WO2020073593A1 - Use of serine protease inhibitor kazal type 1 in the preparation of agent for diagnosing or regulating cell senescence and tumors - Google Patents

Abstract

Disclosed is a use of serine protease inhibitor Kazal type 1 (SPINK1) in the preparation of an agent for diagnosing or regulating cell senescence and tumors. SPINK1 plays an important biological role in SASP phenotype and a tumor microenvironment, and is closely correlated with prognosis after chemotherapy. Thus, SPINK1 can serve as a target for research on SASP phenotype regulation as well as anti-tumor research on the basis of tumor microenvironment, as a marker for prognostic assessment and pathological grading of tumor after chemotherapy, and as a target for developing a tumor-inhibiting drug.

Description

Application of serine protease inhibitor Kazal type 1 in preparation of cell senescence and tumor diagnosis or regulation preparations Technical field

The present invention belongs to the field of disease diagnosis and regulation. More specifically, the present invention relates to the use of serine protease inhibitor Kazal type 1 factor (SPINK1) in the preparation of diagnostic or regulatory agents for cell aging and tumors.

Background technique

Cell senescence manifests as inward nuclear membrane folding, chromatin condensation, lipofuscin accumulation, increased cell volume, enlarged nuclear nuclei, increased β-galactosidase activity, and secretion of various factors. Cell senescence is triggered by one or more factors, activating downstream signaling pathways including p53, p16 ^INK4A / Rb, PI3K / Akt, FoxO transcription factor, and mitochondrial SIRT1. In addition to entering permanent proliferation arrest, senescent cells are often associated with many pathological features, including local inflammation. Cell aging occurs in damaged cells and prevents them from multiplying in the organism. Under the influence of various external stimuli and internal factors, cell damage can cause obvious signs of cell aging; when the damage accumulates and reaches a certain limit, the tissue presents various visually identifiable tissue degeneration changes and physiological aging phenotypes.

It is particularly noteworthy that the expression level of inflammatory cytokines in senescent cells is significantly increased. This phenomenon is called senescence-associated secretion phenotype (SASP). The concept of SASP was first proposed by Coppe et al in 2008. They found that senescent cells can promote the carcinogenesis or malignant enhancement of adjacent precancerous cells by secreting extracellular matrix proteins, inflammation-related factors and cancer cell growth factors, and called these proteins SASP factors.

The function of exocrine proteins produced by senescent cells often depends on the genetic background and species source of aging tumor cells. Although SASP is of great significance to tumor biology, it is still not clear how it controls tumors. In recent years, studies have focused on anti-aging targeting the upstream signaling pathway of SASP, drugs or genetic specific inhibition of IKK / NF-κB, mTOR, p38MAPK, JAK / STAT, etc. in senescent cells, which can inactivate the side effects caused by SASP Secretory effect, thereby improving the aging state of cells and body.

At present, how to kill senescent cells without damaging neighboring healthy cells, how to block the negative factors of SASP while retaining the effects of positive factors, and how to extend the results of animal experiments to clinical diagnosis and treatment Further research is needed.

Summary of the invention

The purpose of the present invention is to provide the application of serine protease inhibitor Kazal type 1 factor in the preparation of diagnostic or regulatory agents for cell aging and tumors.

In the first aspect of the present invention, there is provided a pharmaceutical composition for inhibiting tumors or reducing tumor resistance, the pharmaceutical composition comprising: an antibody that specifically inhibits the serine protease inhibitor Kazal type 1 factor, and chemotherapy drug.

In a preferred example, the chemotherapy drugs are genotoxic drugs; preferably, the chemotherapy drugs include: mitoxantrone, doxorubicin, bleomycin, sabplatin, cisplatin, carboplatin, Daunomycin, nogamycin, arubicin, epirubicin, doxorubicin, cytarabine, capecitabine, gemcitabine, 5-fluorouracil.

In another preferred example, the pharmaceutical composition includes: an antibody that specifically inhibits the serine protease inhibitor Kazal1 type factor and mitoxantrone, and the mass ratio of the two is 1: 0.005 to 1: 2. The ground is 1: 0.01 ~ 1: 1.0; more preferably 1: 0.02 ~ 1: 0.6, such as 1: 0.2.

In another preferred example, the pharmaceutical composition includes: an antibody that specifically inhibits the serine protease inhibitor Kazal1 type factor and doxorubicin, and the mass ratio of the two is 1: 0.02 to 1: 1.5; preferably 1: 0.05 ～ 1: 0.8; more preferably 1: 0.06 ～ 1: 0.3, such as 1: 0.1.

In another preferred example, the pharmaceutical composition includes: an antibody that specifically inhibits the serine protease inhibitor Kazal1 factor and bleomycin, and the mass ratio of the two is 1: 0.02 to 1.5; preferably 1: 0.05 to 1: 0.8; more preferably 1: 0.06 to 1: 0.3, such as 1: 0.1.

In another preferred example, the pharmaceutical composition includes: an antibody that specifically inhibits the serine protease inhibitor Kazal1 factor and one or more selected from saplatin, cisplatin, and carboplatin, and the antibody and the latter The mass ratio is 1: 0.02 to 1.5; preferably 1: 0.05 to 1: 0.8; more preferably 1: 0.06 to 1: 0.3, such as 1: 0.1.

In another preferred example, the antibody that specifically inhibits the serine protease inhibitor Kazal type 1 factor is secreted by the hybridoma cell line CCTCC NO: C2018213.

In another aspect of the present invention, there is provided the use of any of the aforementioned pharmaceutical compositions for preparing a kit for inhibiting tumors or reducing tumor drug resistance.

In a preferred example, in the pharmaceutical composition, an antibody that specifically inhibits the serine protease inhibitor Kazal type 1 factor reduces the tumor resistance by inhibiting the serine protease inhibitor Kazal type 1 factor expressed by stromal cells in the tumor microenvironment Medicinal properties.

In another preferred example, the tumors include: prostate cancer, breast cancer, colorectal cancer, gastric cancer, liver cancer, pancreatic cancer, bladder cancer, and lung cancer.

In another preferred example, the tumor resistance is the resistance of the tumor to chemotherapy drugs.

In another aspect of the invention, there is provided an antibody that specifically inhibits the serine protease inhibitor Kazal type 1 factor, which is secreted by the hybridoma cell line CCTCC NO: C2018213.

In another aspect of the present invention, the use of an antibody that specifically inhibits the serine protease inhibitor Kazal type 1 factor in the preparation of an antibody drug is used in combination with a chemotherapeutic drug to inhibit or eliminate tumor resistance; or It is used to eliminate the resistance of tumor cells to chemotherapy drugs.

In another aspect of the present invention, a hybridoma cell line SP2 / 0-01-SPINK1-SUN is provided, and its deposit number in the Chinese Type Culture Collection Center is CCTCC NO: C2018213.

In another aspect of the present invention, a kit for inhibiting tumors or reducing tumor resistance, comprising: an antibody that specifically inhibits the serine protease inhibitor Kazal type 1 factor, or a cell line that produces the antibody.

In a preferred example, the pharmaceutical composition includes: the kit further includes: chemotherapy drugs; preferably the chemotherapy drugs are genotoxic drugs; preferably, the chemotherapy drugs include: rice Toxantrone, doxorubicin, bleomycin, sabplatin, cisplatin, carboplatin, daunorubicin, nogamycin, arubicin, epirubicin, doxorubicin, arabinocytoma Glycosides, capecitabine, gemcitabine, 5-fluorouracil.

In another aspect of the present invention, the use of a serine protease inhibitor Kazal type 1 factor in the preparation of a diagnostic reagent for the evaluation of tumor chemotherapy prognosis is provided, wherein the serine protease inhibitor Kazal type 1 factor is in the tumor microenvironment The serine protease inhibitor Kazal type 1 factor produced by stromal cells.

In a preferred example, the serine protease inhibitor Kazal1 type factor produced by stromal cells in the tumor microenvironment can be isolated from the sample tissue by conventional isolation means.

In another aspect of the present invention, the use of a reagent that specifically recognizes the serine protease inhibitor Kazal type 1 factor in the preparation of a diagnostic reagent for prognostic evaluation of tumor chemotherapy or pathological grading, wherein the serine protease inhibitor Kazal Type 1 factor is the Kazal type 1 factor, a serine protease inhibitor produced by stromal cells in the tumor microenvironment.

In a preferred example, the reagents that specifically recognize the serine protease inhibitor Kazal type 1 factor include antibody reagents, primers, and probes.

In another aspect of the present invention, a method for screening potential substances that inhibit tumors or reduce tumor resistance is provided. The method includes: (1) treating an expression system with candidate substances that expresses NF-κB and serine Protease inhibitor Kazal type 1 factor, and there is a NF-κB binding site upstream of the gene encoding the serine protease inhibitor Kazal type 1 factor; and (2) Detection of NF-κB in the system for the serine protease inhibitor Kazal type 1 factor If the candidate substance statistically inhibits the transcriptional regulation of the serine protease inhibitor Kazal1 type factor by NF-κB, it indicates that the candidate substance is a potential substance that inhibits tumors or reduces tumor resistance.

In a preferred example, step (1) includes: adding the candidate substance to the expression system in the test group; and / or step (2) includes: detecting the inhibition of serine protease by NF-κB in the system of the test group The transcriptional regulation of factor Kazal type 1 factor is compared with the control group, where the control group is an expression system that does not add the candidate substance; if the NF-κB in the test group is for the transcription of serine protease inhibitor Kazal type 1 factor Regulation is significantly inhibited (eg, inhibition by more than 20%, better inhibition by more than 50%; better inhibition by more than 80%), indicating that the candidate substance is a potential substance that inhibits tumors or reduces tumor resistance.

In another preferred example, the NF-κB binding site includes: Serine protease inhibitor Kazal type 1 factor encoding gene upstream -3902, -1851, -1763, -362, +51 position.

In another aspect of the present invention, a method for screening potential substances that inhibit tumors or reduce tumor drug resistance is provided. The method includes: (1) treating an expression system with a candidate substance that expresses EGFR-mediated signals Pathway and serine protease inhibitor Kazal type 1 factor; and (2) detection of the activation effect of serine protease inhibitor Kazal type 1 factor on EGFR-mediated signaling pathway in the system; if the candidate substance statistically inhibits this Activation indicates that the candidate substance is a potential substance that inhibits tumors or reduces tumor drug resistance.

In a preferred example, step (1) includes: adding the candidate substance to the expression system in the test group; and / or step (2) includes: detecting the serine protease inhibitor Kazal type 1 in the system of the test group The effect of factor on the activation of EGFR-mediated signaling pathway is compared with the control group, where the control group is an expression system that does not add the candidate substance; if the serine protease inhibitor Kazal type 1 factor in the test group is The activation of the signal pathway induced by the pathway is significantly inhibited (eg, inhibition by more than 20%, preferably by more than 50%; more preferably by more than 80%), indicating that the candidate substance is a potential for inhibiting tumors or reducing tumor resistance substance.

