WO2020070333A1 - Ezrin inhibitors and uses thereof - Google Patents

Ezrin inhibitors and uses thereof

Info

Publication number
WO2020070333A1
WO2020070333A1 PCT/EP2019/077110 EP2019077110W WO2020070333A1 WO 2020070333 A1 WO2020070333 A1 WO 2020070333A1 EP 2019077110 W EP2019077110 W EP 2019077110W WO 2020070333 A1 WO2020070333 A1 WO 2020070333A1
Authority
WO
WIPO (PCT)
Prior art keywords
ezrin
disease
mir
cells
mice
Prior art date
Application number
PCT/EP2019/077110
Other languages
French (fr)
Inventor
Carmine SETTEMBRE
Diego Luis MEDINA
Danila FALANGA
Federica Naso
Alberto Auricchio
Ivan CONTE
Daniela INTARTAGLIA
Original Assignee
Fondazione Telethon
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Fondazione Telethon filed Critical Fondazione Telethon
Publication of WO2020070333A1 publication Critical patent/WO2020070333A1/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00—Drugs for disorders of the senses
    • A61P27/02—Ophthalmic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/47—Quinolines; Isoquinolines
    • A61K31/4709—Non-condensed quinolines and containing further heterocyclic rings
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C12N2310/141—MicroRNAs, miRNAs

Definitions

  • the present invention is related to ezrin inhibitors and their therapeutic use.
  • Autophagy is an evolutionarily conserved self-degradative process used by the cells to degrade and recycle cellular components.
  • macroautophagy the most common type of autophagy, double-membrane-bound autophagosomes enclose cytoplasmic material and then fuse with lysosomes for final degradation [1].
  • Autophagy is physiologically activated for survival under a broad range of cellular stress-inducing conditions and mediates the degradation of protein aggregates, oxidized lipids, damaged organelles and intracellular pathogens. Once they reach the lysosomes, these materials are degraded by lysosomal hydrolases and the resulting breakdown products are used to generate new cellular components and energy in response to the nutritional needs of the cell.
  • lysosomes are essential organelles not only for their degradative capacity but also for their role in mediating signalling pathways and nutrient sensing mechanisms that regulate cell metabolism and growth.
  • autophagy in human health and disease is complex. Given its important cytoprotective role in response to stress, dysregulation of autophagy results in many pathophysiological alterations, and is implicated in a range of pathologies, from cancer to neurodegeneration.
  • autophagy occurs constitutively in neurons under physiological conditions. Impairment of autophagy leads to neurodegeneration and has been implicated in the pathogenesis of many neurodevelopmental and neurodegenerative disorders.
  • the retinal pigment epithelium is a monolayer of polarized pigmented epithelial cells that resides between vessels of the choriocapillaris and the light-sensitive outer segments of photoreceptors (PR).
  • the RPE exerts a number of different functions for the maintenance of retinal homeostasis under stress conditions and the preservation of vision [2].
  • the RPE provides part of the retinal-blood barrier, thus mediating selective transport of nutrients, 02 and ions [3] to the retina, and also supplies the enzymes required for isomerization of all-trans retinal to 11- cis retinal, the visual chromophore required for PR excitability [4].
  • the RPE prevents photo-oxidative product toxicity by contributing to the daily renewal of the PR outer segment (POS), a critical process for the maintenance of PR structural integrity and function [5- 7].
  • PR continuously renew their POS via the diurnal shedding of distal spent POS tips, which are phagocytized by the RPE to rapidly clear them from the retina.
  • Phagocytosis of POS was recently reported to be an important trigger of autophagy in the RPE.
  • a subset of autophagy-related proteins, including Beclinl and ATG5 are cyclically engaged in the RPE to act in LC3-associated phagocytosis (LAP), a noncanonical form of autophagy [8].
  • LC3II is recruited to the POS-ingested phagosomes, which then fuse with the lysosome forming phagolysosomes for the degradation and recycling of the ingested POS cargo.
  • some autophagy-related proteins such as ATG5 are required for LC3II localization to POS-containing phagosomes [9].
  • the insoluble proteins aggregate within the ER where they ought to be targeted for translocation from the ER to the ubiquitin-proteasome system (UPS) for degradation in the cytosol.
  • UPS ubiquitin-proteasome system
  • the unsuccessful execution of these responses causes UPS overloading and the build-up of said toxic aggregation-prone proteins', ultimately leading to a block of autophagy and photoreceptor cell death through apoptosis (5).
  • autophagy is becoming more and more clearly involved in the pathogenesis of many diseases of various origins, spanning from cancer to neurodegenerative diseases, to metabolic diseases and lysosomal storage disorders.
  • autophagy enhancing drugs which act in a tissue specific manner to increase the autophagy process with therapeutic effects.
  • Ezrin is a member of the ERM (Ezrin/Radixin/Moesin) family of proteins and is conserved through evolution both structurally and functionally [19]. By regulating membrane cytoskeleton complexes, it plays key roles in normal cellular processes like maintenance of membrane dynamics, survival, adhesion, motility, cytokinesis, phagocytosis and integration of membrane transport with signaling pathways [20]. Both in vivo and in vitro studies show that ezrin function is actively regulated by its conformational changes [19].
  • Ezrin exists in an inactive conformation, in which the membrane and actin binding sites are masked by intramolecular interaction of the N-terminal and the last 100 amino acids of the long Carboxy terminal domains [21]. In its active- open confirmation, it functions as a crosslinker between the plasma membrane and the cortical cytoskeleton. Two factors are reported to be involved in this conformational transition, binding of N-terminal domain to the phosphotidylinositol 4,5 biphosphates (PIP2) and phosphorylation of a conserved threonine at residue 567 (T567) in the F-actin binding site [19]. Several studies have described the expression of Ezrin in many tissues [22].
  • Ezrin In adult mouse tissues, Ezrin is expressed at high levels in small intestine, stomach, lung, pancreas, and kidney; at intermediate levels in spleen, thymus, lymph nodes, and bone marrow; at very low levels in heart, brain, and testis; and undetectable in muscle and liver [23, 24]. Importantly, Ezrin is highly expressed in the RPE [25]. Zhan et al., [26] describe that Ezrin is downregulated in a well-recognized AMD model, the light induced RPE degeneration, hypothesizing that downregulation of Ezrin has a role in the pathogenesis of AMD.
  • Ezrin inhibitors are described in WO2012064396 and in [27, 28] as inhibitors of cancer cells growth, and as such as potential therapeutic agents for the treatment of metastatic osteosarcoma (OS) and multiple cancers including pancreatic cancer, ovarian cancer and rhabdomyosarcoma.
  • OS metastatic osteosarcoma
  • multiple cancers including pancreatic cancer, ovarian cancer and rhabdomyosarcoma.
  • Ezrin inhibitors have not been reported to induce autophagy in a subject. There remains a need in the art for therapeutic methods of inducing autophagy.
  • the present invention is based on the surprising finding that inhibitors of Ezrin induce lysosomal biogenesis and function and increase autophagy-mediated cell clearance.
  • the invention is also based on the finding that MAGT1 is an ezrin interactor that acts downstream of ezrin, that inhibition of Ezrin induces a Mg2+ influx in RPE cells, thus promoting a Mucolipin 1- mediated Ca2+-influx resulting in activation of Calcineurin, and nuclear translocation of the transcription factor EB (TFEB), the master transcriptional regulator of lysosome biogenesis and function.
  • TFEB transcription factor EB
  • the present inventors have surprisingly found that inhibition of Ezrin induces autophagy both in the RPE and in other tissues and activates lysosome functions as characterized by an increase of Cathepsin B activity; they have demonstrated that inhibition of Ezrin is effective in treating disorders characterized by impaired autophagy, particularly eye disorders or eye diseases, preferably retinal disorders as well as lysosomal storage disorders, metabolic disorders and neurodegenerative storage disorders.
  • Diseases of particular interest for the present invention are diseases in which an increase of cellular clearance by means of increased autophagy and/or increased lysosomal functions is beneficial in order to clear accumulation of biomolecules including peptides, nucleic acids, carbohydrates, lipids and proteins , of misfolded proteins and/or aggregates of proteins and/or lipids which result toxic for the cell lifespan.
  • Lysosomal function includes at least one of the following features: a) ability in waste clearance due to lysosomal enzymatic activity (i.e. hydrolases, lipases; etc.), b) lysosomal exocytosis meaning the ability to empty waste-content outside the cell; c) fusion with autophagosomes and phagosomes to start degradative processes.
  • Lysosomal function includes but not is limited to lysosomal exocytosis.
  • Preferred diseases of the invention are disorders characterized by accumulation of toxic debris and impaired autophagy, particularly eye disorders or eye diseases, particularly retinal disorders as well as lysosomal storage disorders, metabolic disorders and neurodegenerative disorders.
  • eye disorders Glaucoma
  • retinal diseases including but not limited to: retinitis pigmentosa (eg autosomal dominant retinitis pigmentosa, autosomal recessive retinitis pigmentosa, X-linked retinitis pigmentosa), macular degeneration (eg macular dystrophies, age related macular degeneration, inherited macular degeneration, Stargardt disease), Leber congenital Amaurosis, Cone-rod dystrophies, cone dystrophies.
  • retinitis pigmentosa eg autosomal dominant retinitis pigmentosa, autosomal recessive retinitis pigmentosa, X-linked retinitis pigmentosa
  • macular degeneration eg macular dystroph
  • Lysosomal storage disorders of the invention are Mucopolysaccharidoses (eg mucopolysaccharidosis selected from the group consisting of Sanfilippo syndrome (MPS III), Hurler syndrome (MPS IH), Hurler-Scheie syndrome (MPS l-H/S), Scheie syndrome (MPS IS), Hunter syndrome (MPS II), Morquio syndrome (MP IV), Maroteaux-Lamy syndrome (MPS VI), Sly syndrome (MPS VII), and MPS IX) , Batten disease , Fabry's disease, Pompe's disease.
  • Metabolic diseases within the meaning of the present invention are diabetes (eg type 2 diabetes), insulin resistance, dyslipidemia.
  • Ezrin has been identified by inventors as a direct target of miR-211.
  • miR-211/autophagy and Ezrin show opposite day/night expression pattern: light induces up- regulation of miR-211 and induction of autophagy in RPE, while ezrin levels are decreased.
  • miR-211 over-expression induces autophagy in vitro in human adult retinal pigment epithelium 19 (ARPE19) cell line and in vivo in the retina of LC3II-GFP transgenic (Tg) mice. It decreases ezrin levels in RPE.
  • pharmacological inhibition of Ezrin by NSC668394 and NSC305787 reduces pathologic accumulation of lipofuscin granules in vitro in human adult retinal pigment epithelium 19 (ARPE19) cell line treated with A2E.
  • Pharmacological inhibition of Ezrin by NSC668394 and NSC305787 reduces pathologic accumulation of dextran in vitro in human adult retinal pigment epithelium 19 (ARPE19) cell line.
  • Pharmacological inhibition of Ezrin by NSC668394 and NSC305787 reduces pathologic accumulation of lipofuscin granules and rescues cone photoreceptor degeneration in miR-211 -/- mouse.
  • Pharmacological inhibition of Ezrin by NSC668394 and NSC305787 rescues photoreceptor degeneration in Aipll -/- mice (model of LCA4 retinal disease, in which the chaperone-like protein Aipll is absent) with a significant reduction in the number of apoptotic photoreceptor cells.
  • Pharmacological inhibition of Ezrin by NSC668394 ameliorates bone phenotype in an MPS VII mouse model.
  • Pharmacological inhibition of Ezrin by NSC668394 rescues phenotype of RHO-P23H mouse model of autosomal dominant Retinitis Pigmentosa (adRP).
  • the invention provides a pharmaceutical composition comprising an inhibitor of ezrin or of its active form for use in the treatment and/or prevention of a condition or disease selected from the group consisting of: eye disease, retinal disease, neurodegenerative disease, preferably neurodegenerative storage disease, lysosomal storage disease and metabolic disease.
  • a condition or disease selected from the group consisting of: eye disease, retinal disease, neurodegenerative disease, preferably neurodegenerative storage disease, lysosomal storage disease and metabolic disease.
  • said inhibitor of ezrin or of its active form induces autophagy and/or activates lysosomal function in a subject.
  • Induction of autophagic flux is determined by any known method in the art, in particular by LC3II lipidation in starved cells, in the presence of bafilomycin (baf) and Baf/starvation condition compared to feed control cells as previously described in Guidelines for the use and interpretation of assays for monitoring autophagy (3rd edition). Autophagy. 2016;12(l):l-222. doi: 10.1080/15548627.2015.1100356.
  • Lysosomal function is the ability of the lysosome to clear waste through increased activity of lysosomal enzymes such as hydrolases, Cathepsin B, Cathepsin D, leading to recycling of nutrients via lysosomal exocytosis. Lysosomal function can be measured or assessed by any known method in the art or as described herein.
  • the disease or condition is characterized by accumulation of toxic debris (i.e. misfolded protein) and impaired autophagy resulting in the decreased clearance of cellular waste via autophagy pathways (i.e. macroautophagy, microautophagy, chaperone-mediated autophagy etc. etc.).
  • toxic debris i.e. misfolded protein
  • impaired autophagy resulting in the decreased clearance of cellular waste via autophagy pathways (i.e. macroautophagy, microautophagy, chaperone-mediated autophagy etc. etc.).
  • Impaired autophagy is defined as impairment of the overall process that constitutes the autophagic pathway including autophagosome formation, impairment of lysosome- autophagosome fusion, lysosomes dysfunction (i.e. defect in enzymatic lysosomal hydrolases, Cathepsin B, Cathepsin D ).
  • Eye diseases are any of the diseases or disorders that affect the human eye and could lead to vision loss.
