PfuUltra II Fusion HS polymerase. The contents of three tubes, each containing 100 mΐ emulsion were individually processed for purification using three methods as described below.

[0083] In the first method (Conventional method, Spin + DEE + Column), the ePCR from each PCR tube (100 mΐ + 30 mΐ overlaid mineral oil) was transferred to 1.5 ml microfuge tube and centrifuged at l3,000g for 5 min at RT. The top oil layer was carefully removed, 70 mΐ of 0.1 x TE was added to increase the volume, and the emulsion was broken by addition of 1 ml water-saturated diethyl ether (DEE) followed by vortexing. The suspension was centrifuged at 12,000 rpm for 1 min at RT, and the top layer of DEE was removed. This step was repeated twice, and leftover DEE was removed using a centrifugal evaporator. The PCR products were purified from aqueous layer (~ 100 mΐ) using QIAquick PCR purification kit as per manufacturer’s protocol described for conventional PCR products and eluted in 40 mI EB. [0084] In the second method (Spin + Column), the ePCR from each PCR tube (100 mΐ + 30 mΐ overlaid mineral oil) was transferred to 1.5 ml microfuge tube and centrifuged at l3,000g for 5 min at RT. The top oil layer was carefully removed, 70 mΐ of 0.1 x TE was added to increase the volume. 500 mΐ of QIA PB purification buffer (5 x volume) was added to each tube and emulsion was broken by vortexing for 1 min. The suspension (emulsification oil + aqueous layer) was centrifuged at 12,000 rpm for 1 min at RT and purified using QIAquick PCR purification kit as described above.

[0085] In the third method (only Column; Quick ePCR extraction protocol), the ePCR from each PCR tube (100 mΐ + 30 mΐ overlaid mineral oil) was transferred to 1.5 ml microfuge tube and 500 mΐ of QIA PB purification buffer (5 x volume) was directly added to each tube and emulsion was broken by vortexing for 1 min. The suspension (emulsification oil + aqueous layer) was centrifuged at 12,000 rpm for 1 min at RT and purified using QIAquick PCR purification kit as described above.

[0086] The purified ePCR products obtained using three different methods were analyzed using agarose gel electrophoresis and quantitated using Nanodrop 2000c spectrophotometer and Qubit Fluorometer 2.0 (Thermo Fisher Scientific, USA) using dsDNA HS kit.

[0087] The entire steps of purification using the third method (Quick ePCR extraction protocol) by using the QIA quick PCR purification kit is as described below:

1. Solution equivalent to Solution-I [Qia PB (Qiagen); or the relevant solution as per other kits] was added to emulsion PCR mixture (500 mΐ PB or other equivalent solution per 100-200 mΐ of the mixture), to obtain first mixture.

2. The first mixture was subjected to vortexing for 1 min.

3. The first mixture was subjected to centrifugation @ 12000 rpm (13,000 x g), RT for 1 min.

4. Post centrifugation, the mixture was loaded on silica column (700 mΐ per spin).

5. Centrifugation @ 12000 rpm (13,000 x g), RT was done for 1 min. 6. The flow-through was discarded and 700 mΐ of Buffer W (Qia PE or equivalent) was added.

7. Centrifugation @ 12000 rpm (13,000 x g), RT was done for 1 min.

8. The flow-through was discarded and centrifugation @ 12000 rpm (13,000 x g), RT was done for 2 min (Blank spin).

9. 40-60 mΐ elution buffer (Qia EB or equivalent) was added and kept at RT for 5 min.