Other aspects of the invention will be apparent to those skilled in the art due to the disclosure herein.

BRIEF DESCRIPTION

Figure 1. Human prostate prostate stromal cell line PSC27 gene expression profile heat map after chemotherapy and radiation treatment. CTRL, control. BLEO, bleomycin. HP, hydrogen peroxide. RAD, radiation. Red arrow, SPINK1.

Figure 2. DNA damage response (DDR) of PSC27 cells after various conditions. A, Representative pictures after immunofluorescence detection, red fluorescence is γH2AX, blue is DAPI. B, DDR statistics comparison analysis. MIT, mitoxantrone. SAT, satraplatin. RAD, radiation. DOX, doxorubicin. BLEO, bleomycin.

Figure 3. PSC27 aging detection after various conditions in Figure 2. A, Representative image of bright field microscope after SA-B-Gal staining. B, Statistical analysis of SA-B-Gal staining positive cells.

Figure 4. Analysis of the rate of DNA intercalation in cells after PSC27 was treated with various conditions in Figure 2. A, Representative diagram after BrdU staining, green fluorescence is BrdU. B, BrdU statistical analysis after various drug treatments.

Figure 5. SPINK1 expression in stromal cells. A, SPINK1 transcript expression level in PSC27 cells after various conditions. B, Western blot analysis of SPINK1 protein expression.

Figure 6. PSC27 stromal cells expressing several typical factors of SASP after bleomycin treatment. Collected on days 1 ("2"), 3 ("3"), 5 ("4"), 7 ("5"), 10 ("6") and 15 ("7") after the drug injury The stromal cells and their total RNA were obtained for RT-PCR detection. The data at each time point is the same as that of the control (non-medicated group, "1") and is used for graphing.

Figure 7. Comparative analysis of SPINK1 transcript expression levels in prostate stromal cells and cancer cells after treatment with several drugs.

The protein samples of each cell line used in FIG. 8 and FIG. 7 after bleomycin treatment were analyzed by Western blot to determine the change of SPINK1 expression. IC, intracellular protein. CM, conditioned media. GAPDH, loading control.

Figure 9. DNA damage of human breast stromal cell line HBF1203 after treatment with chemotherapy drugs. A, Representative graph of immunofluorescence staining results, red fluorescence is γH2AX, blue is DAPI. B, Statistical analysis of DDR signals. CIS: Cisplatin; CARB: Carboplatin.

Figure 10. HBF1203 senescence cell analysis and detection after various conditions in Figure 9. A, Representative image of bright field microscope after SA-B-Gal staining. B, Statistical analysis of SA-B-Gal staining positive cells.

Figure 11. HBF1203 DNA insertion analysis in cells after various drug treatments. A, Representative diagram after BrdU staining, green fluorescence is BrdU. B, BrdU statistical analysis after various drug treatments.

Figure 12. The expression of SPINK1 in HBF1203. The transcript expression level of SPINK1 in cells after various conditions.

Figure 13. Comparative analysis of SPINK1 transcript expression levels in breast stromal cells and cancer cells after treatment with several drugs.

The protein samples of each cell line used in FIG. 14 and FIG. 13 after doxorubicin treatment were analyzed by Western blot to determine the change of SPINK1 expression. IC, intracellular protein. CM, conditioned media. GAPDH, loading control.

Figure 15: The stable transgenic lines established based on PSC27 and HBF1203 were used to determine the expression level of SPINK1 protein by Western blot. Native, original stroma cell. Vector, subline translated with control vector. SPINK1, subline overexpressing exogenous SPINK1. GAPDH, loading control. EGF, epidermal growth factor.

Figure 16. Various phenotype analyses of PSC27 and HBF1203 subline after treatment with DNA-damaging chemotherapy drugs. A, DDR statistics. B, DNA synthesis analysis based on BrdU staining. C, Cell senescence analysis based on SA-B-gal staining. DMSO, control.

Figure 17. Proliferation potential analysis of stromal cells after drug treatment. A, The time growth curve of each subline of PSC27 cells. B, HBF1203 growth curve. Drug treatment (Drug treatment), respectively for bleomycin and adriamycin dosing time point.

Figure 18. Comparative analysis of histopathology of primary lesions in patients with prostate cancer before and after chemotherapy. On the left, representative pictures of histochemical staining. On the right, representative pictures of H & E staining.

Figure 19. Statistical comparison analysis after pathological grading based on the results of SPINK1 staining in tumor tissue of prostate cancer patients. A, Statistics, the number of patients without chemotherapy and those who have experienced chemotherapy are 42 and 48, respectively. B, representative pictures of pathological grading. EL, expression level.

Figure 20. Comparative analysis of SPINK1 transcript expression of stromal cells and epithelial cells after laser capture microdissection (LCM) separation.

Figure 21. Analysis of SPINK1 transcript expression in stromal cells and cancer cells based on a single patient. The number of patients in each group is 10. Left, stromal cells. Right, epithelial cells.

Figure 22. Comparative analysis of SPINK1, IL-8 and WNT16B protein expression in tumor stromal cells of patients with prostate cancer after chemotherapy. The pathological score of each factor comes from the histochemical staining of each factor, and each reading is the average of 3 pathological blind readings.

Figure 23. Representative graph of histochemical staining based on SPINK1, IL-8 and WNT16B. The histopathological staining series of the three factors comes from 3 consecutive slices of a patient after treatment.

Figure 24. Analysis of protein expression relationships between SPINK1 and IL-8, and between SPINK1 and WNT16B in patients after chemotherapy. The value of each factor comes from three pathological blind readings. Among them, r, R ² , slope and P value are all from Pearson correlation analysis. Left, SPINK1-IL-8. Right, SPINK1-WNT16B.

Figure 25. Survival curve (Kaplan Meier) analysis based on the expression level of SPINK1 in the lesions of patients after chemotherapy. Number of patients in SPINK1 low expression group, 20, green curve. SPINK1 high expression group patients, 28, red curve.

Figure 26. Comparative analysis of histopathology of primary lesions in breast cancer patients before and after chemotherapy. On the left, representative pictures of histochemical staining. On the right, representative pictures of H & E staining.

Figure 27. Statistical comparison analysis after pathological grading based on the results of SPINK1 staining in the tumor tissue of breast cancer patients. The number of patients without chemotherapy and those undergoing chemotherapy were 68 and 62, respectively.

Figure 28. Comparative analysis of SPINK1 expression between different types of cells. A, Comparative analysis of SPINK1 transcript expression of stromal cells and epithelial cells separated by laser capture microdissection (LCM). B, Based on the expression analysis of SPINK1 transcripts of stromal cells of a single patient, the number of patients in each group is 10. C, Based on a similar analysis of cancer cells, the number of patients in each group is 10.

Figure 29. Kaplan Meier analysis based on the expression level of SPINK1 in breast cancer patients after chemotherapy. Number of patients in SPINK1 low expression group, 26, green curve. SPINK1 high expression group patients, 36, red curve.

Figure 30. Comparative analysis of histopathology of primary lesions in patients with colorectal cancer before and after chemotherapy. On the left, representative pictures of histochemical staining. On the right, representative pictures of H & E staining.

Figure 31. Statistical comparison analysis after pathological grading based on the results of SPINK1 staining in the tumor tissue of colorectal cancer patients. The number of patients who have not received chemotherapy and those who have undergone chemotherapy are both 40.

Figure 32. Comparative analysis of SPINK1 expression between different types of cells. Left, SPINK1 transcript expression analysis of colorectal cancer stromal cells and epithelial cells after laser capture microdissection (LCM) separation. In the analysis of SPINK1 transcript expression of stromal cells of a single patient, the number of patients in each group was 10. Right, based on a similar analysis of cancer cells, the number of patients in each group is 10.

Figure 33. Survival curve (Kaplan Meier) analysis based on the expression level of SPINK1 in patients with colorectal cancer after chemotherapy. Number of patients in SPINK1 low expression group, 14, blue curve. SPINK1 high expression group patients, 26, purple curve.

Figure 34. Shengxin analysis of the NF-kB binding site within 4000bp upstream of the SPINK1 promoter. A. Schematic diagram of the typical binding site of mammalian NF-kB subunit p65. B, A schematic diagram of a set of expression vectors constructed based on the speculative NF-kB binding site in the SPINK1 promoter region.

Figure 35. After the four reporter expression vectors in Figure 34B were transformed into 293 cells and stimulated with TNFα, the luciferase activity was detected. NAT11-Luc2CP, positive control vector.

Figure 36. After the four vectors used in Figure 35 were transferred into PSC27 stromal cells and treated with 50 μg / ml bleomycin, the luciferase signal intensity was compared and analyzed.

Figure 37. ChIP-PCR analysis of the PCR signal intensity of the 4 speculative NF-kB binding sites on the SPINK1 promoter in the fraction precipitated by the NF-kB specific antibody. Both IL-6-p1 and IL-8-p1 are NF-kB sites with known sequences and are used here as a positive control.

FIG. 38, NF-kB to the nucleus after three kinds of mutations after chemotherapy treatment, SPINK1 and expression levels of ^PSC27 IkBα IL-8 cell subline.

Figure 39. After transfecting GL-SPINK1-P04 into PSC27 cells, and then treated with bleomycin and NF-kB, c / EBP, and AP-1 inhibitors, respectively, the luciferase signals obtained were compared. BAY, NF-kB inhibitor. BA, c / EBP inhibitor. T5224 and SR, AP-1 inhibitors.

Figure 40. After PSC27 cells were treated with bleomycin and NF-kB, c / EBP and AP-1 inhibitors respectively, the expression of several SASP components transcripts A, SPINK1. B, IL-6. C, IL-8.

Figure 41. Analysis of protein expression of SPINK1 in the SPINK1 overexpression subline and knockout subline of PSC27 and the effect on the cell itself. A, Western blot detected SPINK1 expression. GAPDH, loading control. B, Statistical analysis of SA-β-Gal staining. C, representative pictures.

Figure 42. Proliferation analysis of prostate cancer cells after CM treatment by SPINK1 overexpression group and knockout group of PSC27, respectively.

Mobility analysis of prostate cancer cells in each group in Figure 43 and Figure 42, Hela cells are positive controls.

In the analysis of the invasion rate of prostate cancer cells in each group in Fig. 44 and Fig. 42, Hela cells are a positive control.

Analysis of drug resistance of prostate cancer cells in each group in Figure 45 and Figure 42 under the action of mitoxantrone. The mitoxantrone drug concentration is set near the IC50 value of each cancer cell line.

Figure 46. Prostate cancer cell line DU145 in the presence of SPINK1 and / or the use of chemotherapeutic drugs, the analysis of the expression of the complete form of caspase3 and its cleaved form.

Figure 47. Comparative analysis of apoptosis of prostate cancer cell line PC3 under the action of mitoxantrone and apoptosis inhibitor (QVD-OPH, ZVAD / FMK) or activator (PAC1, GA). A, Paclitaxel (DOC). B, Mitoxantrone (MIT).