  • disorders of the inner eye including the uveal tract (ie uveitis), diseases and disorders of the lens, diseases of the retina, (ie retinal detachment and retinal degeneration and dystrophy, macular degenerations and dystrophies), disorders of the optic nerve (ie glaucoma)
  • the retinal diseases is retinitis pigmentosa, macular degeneration, Leber congenital Amaurosis, cone-rod dystrophy, cone dystrophy, wherein the neurodegenerative disease is a neurodegenerative storage disorder, wherein the lysosomal storage disorders is a mucopolysaccharidosis, Batten disease, Fabry's disease, Pompe's disease and wherein the metabolic disease is diabetes, insulin resistance or dyslipidemia.
  • the retinitis pigmentosa is autosomal dominant retinitis pigmentosa, autosomal recessive retinitis pigmentosa or X-linked retinitis pigmentosa
  • the macular degeneration is macular dystrophy, age-related macular degeneration, inherited macular degeneration or Stargardt disease
  • the neurodegenerative disease is Alzheimer's disease or Parkinson's disease
  • the mucopolysaccharidosis is Sanfilippo syndrome (MPS III), Hurler syndrome (MPS IH), Hurler- Scheie syndrome (MPS l-H/S), Scheie syndrome (MPS IS), Hunter syndrome (MPS II), Morquio syndrome (MP IV), Maroteaux-Lamy syndrome (MPS VI), Sly syndrome (MPS VII) or MPS IX and diabetes is type 2 diabetes.
  • Particularly preferred diseases of the invention are age-related macular degeneration, Stargardt's disease, retinitis pigmentosa (recessive or autosomal dominant), Leber congenital Amaurosis, cone-rod dystrophy, cone dystrophy, Batten disease, Alzheimer's disease, Parkinson's disease, Fabry's disease, Mucopolysaccharidoses, Pompe's disease, Glaucoma. More preferably the inhibitor is selected from the group consisting of:
  • the inhibitor is a siRNA or a miR, preferably said siRNA has the sequence: GCUCAAAGAUAAUGCUAUG (SEQ ID No. 1).
  • the inhibitor is NSC668394 or NSC305787 or analog thereof.
  • the inhibitor is a MAGT1 inhibitor.
  • the inhibitor inhibits mTOR and/or induces Ca 2+ flux into a cell.
  • the pharmaceutical composition further comprises a therapeutic agent, wherein said further therapeutic agent is for the treatment and/or prevention of eye disease, retinal disease, neurodegenerative disease, lysosomal storage disease and metabolic disease.
  • Preferred diseases are as defined above.
  • the prophylactic and/or therapeutic methods described herein involve ameliorating one or more of the above symptoms (e.g., one or more symptoms selected from macular degeneration and progressive loss of central vision causing blurry vision, difficulty to adapt in the dark, impaired color vision, photophobia), and/or delaying the onset, slowing, stopping, or reversing the progression of one or more of these symptoms.
  • one or more symptoms selected from macular degeneration and progressive loss of central vision causing blurry vision, difficulty to adapt in the dark, impaired color vision, photophobia
  • delaying the onset, slowing, stopping, or reversing the progression of one or more of these symptoms e.g., one or more symptoms selected from macular degeneration and progressive loss of central vision causing blurry vision, difficulty to adapt in the dark, impaired color vision, photophobia
  • MiR-211 participates in autophagy pathway, (a, b, b') EM analysis of RPE of 2-month- old WT (a) and miR-211 _/ mice (b-b'). Scale bar 5 pm. Enlarged box in b' highlights phagolysosome-like structures containing poorly processed POS (black arrows) Scale bar 1.5 pm.
  • Box plots graphs indicate the means values ⁇ s.e.m. Student's t-test (miR-ctrl vs miR-211 and anti-miR-ctrl vs antimiR-211) *p ⁇ 0.05, **p ⁇ 0.01, ***p ⁇ 0.005.
  • miR-211 positively regulates autophagy in ARPE-19 cells.
  • ARPE-19 cells transiently transfected with miR-ctrl (a, a', a"), miR-211 (b, b', b"), anti-miR-ctrl (c, c', c") or anti-miR-211 (d, d', d"). All cells were fixed and stained with anti-LC3 (a', b', c', d') and anti-LAMPl (a”, b", c", d") antibodies and nuclei were counterstained with DAPI (a, b, c, d). Scale bar 10 pm.
  • GFP green fluorescent protein
  • Ezrin daily expression in RPE is inversely related to autophagy levels.
  • Representative images of eye cryosections, immunostained with an anti-Ezrin (e-f) or anti-Ezrin pT567 (g-h) antibodies, from 1-month-old miR-211-/- mice sacrificed at 10 PM (DARK; e, g') and 10 AM (LIGHT; f, h'). Nuclei were counterstained with DAPI (e', f , g', h'). At least n 6 mice per group. Scale bar 100 pm.
  • RPE were isolated at 10 PM (DARK) and 10 AM (LIGHT) from 1-month-old miR-211-/- mice.
  • FIG. 9 siRNA mediated silencing of EZRIN results in autophagy induction.
  • ARPE-19 cells transiently transfected with siCTRL (a, a', a'') and siEZR (b, b', b"). All cells were fixed and stained with anti-LC3 (a", b") and anti-LAMPl (a', b') antibodies and nuclei were counterstained with DAPI (a, b). Scale bar 10 pm.
  • ARPE-19 cells transiently co-transfected with antimiR-211 and siCTRL (i-i") or siEZR (j-j"). All cells were fixed and stained with anti-LC3 (i, j) and anti-LAMPl (i', j') antibodies and nuclei were counterstained with DAPI (i'', j"). Scale bar 10 pm.
  • NSC668394 rescues inhibition of the autophagy mediated by EZRIN.
  • ARPE-19 cells transiently transfected with GFP (a-a'') or EZRIN GFP (b-c”) and treated with DMSO or NSC668394, respectively. All cells were fixed and stained with anti-LAMPl (a"-c") antibody and nuclei were counterstained with DAPI (a-c). Scale bar 10 pm.
  • MAGT1 is a new ezrin interactor
  • FIG. 12 Ezrin inhibition results in TFEB nuclear translocation, (a) Mg2+ influx (MagFluo4) in ARPE-19 cells stimulated with NSC668394 and silenced or not with siMAGTl.
  • the left panel shows representative fluorescence readings (dots) and corresponding exponential fits in ARPE- 19 cells exposed to high extracellular Mg2+.
  • the bar graph (right) reports the maximal rate of Mg2+ influx for the indicated conditions.
  • Graphs represent the fold change of the slope of Mg2+ flux in ARPE-19 cells either unstimulated or stimulated with NSC668394 and silenced or not with siMAGTl.
  • Each bar represents the mean values ⁇ s.e.m. of at least 10 independent experiments. Student's t-test (NSC668394, siMAGTl and siMAGTl + NSC668394 vs WT) *p ⁇ 0.05, **p ⁇ 0.01, ***p ⁇ 0.005.
  • the graph shows the mean ⁇ s.e.m. of the percentage of nuclearTFEB translocation in Ezrin- inhibited cells and subjected to the silencing of PPP3CB. At least 4 independent experiments were performed. Student's t-test (siPPP3CB vs siCTRL) ***p ⁇ 0.005.
  • the graph shows the mean ⁇ s.e.m. of the percentage of nuclear TFEB translocation in Ezrin- inhibited cells compared with DMSO under Ca2+ chelator BAPTA treatment. At least 4 independent experiments were performed. Student's t-test (stv, stv+BAPTA, BAPTA, NSC668394, NSC668394+BAPTA vs DMSO) *p ⁇ 0.05, ***p ⁇ 0.005.
  • Figure 15 Pharmacological inhibition of Ezrin rescues the miR-211-/- phenotype.
  • OS outer segment
  • ONL outer nuclear layer
  • RPE Retinal Pigment Epithelium
  • PR Photoreceptors
  • h-r' Autofluorescence from lipofuscin granules from WT and miR-211-/- mice at three months of age after DMSO or NSC668394 treatment. Nuclei were counterstained with DAPI.
  • FIG. 16 Pharmacological inhibition of Ezrin rescues Rho-P23H.
  • (a-b') images of TUNEL staining (a', b') of retina cryosections from P19 day-old DMSO-treated Rho-P23H (a, a') and NSC668394-treated Rho-P23H (b, b') mice. Nuclei are counterstained by DAPI (a-b). n 6 mice per group. Scale bars: lOOpm.
  • ERG responses (a- and b-wave), plotted as a function of stimulus intensity, from WT (black lines), DMSO-treated Rho-P23H and NSC668394-treated Rho-P23H mice, at two months of age. Error bars represent s.e.m. ANOVA test (NSC668394 vs DMSO treated mice) *p ⁇ 0.05, **p ⁇ 0.01, ***p ⁇ 0.005.
  • FIG. 17 Model of Ezrin mediated regulation of autophagy. Under light phase conditions Ezrin is repressed by miR-211. The inhibition of Ezrin releases the MAGT1 transporter from its repression, thus increasing a Mg2+ microdomain influx .and the corresponding PLCyl-mediated induction of Ca2+ flux into cells. This leads to calcineurin activation and autophagy induction via TFEB nuclear translocation. Under night phase conditions Ezrin is upregulated and represses MAGTl-mediated autophagy process.
  • FIG. 18 Pharmacological inhibition of Ezrin ameliorates Aipll ⁇ retinal phenotype. Partial preservation of retinal structure in A ⁇ rIG /_ mice following NSC668394 treatment, a-f) Starting from P4, daily injections of NSC668394, 5 times a week, over two consecutive weeks was efficient in ameliorating retinal degeneration in A ⁇ rIG /_ mice (d-f), compared to control injected animals (a-c). Confocal microscopy images of rod marker rhodopsin (b, e) and cone marker cone arrestin (c, f) immunolabelling on retinal sections at P21.
  • the graph shows the quantification (mean ⁇ sem) of the intensity of autofluorescent of Lipofuscin per RPE from 3 independent experiments.
  • RPE retinal pigment epithelium
  • ONL outer nuclear layer
  • INL inner nuclear layer
  • GCL ganglion cell layer.
  • the arrows indicate lipofuscin signal.
  • Figure 20 Analysis of femur and tibia lengths in MPSVII mice treated with NSC668394.
  • b Alizarin red staining of femurs and Tibia isolated from GUSB +/+ (WT), GUSB-/- (MPSVII) and GUSB-/-; NSC668394 mice at P15.
  • the graph shows the mean ⁇ sem of Femur and tibia lengths from wild-type (WT), MPSVII mice and MPSVI mice treated with NSC668394. Student t-test *p ⁇ 0,05. At least 5 mice/genotype were analyzed.
  • CtsB activity in RPE lysates from miR-2ir /_ and control mice sacrificed 3h after light on at 10 AM (diurnal condition).
  • RPE was isolated 1 week after DMSO or NSC668394 treatment from 2-month-old miR-2ir /_ mice.
  • CtsB was rescued in NSC668394- treated miR-2ir /_ compared to DMSO-control miR-2ir /_ mice. Bar graphs represent percentage of CtsB activity ⁇ s.e.m.
  • ezrin or "ezrin protein” is intended to include also the corresponding protein encoded from an ezrin orthologous or homologous genes, functional mutants, functional derivatives, functional fragments or analogues, isoforms thereof.
  • an ezrin inhibitor or an inhibitor of ezrin active form may be any inhibitor known in the art.
  • the inhibitor may be a) a polypeptide; b) a polynucleotide coding for said polypeptide or a polynucleotide able to inhibit or block ezrin or its active form expression and/or function; c) a vector comprising or expressing said polynucleotide; d) a host cell genetically engineered expressing said polypeptide or said polynucleotide; e) a small molecule; f) a peptide, a protein, an antibody, an antisense oligonucleotide, a siRNA, a microRNA , an antisense expression vector or recombinant virus or any other agent able to inhibit or block ezrin or its active form expression and/or function.
  • the inhibitor of ezrin or of its active form induces autophagy and/or induces activation of lysosomal function in a subject. Further, it induces TFEB dephosphorylation and its translocation to the nucleus. , inhibits MAGT1 and /or mTOR and/or induces Ca 2+ flux into a cell.
  • Small molecule ezrin inhibitors have been disclosed in WO 2012064936 and in [27] , all incorporated by reference, as potential therapeutic agents for metastatic osteosarcoma and multiple cancers including pancreatic cancer, ovarian cancer and rhabdomyosarcoma.
  • Ezrin inhibitors have been described [28]: MMV667492, MMV020549, MMV666069, identified at Georgetown University as anticancer drugs by screening the Medicine for malaria venture (MMV) portfolio, based on the close structure similarity of the initial compounds to commonly used quinoline- based antimalarial drugs.
  • ezrin inhibitors are NSC668394 (7-(3,5-dibromo-4 hydroxyphenethylamino)quinoline-5,8-dione), and NSC305787 ([6,8-Dichloro-2-
  • NSC668394 was undetectable after lh. Furthermore, monitoring of plasma concentrations of over an extended time period after a single i.v.injection at the same dose resulted in a monophasic elimination profile similar to i.p. administration; upon i.v. administration, NSC668394 was undetectable after 0.5h.