10. Centrifugation @ 12000 rpm (13,000 x g), RT was done for 1 min to obtain purified PCR product.

[0088] It is understood that the second and third method as described in the previous paragraphs are the process disclosed in the present disclosure. Although, commercially available solutions from Qiagen kit have been used for showing the working of the process, it is contemplated that QIA PB purification buffer is equivalent to the solution-I of the present disclosure. Also, the solutions for further purification step involving commercial Qiagen solutions can be achieved by using the Buffer W and Buffer E of the present disclosure. The Qiagen solutions (Qia PE and Qia EB) as used in the present disclosure for showing the working of the process essentially serves the same purpose. Example 4

Cloning of DNA fragments amplified using ePCR or cPCR

[0089] Plasmids encoding single chain Fvs [scFv(s)], namely HuAbl l84 and HuAbl l90 were used as template for the amplification of scFv encoding DNA using 5’ primer PelBclo-5l (5’ -TGGC AGCTC AGCC AGCGATGGCT-3’ ) and 3’ primer HuJGclo34 (5’ -CGCTAGGGCCCTTTGTACTCGCTGAGGAGAC-3’ ). For this, aqueous PCR mixture was prepared in a volume of 200 mΐ containing 10 mg/ml BSA (Roche), 200 mM dNTPs (Roche), 60 pmoles each of 5’ primer PelBclo-5l and 3’ primer HuJGclo34, 2.4 x 109 template DNA molecules, and 4.8 U of PfuUltra II Fusion HS polymerase in 1 x PfuUltra II Fusion HS polymerase buffer. The aqueous PCR mixture was emulsified in 400 mΐ oil-surfactant mix as described above and 50 mΐ emulsion was divided into 0.2 ml PCR tubes and overlaid with 30 mΐ mineral oil. Thermocycling was performed for 30 cycles and the ePCR products were purified using the process of the present disclosure (Quick ePCR extraction protocol). Simultaneously, the genes were amplified using ePCR and purified using QIAquick PCR purification kit to obtain approximately 5 pg product. The ePCR and ePCR amplified scFv DNA fragments were quantified using dsDNA BR quantification kit with Qubit Fluorometer (version 2.0) and approximately 2 pg product was subjected to T4 DNA polymerase treatment in the presence of dTTP to generate 4 base overhangs at 5’ ends of the DNA fragments. The T4 DNA polymerase-treated products were purified and ligated to Bsal- digested vector pVMAKHuscFvclo002. The ligation mix was electroporated in E. coli TOP10F’ and electroporation efficiency was calculated. For each construct, six random colonies were screened using colony PCR followed by DNA sequencing to determine the number of recombinants with correct sequences.

Example 5

Next generation sequencing of DNA libraries purified using Quick ePCR extraction protocol

[0090] The single-stranded phage DNA sample was obtained by boiling phage particles captured on Streptavidin (SA)-magnetic beads after panning a phage- displayed gene-fragment library, MTBLIB42C02, on different antibodies following panning methods as described before (Gupta A, et al. PLoS One. 20l3;8(9):e752l2. Epub 2013/10/03. doi: l0.l37l/journal.pone.00752l2; Verma V, et ah, PLoS One. 20l8;l3(l):e0l9l3 l5. Epub 2018/01/24. doi: l0. l37l/journal.pone.0l9l3l5). The extracted DNA (without any purification) was used as a template in the three-step PCR-based strategy for preparation of dual- indexed NGS libraries. For the initial pre-amplification of template, ePCR was set up in a volume of 50 mΐ as described above using primers, which annealed completely to the sequences flanking the target. The reactions were subjected to 13 cycles of cPCR followed by dilution of the reaction by two-fold using fresh 50 mΐ PCR mix (containing all components except template). Approximately 80 mΐ of diluted cPCR product was emulsified in 160 mΐ oil-surfactant mix as described above using the same primers as used for cPCR, and subjected to 30 cycles of ePCR. The first step ePCR products were purified using‘Quick ePCR extraction protocol’ (process of the present disclosure) and quantified using dsDNA HS quantification kit with Qubit Fluorometer (version 2.0). This ePCR product was employed as template for the final step of ePCR using primers carrying Illumina adapter sequences for preparation of dual-indexed NGS libraries. For this, aqueous PCR was set up in a volume of 100 mΐ and approximately 80 mΐ was emulsified in 160 mΐ oil-surfactant mix as described above and subjected to 30 cycles of ePCR. The ePCR products i.e., the dual-indexed NGS libraries were purified using‘Quick ePCR extraction protocol’ and quantified using dsDNA HS quantification kit with Qubit Fluorometer (version 2.0), and average library size was determined by chip- based capillary electrophoresis using High Sensitivity DNA kit on 2100 Bioanalyzer (Agilent, CA, USA) as per the manufacturer’s instructions. The libraries were subjected to sequencing on MiSeq Nano v2 reagent kit (MS-103- 1003, Illumina) for 2 x 250 cycles of paired-end sequencing. The run statistics were viewed using Illumina Sequencing Analysis Viewer Software (v2.4.5).