Figure 48. Analysis of the activation of EGFR and its downstream molecules under the action of stromal cell-derived SPINK1 in prostate cancer cell lines PC3 and DU145. EGF, as an endogenous growth factor for detectable cancer cells. The bottom value is the relative calculated concentration of SPINK1 in stromal cell CM (ELISA reading).

Figure 49. The prostate cancer cell lines PC3 and DU145 were subjected to stromal cell-derived SPINK1, and the expression of each molecule in Figure 48 was again analyzed by Western blot.

Figure 50. IP and Western blot analysis based on SPINK1-specific antibodies. IgG, control antibody. S, SPINK1 monoclonal antibody.

Figure 51. The effect of SPINK1 knockout in stromal cells on the senescence of the cells themselves. A, Statistical analysis after SA-B-Gal staining. B, Representative cell staining pictures.

Figure 52. The CM produced by PSC27 (PSC27-BLEO) after bleomycin treatment was used to treat prostate cancer cells, and the proliferation rate of cancer cells was analyzed with or without SPINK1 knockout.

Analysis of the migration rate and invasion rate of prostate cancer cells under each treatment condition in Fig. 53 and Fig. 52. A, mobility. B, attack rate. The statistics of each group are statistical analysis at the top and representative cell pictures at the bottom.

Analysis of the resistance of cancer cells to mitoxantrone under each treatment condition in Figure 54 and Figure 52. The drug use concentration is the IC50 value of each cell line.

The experimental conditions in Fig. 55 and Fig. 54 are similar, but the EGFR inhibitors AG-1478 (2 μM), Cetuximab (50 μg / ml) and SPINK1 mAb (1 μg / ml) are used to detect cell resistance.

The survival curve analysis of the PC3 cell line under various treatment conditions in Figure 56 and Figure 55. The MIT drug concentration is designed to approximate the actual MIT concentration in the plasma of prostate cancer patients under clinical administration conditions.

Figure 57: Cell resistance curves of human breast cancer cells MDA-MB-231 and stromal cells HBF1203 after various treatments similar to those in Figure 56. DOX, doxorubicin.

Figure 58: Measurement of terminal tumor volume of mice at the end of the 8th week after immunodeficient mice were inoculated with PC3 / PSC27 subcutaneously. On the left, a statistical comparison analysis of the five groups of samples. On the right, a representative tumor picture.

Figure 59. Schematic diagram of tumor growth, administration and detection in mice. In the third week after PC3 / PSC27 subcutaneous injection, single or multi-drug treatment was started.

Figure 60. Schematic diagram of mouse treatment mode under pre-clinical conditions. The upper part is each processing method, and the lower part is distributed at each time point.

Figure 61. Statistical analysis of tumor terminal volume of mice after PC3 / PSC27 inoculation after 8 weeks of MIT preclinical administration. On the left, statistical comparison. On the right, a representative tumor picture.

Figure 62. Expression analysis of SASP representative factors and cell aging markers after mouse tumors were microdissected by laser capture after stromal cells and cancer cells were specifically separated. A-H are IL-8, WNT16B, SPINK1, MMP2, AREG, ANGPTL4, p16 and p21 respectively

Figure 63. Expression of SPINK1 in mouse tumor tissues treated with placebo and mitoxantrone, respectively.

Figure 64. Statistical analysis of tumor terminal volume in mice after mitoxantrone and therapeutic antibody Cetuximab or SPINK1 mAb monotherapy or multi-drug treatment.

Figure 65. Detection and analysis of luciferase expression in mice after subcutaneous inoculation based on PC3-luc / PSC27.

Figure 66. Comparative analysis of DNA damage and apoptosis of cancer cells in mouse tumors 7 days after preclinical administration. On the left, statistical comparison. On the right, a representative histochemical staining picture (cleaved caspase 3).

Figure 67. Analysis of SPINK1 protein levels in mouse plasma under several treatment conditions. The test results are from ELISA.

Figure 68. Statistical analysis of the terminal tumor volume of mice at the end of mitoxantrone treatment at the 8th week after inoculation of LNCaP / PSC27 in immunodeficient mice.

Figure 69. Statistical analysis of tumor terminal volume at the end of paclitaxel treatment at week 8 after immunodeficiency mice were inoculated with breast cancer cell lines MDA-MB-231 and / or HBF1203.

Figure 70. Comparative analysis of PC3 mice's body weight (A) and peripheral blood creatinine (B), urea (C), ALP (D) and ALT (E) levels at the end of preclinical studies.

Figure 71. MDA-MB-231 mice at the end of MIT pre-clinical treatment at the end of body weight (A) and peripheral blood creatinine (B), urea (C), ALP (D) and ALT (E) levels of comparative analysis.

Figure 72. Body weight (A) and peripheral blood creatinine (B), urea (C), ALP (D) and ALT (E) levels of immune intact mice (C57BL / 6) at the end of DOX preclinical treatment Comparative analysis. At the same time, the unit volume of hemoglobin (F), white blood cells (G), lymphocytes (H) and platelets (I) in the plasma was also detected.

Figure 73. Analysis of SPINK1 and IL-8 protein levels in plasma of clinical prostate patients and their relationship. A, SPINK1 level readings obtained by ELISA (20 patients before and after chemotherapy). B, SPINK1 level readings obtained by ELISA test (20 patients before and after chemotherapy). C, Pearson analyzed the statistical relationship between SPINK1 and IL-8.

Figure 74, A-C, similar to the clinical data analysis of Figure 73, a sample of breast cancer patients.

Figure 75, A-C, similar to the analysis of clinical data in Figure 72 and Figure 73, a sample of colorectal cancer patients.

Figure 76. Western blot detection of SPINK1 and IL-8 levels in plasma of prostate cancer patients before and after chemotherapy. Six patients before and after chemotherapy. Albumin, plasma loading control.

Figure 77. Correlation analysis of the expression levels of SPINK1 and IL-8 in the primary tumor tissue and peripheral blood of patients after chemotherapy. A total of 20 patients.

Figure 78. Expression analysis of multiple SASP factors in stromal cells in the lesion tissue of 20 prostate cancer patients in Figure 77. IL-2 / 3/5/12 are SASP non-related interleukins (or pro-inflammatory factors), which are experimental controls.

Figure 79. Correlation between plasma levels of SPINK1 and disease-free survival in 20 prostate cancer patients after chemotherapy. Ten patients with low level SPINK1, cyan curve. SPINK1 patients with high levels, purple curve.

Figure 80. Statistical graph of SPINK1 overexpression in ovarian cancer patients. Each red dot represents a patient with ovarian cancer, and each black dot represents a healthy volunteer.

Figure 81. Statistical comparison analysis of mutation, amplification and deletion of SPINK1 in breast cancer patients in TCGA database.

Figure 82. Statistical comparison analysis of mutation, amplification and deletion of SPINK1 in patients with prostate cancer in the TCGA database.

Figure 83. SPINK1 expression and secretion in stromal cells in the tumor microenvironment during clinical treatment, the pathological effects on peripheral cancer cells, and the working mode diagram of entering peripheral blood to participate in circulation.

detailed description

After extensive and in-depth research, the inventors revealed for the first time that the serine protease inhibitor Kazal type 1 factor (SPINK1) plays an important biological role in the SASP phenotype and tumor microenvironment, which is closely related to the prognosis after chemotherapy treatment. Therefore, SPINK1 can be used as a target for SASP phenotype regulation research and anti-tumor research based on the tumor microenvironment, as a marker for prognosis evaluation and classification of tumors after chemotherapy treatment, and as a target for the development of tumor suppressing drugs.

SPINK1

The factor of serine protease inhibitor Kazal type 1 (SPINK1), also known as pancreatic secretory pancreatin inhibitor (PSTI) or tumor-associated pancreatin inhibitor (TATI), is composed of 56 amino acid residues Secreted polypeptide, the main role is to inhibit the activity of various serine proteases such as trypsinogen. The SPINK family is closely related to diseases such as chronic pancreatitis, Netherton syndrome, and esophageal cancer. The amino acid sequence of human SPINK1 is as follows:

Some existing studies suggest that SPINK1 overexpression is positively correlated with the poor clinical outcome of prostate cancer patients. In addition, compared with normal liver tissues, the gene expression of SPINK1 in liver cancer tissues was significantly up-regulated, which may be due to tissue destruction caused by tumor invasion inducing an acute phase reaction. Interleukin 6 (IL-6) and interleukin 1 (IL-1) induced high expression of SPINK1. The high expression of SPINK1 in hepatocellular carcinoma tissues shows its potential as a tumor marker for hepatocellular carcinoma. Further research found that plasma SPINK1 has the potential as a serum tumor marker of hepatocellular carcinoma, and the level of plasma SPINK1 expression is significantly related to the tumor stage of patients with hepatocellular carcinoma.

However, the abnormal expression of SPINK1 and its molecular mechanism during the formation of SASP in stromal cells due to chemotherapeutic drugs or radiation treatment, as well as the effect of this factor on the phenotype of adjacent cancer cells and the significance of malignant progression of the disease There are no related reports so far. In the course of anti-cancer therapy, whether the typical exocrine factor of SASP, such as SPINK1, will have a significant effect on the acquired drug resistance of cancer cells, and whether the cancer cells exhibit drug-induced SPINK1 expression similar to stromal cells during treatment It is an important scientific question that needs to be answered urgently.

Previous reports on SPINK1 in cancer research have involved bladder cancer, colorectal cancer, liver cancer, and prostate cancer, and are mainly about mutations or overexpression of this gene. However, most of the data is focused on the research of cancer cells themselves. In contrast, the situation of patient stromal tissue is basically ignored. In the present invention, it is revealed for the first time that SPINK1 plays an important biological role in the SASP phenotype and tumor microenvironment, which is closely related to the prognosis after chemotherapy treatment.

Drug combination and its application

The present inventors found that an antibody that specifically inhibits SPINK1 in combination with a chemotherapeutic drug can significantly enhance the tumor suppressing effect. The synergistic effect of the antibody that specifically inhibits SPINK1 and the chemotherapeutic drug is through the following mode of action: the antibody that specifically inhibits SPINK1 inhibits its activity by binding to SPINK1 derived from the tumor microenvironment (especially the stromal cells), reversing the tumor for chemotherapy Drug resistance, which makes the effect of chemotherapy drugs more ideal.

Based on the new findings of the present inventors, the present invention provides a drug combination or composition for inhibiting tumors or reducing tumor drug resistance, the drug combination or composition includes: specific inhibition of serine protease inhibitor Kazal type 1 factor Antibodies, as well as chemotherapy drugs.

As used herein, the "tumor" may be a tumor in situ or a metastatic tumor, which includes refractory tumors that have drug resistance, especially tumors that are resistant to genotoxic chemotherapy drugs. Preferably, the tumor is a solid tumor. For example, the tumors include: prostate cancer, breast cancer, colorectal cancer, gastric cancer, liver cancer, pancreatic cancer, bladder cancer, lung cancer, etc.