  • NSC305787 had an elimination half-life and clearance of 13.6 h and 9.6 mL/min/kg, respectively miRNA inhibitors of Ezrin
  • uauggcacugguagaauucacu miR-22 [32] mature mouse miRNA-22 (miRBase Accession No. MIMAT0004629) (SEQ ID No. 26) aguucuucaguggcaagcuuua
  • hsa-miR-3686 MIMAT0018114 (SEQ ID No. 38) aucuguaagagaaaguaaauga
  • hsa-miR-589 MIMAT0003256
  • SEQ ID No. 39 ucagaacaaaugccgguucccaga
  • hsa-miR-548c MIMAT0003285) (SEQ ID No. 41) caaaaaucucaauuacuuuuugc
  • hsa-miR-548ag MIMAT0018969
  • SEQ ID No. 42 aaagguaauugugguuucugc
  • hsa-miR-548ba MIMAT0031175) (SEQ ID No. 43) aaagguaacugugauuuuuuugcu
  • hsa-miR-548ai MIMAT0018989
  • SEQ ID No. 44 aaagguaauugcaguuuuuccc
  • hsa-mir-548p MIMAT0005934
  • SEQ ID No. 45 uagcaaaacugcaguuacuuu
  • miR-3607 MIMAT0017985
  • SEQ ID No. 46 acuguaaacgcuuucugaug
  • miR-6802 (MIMAT0027505) (SEQ ID No. 49) uucaccccucucaccuaagcag
  • miR-570 (MIMAT0022707) (SEQ ID No. 50) aaagguaauugcaguuuuuccc
  • hsa-miR-4428 MIMAT0018943 (SEQ ID No. 51) caaggagacgggaacauggagc
  • hsa-miR-376a MIMAT0000729 (SEQ ID No. 52) aucauagaggaaaauccacgu
  • hsa-miR-367b MIMAT0002172
  • SEQ ID No. 53 aucauagaggaaaauccauguu
  • hsa-miR-643 MIMAT0003313
  • SEQ ID No. 54 acuuguaugcuagcucagguag
  • hsa-miR-6838 MIMAT0027579
  • SEQ ID No. 55 aguccugcuucuguugcag
  • hsa-miR-3160 MIMAT0019212
  • SEQ ID No. 62 ggcuuucuagucucagcucucc
  • hsa-miR-1185-1 MIMAT0022838) (SEQ ID No. 64) auauacagggggagacucuuau
  • hsa-let-7f-2 MIMAT0004487
  • SEQ ID No. 65 cuauacagucuacugucuuucc
  • hsa-miR-3689d MIMAT0019008 (SEQ ID No. 67) gggaggugugaucucacacucg
  • hsa-miR-6851 MIMAT0027602
  • SEQ ID No. 68 aggaggugguacuaggggccagc
  • hsa-miR-648 MIMAT0003318
  • SEQ ID No. 69 agugugcagggcacuggu
  • hsa-miR-6897 MIMAT0027634 (SEQ ID No. 70) uguguguguagaggaagaaggga
  • hsa-miR-4753 (MI AT0019890) (SEQ ID No. 71) caaggccaaaggaagagaacag
  • hsa-miR-6867 MIMAT0027436) (SEQ ID No. 72) cacacaggaaaagcggggcccug
  • hsa-miR-4508 MIMAT0019045
  • SEQ ID No. 73 gcggggcugggcgcgcg
  • hsa-miR- 3613 MIMAT0017991
  • SEQ ID No. 78 acaaaaaaaaaagcccaacccuuc
  • hsa-miR- 4801 (MIIVIAT0019980) (SEQ ID No. 80) uacacaagaaaaccaaggcuca
  • hsa-miR- 6500 MIMAT0025455
  • SEQ ID No. 81 acacuuguugggaugaccugc
  • mature miRNAs may usually have a length of about 19-24 nucleotides (and any range in between), particularly 21, 22 or 23 nucleotides.
  • the miRNAs may be also provided as a precursor which may have a length of about 70 to about 100 nucleotides (pre-miRNA). It should be noted that the precursor may be produced by processing of a primary transcript which may have a length of greater than about 100 nucleotides (pri-miRNA).
  • the miRNA as such may usually be a single-stranded molecule, while the miRNA-precursor may usually be in the form of an at least partially self-complementary molecule capable of forming double-stranded portions, e.g. stem- and loop-structures.
  • DNA molecules encoding the miRNA, pre-miRNA and pri-miRNA molecules are also be encompassed by the invention.
  • the nucleic acids may be selected from RNA, DNA or nucleic acid analog molecules, such as sugar- or backbone-modified ribonucleotides or deoxyribonucleotides. It should be noted, however, that other nucleic analogs, such as peptide nucleic acids (PNA) or locked nucleic acids (LNA), may also be suitable.
  • PNA peptide nucleic acids
  • LNA locked nucleic acids
  • the nucleic acid molecules of the invention may be obtained by chemical synthesis methods or by recombinant methods, e.g. by enzymatic transcription from synthetic DNA-templates or from DNA-plasmids isolated from recombinant organisms.
  • phage RNA- polymerases are used for transcription, such as T7, T3 or SP6 RNA-polymerases.
  • the invention may also relate to a recombinant expression vector comprising a recombinant nucleic acid operatively linked to an expression control sequence, wherein expression, i.e. transcription and optionally further processing results in a miRNA-molecule or miRNA precursor (pri- or pre-miRNA) molecule as described above.
  • the vector may be an expression vector suitable for nucleic acid expression in eukaryotic, more particularly mammalian cells.
  • the recombinant nucleic acid contained in said vector may be a sequence which results in the transcription of the miRNA-molecule as such, a precursor or a primary transcript thereof, which may be further processed to give the miRNA-molecule.
  • said agent is provided within a delivery vehicle, optionally wherein the delivery vehicle is selected from a viral vector, microspheres, liposomes, colloidal gold particles, lipopolysaccharides, polypeptides, polysaccharides, or pegylation of viral vehicles.
  • the delivery vehicle is selected from a viral vector, microspheres, liposomes, colloidal gold particles, lipopolysaccharides, polypeptides, polysaccharides, or pegylation of viral vehicles.
  • said agent is selected from the group consisting of: a miRNA, a miRNA precursor, a mature miRNA, a miRNA mimetic or a mixture of miRNA mimetics, a RNA or DNA molecule encoding for said miRNA, for said miRNA precursor, for said mature miRNA, for said miRNA mimetic or mixture of miRNA mimetics, or any combination thereof.
  • the agent capable of increasing the level of one or more miRNA may be an RNA- or DNA molecule, which may contain at least one modified nucleotide analog, i.e. a naturally occurring ribonucleotide or deoxyribonucleotide is substituted by a non-naturally occurring nucleotide.
  • the modified nucleotide analog may be located for example at the 5'-end and/or the 3 '-end of the nucleic acid molecule.
  • Nucleotide analogs may be selected from sugar- or backbone-modified ribonucleotides. It should be noted, however, that also nucleobase-modified ribonucleotides, i.e. ribonucleotides, containing a non-naturally occurring nucleobase instead of a naturally occurring nucleobase, such as uridines or cytidines modified at the 5-position, e.g. 5-(2-amino)propyl uridine, 5- bromo uridine; adenosines and guanostnes modified at the 8-position, e.g. 8-bromo guanosine; deaza nucleotides, e.g.
  • O- and N-alkylated nucleotides e.g. N6-methyl adenosine may be suitable.
  • the 2'-OH-group is replaced by a group selected from H, OR, R, halo, SH, SR, NH 2 , NHR, NR 2 or CN, wherein R is C 1 -C 6 alkyl, alkenyl or alkynyl and halo is F, Cl, Br or I.
  • R is C 1 -C 6 alkyl, alkenyl or alkynyl and halo is F, Cl, Br or I.
  • the phosphoester group connecting to adjacent ribonucleotides is replaced by a modified group, e.g. of phosphothioate group. It should be noted that the above modifications may be combined.
  • miR mimics or mimetics are small double-stranded RNA oligonucleotides, that can be chemically modified and that mimic endogenous miRNAs and enable miRNA functional analysis by up-regulation of miRNA activity.
  • the mimic or mimetic sequence corresponds to the sequence of the miRNA mature sequence.
  • miRs may be delivered to the retina via the subretinal injection of AAV constructs.
  • miRNA mimics double stranded RNA oligonucleotides
  • both the miR AAV constructs or miR mimics can also be prepared in the form of injectable suspension, eye lotion or ophthalmic ointment that can be delivered to the retina with a non-invasive procedure.
  • the administration of oligonucleotides of the present invention may be carried out by known methods, wherein a nucleic acid is introduced into a desired target cell in vitro or in vivo.
  • the inhibitor as above defined (a) is combined with at least one therapeutic agent (b) to define a combination or combined preparation.
  • the therapeutic agent (b) may be an agent used to treat and/or prevent the disease of the invention, an anti-apoptotic agent, an anti-inflammatory agent, an immune suppressive agent, adjuvant therapy in organ transplantation, protective agent in cell therapy approach a pain reliever.
  • the additional therapeutic agent (b) may be a recombinant expression vector comprising the wild type form of the coding sequence responsible for the disease of the invention under the control of an appropriate promoter.
  • Additional therapeutic agents may include a neuroprotective molecule such as: growth factors such as ciliary neurotrophic factor (CNTF), glial-derived neurotrophic factor (GDNF), cardiotrophin-1, brain-derived neurotrophic factor (BDNF) and basic fibroblast growth factor (bFGF) or the rod-derived cone viability factors such as RdCVF and RdCVF2.
  • the therapeutic agent (b) may be any therapeutic intervention for the treatment of lysosomal storage disorders, for example as reported in Table IV.
  • Table IV Therapeutic agents for the treatment of lysosomal storage disorders
  • kits of parts in the sense that the combination partners (a) and (b) as defined above can be dosed independently or by use of different fixed combinations with distinguished amounts of the combination partners (a) and (b), i.e. simultaneously or at different time points.
  • the parts of the kit of parts can then, e.g., be administered simultaneously or chronologically staggered, that is at different time points and with equal or different time intervals for any part of the kit of parts.
  • the ratio of the total amounts of the combination partner (a) to the combination partner (b) to be administered in the combined preparation can be varied, e.g. in order to cope with the needs of a patient sub-population to be treated or the needs of the single.
  • the combination therapy may result in unexpected improvement in the treatment of the disorders of the invention.
  • the inhibitor and the other therapeutic agent may interact in a synergistic manner to reduce disorders or diseases of the invention.
  • This unexpected synergy allows a reduction in the dose required of each compound, leading to a reduction in the side effects and enhancement of the clinical effectiveness of the compounds and treatment.
  • Determining a synergistic interaction between one or more components the optimum range for the effect and absolute dose ranges of each component for the effect may be definitively measured by administration of the components over different w/w ratio ranges and doses to patients in need of treatment. For humans, the complexity and cost of carrying out clinical studies on patients renders impractical the use of this form of testing as a primary model for synergy.
  • synergy in one species can be predictive of the effect in other species and animal models exist, as described herein, to measure a synergistic effect and the results of such studies can also be used to predict effective dose and plasma concentration ratio ranges and the absolute doses and plasma concentrations required in other species by the application of pharmacokinetic/pharmacodynamic methods.
  • Established correlations between disease models and effects seen in man suggest that synergy in animals may e.g. be demonstrated in the models as described in the Examples below.
  • compositions are preferably for systemic, oral, locally, preferably rectally, or topical administration.
  • the active ingredients may also be entrapped in microcapsule prepared, for example, by coacervation techniques or by interfacial polymerization, for example, hydroxymethylcellulose or gelatin-microcapsule and poly-(methylmethacylate) microcapsule, respectively, in colloidal drug delivery systems (for example, liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules) or in macroemulsions.
  • colloidal drug delivery systems for example, liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules
  • the formulations to be used for in vivo administration must be sterile. This is readily accomplished by filtration through sterile filtration membranes.
  • Sustained-release preparations may be prepared. Suitable examples of sustained-release preparations include semipermeable matrices of solid hydrophobic polymers containing the antibody, which matrices are in the form of shaped articles, e.g., films, or microcapsule. Examples of sustained-releabe matrices include polyesters, hydrogels (for example, poly(2- hydroxyethyl-methacrylate), or poly(vinylalcohol)), polylactides (U.S. Pat. No.
  • copolymers of L-glutamic acid and [gamma] ethyl-L-glutamate non-degradable ethylene-vinyl acetate
  • degradable lactic acid-glycolic acid copolymers such as injectable microspheres composed of lactic acid-glycolic acid copolymer and leuprolide acetate
  • poly-D-(- )-3- hydroxybutyric acid While polymers such as ethylene- vinyl acetate and lactic acid-glycolic acid enable release of molecules for over 100 days, certain hydrogels release proteins for shorter time periods.
  • encapsulated antibodies When encapsulated antibodies remain in the body for a long time, they may denature or aggregate as a result of exposure to moisture at 37°C, resulting in a loss of biological activity and possible changes in immunogenicity. Rational strategies can be devised for stabilization depending on the mechanism involved. For example, if the aggregation mechanism is discovered to be intermolecular S- S bond formation through thio-disulfide interchange, stabilization may be achieved by modifying sulfhydryl residues, lyophilizing from acidic solutions, controlling moisture content, using appropriate additives, and developing specific polymer matrix compositions.
  • an "effective amount" of a composition is one that is sufficient to achieve a desired biological effect, in this case an amelioration or the treatment of the disease of the invention.
  • the effective dosage will be dependent upon the age, sex, health, and weight of the recipient, kind of concurrent treatment, if any, frequency of treatment, and the nature of the effect desired.
  • the provided ranges of effective doses of the inhibitor or molecule of the invention e.g. from 1 mg/kg to 1000 mg/kg, in particular systemically administered
  • the preferred dosage can be tailored to the individual subject, as is understood and determinable by one of skill in the art, without undue experimentation.
  • oligonucleotides of the present invention may be carried out by known methods, wherein a nucleic acid is introduced into a desired target cell in vitro or in vivo.
  • An aspect of the present invention comprises a nucleic acid construct comprised within a delivery vehicle.
  • a delivery vehicle is an entity whereby a nucleotide sequence can be transported from at least one media to another. Delivery vehicles may be generally used for expression of the sequences encoded within the nucleic acid construct and/or for the intracellular delivery of the construct. It is within the scope of the present invention that the delivery vehicle may be a vehicle selected from the group of RNA based vehicles, DNA based vehicles/vectors, lipid-based vehicles, virally based vehicles and cell-based vehicles.