Example 6

Validation of Quick ePCR extraction protocol of the present disclosure using commercially available kits

[0091] The emulsion PCR (22 x 100 mΐ) was setup as described in the methods section in the present disclosure. Eleven commercially available kits were analyzed and for each the extraction was performed in duplicates (two tubes of 100 mΐ ePCR per kit). The ePCR from each PCR tube (100 mΐ + 30 mΐ overlaid mineral oil) was transferred to 1.5 ml microfuge tube and different volumes of binding buffers were added as per manufacturer’s protocol for different kits. The emulsion was broken by vortexing for 1 min and the suspension (emulsification oil + aqueous layer) was centrifuged at 12,000 rpm for 1 min at RT. The suspension was loaded on the columns and purified as per manufacturer’s protocol. The ePCR products were eluted in 40 mΐ elution buffer provided by respective manufacturers.

[0092] The purified ePCR products were analyzed using agarose gel electrophoresis and quantitated using Nanodrop 2000c spectrophotometer and Qubit Fluorometer 2.0 (Thermo Fisher Scientific, USA) using dsDNA HS kit. Results of the Examples:

[0093] Emulsion PCR eliminates PCR artifacts - Conventional PCR-based amplification (ePCR) of DNA molecules has been reported to lead to the generation of a population of partially single-stranded DNA (ssDNA) molecules due to incomplete primer extension. As depicted in Figure 1 , this phenomenon is especially troublesome during the amplification of DNA molecules carrying stretches of same or similar sequences (for e.g. in case of DNA fragments libraries, libraries of variable domains of antibodies, 16S rRNA libraries, etc., different genes share common sequences). During subsequent cycles of PCR, such partial ssDNA molecules (Figure 1, Al’, A2’, Bl’, and B2’) can act as mega primers and their‘spurious but perfect’ annealing with other ssDNA molecules carrying same 3’ end sequence can lead to the generation of new PCR artifacts, which carry a sequence different from the original template DNA (Figure 1 , new product 1 and 2). Similarly, during the amplification of genes encoding variable antibody domains for the construction of antibody libraries, PCR can lead to generation of spurious chimeric products carrying DNA sequences from two different antibody coding sequences sharing a common stretch of highly similar/same DNA sequences. This phenomenon is detrimental to the quality of the antibody libraries as the spurious PCR products do not encode the natural repertoire and are likely to be off-frame. Since, the emulsion PCR (ePCR) allows the amplification of DNA molecules in individual water-in-oil droplets, problems related to mis-priming by incomplete PCR products and generation of artifacts is avoided. However, owing to the tedious procedures involved in extraction of emulsions, the use of ePCR has not been practiced in applications that require high-throughput (HTP) amplification of multiple complex templates. In this study, the protocol was adapted from Williams et al. for ePCR and simplified it, both for setting up the ePCR and for extraction and purification of PCR products, to make it amenable for use in regular and HTP applications.

[0094] The process of purifying the emulsion PCR mixture as disclosed in the present disclosure is different from the protocol used by Williams et al., and will be described in detail in forthcoming paragraphs.

[0095] Figure 1 depicts a model for generation of spurious PCR by-products during conventional PCR-based amplification of a mixture of different DNA molecules sharing same/similar sequences. PCR-based amplification of a mixture of different DNA molecules in the aqueous reaction leads to the generation of partially single-stranded DNA molecules (Al-Al’, A2-A2’, Bl-Bl’, and B2-B2’). During subsequent PCR cycles, the partial ssDNA can serve as primers and mis- prime with other DNA molecules sharing the same sequence as the 3’ end of partial ssDNA (B2’-Al’ and A2’-Bl’). This leads to production of new spurious products that were not present in the initial template mix (New product 1 and 2).