As a preferred mode of the present invention, an anti-SPINK1 monoclonal antibody that is particularly effective for inhibiting tumors or reducing tumor resistance is provided. The anti-SPINK1 monoclonal antibody has high specificity for SPINK1 and does not bind to proteins other than SPINK1 . Also, when used in combination with chemotherapeutic drugs to suppress tumors, its effect is extremely excellent.

The anti-SPINK1 monoclonal antibody of the present invention is prepared using hybridoma technology. The deposit number of the hybridoma cell strain in the Chinese Type Culture Collection Center is CCTCC NO: C2018213. When the hybridoma is obtained, the hybridoma cells can be cultured and expanded in vitro according to a conventional animal cell culture method, so that the anti-SPINK1 monoclonal antibody is secreted. As an embodiment, the anti-SPINK1 monoclonal antibody can be prepared by the following preparation methods: (1) mice pre-treated with adjuvant; (2) inoculation of the hybridoma cells in the abdominal cavity of the mouse and secretion of monoclonal antibodies Clone the antibody; (3) draw ascites and isolate the monoclonal antibody. The monoclonal antibody isolated from ascites fluid is further purified to obtain high-purity antibodies. The monoclonal antibodies of the present invention can also be prepared by recombinant methods or synthesized using a polypeptide synthesizer. Those skilled in the art understand that after the monoclonal antibody hybridoma cell line is obtained or the monoclonal antibody is known by sequencing and other means, those skilled in the art can easily obtain the antibody.

Antibodies and chemotherapy drugs that specifically inhibit SPINK1 can be administered as a pharmaceutical composition, or the two can be present separately in a kit. The antibodies and chemotherapeutics that specifically inhibit SPINK1 are effective amounts. When used as a medicine, the antibody that specifically inhibits SPINK1 is also mixed with a pharmaceutically acceptable carrier.

As used herein, the term "effective amount" or "effective dose" refers to a human and / or animal that can produce a function or activity and can be accepted by a human and / or animal as used herein.

In specific embodiments of the present invention, some dosing regimens for animals such as mice are given. It is easy for those skilled in the art to convert the dosage from animals such as rats to the dosage suitable for humans, for example, it can be calculated according to the Meeh-Rubner formula: Meeh-Rubner formula: A = k × (W ^{2 / 3} ) / 10,000.

Where A is the body surface area, calculated in m ² ; W is the body weight, calculated in g; K is a constant, which varies with the type of animal, in general, mouse and rat 9.1, guinea pig 9.8, rabbit 10.1, cat 9.9, Dog 11.2, monkey 11.8, human 10.6. It should be understood that the conversion of the administered dose can be changed according to the difference of the drug and clinical situation and the evaluation of an experienced pharmacist.

As used herein, "pharmaceutically acceptable" ingredients are suitable for humans and / or mammals without excessive adverse side effects (such as toxicity, irritation, and allergies), that is, substances with a reasonable benefit / risk ratio. The term "pharmaceutically acceptable carrier" refers to a carrier for administration of a therapeutic agent, including various excipients and diluents.

The present invention provides a kit for inhibiting tumors or reducing tumor drug resistance. The kit includes antibodies and chemotherapy drugs (such as mitoxantrone, doxorubicin, bleomycin) that specifically inhibit SPINK1 Vegetarian, satraplatin, paclitaxel). More preferably, the kit further includes instructions for use to guide the clinician to use the medicine in a correct and reasonable manner.

For the convenience of administration, the combination of the antibody that specifically inhibits SPINK1 and chemotherapy drugs (such as mitoxantrone, doxorubicin, bleomycin, sabplatin, paclitaxel) or antibodies or chemotherapy drugs that exist independently of each other (Eg mitoxantrone, doxorubicin, bleomycin, sabplatin, paclitaxel) can be made into unit dosage form and placed in the kit. "Unit dosage form" refers to the preparation of the medicine into a dosage form required for single administration for the convenience of taking, including but not limited to various solid agents (such as tablets), liquid agents, capsules, and sustained-release agents.

Application of prognostic evaluation of tumor after chemotherapy

Based on the above-mentioned new findings of the present inventors, SPINK1 can be used as a marker for prognostic evaluation in the post-chemotherapy stage of tumor: (i) disease classification, differential diagnosis, and / or disease-free survival analysis in post-chemotherapy stage of tumor; ii) Evaluate the tumor treatment drugs, drug efficacy, prognosis of the relevant population, and select appropriate treatment methods. For example, people with abnormal expression of the SPINK1 gene in the tumor microenvironment, especially in stromal cells, can be isolated for more targeted treatment.

The prognosis of the tumor of the subject who provided the sample to be evaluated can be predicted by judging the expression or activity of SPINK1 in the sample to be evaluated (stromal cells), and selecting a suitable drug for treatment. Generally, a threshold of SPINK1 can be specified. When the expression of SPINK1 is higher than the specified threshold, consider using SPINK1 suppression treatment. The threshold is easily determined by those skilled in the art. For example, the expression of SPINK1 in the microenvironment of normal human tissues can be compared with the expression of SPINK1 in the microenvironment of tumor patients to obtain abnormal expression of SPINK1 Threshold.

Therefore, the present invention provides the use of SPINK1 gene or protein for preparing reagents or kits for tumor prognosis evaluation. Various techniques known in the art can be used to detect the presence or expression of the SPINK1 gene and these techniques are all included in the present invention. For example, existing techniques such as Southern blotting, Western blotting, DNA sequence analysis, PCR, etc., can be used in combination. The invention also provides reagents for detecting the presence or absence and expression of SPINK1 gene in analytes. Preferably, when performing gene-level detection, primers that specifically amplify SPINK1 may be used; or probes that specifically recognize SPINK1 to determine the presence or absence of the SPINK1 gene; when performing protein-level detection, specificity may be used The antibody or ligand of the protein encoded by SPINK1 is combined to determine the expression of SPINK1 protein.

The kit can also include various reagents required for DNA extraction, PCR, hybridization, color development, etc., including but not limited to: extraction solution, amplification solution, hybridization solution, enzyme, control solution, display solution Color, lotion, etc. In addition, the kit can also include instructions for use and / or nucleic acid sequence analysis software.

Application of screening drugs

After learning that the expression of SPINK1 in stromal cells is regulated by NF-κB, it is possible to screen for substances that inhibit the transcriptional regulation of SPINK1 by NF-κB (NF-κB promotes SPINK1 transcription) based on this feature. From the said substances, drugs that are really useful for inhibiting tumors or reducing tumor resistance can be found.

Therefore, the present invention provides a method for screening potential substances that inhibit tumors or reduce tumor resistance. The method includes: treating a system for expressing NF-κB and SPINK1 with a candidate substance, and NF- is present upstream of the gene encoding SPINK1 κB binding site; and detection of the regulatory effect of NF-κB on SPINK1 in the system; if the candidate substance statistically inhibits the transcriptional regulation of SPINK1 by NF-κB, it indicates that the candidate substance inhibits or reduces tumors Potential substances for drug resistance. In the preferred mode of the present invention, in the screening, in order to more easily observe the transcriptional regulation of SPINK1 by NF-κB and the change of the expression or activity of SPINK1, a control group may also be set, and the control group may not be added The expression system of the candidate substance.

After learning that the functional impact of SPINK1 on the tumor microenvironment (especially stromal cells) on tumor cells is mainly controlled by EGFR and its downstream signaling pathways, it is possible to screen for inhibitory signals of SPINK1 on EGFR based on this feature The activated substance of the pathway. From the said substances, drugs that are really useful for inhibiting tumors or reducing tumor resistance can be found.

Therefore, the present invention provides a method for screening potential substances that inhibit tumors or reduce tumor resistance. The method includes: treating an expression system with candidate substances that expresses EGFR-mediated signaling pathways and SPINK1; and detection In the system, SPINK1 activates the EGFR-mediated signaling pathway; if the candidate substance statistically inhibits the activation, it indicates that the candidate substance is a potential substance that inhibits tumors or reduces tumor resistance. In a preferred mode of the present invention, when performing screening, in order to more easily observe the activation effect of SPINK1 on the EGFR-mediated signaling pathway and changes in the expression or activity of SPINK1, a control group may also be provided, and the control group may It is an expression system that does not add the candidate substance.

As a preferred mode of the present invention, the method further includes: performing further cell experiments and / or animal experiments on the obtained potential substances to further select and determine substances that are truly useful for inhibiting tumors or reducing tumor drug resistance.

The present invention is further described below in conjunction with specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods that do not indicate specific conditions in the following examples are generally based on the conditions described in J. Sambrook et al., Molecular Cloning Experiment Guide, Third Edition, Science Press, 2002, or according to the manufacturer The recommended conditions.

Materials and Method

1. Cell culture

(1) Cell line maintenance

Normal human-derived primary prostate stromal cell line PSC27 and human-derived primary breast stromal cell line HBF1203 (both obtained from the Fred Hutchinson Cancer Research Center in the United States) were propagated and passaged in PSCC complete culture medium. Benign prostate epithelial cell lines BPH1, prostate cancer epithelial cell lines M12, DU145, PC3, LNCaP and VCaP, breast cancer epithelial cell lines MCF-7, MDA-MB-231, MDA-MB-468, T47D and BT474 (purchased from ATCC ) Both were cultured in 5% FBS RPMI-1640 complete culture medium in an incubator at 37 ° C and 5% CO ₂ .

(2) Cell cryopreservation and recovery

a cell cryopreservation

Collect cells in logarithmic growth phase with 0.25% trypsin, centrifuge at 1000 rpm for 2 min, discard the supernatant, and resuspend the cells in a freshly prepared cryopreservation solution. Dispense cells into labeled sterile cryovials. Then cool down by gradient (4 ℃ 10min, -20 ℃ 30min, -80 ℃ 16 ～ 8h), and finally transfer to liquid nitrogen for long-term storage.

b cell resuscitation

Remove the frozen cells in liquid nitrogen and immediately put them in a 37 ° C water bath to quickly melt them. Add 2ml of cell culture solution directly to suspend the cells evenly. After the cells adhere to the wall, replace with new culture medium.

(3) In vitro experimental treatment

To cause cell damage, when the PSC27 cells grow to 80% (referred to as PSC27-Pre), 100nM docetaxel (DTX), 100nM paclitaxel (PTX), and 200nM vincristine (VCR) are added to the culture medium. 50 μg / ml bleomycin (BLEO), 1 μM mitoxantrone (MIT), 10 uM satraplatin (SAT) or 10 Gy ¹³⁷ Cs ionizing radiation (γ-radiation at 743 rad / min, RAD). After 6 hours of drug treatment, the cells were washed briefly with PBS three times, and left in the culture medium for 7 to 10 days, and then the subsequent experiments were carried out.