  • delivery vehicles include biodegradable polymer microspheres, lipid-based formulations such as liposome carriers, coating the construct onto colloidal gold particles, lipopolysaccharides, polypeptides, polysaccharides, pegylation of viral vehicles.
  • a virus as a delivery vehicle
  • the virus may be selected from: adenoviruses, retroviruses, lentiviruses, adeno-associated viruses, herpesviruses, vaccinia viruses, foamy viruses, cytomegaloviruses, Semliki forest virus, poxviruses, RNA virus vector and DNA virus vector.
  • viral vectors are well known in the art. Commonly used gene transfer techniques include calcium phosphate, DEAE-dextran, transfection, electroporation and microinjection and viral methods.
  • Another technique for the introduction of DNA into cells is the use of cationic liposomes.
  • Commercially available cationic lipid formulations are e.g. Tfx 50 (Promega) or Lipofectamin 2000 (Life Technologies).
  • compositions of the present invention may be in form of a solution, e.g. an injectable solution, a cream, ointment, tablet, suspension or the like.
  • the composition may be administered in any suitable way, e.g. by injection, particularly by intraocular injection, by oral, topical, nasal, rectal application etc.
  • the carrier may be any suitable pharmaceutical carrier.
  • a carrier is used, which is capable of increasing the efficacy of the RNA molecules to enter the target-cells. Suitable examples of such carriers are liposomes, particularly cationic liposomes.
  • the recombinant expression vector of the invention can be any suitable recombinant expression vector and can be used to transform or transfect any suitable host. Suitable vectors include those designed for propagation and expansion or for expression or both, such as plasmids and viruses.
  • the recombinant expression vectors of the invention can be prepared using standard recombinant DNA techniques. Constructs of expression vectors, which are circular or linear, can be prepared to contain a replication system functional in a prokaryotic or eukaryotic host cell. Replication systems can be derived, e.g., from ColEI, 2 m plasmid, l, SV40, bovine papilloma virus, and the like.
  • the recombinant expression vector comprises regulatory sequences, such as transcription and translation initiation and termination codons, which are specific to the type of host (e.g., bacterium, fungus, plant, or animal) into which the vector is to be introduced, as appropriate and taking into consideration whether the vector is DNA- or RNA- based.
  • the recombinant expression vector can include one or more marker genes, which allow for selection of transformed or transfected hosts. Marker genes include biocide resistance, e.g., resistance to antibiotics, heavy metals, etc., complementation in an auxotrophic host to provide prototrophy, and the like.
  • Suitable marker genes for the inventive expression vectors include, for instance, neomycin/G418 resistance genes, hygromycin resistance genes, histidinol resistance genes, tetracycline resistance genes, and ampicillin resistance genes.
  • the recombinant expression vector can comprise a native or normative promoter operably linked to the nucleotide sequence encoding the PCYOX1 inhibitor (including functional portions and functional variants thereof), or to the nucleotide sequence which is complementary to or which hybridizes to the nucleotide sequence encoding the RNA.
  • promoters e.g., strong, weak, inducible, tissue- specific and developmental-specific, is within the ordinary skill of the artisan.
  • the promoter can be a non-viral promoter or a viral promoter, e.g., a cytomegalovirus (CMV) promoter, an SV40 promoter, an RSV promoter and a promoter found in the long-terminal repeat of the murine stem cell virus.
  • CMV cytomegalovirus
  • inventive recombinant expression vectors can be designed for either transient expression, for stable expression, or for both. Also, the recombinant expression vectors can be made for constitutive expression or for inducible expression.
  • the following assays can be used to evaluate lysosomal biogenesis and function: 1) Lysosomal morphometries, 2) Lysosomal pH and membrane integrity, 3) Lysosomal exocytosis and calcium signalling, 4) Lysosomal degradation and clearance capacity, 5) Autophagy.
  • Lysosomal morphometries Lysosomes are highly dynamic organelles that can vary substantially in shape, position and number. These changes may be the result of specific perturbations or environmental cues and may be mediated by different pathways. Most importantly, the lysosome undergoes significant morphological changes in LSDs, as a result of the accumulation of un-degraded storage material in the lysosomal lumen. It is possible to perform the quantification of lysosomal number, morphology, and positioning by using antibodies against the abundant lysosomal membrane proteins LAMP1 and LAMP2A, and Bodipy-Pepstatin. The use of three different lysosomal markers allow to unequivocally identify lysosomes (Bodipy-Pepstatin will also enable us to distinguish lysosomes form late lysosomes).
  • Lysosomal pH and membrane integrity pH changes in the lysosomal lumen strongly alter lysosomal function by impairing the activity of lysosomal hydrolases. It is possible to measure lysosomal acidification using the weak amine base lysostracker (fixable format), coupled to immunofluorescence with antibodies to galectin-3, a cytosolic protein that translocates to the lysosome after lysosomal membrane permeabilization, thus labelling individual damaged lysosomes. Live cells can be loaded with lysotracker red, fixed and stained with anti-galectin3 antibodies. Then it is possible to detect lysotracker mean intensity and vesicular structures stained with galectin-3 antibodies.
  • Lysosomal exocytosis and calcium signaling Lysosomes are also involved in a secretory pathway known as lysosomal exocytosis, which requires movement of lysosomes to cell periphery, docking and fusion to the plasma membrane. Activation of lysosomal exocytosis promotes cellular clearance in LSDs, thus indicating a potential therapeutic application for this process. It is possible to measure lysosomal exocytosis by detecting the translocation of lysosomal membrane markers to the plasma membrane. Highly specific monoclonal antibodies that react with lumenal epitopes of LAMP1 are available, allowing sensitive immunofluorescence detection of LAMP1 translocation to the plasma membrane in non- permeabilized cells.
  • Lysosomal degradative and clearance capacity To quantify the general degradative activity of the lysosome, a red BODIPY dye conjugated to bovine serum albumin (DQ-BSA, Molecular Probes) may be used. This substrate is so heavily labelled that the fluorophore is self-quenched. However, lysosomal proteolysis of BSA results in de-quenching and release of bright fluorescent fragments.
  • DQ-BSA bovine serum albumin
  • Autophagy substrates are degraded by the lysosome
  • a major step of the autophagic pathway is the fusion between autophagosomes and lysosomes. It is possible to monitor autophagy by using a cell-based assay to quantify the formation of autophagosomes with antibodies against endogenous LC3 protein in combination with autophagosome staining with lysosome staining using LAMP1. Perturbations inducing autophagy will result in an increased co-localization of the two proteins.
  • Diseases to be treated or prevented Diseases of particular interest for the present inventions are diseases in which an increase of cellular clearance by means of increased autophagy and/or lysosomal exocytosis is beneficial in order to clear accumulation of misfolded proteins and/or aggregates of proteins and/or lipids, such as retinal disease, in particular inherited retinal dystrophies, neurodegenerative diseases, lysosomal storage disorders; particularly preferred diseases of the invention are: age-related macular degeneration, Stargardt's disease, retinitis pigmentosa (recessive or autosomal dominant), Leber congenital Amaurosis, cone-rod dystrophies, cone dystrophies, Batten disease, Alzheimer's disease, Parkinson's disease, Fabry's disease, Mucopolysaccharidoses, Pompe's disease.
  • Inherited retinal dystrophies represent one of the most frequent causes of genetic blindness in the western world.
  • the primary condition that underlies this group of diseases is the degeneration of photoreceptors, i.e., the cells that convert the light information into chemical and electrical signals that are then transmitted to the brain through the visual circuits.
  • photoreceptors There are two types of photoreceptor cells in the human retina: rods and cones.
  • Rods represent about 95% of photoreceptor cells in the human retina and are responsible for sensing contrast, brightness and motion, whereas fine resolution, spatial resolution and color vision are perceived by cones.
  • IRDs can be subdivided into different groups of diseases, namely Retinitis Pigmentosa (RP), Leber Congenital Amaurosis (LCA), cone-rod dystrophies and cone dystrophies.
  • RP Retinitis Pigmentosa
  • LCDA Leber Congenital Amaurosis
  • cone-rod dystrophies cone-rod dystrophies
  • cone dystrophies cone dystrophies
  • RP a frequent form of inherited retinal dystrophy with an approximate frequency of about 1 in 4,000 individuals [36].
  • RP is characterized by broad variability in age of onset, rate of progression and secondary clinical manifestations.
  • Affected individuals generally first develop night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife.
  • Central visual acuity loss may occur at any age as a result of cystoid macular edema or photoreceptor loss.
  • Posterior subcapsular cataracts are common and severity is age dependent. Reduced color vision may also be found.
  • RP can be either isolated or syndromic, i.e., associated with extraocular manifestations such as in Usher syndrome or in Bardet-Biedle syndrome. From a genetic point of view, RP is highly heterogeneous, with autosomal dominant, autosomal recessive and X-linked patterns of inheritance. A significant percentage of RP patients, however, are apparently sporadic.
  • LCA has a prevalence of about 2-3 in 100,000 individuals and is characterized by a severe visual impairment that starts in the first months/years of life [37]. LCA has retinal, ocular as well as extraocular features, and occasionally systemic associations. LCA is inherited as an autosomal recessive trait in the large majority of patients, while autosomal dominant inheritance has been described only in a limited number of cases.
  • LCA is genetically heterogeneous and, to date, mutations have been identified in 15 different genes: GUCY2D (locus name: LCA1), RPE65 (LCA2), SPATA 7 (LCA3), AIPL1 (LCA4), LCA5 (LCA5), RPGRIP1 (LCA6), CRX (LCA7), CRB1 (LCA8), CEP290 (LCA10), IMPDH1 (LCA11), RD3 (LCA12), NMNAT1 (LCA9), LRAT (LCA 14), TULP1 (LCA 15), and RDH12 (LCA13).
  • the diagnosis of LCA is established by clinical findings. Molecular genetic testing is clinically available for the 15 genes currently known to be associated with LCA. Collectively, mutations in these genes are estimated to account for approximately 40%-50% of all LCA cases, depending on the survey.
  • CRDs Cone-rod dystrophies
  • RP retinopathy-receptors
  • CRDs reflect the opposite sequence of events.
  • CRD is characterized by a primary cone involvement, or, sometimes, by concomitant loss of both cones and rods that explains the predominant symptoms of CRDs: decreased visual acuity, color vision defects, photo-aversion and decreased sensitivity in the central visual field, later followed by progressive loss in peripheral vision and night blindness [38]. Mutations in at least 20 different genes have been associated with CRD (RETnet web site: http://www.sph.uth.tmc.edu/RetNet/).
  • Cone dystrophies are conditions in which cone photoreceptors display a selective dysfunction that does not extend to rods. They are characterized by visual deficit, abnormalities of color vision, visual field loss, and a variable degree of nystagmus and photophobia. In CDs, cone function is absent or severely impaired on electroretinography (ERG) and psychophysical testing [39]. Similar to the other forms of inherited retinal dystrophies, CDs are heterogeneous conditions that can be caused by mutations in at least 10 different genes (RETnet web site: http://www.sph.uth.tmc.edu/RetNet/). Stargardt disease is an inherited retinal disease the most prevalent childhood-onset macular dystrophywith an estimated prevalence of 1 in 10,000 individuals .
  • the autosomal recessive form of the disease typically presents within the first two decades of life, even though symptoms can also appear during adulthood and as late as the seventh decade.
  • STGD1 is usually characterized by macular degeneration and progressive loss of central vision causing blurry vision and, occasionally, an increasing difficulty to adapt in the dark.
  • Peripheral vision is usually normal. Most affected individuals also have impaired color vision. Photophobia may be present.
  • STGD1 has been linked to mutations in the ABCA4 gene, which encodes an adenosine triphosphate (ATP)-binding cassette transporter (ABCR) expressed specifically in the cones and rods of the retina.
  • ATP adenosine triphosphate
  • ABCR adenosine triphosphate-binding cassette transporter
  • Defects in ABCR function cause the accumulation of all-trans-retinal and its cytotoxic derivatives (e.g., diretinoid-pyridinium-ethanolamine) (lipofuscin pigments) in photoreceptors and retinal pigment epithelial (RPE) cells, ultimately causing RPE cell death and the subsequent loss of photoreceptors.
  • Mutations in ABCA4 have been linked to a spectrum of phenotypes ranging from STGD1 to cone rod dystrophy and severe early-onset retinal dystrophy.
  • a butterfly pattern of dystrophy is caused by mutations in a gene that encodes a membrane bound protein that is involved in the elongation of very long chain fatty acids.
  • Macular dystrophy refers to a group of heritable disorders that cause ophthalmoscopically visible abnormalities in the portion of the retina bounded by the temporal vascular arcades.
  • Macular dystrophies include but are not limited to Best macular dystrophy, Stargardt disease, Stargardt-like dominant macular dystrophy, Pattern dystrophy, Sorsby fundus dystrophy, Autosomal dominant radial drusen, North Carolina macular dystrophy, Spotted cystic dystrophy, Dominant cystoid macular edema
  • Age-related macular degeneration AMD is the most common cause of irreversible central vision loss in elderly patients. AMD has a significant genetic component. However, the genes that cause AMD interact with each other and with the environment in a sufficiently non- Mendelian fashion that it is not typically considered one of the macular dystrophies.
  • Diagnosis is based on dilated funduscopic findings are diagnostic; color photographs, fluorescein angiography, and optical coherence tomography AMD is the leading cause of permanent, irreversible vision loss in the elderly.
  • Age related macular degeneration occurs in two forms: Dry (nonexudative or atrophic); and Wet (exudative or neovascular).
  • Dry AMD causes changes of the retinal pigment epithelium, typically visible as dark pinpoint areas.
  • the retinal pigment epithelium plays a critical role in keeping the cones and rods healthy and functioning well. Accumulation of waste products from the rods and cones can result in drusen, which appear as yellow spots.