[0096] Efficiency of ePCR for amplification of DNA- Four fdtet9.62 plasmid molecules carrying the overlapping fragments of M. tuberculosis H37Rv MPT64 gene (Rvl980c) with 60 base incremental deletions on either end (namely, MPT64 Fl - F4) were chosen as the template for optimization of ePCR. These template molecules were carefully chosen as they carry overlapping sequences flanked by same adapter sequences and therefore can be amplified using same primer pair. However, small proportion of partial PCR products generated from these templates during PCR can lead to mis-priming and result in new chimeric products as depicted in Figure 1. [0097] First, the efficiency of ePCR was compared with routinely performed cPCR by testing amplification from the four templates individually at increasing number of PCR cycles. Considering the number of droplets formed per ml of emulsion to be approximately 1 x 10¹⁰, to ensure that each droplet receives no more than one template molecule for faithful amplification, the number of template molecules was fixed at ~ 6 x 10⁸ molecules per 260 mΐ of aqueous PCR. All the four fragments showed good amplification with no difference in the product yield (Figure 2). The ePCR yield was approximately 50-70 % of the total yield obtained with ePCR for all samples with only a marginal increase in the product yield with increase in PCR cycles from 30 to 40 (Figure 2). This is likely to be due to the exhaustion of reaction components in the emulsion droplets after certain number of PCR cycles, whereas there is no such limitation in ePCR. As explained later, at the template concentration employed, only 40-50% emulsion droplets are expected to contain a template, thus resulting in reduced total product.

[0098] Determination of effect of DMSO on ePCR - PCR additives like DMSO are often necessary for increasing the amplification efficiency and specificity, especially during the amplification of DNA sequences from GC-rich genomes like M. tuberculosis. Hence, the effect of DMSO was tested on ePCR. The results (Figure 3) reveals that ePCR allows specific amplification of the four fragments, in the presence of up to 2 % DMSO and 40 cycles of PCR, whereas, ePCR shows non-specific amplification just after 20 cycles of PCR even in presence of 2 % DMSO. With this, it can be concluded that up to 2 % DMSO could be successfully used as an additive in ePCR without affecting the stability of the emulsion droplets.

[0099] Emulsion PCR made easy: Simplified ePCR extraction protocol - After ePCR, the sample needs to be processed, for removal of oil and detergents employed for producing the emulsion droplets, to obtain purified PCR product. Most of the currently employed protocols for the purification of PCR products after ePCR involve tedious steps requiring the use of hazardous organic solvents like diethyl ether, butanol etc. for breaking the emulsion followed by purification of PCR products using silica-based column.

[00100] The efficiency of two new methods of the present disclosure was compared with a conventional method for breaking the emulsion and subsequent PCR product purification. The conventional method (Spin + DEE + Column) involved centrifugation of the emulsion to remove excess oil, followed by breakage of the emulsion using diethyl ether, and purification of the PCR products using QIAquick silica-based spin column. The first disclosed method (Spin + Column) avoided the use of DEE, but involved the centrifugation of the emulsion to remove excess oil directly followed by the breakage of emulsion using QIA PB purification buffer containing high concentration of guanidine hydrochloride and isopropanol, and subsequent PCR purification on QIAquick spin columns, which are compatible with the mineral oil and detergents in the sample. The second disclosed method (Quick ePCR extraction method) avoided initial centrifugation and oil removal and involved direct breakage of emulsion using QIA PB purification buffer followed by subsequent PCR purification on QIA quick spin columns. The results show that all three methods worked equally well for purification of PCR products after ePCR (Figure 4 and Table 1). Referring to Table 1, it can be appreciated that the concentration of purified DNA obtained by the three protocols is similar. This is a very important finding as the third method named as‘Quick ePCR extraction protocol’ (involving only column) which is the process of the present disclosure eliminates the step of excess oil removal and the use of hazardous organic solvents for breaking the emulsion, thereby simplifying the whole process and making it amenable with HTP applications.