2. Plasmid preparation and lentivirus transfection

The full-length human SPINK1 was cloned between the lentiviral expression vector pLenti-CMV / To-Puro-DEST2 (Invitrogen) restriction sites BamHI and XbaI. The packaging line 293FT is used for cell transfection and lentivirus manufacturing.

The small hairpin RNAs (shRNAs) sense strands used to knock out SPINK1 are GAAGAGAGGCCAAATGTTATTCAAGAGATAACATTTGGCCTCTCTTCTTT (SEQ ID NO: 2) and CCAAGATATATGACCCTGTTTCAAGAGAACAGGGTCATATATCTTGGTTTTT (SEQ ID NO: 3).

3. Immunofluorescence and histochemical analysis

Mouse monoclonal antibody anti-phospho-Histone H2A.X (Ser139) (clone JBW301, Millipore) and mouse monoclonal antibody anti-SPINK1 (Cat # H00006690-M01 (clone 4D4), Abnova), and secondary antibody Alexa

488 (or 594) -conjugated F (ab ') _{2 was} added to the slides covered with fixed cells in order. The nuclei were counterstained with 2μg / ml of 4 ', 6-diamidino-2-phenylindole (DAPI). Select the most representative one of the three observation fields for data analysis and result display. The FV1000 laser scanning confocal microscope (Olympus) was used to acquire confocal fluorescence images of cells.

The SPINK1 antibody used in the IHC staining of clinical prostate cancer, breast cancer and colorectal cancer patients was the same as that purchased from Abnova. The specific steps are as follows: conventional dewaxing, incubation with 0.6% H2O2 methanol at 37 ° C for 30min, then repair with 0.01M pH6.0 citrate buffer for 20min, and cooling at room temperature for 30min. Block with normal goat serum for 20 min, incubate with SPINK1 primary antibody (1: 200) at 37 ℃ for 1h, and move to 4 ℃ refrigerator overnight. The next day, it was washed three times with TBS, incubated with a secondary antibody (HRP-conjugated goat anti-rabbit) at 37 ° C for 45 min, washed with TBS three times, and finally developed with DAB.

4. Matrix-epithelium co-culture and in vitro experiments

PSC27 cells were cultured with DMEM + 0.5% FBS medium for 3 days, and then washed with 1 times PBS to wash the full abundance of the cell population. After simple centrifugation, the supernatant was collected and stored as conditioned medium at –80 ° C or used directly. Prostate epithelial cells were continuously cultured in this conditioned medium for 3 days to carry out in vitro experiments. For chemotherapy resistance, epithelial cell lines are cultured in low serum DMEM (0.5% FBS) (referred to as "DMEM"), or conditioned medium, while mitoxantrone (MIT) is used to treat cells for 1 to 3 days, The concentration was close to the IC ₅₀ value of each cell line, and then observed under a bright field microscope.

5. Genome-wide expression microarray analysis (Agilent expression microarray)

For the procedures and methods of the genome-wide expression chip (4x44k) analysis of the normal human primary prostate stromal cell line PSC27, see Sun, Y. et al., Nat. Med. 18: 1359-1368).

6. Quantitative PCR (RT-PCR) to determine gene expression

The total RNA of growing cells was extracted with Trizol reagent to perform reverse transcription reaction. The reverse transcription reaction product cDNA was diluted 50 times as a template, and RT-PCR was performed.

After the reaction is completed, the analysis of the amplification of each gene is analyzed through the software, the corresponding threshold cycle number is derived, and the relative expression level of each gene is calculated using the 2-ΔΔCt method. The peaks and waveforms of the melting curve are analyzed to determine whether the amplified product is a specific single-purpose fragment.

7. Analysis of NF-κB regulation

The antiviral vector pBabe-Puro-IκBα-Mut (superrepressor) containing the two IKK phosphorylation mutation sites S32A and S34A on the IκBα protein sequence was used to transfect the lentiviral packaging cell line PHOENIX. The lentivirus was then used to infect the PSC27 stromal cell line, and 1 μg / ml puromycin was used to screen positive clones. As another method, a 5 μM small molecule inhibitor Bay 11-7082 (available from Selleck) was used for NF-κB activity control. The stromal cells were subsequently exposed to several different forms of cytotoxicity, and the resulting phenotypes were recorded in time to analyze the expression of related genes. The cells treated in this way, the conditioned medium produced is collected and used for various detections of epithelial cells.

8. SPINK1 promoter analysis and Chromosome immunoprecipitation (ChIP) detection

The human SPINK1 gene (Gene ID 6690, Genbank accession NM_001354966.1) was analyzed using software CONSITE to discover potential core NF-κB binding sites. In the ChIP-PCR experiment, four pairs of PCR primers were designed to amplify the core near the NF-κB binding region of the SPINK1 promoter: sequence: primer # 1 (-482 ～ -259): forward 5'-CTACTGAAATCACAGTGAAGTATAG-3 '(SEQ ID NO: 4), reverse 5'-CTGTTCATTGCATCCTGCTAT-3 '(SEQ ID NO: 5); primer set # 2 (-1870 ～ -1625): forward 5'-GACCAGTCTGGCCAACATGG-3' (SEQ ID NO: 6) , Reverse 5'-CCTCATGCTGTATGTTAGATATTCAGAC-3 '(SEQ ID NO: 7); primer set # 3 (-1917 ～ -1773): forward 5'-TACTTTGGGAGGCCGAGGCAG-3' (SEQ ID NO: 8), reverse 5 '-CTCCCGAGTAGCTGGGATTACAGG-3' (SEQ ID NO: 9); primer # 4 (-4000 ～ -3798): forward 5'-TTTAAGAACCTACTATGTGTTTGG-3 '(SEQ ID NO: 10), reverse 5'-GAAACTCTTGGACACTTTG AG -3 '(SEQ ID NO: 11). At the same time, another two pairs of primers were designed to amplify IL-6: forward 5'-AAATGCCCAACAGAGGTCA-3 '(SEQ ID NO: 12), reverse 5'-CACGGCTCTAGGCTCTGAAT-3' (SEQ ID NO: 13) and IL8: forward 5'-ACAGTTGAAAACTATAGGAGCTACATT-3 '(SEQ ID NO: 14), reverse 5'-TCGCTTCTGGGCAAGTACA-3' (SEQ ID NO: 15) promoter sequence (all known positive controls). ChIP analysis was performed on early passage PSC27 cells (such as p8) and PSC27 cells treated with bleomycin (50ug / ml). The chromosomes fixed in vitro were settled using mouse monoclonal antibody anti-p65antibody (F-6, Santa Cruz), and DNA was extracted for amplification. Reporter expression vectors carrying multiple NF-κB binding site mutations are designed and generated by the site-directed mutagenesis (Stratagene) method. In addition, it covers multiple NF-κB binding sites and the optimized IL-2 minimum promoter as the reporting vector for NF-κB activated transgenic system (NAT system) NAT11-Luc2CP-IRES-nEGFP (Dr. Hatakeyama friendship of Hokkaido University, Japan Provided), used as a positive control in the experiment. Each reporter vector was co-transfected with pRL-TK vector (Addgene) for signal standardization.

9. Obtain and analyze tissue samples of clinical prostate cancer, breast cancer and colorectal cancer patients

The chemotherapy regimen is based on patients with castration-resistant prostate cancer (clinical trial registration number NCT03258320), patients with osmotic catheter breast cancer (clinical trial registration number NCT02897700) and patients with non-metastatic colorectal cancer (clinical trial registration number NCT00643877) Pathological characteristics are specified. Patients with a clinical stage of primary cancer above I subtype A (IA) (T1a, N0, M0) but no obvious distant metastatic lesions were recruited into the clinical cohort. At the same time, patients aged 40-75 years who were clinically diagnosed with PCa, or those older than 18 years who had been confirmed to have osmotic BCa by tissues, and patients younger than 75 years who were clinically diagnosed with CRC were recruited. All patients were provided with informed consent and signed for confirmation. Data on tumor size, tissue type, tumor penetration, lymph node metastasis, and pathological TNM disease stage were obtained from the pathology recording system. Tumors were processed into FFPE samples and processed into histological sections for evaluation. OCT frozen sections were selectively separated by LCM and used for gene expression analysis. In particular, gland-associated stromal cells before and after chemotherapy were isolated by LCM. Immune activity scores (IRS) are classified into 0-1 (negative), 1-2 (if), 2-3 (medium), and 3-4 (strong) according to histochemical staining of each tissue sample. Category (Fedchenko and Reifenrath, 2014). The randomized controlled trial (RCT) protocol and all experimental procedures are approved and authorized by the IRB of Shanghai Jiaotong University School of Medicine, and are gradually carried out according to authoritative guidelines.

10. Mouse transplantation tumor test and pre-clinical chemotherapy procedure

ICR / SCID mice (about 25g in weight) of immunodeficient mice aged about 6 weeks are used in the animal experiments related to the present invention. The stromal cells PSC27 and epithelial cells are mixed in a ratio of 1: 4, and each graft contains 1.25 × 10 ⁶ cells for tissue reconstruction. The transplanted tumors were implanted into mice by subcutaneous transplantation, and the animals were euthanized 8 weekends after the transplantation. The tumor volume is calculated according to the following formula: V = (π / 6) x ((l + w) / 2) ³ (V, volume; l, length; w, width). Similarly, breast cancer xenografts are formed by MDA-MB-231 (triple negative, highly malignant breast cancer cell line) and HBF1203 (breast fibroblast cell line) through tissue remodeling.

In the pre-clinical chemotherapy trial, mice subcutaneously transplanted were given standard experimental diets, and the chemotherapy drugs mitoxantrone (0.2 mg / kg dose) or doxorubicin (1.0 mg / kg dose) were administered intraperitoneally after 2 weeks . At the same time, the FDA approved therapeutic antibody Cetuximab (10.0 mg / kg dose, 200 μl / dose) or SPINK1 mAb (10.0 mg / kg dose, 200 μl / dose) after strict purification was administered intravenously as a single or double agent. The time point was the first day of the 3rd, 5th, and 7th weeks. There were 3 cycles of drug administration throughout the course of treatment, and each cycle was 2 weeks. After the course of treatment, the mouse kidneys were collected for tumor measurement and histological analysis. Each mouse received cumulatively mitoxantrone 0.6 mg / kg body weight, or doxorubicin 3.0 mg / kg body weight. The chemotherapy experiment was carried out until the end of the 8th week. The mice were dissected immediately after sacrifice, and the transplanted tumors were collected and used for pathological analysis. Part of the mice 7 days after the administration was used for histochemical evaluation of the caspase 3 activity at the tissue level.

During the course of chemotherapy, the mice were weighed once a week; after the completion of chemotherapy as a whole, the mice were weighed again and their blood was collected by cardiac puncture and placed in an ice bath for 45 minutes. Peripheral blood was immediately centrifuged at 8000 rpm for 10 minutes at 4 ° C, and about 50 μl was sucked by the VetTest pipette tip for detection by the IDEXX VetTest 8008 chemical analyzer. Liver function measurement items include creatinine, urea, alkaline phosphatase and alanine aminotransferase.