  • Areas of chorioretinal atrophy occur in more advanced cases of dry AMD.
  • macular scar disciform scar
  • edema edema
  • hemorrhage edema
  • exudation edema
  • Wet AMD occurs when new abnormal blood vessels develop under the retina in a process called choroidal neovascularization (abnormal new vessel formation).
  • choroidal neovascularization abnormal new vessel formation.
  • Localized macular edema or hemorrhage may elevate an area of the macula or cause a localized retinal pigment epithelial detachment.
  • untreated neovascularization causes a disciform scar under the macula.
  • Glaucoma is a progressive optic neuropathy characterized by axonal degeneration and retinal ganglion cells loss.
  • IOP intraocular pressure
  • the prophylactic and/or therapeutic methods described herein involve ameliorating one or more of the above symptoms (e.g., one or more symptoms selected from the group consisting of drusen or waste deposits on the surface of the retina, changes in color (pigment) of the macula, blurred or fuzzy vision, the illusion that straight lines are wavy; the illusion that some objects are smaller than they really are, the appearance of a gray, dark or empty area in the center of the visual field, and fading of color vision), and/or delaying the onset, slowing, stopping, or reversing the progression of one or more of these symptoms.
  • Lysosomal storage diseases are a group of about 70 inherited metabolic disorders that result from defects in lysosomal function.
  • Lysosomes are intracellular compartments that contain enzymes that digest large molecules and pass the fragments on to other parts of the cell for recycling. This process requires several critical enzymes and if one or more of these enzymes is defective, e.g., because of a mutation, the large molecules accumulate within the cell, eventually killing it.
  • Lysosomal storage disorders are caused by lysosomal dysfunction usually as a consequence of deficiency of a single enzyme required for the metabolism of lipids, glycoproteins, or so-called mucopolysaccharides.
  • LSDs occur with incidences of less than 1:100,000; however, as a group, the incidence is about 1:5,000 - 1:10,000 (see, e.g., Meikle et al. (1999) JAMA, 281(3): 249-254).
  • Most of these disorders are autosomal recessively inherited such as Niemann-Pick disease, type C, but a few are X-linked recessively inherited, such as Fabry disease and Hunter syndrome (MPS II).
  • Lysosomal disorders are usually triggered when a particular lysosome enzyme exists in too small an amount or is missing altogether. When this happens, excess products destined for breakdown and recycling are stored in the cell.
  • each disorder results from different gene mutations that translate into a deficiency in enzyme activity, they all share a common biochemical characteristic - all lysosomal disorders originate from an abnormal accumulation of substances inside the lysosome.
  • the LSDs are generally classified by the nature of the primary stored material involved, and can be broadly broken into the following: 1) Lipid storage disorders, mainly sphingolipidoses (including Gaucher's and Niemann-Pick diseases); 2) Gangliosidosis (including Tay-Sachs disease; 3) Leukodystrophies; 4) Mucopolysaccharidoses (including Hunter syndrome and Hurler disease); 5) glycoprotein storage disorders; and 6) mucolipidoses.
  • Lipid storage disorders mainly sphingolipidoses (including Gaucher's and Niemann-Pick diseases); 2) Gangliosidosis (including Tay-Sachs disease; 3) Leukodystrophies; 4) Mucopolysaccharidoses (including Hunter syndrome and Hurler disease); 5) glycoprotein storage disorders; and 6) mucolipidoses.
  • lysosomal storage diseases include but are not limited to, Sphingolipidoses, Ceramidase (e.g., Farber disease, Krabbe disease), Galactosialidosis, gangliosidoses including Alpha-galactosidases (e.g., Fabry disease (alpha-galactosidase A), Schindler disease (alpha-galactosidase B)), Beta-galactosidase (e.g., GM1 gangliosidosis, GM2 gangliosidosis, Sandhoff disease, Tay-Sachs disease), Glucocerebrosidoses (e.g., Gaucher disease (Type I, Type II, Type III), Sphingomyelinase (e.g., Lysosomal acid lipase deficiency, Niemann-Pick disease), Sulfatidosis (e.g., Metachromatic leukodystrophy.
  • Ceramidase e.
  • Mucopolysaccharidoses e.g., Type I (MPS I (Hurler syndrome, MPS I S Scheie syndrome, MPS I H-S Hurler-Scheie syndrome), Type II (Hunter syndrome), Type III (Sanfilippo syndrome), Type IV (Morquio), Type VI (Maroteaux-Lamy syndrome), Type VII (Sly syndrome), Type IX (hyaluronidase deficiency)), mucolipidoses (e.g., Type I (sialidosis), Type II (l-cell disease), Type III (pseudo-Hurler polydystrophy/phosphotransferase deficiency), Type IV (mucolipidin 1 deficiency)), lipidoses (e.g., Niemann-Pick disease), Neuronal ceroid lipofuscinoses (e.g., Type 1 Santavuori-Haltia disease/ infantile NCL (CLN1 PPT1)), Type 2
  • Mucopolysaccharidoses e.g., Type I (MPS I (Hurler syndrome, MPS I S Scheie syndrome, MPS I H-S Hurler-Scheie syndrome), Type II (Hunter syndrome), Type III (Sanfilippo syndrome), Type IV (Morquio), Type VI (Maroteaux-Lamy syndrome), Type VII (Sly syndrome), Type IX (hyaluronidase deficiency)
  • Type I MPS I
  • Hurler syndrome Hurler syndrome
  • MPS I S S Scheie syndrome MPS I H-S Hurler-Scheie syndrome
  • Type II Heunter syndrome
  • Type III Seippo syndrome
  • Type IV Mequio
  • Type VI Maroteaux-Lamy syndrome
  • Type VII Sly syndrome
  • Type IX hyaluronidase deficiency
  • Mucopolysaccharidosis type III (MPS III), is characterized by severe and rapid intellectual deterioration. Deficiencies in one of the four enzymes required for heparan sulfate (HS) degradation are responsible for each of the MPS III subtypes: heparan sulfamidase for MPS IIIA, alpha-N-acetylglucosaminidase for MPS NIB, alpha-glucosaminide N-acetyltransferase for MPS MIC, and N-acetylglucosamine-6-sulfate sulfatase for MPS HID.
  • Hurler syndrome also known as mucopolysaccharidosis type I (MPS I)
  • Hurler's disease also gargoylism
  • MPS I mucopolysaccharidosis type I
  • Hurler's disease also gargoylism
  • MPS I mucopolysaccharidosis type I
  • Hurler's disease also gargoylism
  • MPS I H or Hurler syndrome is the most severe of the MPS 1 subtypes.
  • the other two types are MPS I S or Scheie syndrome and MPS I H-S or Hurler-Scheie syndrome.
  • MPS II Mucopolysaccharidosis type II
  • Hunter syndrome is a condition that affects many different parts of the body and occurs almost exclusively in males. It is a progressively debilitating disorder.
  • MPS VII Mucopolysaccharidosis type VII
  • Sly syndrome is a progressive condition that affects most tissues and organs.
  • the most severe cases of MPS VII are characterized by hydrops fetalis, a condition in which excess fluid builds up in the body before birth. Most babies with hydrops fetalis are stillborn or die soon after birth.
  • MPS VII Other people with MPS VII typically begin to show signs and symptoms of the condition during early childhood.
  • the features of MPS VII include a large head (macrocephaly), a buildup of fluid in the brain (hydrocephalus), distinctive-looking facial features that are described as "coarse,” and a large tongue (macroglossia).
  • Affected individuals also frequently develop an enlarged liver and spleen (hepatosplenomegaly), heart valve abnormalities, and a soft out-pouching around the belly-button (umbilical hernia) or lower abdomen (inguinal hernia).
  • neuronal ceroid lipofuscinoses include, but are not limited to, infantile NCL (Santavuori-Haltia disease), late infantile NCL (Jansky-Bielschowsky disease, Juvenile NCL (CLN1, Batten disease), adult NCL (Kufs disease), Finnish Late Infantile NCL, Variant Late Infantile NCL, CLN7 NCL, CLN8 NCL (Northern Epilepsy, progressive epilepsy with mental retardation (EPMR)), Turkish Late Infantile Variant NCL, and CLN10 NCL (Congenital, Cathepsin D Deficiency).
  • NCLs Neuronal ceroid lipofuscinoses
  • NCL also called INCL or Santavuori-Haltia
  • NCL also called INCL or Santavuori-Haltia
  • individuals appear normal at birth, but early visual loss leading to complete retinal blindness by the age of 2 years is the first indicator of the disease; by 3 years of age a vegetative state is reached and by 4 years isoelectric encephalograms confirm brain death.
  • Late infantile variant usually manifests between 2 and 4 years of age with seizures and deterioration of vision. The maximum age before death for late infantile variant is 10-12 years.
  • Juvenile NCL Juvenile NCL (JNCL, Batten Disease, or Spielmeyer-Vogt), with a prevalence of 1 in 100,000, usually arises between 4 and 10 years of age; the first symptoms include considerable vision loss due to retinal dystrophy, with seizures, psychological degeneration, and eventual death in the mid- to late-20s or 30s ensuing.
  • Adult variant NCL (ANCL or Kufs Disease) generally manifests milder symptoms; however, while symptoms typically appear around 30 years of age, death usually occurs ten years later.
  • miR-211-/- mice display an impaired autophagic pathway.
  • MiR-211 expression levels are known to respond rapidly to dark-light transitions in mouse retinal neurons [40]. The inventors found that the peak in miR-211 expression levels coincided with light dependent activation of autophagy in the RPE/retina at 10:00 AM 3h after light on, as shown in Figure 1 (a-e, h).
  • miR211 may be involved in light-mediated autophagy activation.
  • GFP-LC3 transgenic mice [41, 42] were subretinally injected with an adeno-associated virus (AAV) vector encoding the human miR-211 precursor (AAV2/8-miR- 211).
  • AAV adeno-associated virus
  • Both retina and RPE specimens from miR-211-injected animals showed a significant increase in the number of both GFP-LC3-positive and GFP-LC3/Lampl-positive vesicles as shown in Figure 4 (a-e) as well as a significant increase in both lysosomal marker LAMP1 and lipidated LC3II levels [at 10:00 AM 3h after light on as shown in Figure 4 f].
  • retina and RPE specimens from miR-211-injected animals showed a significant decrease of Ezrin staining Figure 4 g., confirming the miR-211-mediated targeting of Ezrin.
  • Autophagy in the retina shows circadian rhythmicity [43] and is associated with lipofuscin accumulation in rod and cone photoreceptors [44] .
  • the inventors surprisingly found that during the dark/light transitions the protein Ezrin was expressed in the retina and RPE with an opposite correlation to the LC3 autophagy marker.
  • the eyes of mice that ubiquitously express the autophagosome marker MAP1LC3 tagged with green fluorescent protein (GFP) (GFP-LC3tg/+) [41] were analyzed in order to confirm the correlation between circadian rhythm and autophagy markers.
  • GFP green fluorescent protein
  • Ezrin is a member of the ERM (Ezrin/Radixin/Moesin) family of proteins [19] which regulates membrane cytoskeleton complexes, playing key roles in cellular processes like maintenance of membrane dynamics, survival, adhesion, motility, cytokinesis, phagocytosis and integration of membrane transport with signaling pathways.
  • Ezrin expression in GFP-LC3tg/+ mice using antibodies that recognize the endogenous Ezrin and the active phosphorylated form shows that Ezrin and pT567-Ezrin expression are inversely related to LC3 expression, with a high expression detected 3h after light off (10:00 PM - dark) ( Figure 5 c, e) and a very low expression detected 3h after light on (10:00 AM -light) ( Figure 5 d, f).
  • the inventors then separated the retina from the RPE in order to specifically collect RPE tissue, which actively participates to the visual cycle [8] for photoreceptor outer segments (POS) degradation as well as maintenance of retinoid levels to support a proper vision [8].
  • the protein levels of both Ezrin and its pT567-Ezrin phosphorylated form in RPE of wild type mice at different dark and light conditions were quantified by western blot, as shown in Figure 5 g. Specifically, total protein was extracted from the collected samples and the expression levels were measured by western blot.
  • Ezrin-GFP expression resulted in repression of autophagy as assessed by immunofluorescence staining for Lampl ( Figure 10 ( a-b')) and Western blot analysis for autophagic markers.
  • Ezrin overexpression led to a reduction of both lipidated LC3II and Lampl and an increase of SQSTMl/p62 autophagy substrate ( Figure 10 d).
  • NSC668394 treatment rescued the Ezrin-mediated inhibition of autophagy, supporting the ability of NSC668394 in targeting and repressing Ezrin ( Figure 10 a-d).
  • treated cells also displayed an increase of Lampl-positive structures as detected by immuno-electron microscopy (EM) analysis as shown in figure 8 (a-c).
  • EM immuno-electron microscopy
  • autophagic flux was measured by monitoring LC3II protein levels in different conditions.
  • the most well-known inducer of autophagy is nutrient starvation, both in cultured cells and in intact organisms, ranging from yeast to mammals.
  • bafilomycin Al which inhibits acidification inside the lysosome, the degradation of LC3-II is blocked, resulting in the accumulation of LC3-II [53].
  • the inventors developed additional Ezrin inhibitors by using siRNA oligonucleotides targeting Ezrin mRNA, as indicated in Table I above.
  • ARPE-19 cells were transfected with siRNA oligonucleotides specific for Ezrin or with control siRNA. 48h later cells were left untreated, serum starved or treated with bafilomycin Al, and then LC3II was measured as shown above. siRNA mediated inhibition of Ezrin further increased both LC3 and Lampl protein levels as well as their co-localization, strongly supporting enhancement of autophagosome-lysosome fusion ( Figure 9 (a-c)). Consistently, an increased rate of autophagosome-lysosome fusion in Ezrin-siRNA-treated ARPE-19 cells using the LC3 protein tandem-tagged with red fluorescent protein-green fluorescent protein (RFP-GFP) was observed, as shown in figure 9 (d-f).