[00101] Figure 4 depicts the optimization of the process for extraction and purification of PCR products from emulsion PCR. After PCR, the emulsion was extracted using three different protocols, namely, Protocol- 1: Spin+DEE+Column, Protocol-2: Spin+Column, and Protocol-3: only Column (Quick ePCR extraction protocol as described in the present disclosure). Each extraction was performed in triplicates (A, B and C) and different volumes of purified PCR product were analyzed (Lane 1-5m1 ePCR product; Lane 2-10m1 of ePCR product).

Table 1 :

G001021 Compatibility of purified PCR products obtained by the method of present disclosure - Further the utility of the PCR products was evaluated by purifying using‘Quick ePCR extraction protocol’ in cloning and next generation sequencing (NGS). Two single chain Fv (scFv) fragments were amplified using ePCR or ePCR and were made compatible for restriction enzyme-free cloning using library-scale method for insert preparation. The fragments were cloned in scFv expression vector and comparison of clones obtained revealed no difference between the cloning efficiency of Quick ePCR or ePCR amplified products (Table 2).

Table 2: Cloning efficiency

[00103] Moreover, 100 % clones were found to be recombinants encoding correct scFv sequence in case of both ePCR and cPCR amplified inserts. The data clearly reflects that the‘Quick ePCR extraction protocol’ which is the process as disclosed in the present disclosure does not affect the quality of the PCR products.

[00104] Furthermore, the DNA products purified using the‘ Quick ePCR extraction protocol’ were found suitable for NGS using Illumina MiSeq platform. In an attempt to determine the epitopes recognized by different antibodies available in the lab using a phage-displayed gene fragment library after only a single round of panning, NGS was employed to identify the enriched sequences for the prediction of epitopes. However, since after the first round of panning there are only 10⁵-10⁶ bound phage particles, their DNA was amplified using PCR to obtain sufficient template for NGS. For this, a combination of ePCR was employed followed by two steps of ePCR in which the products were purified using‘Quick ePCR extraction protocol.’ In three independent NGS runs, the‘Clusters Passing Filter’ was found to be more than 85 % and high-quality data was obtained with more than 75 % bases carrying % Q > 30, indicating that the quality of DNA library purified using ‘Quick ePCR extraction protocol’ was suitable for NGS (Table 3).

[00105] Table 3 depicts parameter details of NGS runs performed with DNA libraries purified using Quick ePCR extraction protocol.

[00106] Overall, the present disclosure describes a quick procedure for the extraction of DNA without the use of hazardous organic solvents and therefore, is applicable even for small volume ePCR. [00107] The elimination of chimera formation during ePCR was successfully demonstrated using a mixture of 4 overlapping templates. In order to avoid chimerization, it is also important to maintain an optimal droplet to template ratio. In the experiments of the present disclosure, a ratio of approximately 6 templates per 15 droplets was found as a good ratio so that most droplets contain no more than one template. M/s Roboklon GmbH, have nicely depicted that assuming Poisson distribution, when the number of template DNA is one-third or half the total number of droplets, approximately 22.2 % and 30.3 % of micelles host one template copy per micelle and 3.7 % and 9.0 % micelles carrying more than one template copy, respectively. The results of the present disclosure also show that the presence of up to 2 % DMSO, generally employed with GC-rich template to improve the PCR specificity, does not affect the integrity of emulsion in PCR. The successful amplification of templates in small volume ePCR prepared in 96 well deep plate will be useful in high-throughput applications such as 16S rRNA sequencing, cloning of antibody genes, etc.