11. Biostatistical methods

All the in vitro experiments involving cell proliferation rate, migration, invasiveness and survivability in the application of the present invention and the in vivo experiments on mouse transplanted tumor and chemotherapy treatment were repeated more than 3 times, and the data are presented in the form of mean ± standard error. Statistical analysis is based on the original data, through two-tailed Student's test, one-or two-way ANOVA, Pearson's correlation coefficient test, Kruskal-Wallis, log-rank test, Wilcoxon-Mann-Whitney test or Fisher's express The test is calculated, and the result of P <0.05 is regarded as a significant difference.

Example 1. Genotoxic drugs can induce high expression of SPINK1 in human stromal cells

Recently, the inventors have noticed that the human prostate stromal cell line PSC27 (mainly composed of fibroblasts), after being treated with cytotoxic, especially genotoxic chemotherapy drugs or ionizing radiation, will generate a large amount of SASP factors, and SPINK1 appears to upregulate the expression amplitude Among the highest group of proteins (Figure 1). In order to verify this phenomenon and expand the scope of research, the inventors subsequently used a set of DNA-damaging drugs, including mitoxantrone (MIT), sabplatin (SAT), gamma rays (RAD), doxorubicin (DOX) Treat stromal cells with Bleomycin (BLEO). In vitro experiments showed that the cells exhibited significantly increased DNA damage focus (γH2AX), increased galactosidase (SA-β-Gal) activity and decreased DNA synthesis (BrdU intercalation) (Figures 2, 3, 4), suggesting Typical cell cycle arrest and cell senescence occur. Subsequent testing demonstrated that SPINK1 at both transcript and protein levels increased significantly in response to multiple genotoxicities (Figure 5). Interestingly, the expression pattern of SPINK1 in stromal cells is very similar to several other SASP markers such as MMP1, WNT16B, SFRP2 and MMP12, that is, the expression level gradually increases after the cells are damaged by drugs until The cells reached a plateau after 7-10 days and maintained a secreted state for a long time (Figure 6).

After analyzing the expression of SPINK1 in several prostate-derived cell lines, the inventors found that stromal cells are more inducible than epithelial cells (Figures 7 and 8), suggesting that stromal cells may have a drive for SPINK1 Molecular mechanism of high expression in the context of DNA damage. This significantly different molecular feature of stromal-epithelial cells was subsequently confirmed by a group of human breast-derived cell lines, including the stromal cell line HBF1203 and several epithelial cancer cell lines with different malignant degrees, indicating that SPINK1 expression has tissue And non-specific organ types (Figures 9-14).

Next, the inventors investigated whether the expression of SPINK1 in stromal cells would cause senescence and other effects on the mechanism cells themselves. Prostate and breast stromal cell lines (PSC27 ^SPINK1 and HBF1203 ^SPINK1 ) overexpressing SPINK1 after lentivirus transfection were evaluated, but it was found that regardless of DNA damage response, lysosomal activity, DNA synthesis rate, and cell proliferation potential There was no change, and the organ origin was non-specific (Figure 15-17). It is worth noting that a protein of the same family as SPINK1, namely human epidermal growth factor EGF, did not undergo significant changes in protein levels after SPINK1 overexpression (Figure 15). The above data indicates that SPINK1 expression is one of the results of cell aging, rather than the stimulating factor that causes cell aging.

Example 2. The expression of SPINK1 in the tumor microenvironment is significantly negatively correlated with the survival of patients after chemotherapy

The results of in vitro experiments prompted the inventor to continue to think about whether SPINK1 expression will also appear in the tumor microenvironment. The inventors studied a cohort of patients undergoing clinical chemotherapy because they were diagnosed with prostate cancer, and were surprised to find that these patients generally experienced a significant upregulation of SPINK1 in tumor tissues after treatment, but not before (Figure 18). Consistent with the in vitro experimental data, the expression of SPINK1 in tissues is concentrated in the stromal cells around the glands instead of the epithelial cells in the glands (Figure 18).

Compared with pre-chemotherapy, SPINK1 is highly expressed in tumors after chemotherapy. It is a pre-established pathological detection system that can quantitatively evaluate its expression level in tissues according to the histochemical staining intensity of specific proteins. Analysis and further determination (Figure 19). After the microscopic technique of laser capture microdissection, the inventors found that SPINK1 in tissues is more inclined to induce inducible expression in stromal cell populations rather than epithelial cell populations (FIG. 20). In order to confirm the drug-inducibility of SPINK1, the inventors selected a group of patients whose tissue samples were obtained and saved before and after chemotherapy, and found that in any of them, SPINK1 stromal cells instead of epithelia after chemotherapy Highly expressed in cells (Figure 21). The inventors further noticed that the expression of SPINK1 in the microenvironment destroyed by drugs basically showed a parallel relationship with the stromal cell SASP characteristic factors IL-8 and WNT16B (Figure 22). In the damaged tumor microenvironment, the relationship between SPINK1 and IL-8 and WNT16B was confirmed by the pathological evaluation of these factors in patients after chemotherapy (Figure 23-24). More importantly, according to the large data obtained by the pathological grading of SPINK1 in the tumor stromal body of the patient, it shows that the expression level of SPINK1 in the stromal tissue has a significant negative correlation with the disease-free survival of patients after treatment (Figure 25).

As supporting evidence, this series of pathological features of SPINK1 was repeated and confirmed in a subsequent set of expanded studies covering breast cancer patients and colorectal cancer patients (Figures 26-33). The research data of the present inventors suggest that the expression of SPINK1 in tumor stromal tissues can be used as an independent predictor related to SASP and used for stratification of patients with risk factors related to disease recurrence and clinical mortality in the post-treatment period; The formation in the matrix may have important pathological significance.

Example 3. The expression of SPINK1 in stromal cells is regulated by transcription factors such as NF-kB

Then, the inventors studied the expression mechanism of SPINK1 in damaged stromal cells. As the key transcription machinery for regulating the expression of SASP in mammalian cells, the NF-κB complex plays an important role in the process of cell senescence caused by oncogene induction or therapeutic injury. First consider whether NF-κB mediates the expression of SPINK1 in stromal cells after DNA damage. The analysis revealed that there were several NF-κB binding sites in the 4000 bp upstream of SPINK1 (Figure 34), and subsequent fluorescence detection based on the reporter vector confirmed the importance of these several sites.

Compared with the control group 293T or PSC27 cells, the TNF-α stimulated or BLEO-treated experimental group showed a significantly increased SPINK1 promoter transcription activity (Figure 35, 36). The following ChIP-PCR results confirmed that all four sites were true NF-κB binding sites after DNA damage (Figure 37). Experiments based on the NF-κB functionally deficient cell line (PSC27 ^IκBα ) have shown that loss of nuclear translocation activity of NF-κB can lead to a significant reduction in SPINK1 transcription levels (Figure 38).

Transcription factors have been reported to participate in the expression of SASP factors, such as C / EBP and AP-1, but their role in SPINK1 expression is not yet clear. To this end, the inventors used betulinic acid (BA), which is a C / EBP family inhibitor, and T-5224, which is an AP-1 selective inhibitor, to separately treat PSC27 cells that were pretransduced with the SPINK1 promoter reporter vector. . After the DNA damage treatment, the fluorescent signal of the report vector increased significantly, and Bay11-7082, an NF-κB inhibitor, can basically abolish the generation of these signals (Figure 39). Although the treatment of BA or T-5224 can reduce the fluorescent signal of the report carrier, their reduction is significantly lower than that caused by Bay 11-7082 (Figure 39). Further experimental results showed that NF-κB inhibition, rather than C / EBP or AP-1 blockade, can cause a significant decrease in SPINK1 transcription levels (Figure 40). This expression characteristic of SPINK1 is similar to the two characteristic factors of SASP, IL-6 and IL-8, although the transcription of the latter two is mainly mediated by NF-κB and C / EBP, not AP-1 ( (Figure 40).

Overall, the expression of SPINK1 in stromal cells under genotoxic background is mainly regulated by NF-κB. At the same time, based on the regulatory effect of NF-κB on SPINK1, drugs that inhibit tumors by affecting the interaction between the two can be screened. Some drugs that can inhibit or prevent the interaction of the two may potentially be beneficial to tumor treatment.

Example 4. The functional impact of SPINK1 on cancer cells is mainly controlled by EGFR and its downstream signaling pathways

Compared with previous studies on SPINK1 in diseases such as prostate cancer, the main focus is on the autocrine action of this factor. The inventors then focused on whether stromal cell-derived SPINK1 exerts an effect on the recipient cells through the paracrine pathway. First, after knocking out SPINK1 in stromal cells, the expression of soluble factors such as EGF and the occurrence of senescence of stromal cells did not cause significant changes (Figure 41). In contrast, the conditioned medium (CM) produced by PSC27 cells overexpressing SPINK1 (PSC27 ^SPINK1 ) can have a significant effect on a range of prostate epithelial cancer cells such as PC3, DU145, LNCaP and M12, including upregulated proliferation Rate, mobility and invasiveness (Figures 42-44). However, this series of malignant features was significantly reversed after SPINK1 was knocked out of stromal cells (Figure 42-44). More importantly, SPINK1 significantly increased the resistance of prostate cancer cells to the clinical chemotherapy drug mitoxantrone (MIT) (Figure 45). Further research found that MIT induces apoptosis by causing caspase 3 cleavage in cells, but this process can be significantly weakened by SPINK1, and SPINK1 knocked out of stromal cells can restore this effect of MIT ( Figure 46). To confirm this finding, the inventors subsequently used QVD-OPH and ZVAD-FMK, two broad-spectrum caspase 3 inhibitors, and PAC1 and gambogic acid (GA), two caspase 3 activators, to treat cells at MIT, respectively Previously used for cell culture. The inventors found that the degree of apoptosis was significantly reduced in the presence of QVD-OPH or VAD-FMK, even if SPINK1 was used to culture cancer cells (FIG. 47). However, when PAC1 or GA were added to the cell culture medium, the apoptosis index increased significantly, which basically offset the anti-apoptotic effect of SPINK1 (Figure 47). This finding was later confirmed by another chemotherapy drug, paclitaxel (DOC), although the latter mainly plays a role in inducing apoptosis by interfering with the depolymerization of cellular microtubules. Therefore, SPINK1 is mainly through the inhibition of caspase3 mediated apoptosis, resulting in the resistance of cancer cells to various chemotherapy drugs.