  • RFP-GFP red fluorescent protein-green fluorescent protein
  • Autophagy is the homeostatic process through which damaged proteins and organelles are cleared from the cells, physiologically activated for survival under a broad range of cellular stress-inducing conditions, mediating the degradation of protein aggregates, oxidized lipids, damaged organelles and intracellular pathogens.
  • TFEB transcription factor EB
  • physiological activation of autophagy requires the cellular activation of a transcriptional program controlling major steps of the autophagic pathway, including autophagosome formation, autophagosome-lysosome fusion and substrate degradation.
  • TFEB nuclear translocation induced by nutrient starvation is strictly associated to a lower molecular weight compared to that of normally fed cells, as revealed by western blot analysis.
  • induction of TFEB, a master gene for lysosomal biogenesis and autophagy [42] reduces the pathologic accumulation of glycosaminoglycans in different neurodegenerative Lysosomal Storage Disorder (LSD) models, ameliorates tissue pathology in a murine mode!
  • both Mg 2+ and Ca 2+ influx modulates the protein phosphatase Calcineurin (PPP3CB) [54, 59, 60], which in turn dephosphorylates and activates the transcription factor EB (TFEB) [54], a master regulator of lysosomal biogenesis and the autophagy pathway [42].
  • PPP3CB protein phosphatase Calcineurin
  • TFEB transcription factor EB
  • Ezrin cellular interacting proteins candidates were identified by coupling immunoprecipitation experiments of GFP:tagged-Ezrin in ARPE-19 cells to quantitative high pressure nanoflow liquid chromatography-mass spectrometry-based proteomics (HPLC-MS) [62]
  • the candidates, listed in Table 2 were then analyzed for biological function by using the publicly available Functional Annotation data [63] established in the AmiGO and the GO Consortium's annotation toolkit [64, 65].
  • the analysis showed many terms related to "metabolism".
  • BPs Biological Process terms
  • MAGT1 a highly selective transporter of Mg2+, showed 96% of its BPs related to metabolic processes, and its activation is known to promote a significant increase in free Mg2+ concentrations enhancing PLCyl activation and Ca2+ signaling [67], which in turn activates Calcineurin [54, 59, 60].
  • FIG 11 (a) ARPE-19 cells were transiently transfected with GFP or EZRIN-GFP. After cell lysis, whole protein extracts were immunoprecipitated with Agarose Anti-Green Fluorescent Protein. The immuno complex was washed with lysis buffer, and the immunoprecipitation (IP) was revealed with anti-MAGTl. (b) Immunoprecipitation experiments of the EZRIN-GFP form were coupled to quantitative nanoflow liquid chromatography-mass spectrometry (LC-MS) analysis. Volcano plot of EZRIN-GFP interactors in ARPE-19 cells, (c) List of most statistically significant interactors of Ezrin.
  • LC-MS quantitative nanoflow liquid chromatography-mass spectrometry
  • the inventors formulated the hypothesis that Ezrin might modulate autophagy by controlling MAGTl-dependent Mg2+ flux followed to Ca2+ signaling and modulation of TFEB nuclear translocation in the RPE.
  • a physical interaction between EZRIN and MAGT1 at cytoplasmic membrane was further confirmed, using Proximity Ligation Assay (PLA) [68] on the endogenous Ezrin protein in MAGTl-transfected living cells ( Figure 11 (d-e')).
  • PHA Proximity Ligation Assay
  • Figure 12 shows representative experiments of TFEB nuclear translocation in HeLaTFEB-GFP cells transfected with siCTRL (b,f) or siPPP3CB (g,k) and treated with DMSO (b,g) or NSC668394 (c,h), silenced for EZRIN (d,i) or for EZRIN and MAGT1 (e,j) or serum-starved (f,k).
  • siCTRL b,f
  • siPPP3CB g,k
  • NSC668394 c,h
  • FIG 12 panels o-u show nuclear translocation of TFEB in stable HeLaTFEB-GFP cells subjected to the indicated conditions is reduced after Ca2+ chelator BAPTA treatment.
  • the graph of Figure 12 u shows the mean ⁇ s.e.m. of the percentage of nuclear TFEB translocation in Ezrin-inhibited cells compared with DMSO under Ca2+ chelator BAPTA treatment.
  • the inventors further investigated whether silencing of MAGT1 would inhibit autophagy and reestablish normal lipidated LC3II and Lampl expression levels in both miR-211 gain-of-function (GoF) and Ezrin loss of function (LoF) models.
  • siRNA-mediated silencing of MAGT1 strongly reduced autophagic flux and led to a reduction of both lipidated LC3II and Lampl and an increase of the autophagy substrate SQSTMl/p62 in ARPE-19 cells.
  • Figure 11 f- g" shows representative images from ARPE-19 cells transiently transfected with siCTRL (f-g") or siMAGTl (f'-g").
  • Figure llh shows Western blot analysis of LAMP1, SQSTMl/p62, MAGT1 and LC3 proteins from siCTRL or siMAGTl transfected cells. The plot shows the quantification of the indicated proteins normalized to the b-Actin loading control.
  • Figure Hi shows Western blot analysis from ARPE-19 cells transiently transfected with siCTRL or siMAGTl cultured in normal medium (stv-), starved HBSS medium (stv+), supplemented with bafilomycin (baf +) or without bafilomycin (baf -) as the quantification of LC3-II intensity.
  • silencing of MAGT1 abolished autophagy upregulation in both miR-211 GoF and Ezrin LoF, as seen in Figure 13 (a-j), wherein staining of endogenous LAMP1 and LC3 from ARPE- 19 cells: represents how silencing of MAGT1 reduces induction of autophagy in Ezrin-inhibited cells by miR-211, siEZR, and NSC668394 treatment.
  • MAGT1 is identified as an Ezrin-interacting protein that acts downstream of Ezrin in the regulation of autophagy and that modulation of its activity may interfere with Ezrin- mediated autophagy control.
  • GFP-LC3 transgenic mice were injected daily intraperitoneally with NSC668394, at a dose of 0.26 mg/Kg, whose pharmacokinetic studies demonstrated a monophasic elimination after 1-2 hours from the plasma [29].
  • NSC668394 daily injections of NSC668394 at 8:00 AM, 5 times a week, over two consecutive weeks was efficient in inducing autophagy in the RPE/retina of 3-month-old GFP-LC3 transgenic mice.
  • NSC668394 treated, but not vehicle treated, rescued upregulation of Ezrin levels, as shown in Figure 14 (h-k) and in turn normalized the daily autophagy activation in the RPE/retina miR-211-/-, as demonstrated by recovery of both the lysosomal marker LAMP1 and lipidated LC3II levels and reduction in the autophagy substrate SQSTMl/p62 upon the switch from dark to light conditions as demonstrated in both western and immunofluorescence assays ( Figure 14 d-l).
  • Figure 15 (e) representative flicker traces at three months of age show the rescue of flicker responses of NSC668394-treated miR-211-/- mice (green lines) compared to DMSO-treated miR-211-/- control mice (red lines).
  • WT mice were used as a control (black lines).
  • Flicker recordings were performed with light intensities ranging from 10-4 to 15 cd s/m2 in steps of 0.6 logarithmic units at 6 Hz frequency.
  • Figure 15 (f) shows flicker responses, plotted as a function of stimulus intensity, from WT (black lines), DMSO-treated miR-211-/- (red lines) and NSC668394-treated miR-211-/- (green lines) mice, at three months of age.
  • the amplitude of the recordings from NSC668394 miR-211-/- treated mice was significantly rescued compared to DMSO-treated miR-211-/- mice.
  • WT mice were used as a control.
  • the main group of genetic disorders affecting the eye is represented by inherited retinal dystrophies (IRD), which include, among others, Retinitis Pigmentosa (RP), one of the leading causes of inherited blindness.
  • IRD retinal dystrophies
  • RP Retinitis Pigmentosa
  • These diseases show a great diversity in clinical phenotypes; patients may develop visual loss in early childhood, whereas others may remain asymptomatic until mid-adulthood. They share a common pathological hallmark, death of rod cells, resulting in the development of night blindness with visual field restrictions, accompanied by subsequent loss of cone cells leading to a complete loss of visual fields.
  • proof-of-concept studies are shedding new light on the pathological mechanisms behind eye disorders.
  • the inventors first investigated an autosomal dominant form of retinitis pigmentosa (adRP) for which an animal model is available: the P23H-Rho +/ mouse model for adRP, in which mutated Rhodopsin accumulated in the ER.
  • adRP retinitis pigmentosa
  • This knock-in mouse line carries a copy of the human Rhodopsin gene harboring a proline-to-histidine substitution in position 23 of the protein.
  • This mutation is responsible for a form of RP in human patients.
  • the retinal phenotype in this mouse model appears up to 1 month of postnatal life.
  • Figure 16 (i) shows ERG responses (a- and b-wave), plotted as a function of stimulus intensity, from WT (black lines), DMSO-treated Rho-P23H (red lines) and NSC668394-treated Rho-P23H (green lines) mice, at two months of age.
  • Figure 16 (j) shows representative ERG (a- and b-wave) at two months of age show the rescue of ERG responses of NSC668394-treated Rho-P23H mice (green lines) compared to DMSO- treated Rho-P23H control (red lines) mice. WT mice were used as a control (black lines).
  • FIG. 17 shows a Model of Ezrin mediated regulation of autophagy: under light phase conditions Ezrin is repressed by miR-211. The inhibition of Ezrin releases the MAGT1 transporter from its repression, thus increasing a Mg2+ microdomain influx .and the corresponding PLCyl- mediated induction of Ca2+ flux into cells. This leads to calcineurin activation and autophagy induction via TFEB nuclear translocation. Under night phase conditions Ezrin is upregulated and represses MAGTl-mediated autophagy process.
  • Ezrin-exerted inhibition of lysosomal pathway as very likely to be Ca2+-dependent and mediated by regulation of Calcineurin and its target TFEB gene.
  • Ezrin has been reported to participate in retaining Ca2+-ion channels within multiprotein complex at cytoplasmic membrane and regulate Ca2+ homeostasis in different cell types [33-35].
  • the inventors found a yet unreported function of Ezrin inhibition in inducing an increased rate of Ca2+-mediated activation of Calcineurin through Mucolipin 1 channel and the corresponding activation of lysosomal biogenesis and autophagy via TFEB nuclear translocation. More importantly, these molecular events converge and integrate to mTOR pathway due the fact that Ezrin participates to TSC lysosomal translocation and mTOR pathway.
  • Aipll Aryl hydrocarbon interacting protein like 1
  • LCA Leber congenital amaurosis
  • RP RP
  • cone-rod dystrophy atypicallycerosis
  • PDE6 phosphodiesterase 6
  • Aipll -/ mice were injected daily intraperitoneally starting at postnatal day (P) 6, 5 times a week over two consecutive weeks, with NSC668394, at a dose of 0.26 mg/Kg; mice were sacrificed at P21.
  • P postnatal day
  • mice were sacrificed at P21.
  • Figure 18 In contrast, in the eyes of Aipll-/- untreated mice only a single row of photoreceptor nuclei is present ( Figure 18).
  • a significant increase in the number of preserved rows as well as an increase in density of photoreceptor nuclei were observed in the eyes of the NSC668394-treated Aipll-/- animals, ( Figure 18).
  • Stargardt's Disease is an autosomal recessive hereditary disease included in the group of degenerative macular diseases, which consists in progressive loss of cones in the fovea of both eyes, leading to variable levels of central vision loss.
  • STGD Stargardt's Disease
  • the presence of yellowish flecks around the macula is often observed, a condition called fundus flavimaculatus. It usually develops between 7 and 12 years of age, with an estimated prevalence of 1/10,000 individuals, which makes this disease the largest cause of inherited macular degeneration affecting the photoreceptor cells in the first and second decades of life, and correspond to 7% of all retinal dystrophies.
  • This disease was first described as an autosomal recessive inherited disease, but there are some described cases of dominant pattern.
  • the recessive pattern which includes more than 90% of cases, is due to a defect at chromosome Iq21-pl3. The dominant pattern seems to be related to a change at chromosome 6, but some studies also reported the location on chromosome 12.
  • the gene responsible for recessive Stargardt's disease has been identified as the ABCA4 gene.
  • a photoreceptor cell-specific ATP-binding transporter gene (ABCR) is mutated in recessive Stargardt macular dystrophy.
  • Other diseases associated with mutations in ABCA4 include cone-rod dystrophy.
  • Ezrin inhibition was further tested in a model of Mucopolysaccharidosis type 7 (MPS VII or Sly syndrome) that is a rare lysosomal storage disease belonging to the group of mucopolysaccharidoses, resulting from a deficiency of b- glucuronidase (GUSB).
  • MPS VII Mucopolysaccharidosis type 7
  • GUSB b- glucuronidase
  • the phenotype ranges from severe lethal hydrops fetalis to mild forms with survival into adulthood. Most patients with the intermediate phenotype show hepatomegaly, skeletal anomalies, coarse facies, and variable degrees of mental impairment.
  • MPS VII lacks an efficient treatment. Newborn MPS VII mice were injected daily intraperitoneally with NSC668394 at a dose of 0.26 mg/Kg, 5 times a week over two consecutive weeks. Control mice were injected with vehicle only. Mice were sacrificed after 15 days (P 19). At postnatal day 19 (P19) untreated MPSVII mice show significant reduced femur and tibia lengths compared to wild type mice as shown in Figure 20 a,b.
  • the Rho-P23 transgenic mice (/?ho-P23H) is the most used animal model for the autosomal dominant Retinitis Pigmentosa as previously described [73].
  • the Aipll / mice a model for a Leber congenital amaurosis (LCA) that accounts for at least 5% of all inherited retinal disease and is the most severe inherited retinopathy as previously described [74].