G001081 Compatibility of Quick ePCR extraction protocol as disclosed in the present disclosure with commercially available kits

[00109] To assess the wide applicability of the Quick ePCR extraction protocol as disclosed in the present disclosure, it was validated with eleven commercially available PCR product purification kits listed in Table 4. It was observed that binding buffers provided with five out of eleven kits could successfully break the emulsion completely (Kit no. I-IV (1-4) and VII (7); Figure 5 and Table 4). For the remaining kits, only partial breakage of the emulsion was observed (Kit no. V (5), VI (6), VIII-IX (8-9); Figure 5). The PCR products were purified irrespective of the breakage of emulsion and their analysis using agarose gel electrophoresis and quantitation using Nanodrop and Qubit revealed variable PCR product yields (Figure 6 and Table 4). Use of the kits like Kit no. II, Kit no. Ill, Kit no. VIII, Kit no. X, and Kit no. XI led to higher yield of PCR products despite incomplete breakage of emulsion with some of these kits. In case of Kit no. IX, which employs a silica bead suspension (instead of column), the eluted sample contained oil. Due to the presence of oil, a high sample reading with Nanodrop (based on measurement of absorbance at 280 nm) was observed but not with Qubit (based on measurement of fluorescence after specific binding of dye to the DNA) and this was confirmed by agarose gel analysis (Figure 6, C; Kit no. IX). The results obtained by Kit IX show that a simple addition of binding buffer and purifying by all the methods would not provide a desirable purification. The present disclosure by way of exemplification has shown that the purification after the addition of solution-I (binding buffers of commercial kits) has to be done by silica-based columns and not by silica-based suspension.

Overall, the present disclosure successfully demonstrates that several commercially available PCR product extraction kits can be employed in Quick ePCR extraction protocol (protocol as described in the present disclosure) for rapid and easy purification of ePCR products. However, the quality of the PCR product purified using commercially available kits other than the QIAquick PCR purification kit remains to be validated.

[00110] Table 4:

Advantages of the present disclosure

[00111] The most important contribution of the work embodied in the disclosure is the direct use of silica-based columns for achieving emulsion breakage, oil removal and product purification. Although, the conventional methods to purify DNA after ePCR also use silica-based columns, they involve the breakage of the emulsion using organic solvents or hazardous solvents like diethyl ether (DEE), hexane, 1 -butanol, 2-butanol, octanol, and sodium dodecyl sulphate. While oil or detergents present in the PCR mixture reportedly do not bind to the silica membrane, no protocol for direct breaking of emulsion and purification of DNA contained in the emulsion droplets has been described. The results presented in the disclosure clearly show that the quality of the product obtained using Quick ePCR extraction protocol (involving direct extraction using silica column) is as good as the conventional method for extraction of PCR products after ePCR and is suitable for routinely performed gene cloning experiments and NGS applications. Further, the present disclosure also demonstrates that the Quick ePCR extraction protocol as disclosed herein is compatible with several commercially available and widely used kits for PCR purification, thereby, making the process feasible across different laboratories or companies worldwide.

[00112] The following paragraphs summarise the advantages provided by the present disclosure.

G001131 Avoids the use of hazardous solvents - Conventionally used method involves the use of hazardous solvent for purifying the PCR product for obtaining purified product. The present disclosure provides an easy to practice method which does not involve the use of any such hazardous solvents.

G001141 Efficient method - The results disclosed herein clearly shows that the purified PCR product obtained by the Quick ePCR extraction protocol of the present disclosure is comparable to the product obtained by using conventional methods of purification involving the use of such hazardous solvents.

G001151 Cost-effective method - Since the present disclosure provides a method which can be practiced using the ingredients which are widely available, it is cost- effective method to obtain a high-quality purified PCR product from emulsion PCR mixture.

G001161 Time-saving method - It is a well-known fact that the use of hazardous organic solvents in purification of biomolecules involves a lot of intermediate steps for cleaning the organic solvent so that the final purified product does not have remains of such solvents as it leads to hindrance in various down-stream applications. The present method provides a solution to this problem by avoiding the use of such solvents which in turn saves time as well as efforts to obtain a purified PCR product.