Since SPINK1 shares about 50% sequence homology with EGF, the inventors first determined the effect of SPINK1 as an EGF analog growth factor on cancer cell signaling pathways. After using SPINK1 highly expressed stromal cells (PSC27 ^SPINK1 ) to generate cancer cells, the inventors found that the latter showed multiple protein molecule changes, mainly including EGFR (Y845), Akt (S473) and mTOR (S2448), etc. Phosphorylation at the site implies activation of PI3K / Akt / mTOR signaling pathway mediated by SPINK1 (Figure 48). Furthermore, phosphorylation of Erk (T202 / Y204) and Stat3 (S727) indicates the activation of MAPK meridian in these cells. It is worth noting that the expression level of EGF in cancer cells has not changed significantly, even in the presence of SPINK1, so it can be ruled out that cancer cells undergo signal pathway changes through the adjustment of EGF autocrine (Figure 48). To determine whether EGFR plays a major mediating role in the process of SPINK1 affecting cancer cell activation, the inventors used AG-1478, an RTK inhibitor, to treat recipient cancer cells. Interestingly, in the presence of AG-1478, the phosphorylation of EGFR and multiple downstream molecules induced by SPINK1 was abolished, including the Akt / mTOR and Erk / Stat3 signal axes. Therefore, the phenotype change of cancer cells caused by SPINK1 is mainly achieved through the activation of EGFR-mediated signaling pathways, although the participation of other receptor molecules in this process cannot be ruled out. As supporting evidence, after SPINK1 was knocked out of stromal cells, the activation of this series of signaling pathways of cancer cells basically disappeared (Figure 49), further confirming that SPINK1 caused the activation of multiple downstream signaling pathways through EGFR receptors. To determine the interaction between SPINK1 and EGFR, the inventors conducted IP experiments using SPINK1 specific antibodies. The results show that there is a physical direct interaction between the two molecules of SPINK1 and EGFR, and the IP signal can be easily found in cancer cell samples treated with PSC27 ^SPINK1 instead of PSC27 ^Vector CM (Figure 50).

Next, the inventor asked another key question, whether SPINK1 plays a central role in the process of SASP driving cancer cell malignant progression. For this purpose, the inventors constructed the PSC27-shRNA ^SPINK1 stability subline and collected its CM after DNA damage treatment. The inventors noticed that after SPINK1 was knocked out, the senescence of cells that PSC27 originally appeared under DNA damage conditions was neither delayed nor accelerated, and the SA-β-Gal positive rate was unchanged (Figure 51). When the CM produced by PSC27-BLEO cultured cancer cells, the latter's proliferation rate, migration rate and invasiveness were significantly increased, and the knockout of SPINK1 from stromal cells can greatly reduce the increase in this series of malignant phenotypes (Figures 52, 53).

The present inventors found that after SPINK1 was knocked out, the resistance of prostate cancer cells conferred by PSC27-BLEO to mitoxantrone significantly decreased (FIG. 54). Similarly, under the culturing conditions of PSC27-BLEO CM, the drug resistance of cancer cells treated by the EGFR inhibitor AG-1478 was also significantly reduced (Figure 55). To confirm the key role of SPINK1 in the SASP broad-spectrum factor, the inventors used Cetuximab, a monoclonal antibody that specifically approved by the FDA to specifically inhibit EGFR in the clinic. The inventors found that Cetuximab can significantly down-regulate the drug resistance of stromal cells to cancer cells, and the effect is close to AG-1478 (Figure 54). Since the targeting molecules of Cetuximab and AG-1478 are both EGFR, the inventors reasoned whether direct targeting and control of SPINK1 in the microenvironment could achieve more effects. After a lot of analysis and screening, the inventors obtained a mouse monoclonal antibody SPINK1mAb (accession number is CCTCC NO: C2018213) through the method of hybridoma screening, which can achieve very ideal results in the drug resistance control experiment of cancer cells. Cancer cell removal efficiency is even higher than AG-1478 or Cetuximab (Figure 55). Furthermore, the inventors used both SPINK1 mAb and Cetuximab to treat cancer cells under culture conditions, and found that the results were the same as when SPINK1 mAb was used alone (Figure 55). Higher anti-cancer efficiency. Although PSC27-BLEO CM can make PC3 show acquired resistance to MIT (dose range 0.1 ~ 1.0 μM) in a series of in vitro experiments, the SPINK1 mAb-mediated clearance of SPINK1 makes this resistance significantly weakened, The effect is close to that when SPINK1 mAb and Cetuximab are used together (Figure 56). In the subsequent in vitro experiments on breast cancer, the inventors observed an essentially similar phenomenon (Figure 57). Therefore, by targeting EGFR, which is one of the receptors on the surface of cancer cells, and directly controlling SPINK1 derived from stromal cells, the practical purpose of reducing the acquired resistance of cancer cells can be achieved.

Example 5. Targeting SPINK1 in vivo can delay tumor progression and increase tumor sensitivity to chemotherapy drugs

The broad-spectrum expression of microenvironment SASP in the clinical anticancer process can accelerate many malignant events, including tumorigenesis, local inflammation and therapeutic resistance. However, whether this trend toward malignancy can be controlled by specifically controlling the core factors of SASP in the microenvironment, and how to effectively inhibit SASP in the in vivo microenvironment activated by anti-cancer therapies have always been a problem in the scientific community. In order to simulate clinical conditions as much as possible, the inventors inoculated a subpopulation of immunodeficient mice with a mixed cell population of PSC27 and PC3, and after 8 weeks, the inventors stopped the experiment and analyzed. As a result, it was found that when the stromal cells expressed the exogenous factor SPINK1, the terminal volume of the tumor increased significantly, but after SPINK1 was knocked out from the stromal cells, it decreased significantly (Figure 58). In addition, the inventors designed a set of pre-clinical treatment strategies for simulating clinical anti-cancer treatment regimens, that is, an 8-week chemotherapy regimen for tumor-bearing mice, the latter including 3 determinations based on a series of pre-experimental data Monotherapy or dual therapy (Figure 59, Figure 60). Compared with the control group, the tumor volume of mice inoculated with PSC27 ^SPINK1 increased significantly, but the tumor volume formed under the screening pressure caused by the intraperitoneal administration of the chemotherapy drug mitoxantrone was significantly reduced, proving that chemotherapy itself can effectively block tumor development. (Figure 61). However, compared with the tumors of the control group (PSC27 ^Vector mice), the tumors of PSC27 ^SPINK1 residual mice still increased significantly, suggesting the pathological role of the microenvironment throughout the chemotherapy.

After the stromal cells and cancer cells were separated by laser capture microdissection technology, the present inventors found that these two cells in the microenvironment showed a great difference in expressing typical SASP exocrine factors. A group of SASP classic factors including IL-8, WNT16B, SPINK1, MMP3, AREG and ANGPTL4 are widely up-regulated in stromal cells, although cancer cells also show enhanced expression of AREG and ANGPTL4; meanwhile, p16 / p21 and other cell aging symbols Sexual CDK inhibitors showed a significant increase in both epithelial cells and stromal cells (Figure 62), suggesting the trend of cell senescence and SASP development under in vivo conditions.

The present inventors confirmed the obvious expression of SPINK1 in tumor tissue under pre-clinical treatment conditions by histochemical staining (FIG. 63). In order to verify the results of in vitro experiments, the inventors then used Cetuximab or SPINK1 mAb in combination with mitoxantrone. In the group of mice inoculated with PC3 cells only, although mitoxantrone alone can significantly reduce tumor volume (40.5%), the concurrent administration of Cetuximab therapeutic antibody did not further reduce the mass (Figure 64), suggesting PC3 Tumors basically progress in a microenvironment independent of the EGF / EGFR signal axis. When the stromal cells PSC27 and cancer cells PC3 were co-inoculated into mice, the terminal volume of the tumor rose to 149.0%, again confirming the stromal cell's tumor-promoting potential. When PC3 / PSC27 mice were treated with mitoxantrone, the tumor volume decreased by 44.9%; after combined treatment with Cetuximab or SPINK1 mAb and mitoxantrone, the tumor volume further decreased by 34.6% and 46.3% (Figure 64) ; The efficacy of Cetuximab as a therapeutic monoclonal antibody has been understood, and SPINK1 mAb is significantly more desirable than Cetuximab and the effect is particularly unexpected.

At the same time, the present inventors used the PC3 cell line (PC3-luc) expressing luciferase and found that the relative intensity of the bioluminescence signal detected under the conditions in mice in vivo among the animals in each group was similar to the tumor terminal detected above. The volume basically corresponds, and the possibility of ectopic organ metastasis in cancer cells is excluded (Figure 65). This series of data shows that compared with traditional chemotherapy itself, SPINK1 monoclonal antibody-mediated targeted therapy combined with genotoxic chemotherapy can cause a more significant tumor response; specific targeting of SPINK1 monoclonal antibody can even reach a significantly higher Due to the efficiency of Cetuximab, an RTK-targeted preparation, although the latter has been used clinically to treat EGFR ⁺ cancer patients and has achieved good results for many years.

In order to further analyze the mechanism of cancer cell resistance caused by SPINK1 under in vivo conditions, the inventors dissected mice after 7 days of administration and obtained tumors for pathological analysis. Although Cetuximab itself does not cause DNA damage response (DDR), PC3 tumors show obvious apoptosis, which may be related to the high affinity between Cetuximab and EGFR, which can reduce the survival rate of cancer cells (Figure 66). However, Cetuximab after being combined with mitoxantrone did not further increase the apoptosis rate of cancer cells, suggesting that the cytotoxicity of Cetuximab is limited when synergized with mitoxantrone. The important thing is that SPINK1 mAb produced a more significant therapeutic effect than Cetuximab (Figure 66). The results of histochemical staining showed that under the condition that SPINK1 mAb was used, caspase 3 showed more obvious cleavage. In addition, ELISA test results showed that mitoxantrone can cause a significant increase in SPINK1 protein levels in the plasma of mice, but it can be significantly controlled when SPINK1 mAb is administered simultaneously (Figure 67).

To further verify the above findings, the inventors further used LNCaP, another classic prostate epithelial cancer cell line, which was inoculated with PSC27 to form tumors under the skin of mice. Unlike PC3, LNCaP itself expresses the androgen receptor AR and exhibits androgen-dependent growth. In order to form the original state of the AR signaling pathway, the present inventors did not take castration treatment, but followed a series of steps in PC3 mouse pre-clinical experiments. Importantly, the terminal tumor volume of LNCaP / PSC27 mice decreased significantly after the combination of chemotherapeutic drugs and therapeutic antibodies (36.7%, cetuximb; 50.7%, SPINK1 mAb) (Figure 68). These results of the inventors show that the specific removal of SPINK1 from SASP broad-spectrum factors can effectively enhance the sensitivity of tumors to chemotherapy, and this process does not depend on androgen or AR signal axis.

Taking into account the characteristics of the solid tumor itself, the inventors then expanded the research to human breast cancer. After inoculating MDA-MB-231 cancer cells and HBF1203 breast-derived stromal cells subcutaneously in mice, the inventors found that MDA-MB-231 / HBF1203 tumors showed a trend very similar to the data of prostate cancer mice. On the basis of element, combined use of cetuximb further inhibited tumor volume by 26.6%, and combined use of SPINK1 mAb further inhibited tumor volume by 39.5%) (Figure 69). Therefore, the drug resistance antagonistic data caused by targeting SPINK1 indicates that controlling the effect of SPINK1 in the microenvironment on tumor treatment is organ-independent and a means applicable to a variety of solid tumors.