  • the Abca4 / mice a model for the Stargardt disease as previously described [75].
  • Recombinant AAV vectors containing the murine precursor sequence of mmu-miR-211 under the cytomegalovirus (CMV) promoter were constructed by using the following oligonucleotides: 5' -AT AAG AAT G CGG CCG CT CT G ACCAT GCAAT CACAG -3' and 5'-
  • AAV vectors were produced by the TIG EM AAV Vector Core by triple transfection of HEK293 cells followed by two rounds of CsCh purification, as previously described [77].
  • mice GFP-LC3 mice were housed at the Institute of Genetics and Biophysics animal house (Naples, Italy) and maintained under a 12-h light/dark cycle (10-50 lux exposure during the light phase). Mice were anesthetized as previously described [78], then AAV2/8 vectors were delivered subretinally via a trans-scleral trans-choroidal approach as described by Liang et al. [79]. All eyes were treated with 1 mI of AAV2/8 vector solution, at a dose of lxlO 9 genome copies/eye. Mice were sacrificed 1 month post-injection as previously described [80]. Overnight dark-adaptation of mice was performed before sacrifice.
  • Drug treatments were performed by once daily intraperitoneal injection of NSC668394, at a dose of 0.26 mg/Kg, and of NSC305787 at a dose of 0.24 mg/kg, as previously described [29].
  • Light/Dark adaptation of treated mice was performed following standard procedures [40]. Light adapted animals were kept in a room at 450 lux. For dark adaptation, animals were kept in a dark chamber with a maximum of 0.4 lux. Tissues from DA mice were isolated under dim red light.
  • Scotopic and photopic electrophysiological recordings were performed as described [81].
  • a CSO RETIMAX with a LED Ganzfeld stimulator (Costrumony Strumenti Oftalmici, Florence, Italy) was used for Rho-P23H. Briefly, mice were dark-adapted for 3 hours. Animals were anesthetized and positioned in a stereotaxic apparatus under dim red light. Their pupils were dilated with a drop of 0.5% tropicamide (Visufarma, Rome, Italy) and body temperature was maintained at 37.5°C.
  • the electrophysiological signals were recorded through gold-plate electrodes inserted under the lower eyelids in contact with the cornea. The electrodes in each eye were referred to a needle electrode inserted subcutaneously at the level of the corresponding frontal region.
  • the different electrodes were connected to a two-channel amplifier.
  • ERG analysis in dark- adapted conditions (scotopic), eyes were stimulated with light flashes. 11 different light intensity stimuli were used ranging from 1 x 10-4 to 20 cd*s/m2. Amplitudes of a- and b-waves were plotted as a function of increasing light intensity.
  • the recording session continued with the purpose of dissecting the cone pathway through the photopic ERG.
  • Photopic cone responses were isolated in light conditions with a constant background illumination of 50 cd/m2, with 10 flashes and a light intensity of 20 cd*s/m2. Cone response was then better isolated using Flicker analysis [82].
  • mice were stimulated with a fixed frequency of 6 Hz and flashes of 13 different light intensities, ranging from 10-4 to 15 cd*s/m 2 generated by the Ganzfeld stimulator. To minimize the noise, different responses evoked by light were averaged for each luminance step.
  • DMEM Dulbecco's Modified Eagle Medium
  • DMEM Dulbecco's Modified Eagle Medium
  • DMEM Dulbecco's Modified Eagle Medium
  • All cell lines were maintained at 37°C, 5% C02 in a humidified incubator according to the guidelines provided by the vendors.
  • Stably HeLaTFEB-GFP and HeLaTFEB-KO cell lines were described in [69, 83].
  • NSC668394 Ezrin Inhibitor
  • DMSO DMSO
  • serial dilutions of NSC668394 were obtained from the dilution of 10-mM stock into complete medium and added to plates starting at 30 mM to 0,1 mM. Final concentration of DMSO did not exceed 0.25% in the dose-response assays.
  • Cells were incubated toghether with drugs from 6 to 48 h at 37 °C and 5% C02.
  • ARPE19 cells loaded with 100mM A2E (ACME BIOSCIENCE INC, AB4344 (MLL)) for 5 hours.
  • Ezrin-GFP Ezrin T567D
  • Ezrin T567A Ezrin T567A
  • RFP-GFP-Tandem tagged LC3 was provided by C.Settembre's lab (Tigem, Pozzuoli) [42, 49].
  • the MAGT1-GFP expressing vector has been described by Cherepanova et al and was
  • mice and cell samples were lysed by using RIPA buffer (150 mM sodium chloride, 1% Triton X-100, 0.5% sodium deoxycholate, 0.1% sodium dodecyl sulfate, 50 mM Tris, pH 8.0) with inhibitors cocktail fixed. The concentration of total protein was determined by Bradford analysis and quantified by using NanoDrop ND- 8000 spectrophotometer (NanoDrop Technologies).
  • Proteins were fractionated by sodium dodecyl sulfate polyacrilamide gel electrophoresis (SDS-PAGE) and transferred to PVDF membranes (EMD Millipore, IPVH00010), then blocked in Tris-buffered saline containing 5% nonfat milk or 1% Bovine Serum Albumine (Sigma- Aldrich, 9048-46-8) for lhr at RT and subsequently incubated overnight at 4°C with primary antibodies.
  • SDS-PAGE sodium dodecyl sulfate polyacrilamide gel electrophoresis
  • mice Anti-Lampl (1:500, Sigma-Aldrich, L1418
  • Anti-LC3 (1:1000, Novus LC3B/MAP1LC3B
  • mouse Anti-Ezrin (1:1000, Novex, 357300
  • rabbit Anti-phosphoEzrin (Th567) (1:700 Sigma- Aldrich, PA5-37763 )
  • Anti-Beclin (1:1000, Cell Signaling
  • Rabbit Anti-Cln5 (1:1000, Abeam AB126306)
  • Rabbit Anti-Trpmll (1:1000, ALOMONE Lab ACC-081)
  • Mouse Anti-CtsD (1:1000, Santa Cruz SC-377124
  • rabbit Anti-TSCl (1:1000, Cell signalling, #6935
  • rabbit Anti-TSC2 (1:1000, Cell signalling, #4308)
  • mouse Anti- -Actin (1: 700, Sigma-Ald
  • the membranes were incubated, for lhr at room temperature, with the following secondary anibodies: Goat Anti-Rabbit IgG Antibody, HPR conjugate and Goat Anti- Mouse IgG Antibody HPR conjugate (1:10000 EMD Millipore, 12-348; 12-349).
  • Western blot detection was done with GE detector (GE Healthcare Life Sciences) and quantified using ImageJ software.
  • cells were transfected with GFP-tagged vectors. Then cells were solubilized in lysis buffer (TRIS-HCI 1,5M pH7.5, NaCI 150mM, 1% EDTA and 2% Tryton 100X) added with protease inhibitors and phosphatase inhibitors (Thermo Fischer Scientific, 78420). An equal amount of each protein lysate was incubated with Agarose Anti-Green Fluorescent Protein (Vector, MB0732) overnight at 4°C on a rotating wheel.
  • lysis buffer TriS-HCI 1,5M pH7.5, NaCI 150mM, 1% EDTA and 2% Tryton 100X
  • protease inhibitors and phosphatase inhibitors Thermo Fischer Scientific, 78420.
  • An equal amount of each protein lysate was incubated with Agarose Anti-Green Fluorescent Protein (Vector, MB0732) overnight at 4°C on a rotating wheel.
  • the Escherichia coli strains DH5a (Invitrogen, Carlsbad, CA, USA) were used for propagation and construction of all plasmid constructs. For each transformation, 10-50 ng of DNA was added to 100 mI of chemically competent cells and incubated on ice for 30 minutes, followed by heat shock at 42°C for 1 min and incubation on ice for 2 minutes. The cells were allowed to recover in 1 ml Luria-Bertani broth (LB broth: 1% Bacto-Tryptone, 1% NaCI and 0.5% Bacto-Yeast extract) broth and then incubated for lhr at 37°C with shaking (200-250 rpm).
  • Luria-Bertani broth LB broth: 1% Bacto-Tryptone, 1% NaCI and 0.5% Bacto-Yeast extract
  • mice Anti- Lampl Hybridoma Bank 1D4B
  • rat Anti-Lampl Santa Cruz 1D4B: scl9992
  • rabbit Anti-LC3B (1:100, Novus bio NB100-2220
  • rabbit Anti-Cone-Arrestin (1:1000, EMD Millipore, AB15282
  • mouse Anti-Ezrin (1:100, Novex, 357300
  • rabbit Anti-phosphoEzrin Th567) (1:100, Sigma- Aldrich, PA5-37763
  • mouse Anti-Rhodopsin 1:5000, Abeam, ab3267). All the incubations were performed overnight at 4°C.
  • Cells were seeded at 50% of confluence in 96-well plates and allowed to attach overnight. The day after cells were loaded with 0,2 pg/mI of Dextran, Alexa Fluor 568 (Invitrogen) in complete medium for 6 hours then the Dextran was wash with PBS and cell were incubate for further 48h with different concentration of NSC668394. Cells were fixed with 4% paraformaldehyde and washed three times in PBS. Nuclei were counter-stained with Hoechst (Invitrogen) and cytoplasm were stained with cellMask deep red (Invitrogen). Images were acquired on random fields per well using Opera (PerkinElmer) with 40x objective; Image analysis were performed using "Columbus image data storage and analysis System".
  • ARPE-19 cells were seeded in 96-well or 6-well plates and allowed to attach overnight. The day after cells were transfected with either control siRNA or ezrin siRNA for 48 hours or treated with NSC668394 for 6 hours. After the treatment cells were incubated with 100 nM LysoTracker Red probes (Life Technologies) for 30 minutes in complete medium. For Opera analysis cells were fixed with 4% paraformaldehyde and washed three times in PBS. Nuclei were counter-stained with Hoechst (Invitrogen) and cytoplasm were stained with cellMask deep red (Invitrogen). Images were acquired on random fields per well using Opera (PerkinElmer) with 40x objective; Image analysis were performed using "Columbus image data storage and analysis System". For FACS analysis adherent cells are detached by trypsinization, followed by centrifugation and resuspension in PBS. LysoTracker intensity was detected by BD FACS Aria III.
  • ln-situ MAGT1-GFP and Ezrin interactions revealed as red fluorescent dots, were detected using the Duolink II PLAkit (Olink Bioscience, Uppsala, Sweden), according to the manufacturer's instructions. GFP transfection was used as a negative control. Immunofluorescence was performed using an anti-GFP antibody in combination with an anti-Ezrin antibody. Nuclei were counterstained with DAPI.
  • TFEB nuclear translocation analysis was performed as previous described [54].
  • HeLa TFEB GFP cells were seeded in 96-well plates and allowed to attach overnight. The day after cells were pre incubated with 10 mM BAPTA-AM (Invitrogen) for 30 minutes and then were treated with starvation medium (HBSS, 10 mM HEPES) or with NSC668394 with or without 10 mM BAPTA-AM for 3 h. Cells were fixed with 4% paraformaldehyde and washed three times in PBS. Nuclei were counter-stained with Hoechst (Invitrogen) and the cytoplasm was stained with cellMask deep red (Invitrogen).
  • Cells were seeded in 96-well microplates (25,000 cells/well) in 100 mI medium and transfected with si MAGT1 for 48 h. Cells were incubated for 18 h with a Mg 2+ -free solution (150 mM NaCI, 0.1 mM CaCI 2 , 10 mM HEPES, 10 mM mannitol, 10 mM glucose, MEM non-essential amino acids lx, MEM amino acids lx, pH 7.4), and then loaded with 1 mM MagFluo-4-AM (M14206, Invitrogen) for 1 h at 37 °C in the same solution.
  • Mg 2+ -free solution 150 mM NaCI, 0.1 mM CaCI 2 , 10 mM HEPES, 10 mM mannitol, 10 mM glucose, MEM non-essential amino acids lx, MEM amino acids lx, pH 7.4
  • mice retina were fixed using the mixture of 2% paraformaldehyde and 1% glutaraldehyde prepared in 0.2 M HEPES buffer (pH 7.4) for 24 h at 4°C.
  • ARPE19 cells were fixed with the mixture of 4% PFA and 0.05% GA for 10 min at RT, then washed with 4% PFA once to remove the residual GA and fixed again with 4% PFA for 30 min at RT. Next the cells were incubated with the blocking/permeabilizing mixture (0.5% BSA, 0.1% saponin, 50 mM NH 4 CI) for 30 min and subsequently with the primary monoclonal antibody against LAMP1, diluted 1:500 in blocking/ permeabilizing solution.
  • the blocking/permeabilizing mixture (0.5% BSA, 0.1% saponin, 50 mM NH 4 CI
  • the cells were washed and incubated with the secondary antibody, the anti-rabbit Fab fragment coupled to 1.4-nm gold particles (diluted 1:50 in blocking/ permeabilizing solution) for 2h at RT. All specimens (retina and cells) then were post-fixed as described in [85]. After dehydration the specimens were embedded in epoxy resin and polymerized at 60°C for 72 hr. Thin 60 nm sections were cut at the Leica EM UC7 microtome. EM images were acquired from thin sections using a FEI Tecnai-12 electron microscope equipped with a VELETTA CCD digital camera (FEI, Eindhoven, The Netherlands). Morphometric analysis on the size of lysosomes and the distribution of gold particles at the lysosomal structures was performed using iTEM software (Olympus SYS, Germany).
  • the inventors used the miRCURYLNA detection miR-211 probe from Exiqon (double 5' -3' dig). In situ hybridization of 30 nM of probe was performed using the miRCURY LNA microRNA ISH Optimization kit according to the manufacturer's protocol (Exiqon), with minor modifications. As a negative control, a double-DIG-labeled LNA scrambled microRNA probe, included in the above kit, was hybridized in parallel at the same concentration and optimal hybridization temperature (50°C). Mouse cryosections were treated with 5 pg/mL proteinase K for 15 min.