[00117] The present disclosure discloses the applicability of the solution-I or any other solutions having the same or similar composition as solution-I in purifying emulsion PCR mixtures to obtain purified PCR product. This simplified process will find use in numerous applications that involve amplification of genes with highly similar or same sequences, such as antibody gene cloning, aptamer library amplification, and NGS, especially, sequencing of 16S rRNA or other amplicons. [00118] In summary, the protocols described in this disclosure make emulsion PCR easy and within the reach of every laboratory without use of hazardous organic solvents. The protocol also allows emulsion PCR to be performed in smaller volumes on a larger number of samples simultaneously.

Claims

I/We Claim:

1. A process to obtain purified PCR product from an emulsion PCR mixture, said process comprising:

a) mixing emulsion PCR mixture with a solution-I, to obtain a first mixture, and

b) purifying the first mixture on a silica-based column, to obtain purified PCR product from the emulsion PCR mixture, wherein the solution-I is selected from a group consisting of: a solution comprising guanidine thiocyanate, a solution comprising guanidium hydrochloride, a solution comprising guanidine hydrochloride and isopropanol, and a solution comprising guanidine thiocyanate and isopropanol, and combinations thereof.

2. A process to obtain purified PCR product from an emulsion PCR mixture, said process comprising:

a) mixing emulsion PCR mixture with a solution-I, to obtain a first mixture, wherein the solution-I is selected from a group consisting of guanidine thiocyanate, a mixture of guanidine hydrochloride and isopropanol, a mixture of guanidine thiocyanate and isopropanol, and guanidine hydrochloride, and wherein when the solution-I is either guanidine hydrochloride or guanidine thiocyanate, isopropanol is added to the emulsion PCR mixture prior to addition of the solution-I or after addition of the solution-I to the emulsion PCR mixture; and

b) purifying the first mixture on a silica-based column, to obtain purified PCR product from the emulsion PCR mixture.

3. The process as claimed in claim 1, wherein the solution-I is a solution comprising 5-6M guanidium thiocyanate.

4. The process as claimed in claim 1, wherein the solution-I is a solution comprising 5-6M guanidium hydrochloride.

5. The process as claimed in claim 1, wherein the solution-I is a solution comprising 5-6M guanidium thiocyanate and 30-40% isopropanol.

6. The process as claimed in claim 1, wherein the solution-I is a solution comprising 5-6M guanidium hydrochloride and 30-40% isopropanol.

7. The process as claimed in any one of the claims 1 or 2, wherein the process optionally involves a step for removing oil layer from the emulsion PCR mixture before mixing with the solution-I.

8. The process as claimed in any one of the claims 1 or 2, wherein the process optionally involves a centrifugation step after obtaining the first mixture.

9. The process as claimed in any one of the claims 1 or 2, wherein the process is devoid of use of hazardous chemicals selected from a group consisting of diethyl ether (DEE), hexane, 1 -butanol, 2-butanol, octanol, and sodium dodecyl sulphate.

10. The process as claimed in any one of the claims 1 or 2, wherein in step (a), mixing involves a step selected from a group consisting of vortexing, pipetting, vigorous shaking, and combinations thereof.

11. The process as claimed in any one of the claims 1 or 2, wherein the emulsion PCR mixture comprises a water-in-oil emulsion, and wherein the water-in-oil emulsion comprises biomolecules.

12. The process as claimed in claim 11, wherein the biomolecules are either attached to a substrate or are present in a free form.

13. The process as claimed in claim 12, wherein the biomolecules are polynucleotides.

14. The process as claimed in any one of the claims 1 or 2, wherein the process is essentially devoid of any physical or chemical method of pre-treating the emulsion PCR mixture.

15. The process as claimed in any one of the claims 1 or 2, wherein the PCR mixture comprises dimethyl sulfoxide (DMSO) having a weight percentage in a range of 0-10% with respect to the aqueous portion of the emulsion PCR mixture.

16. The process as claimed in any one of the claims 1 or 2, wherein the purified

PCR product is used for an application selected from a group consisting of NGS (Next Generation Sequencing), cloning, DNA fragment library construction, aptamer library construction, and antibody fragment library construction.

17. The process as claimed in any one of the claims 1 or 2, wherein purifying the first mixture on a silica-based column is done by conventionally known method for purifying using a silica-based column.