To determine the safety and feasibility of this treatment strategy, the inventors next conducted a pathophysiological evaluation of the experimental mice. The results showed that regardless of monotherapy or multi-drug treatment, the body weight of mice and various other indicators, including plasma levels of creatinine, urea, ALP and ALT, remained unchanged (Figure 70). At the same time, in breast cancer tumor-bearing mice, the inventors verified this effect (Figure 71). More importantly, in immunized intact mice (C57BL / 6), in addition to observing similar data above, the inventors also found that the number of blood cells of the animals did not change significantly (Figure 72). The results of this series of pre-clinical studies show that the combination of antibody therapy targeting SPINK1 and traditional chemotherapy can not only cause more significant tumor suppression effects, but also have higher drug safety and will not cause obvious in vivo toxicity.

Example 6. SPINK1 is a novel biomarker for judging the occurrence and development of SASP in patients under clinical conditions

The inventors then determined whether SPINK1 could be detected in cancer peripheral blood after clinical chemotherapy using conventional techniques. To this end, the inventors collected plasma samples of two groups of prostate cancer patients, including a group of patients undergoing chemotherapy and another group of patients without any treatment. After ELISA-based protein detection, the present inventors found that the level of SPINK1 in the blood of patients after chemotherapy was significantly higher than that of patients without chemotherapy (Figure 73). Interestingly, this trend is very similar to IL-8, a typical factor of SASP. In order to determine the relationship between these two factors, the inventors selected a group of patients with blood samples provided before and after chemotherapy, and found that there was a significant correlation between SPINK1 and IL-8 in these patients' plasma (r = 0.9443, P < 0.0001) (Figure 73). In another group of breast cancer clinical patients and a group of colorectal cancer patient samples, the inventors noticed that this phenomenon exists (Figures 74 and 75).

In order to gain further understanding, the inventors conducted a longitudinal analysis based on the patient's clinical specimens. In a group of primary cancer tissues and peripheral blood samples of prostate cancer patients, the inventors were surprised to note that the two SASP related factors SPINK1 and IL-8 can be clearly displayed on the Western blot, and only after chemotherapy A signal appeared in the patient's plasma sample (Figure 76). In addition, whether in solid tissue or plasma levels, there is a clear correlation between these two factors (Figure 77). To clarify SPINK1 and IL-8 as markers for detecting SASP status in vivo, the present inventors used laser capture microdissection technology to isolate stromal cells in the lesion tissue of prostate cancer patients and analyzed their transcript levels. The results showed that multiple SASP-related factors, including MMP1, CXCL3, IL-1β, WNT16B, IL-6 and GM-CSF, were closely related to SPINK1 and IL-8 in each patient tissue (Figure 78). In contrast, IL-2 / 3/5/12 equivalent SASP-independent factors do not have this feature. The research data of the present inventors show that SPINK1 can be used as a landmark factor reflecting the occurrence and development of SASP under clinical conditions in clinical patients, and used to evaluate the development status and dynamic characteristics of SASP in cancer patients at the post-chemotherapy stage. In addition, there is a significant negative correlation between the plasma SPINK1 protein level and the survival time of clinical patients after treatment (Figure 79), suggesting that SPINK1 is an exocrine factor released after irreparable damage to the patient's tumor microenvironment. , Can be used as an independent indicator for analyzing and judging the survival of patients after traditional chemotherapy (Figure 80-82), using SPINK1 as a conventional, non-invasive liquid biopsy marker can provide an accurate clinical medicine for the future , Convenient and efficient new diagnosis and prevention technology (Figure 83).

Biomaterial deposit

The hybridoma cell line SP2 / 0-01-SPINK1-SUN of the present invention is deposited at the Chinese Type Culture Collection (CCTCC, Wuhan, China), with the deposit number CCTCC NO: C2018213, and the deposit date is October 10, 2018.

All documents mentioned in the present invention are cited as references in this application, just as each document is individually cited as a reference. In addition, it should be understood that after reading the above teaching content of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the appended claims of the present application.

Claims (20)

1. A pharmaceutical composition for inhibiting tumors or reducing tumor drug resistance, characterized in that the pharmaceutical composition includes antibodies that specifically inhibit the serine protease inhibitor Kazal type 1 factor and chemotherapy drugs.
2. The pharmaceutical composition according to claim 1, wherein the chemotherapy drugs are genotoxic drugs; preferably, the chemotherapy drugs include: mitoxantrone, doxorubicin, bleomycin, Saplatin, cisplatin, carboplatin, daunorubicin, nogamycin, arubicin, epirubicin, doxorubicin, cytarabine, capecitabine, gemcitabine, 5-fluorouracil.
3. The pharmaceutical composition according to claim 2, characterized in that it comprises:

   Antibodies that specifically inhibit serine protease inhibitor Kazal type 1 factor and mitoxantrone, and the mass ratio of the two is 1: 0.005 to 1: 2.0;

   Antibodies that specifically inhibit serine protease inhibitor Kazal type 1 factor and doxorubicin, with a mass ratio of 1: 0.02 to 1: 1.5;

   Antibodies that specifically inhibit serine protease inhibitor Kazal type 1 factor and bleomycin, and the mass ratio of the two is 1: 0.02 ～ 1.5; or

   The antibody that specifically inhibits the serine protease inhibitor Kazal type 1 factor and one or more selected from saplatin, cisplatin, and carboplatin, and the mass ratio of the antibody to the latter is 1: 0.02 to 1.5.
4. The pharmaceutical composition according to any one of claims 1 to 3, wherein the antibody that specifically inhibits the serine protease inhibitor Kazal type 1 factor is secreted by the hybridoma cell line CCTCC NO: C2018213.
5. Use of the pharmaceutical composition according to any one of claims 1 to 4 for preparing a kit for inhibiting tumors or reducing tumor drug resistance.
6. The use according to claim 5, characterized in that, in the pharmaceutical composition, the antibody that specifically inhibits the serine protease inhibitor Kazal type 1 factor by inhibiting the serine protease inhibitor Kazal expressed in the stromal cells of the tumor microenvironment Type factor, thereby reducing tumor resistance.
7. The use according to claim 5, wherein the tumors include: prostate cancer, breast cancer, colorectal cancer, gastric cancer, liver cancer, pancreatic cancer, bladder cancer, lung cancer.
8. An antibody that specifically inhibits the serine protease inhibitor Kazal type 1 factor is secreted by the hybridoma cell line CCTCC NO: C2018213.
9. The use of antibodies that specifically inhibit serine protease inhibitor Kazal type 1 factor in the preparation of antibody drugs, the antibody drugs are used in combination with chemotherapeutic drugs to inhibit tumors or eliminate tumor resistance; or to eliminate tumor cells from chemotherapy drugs Drug resistance.
10. A hybridoma cell line, the deposit number of which is in the Chinese Type Culture Collection Center is CCTCC NO: C2018213.
11. A kit for inhibiting tumors or reducing tumor drug resistance, characterized in that the kit includes: an antibody that specifically inhibits the serine protease inhibitor Kazal type 1 factor, or a cell line that produces the antibody.
12. The kit of claim 11, wherein the kit further comprises: a chemotherapy drug; preferably the chemotherapy drug is a genotoxic drug; preferably, the chemotherapy drug comprises: rice Toxantrone, doxorubicin, bleomycin, sabplatin, cisplatin, carboplatin, daunorubicin, nogamycin, arubicin, epirubicin, doxorubicin, arabinocytoma Glycosides, capecitabine, gemcitabine, 5-fluorouracil.
13. Use of serine protease inhibitor Kazal type 1 factor in the preparation of diagnostic reagents for prognostic evaluation of tumor chemotherapy, wherein the serine protease inhibitor Kazal type 1 factor is serine protease inhibitor Kazal produced by stromal cells in the tumor microenvironment Type 1 factor.
14. Use of a reagent specifically recognizing Kazal type 1 factor of serine protease inhibitor in the preparation of a diagnostic reagent for tumor chemotherapy prognosis evaluation or pathological grading, wherein the serine protease inhibitor Kazal type 1 is a matrix in the tumor microenvironment Cell-produced serine protease inhibitor Kazal type 1 factor.
15. The use according to claim 13 or 14, wherein the tumors include: prostate cancer, breast cancer, colorectal cancer, gastric cancer, liver cancer, pancreatic cancer, bladder cancer, lung cancer.
16. A method for screening potential substances that inhibit tumors or reduce tumor resistance, the method includes:

    (1) Treating an expression system with a candidate substance that expresses NF-κB and the serine protease inhibitor Kazal type 1 factor, and that there is an NF-κB binding site upstream of the gene encoding the serine protease inhibitor Kazal type 1 factor; and

    (2) To detect the regulatory effect of NF-κB on the serine protease inhibitor Kazal type 1 factor in the system; if the candidate substance statistically inhibits the transcriptional regulation of the serine protease inhibitor Kazal type 1 factor by NF-κB, This indicates that the candidate substance is a potential substance that inhibits tumors or reduces tumor drug resistance.
17. The method according to claim 16, wherein step (1) comprises: adding candidate substances to the expression system in the test group; and / or

    Step (2) includes: detecting the transcriptional regulation of the serine protease inhibitor Kazal type 1 factor by NF-κB in the system of the test group and comparing it with the control group, wherein the control group is an expression system that does not add the candidate substance ;

    If the NF-κB in the test group significantly inhibited the transcriptional regulation of serine protease inhibitor Kazal type 1 factor, it indicates that the candidate substance is a potential substance that inhibits tumors or reduces tumor resistance.
18. The method according to claim 16, wherein the NF-κB binding site comprises: Serine protease inhibitor Kazal type 1 factor encoding gene upstream-3902, -1851, -1763, -362, +51 .
19. A method for screening potential substances that inhibit tumors or reduce tumor resistance, the method includes:

    (1) Treating an expression system with candidate substances that expresses EGFR-mediated signaling pathways and serine protease inhibitor Kazal type 1 factor; and

    (2) To detect the activation effect of the serine protease inhibitor Kazal type 1 factor on the EGFR-mediated signaling pathway in the system; if the candidate substance statistically inhibits the activation, it indicates that the candidate substance is a tumor suppressor or Potential substances that reduce tumor resistance.
20. The method according to claim 19, wherein step (1) comprises: adding a candidate substance to the expression system in the test group; and / or

    Step (2) includes: detecting the activation effect of the serine protease inhibitor Kazal type 1 factor on the EGFR-mediated signaling pathway in the system of the test group, and comparing with the control group, wherein the control group does not add the candidate substance 'S expression system;

    If the serine protease inhibitor Kazal type 1 factor in the test group significantly inhibits the activation of EGFR-mediated signaling pathways, it indicates that the candidate substance is a potential substance that inhibits tumors or reduces tumor resistance.

Images