  • Sections were blocked for 1 h with 1% blocking reagent (Roche) in 100 mM maleic acid, 150 mM NaCI, and 0.1% Tween 20 (pH 7.5; MABT) containing 10% sheep serum and incubated with alkaline phosphatase (AP)-labeled anti-digoxigenin antibody (1:2000; Roche) in 1% blocking reagent in MABT overnight at 4°C. After extensive washes with PBS containing 0.1% Tween 20 (PBT), sections were exposed to the alkaline phosphatase substrate nitroblue tetrazolium and 5-bromo-4-chloro-3-indoyl phosphate (NBT-BCIP; Sigma-Aldrich, St. Louis, MO).
  • Qiagen QuantiTect Reverse Transcription Kit
  • the PCR conditions for all the genes were as follows: preheating, 95°C for 60 s; cycling, 45 cycles of 95°C for 10 s, 60°C for 10 s and 72°C for 15 s. Quantified results were expressed in terms of cycle threshold (Ct).
  • Ct cycle threshold
  • Plasmids containing either the WT 3'UTR sequence or its mutated version containing three point mutations in the seed of the predicted miR-211 target site of the human EZRIN gene, and psiUx plasmid constructs containing the hsa-pre-miR-211 sequence were used in Luciferase assays, as previously described [86]. Each assay was performed in triplicate, and all results are shown as means ⁇ SD of at least three independent assays.
  • the primer sequences used to amplify each transcript, both WT and with mutagenized miR-211 target site were 3'UTR-EZR Forward 5'- CAGTTCT AG AAT ACATT GTAC-3' (SEQ ID No.
  • GFP beads were washed three times with 50 mM Tris, pH 7.5. Then, purified proteins were digested and eluted by adding 2 M urea in 50 mM Tris, pH 7.5, 1 mM DTT, and 150 ng EndoLysC (Wako Chemicals USA, Inc.) and 150 ng trypsin (Promega). The digestion was stopped by adding 1 mI trifluoroacetic acid, and peptides of each experiment were purified on C18 Stage Tips.
  • Raw MS data were processed using MaxQuant version 1.5.3.15 (Cox and Mann, 2008; Cox et al., 2011) with an FDR ⁇ 0.01 at the level of proteins, peptides and modifications. Searches were performed against the Human UniProt FASTA database (September 2014). Enzyme specificity was set to trypsin, and the search included cysteine carbamidomethylation as a fixed modification and N-acetylation of protein, oxidation of methionine, and/or phosphorylation of Ser, Thr, Tyr residue (PhosphoSTY) as variable modifications. Up to three missed cleavages were allowed for protease digestion, and peptides had to be fully tryptic.
  • Quantification was performed by MaxQuant, 'match between runs' was enabled, with a matching time window of 0.5-0.7 min. Bioinformatic analyses were performed with Perseus (doi:10.1038/nmeth.3901). Significance was assessed using two-sample student's t-test, for which replicates were grouped, and statistical tests performed with permutation-based FDR correction for multiple hypothesis testing. Missing data points were replaced by data imputation after filtering for valid values (all valid values in at least one experimental group).
  • the Functional Annotation analysis [63, 87] was performed to understand the distinctive biological nature of the EZR putative protein partners.
  • the significantly modulated proteins (Student T Test, FDR O.l) obtained by MS experiment were characterized for the Biological Processes (BPs) in which they are mainly involved.
  • the DAVID online tool (DAVID Bioinformatics Resources 6.7) was used restricting the output to all Biological Process terms (BP_ALL).
  • the study gave Functional Annotation (FA) results for 28 EZR putative protein partners genes.
  • the list of 418 BP terms was mapped on the GO hierarchy [88] rooted in the Metabolic Process (G0:0008152) term: the inventors found that in the list of all Biological Processes found at least in one putative EZRIN protein partners, 105 terms were "children" of the Metabolic Process. Finally, the inventors calculated the percent of these "children” terms for each gene, MAGT1 was the gene with the highest percent: 96% (24 "children" of the Metabolic Process out of 25 BPs terms).
  • the Magic RedTM Cathepsin B kit uses a quick and easy method to analyse intracellular Cathepsin B protease activity in whole living cells. Cells were seeded at 50% confluence. The day After were incubated with Ezrin Inhibitor lOuM for 3h. After treatment cells were washed with medium and loaded with Magic RedTM Cathepsin B in plain medium for 20 minutes and counter-stained with hoechst 3325, finally cells were washed and quickly analysed with Opera (Perkin Elmer). Single cell quantitative high content imaging was utilized for automated fluorescence imaging to determine the average spot area stained by Cathepsin B. Cathepsin B activity was measured by a fluorometric assay kit (AB65300; Abeam, Cambridge, MA, USA) following manufacturer's instructions.
  • ARPE-19 cells were seeded in m-slide 8 well (IBIDI) and transfected with a plasmid encoding the perilysosomal-localized MLl-GCaMP3 calcium probe (Medina et al 2015). After 24 hours, cells were washed with PBS and incubated with 150 mI of PBS for 5 minutes at room temperature. Then, the slide was moved on the stage of an inverted microscope equipped with GFP filter, 40X oil immersion objective (Olympus), LAMBDA DG4 (Sutter Instrument), Prime emos camera (Photometries) and MetaMorph Imaging Acquisition Software (Molecular Devices).
  • IBIDI m-slide 8 well
  • Time-lapse experiments were carried-out with 200 ms exposure time, 500 ms interval and 5-6 minutes total duration. Analysis was performed with MetaMorph Software in single cell ROI. After background subtraction, fluorescence recordings were normalized for the initial value. Data are presented as representative fluorescence recording traces and as bar graph showing the mean values ⁇ s.e.m. of the time required by fluorescence to decay to half of the peak elicited by ML-
  • Ezrin induces lysosomal Ca 2+ release through mucolipin 1 (TRPML1) channel and activates lysosomal function.
  • Ezrin is a widely expressed protein that links the actin cytoskeleton to various proteins and has been shown to be involved in a large spectra of cellular functions (i.e. cell motility, cell-cell and cell-matrix recognition, etc.) directly depending on its conformational states and its interactors [89]. Ezrin has been also reported to regulate Ca 2+ homeostasis in different cell types through its essential role in retaining ion-channels within multiprotein complex at plasma membrane [61, 90, 91].
  • TRPML1 mucolipin 1
  • PPP3CB protein phosphatase Calcineurin
  • TFEB a master regulator of CLEAR (Coordinated Lysosomal Expression and Regulation) network
  • CLEAR Coordinatd Lysosomal Expression and Regulation
  • calcium dynamics in the close proximity of lysosomal membrane were monitored using tihe fluorescent calcium-sensitive GCaMP3 probe fused to TRPML1 [54].
  • TRPML1 activity was triggered with the selective activator ML-SA1.
  • Addition of this compound resulted in a rapid localized calcium increase that showed a fast decline to near resting levels in approximately 100 s (Fig. 21).
  • cells receiving NSC668394, or genetically silenced for Ezrin showed a much more sustained response to ML- SA1 (Fig. 21).
  • this sustained phase was highly sensitive to ML-SI3, a specific inhibitor of TRPML1 (Fig. 21), strongly supporting that Ezrin inhibition results in a potentiation of TRPML1 sensitivity to activating stimuli.
  • mTORCl is a major regulator of the autophagy and is regulated by starvation, growth factors and cellular stressors [93].
  • the activation state of mTORCl on lysosomal surface is directly controlled by TSC complex playing a critical role in turning off the activity of Rheb, an essential activator of mTORCl [93].
  • T567-Ezrin phosphorylation has been reported to be also specifically inhibited by the small molecule NSC305787 through its direct binding to Ezrin [27].
  • ARPE-19 cells were cultured in the presence of NSC305787 for 6h and autophagy was assessed. Immunostaining showed an increase of both LC3 and Lampl staining and of their co-localization, strongly supporting enhancement of autophagosome-lysosome fusion ( Figure 23 (a-b”)). Moreover, a TSC lysosomal translocation was also noticed (Fig. 23 c-f”), along with activation of lysosomal biogenesis and function (Fig. 23 g)..
  • Ezrin under light phase conditions Ezrin is repressed by miR-211.
  • the inhibition of Ezrin releases the MAGT1 transporter from its repression, thus increasing a Mg2+ microdomain influx and the corresponding PLCyl-mediated induction of Ca2+ flux into cells.
  • Ca2+ flux depending on the lysosomal Mucolipin 1 activity.
  • This leads to calcineurin (Cn) activation and autophagy induction via TFEB nuclear translocation.
  • Cn calcineurin
  • inhibition of Ezrin induces TSC lysosomal translocation and inhibition of mTOR pathway supporting both lysosomal biogenesis and function.
  • Ezrin Under night phase conditions Ezrin is upregulated and induces TSC cytoplasmic translocation, represses MAGT1 and consequently reduces autophagy process.

Abstract

The present invention is related to ezrin inhibitors and their therapeutic use.

Description

Ezrin inhibitors and uses thereof
Field of the invention
The present invention is related to ezrin inhibitors and their therapeutic use.
Background of the invention
Autophagy is an evolutionarily conserved self-degradative process used by the cells to degrade and recycle cellular components. During macroautophagy, the most common type of autophagy, double-membrane-bound autophagosomes enclose cytoplasmic material and then fuse with lysosomes for final degradation [1]. Autophagy is physiologically activated for survival under a broad range of cellular stress-inducing conditions and mediates the degradation of protein aggregates, oxidized lipids, damaged organelles and intracellular pathogens. Once they reach the lysosomes, these materials are degraded by lysosomal hydrolases and the resulting breakdown products are used to generate new cellular components and energy in response to the nutritional needs of the cell. The degradation products are recycled to synthesize new cellular components or to generate energy in response to nutritional needs. Thus, lysosomes are essential organelles not only for their degradative capacity but also for their role in mediating signalling pathways and nutrient sensing mechanisms that regulate cell metabolism and growth.
The role of autophagy in human health and disease is complex. Given its important cytoprotective role in response to stress, dysregulation of autophagy results in many pathophysiological alterations, and is implicated in a range of pathologies, from cancer to neurodegeneration.
Indeed, autophagy occurs constitutively in neurons under physiological conditions. Impairment of autophagy leads to neurodegeneration and has been implicated in the pathogenesis of many neurodevelopmental and neurodegenerative disorders.
Autophagic flux in the retinal pigmented epithelium (RPE) and in the retina is critical for the visual cycle.
The retinal pigment epithelium (RPE) is a monolayer of polarized pigmented epithelial cells that resides between vessels of the choriocapillaris and the light-sensitive outer segments of photoreceptors (PR). The RPE exerts a number of different functions for the maintenance of retinal homeostasis under stress conditions and the preservation of vision [2]. The RPE provides part of the retinal-blood barrier, thus mediating selective transport of nutrients, 02 and ions [3] to the retina, and also supplies the enzymes required for isomerization of all-trans retinal to 11- cis retinal, the visual chromophore required for PR excitability [4]. Most importantly, the RPE prevents photo-oxidative product toxicity by contributing to the daily renewal of the PR outer segment (POS), a critical process for the maintenance of PR structural integrity and function [5- 7]. PR continuously renew their POS via the diurnal shedding of distal spent POS tips, which are phagocytized by the RPE to rapidly clear them from the retina. Phagocytosis of POS was recently reported to be an important trigger of autophagy in the RPE. A subset of autophagy-related proteins, including Beclinl and ATG5, are cyclically engaged in the RPE to act in LC3-associated phagocytosis (LAP), a noncanonical form of autophagy [8]. Once lipidated, LC3II is recruited to the POS-ingested phagosomes, which then fuse with the lysosome forming phagolysosomes for the degradation and recycling of the ingested POS cargo. Importantly, some autophagy-related proteins, such as ATG5, are required for LC3II localization to POS-containing phagosomes [9]. These findings support a direct convergence of phagosome maturation and autophagy for the final degradation of PR outer segments in the RPE. The time course of lipidated LC3II formation is delayed when compared to the peak of POS shedding and LAP in the RPE, strongly arguing for an additional role of the lysosomal-autophagy pathway in post-phagocytosis processing of POS and reestablishment of RPE homeostasis. In addition, an oscillation of autophagy-related genes was observed to be rapidly responsive to changes in light environment supporting a light- dependent regulation of autophagy other than circadian-mediated POS shedding and phagocytosis [10]. However, an understanding of the mechanisms that regulate autophagy induction and that underlie autophagy adaptation to different states of light and dark conditions is still at an initial phase. Notably, defects in autophagy-related genes have been implicated in the pathogenesis of Retinitis Pigmentosa (RP) and contribute to increased susceptibility to age- related macular degeneration (AMD) since cells with diminished degradative processes are highly sensitive to the accumulation of toxic debris that can be deleterious for the lifespan of the cell [11-16],
Proof-of-concept studies are shedding new light on the pathological mechanisms behind RP disorders. Recent findings in autosomal dominant retinitis pigmentosa (adRP), which represent up to 30% of all cases of RP, have pointed out the role of mistrafficking and accumulation of mutated and unfolded proteins in impairment of normal cellular function and induction of toxicity in photoreceptor cells [17, 18]. Mutations in adRP genes induce toxic intracellular accumulation of aggregation-prone proteins, leading to the recruitment of ER-resident chaperones and initiation of the unfolded protein response (UPR) to disengage protein synthesis and favor protein degradation. The insoluble proteins aggregate within the ER where they ought to be targeted for translocation from the ER to the ubiquitin-proteasome system (UPS) for degradation in the cytosol. However, the unsuccessful execution of these responses causes UPS overloading and the build-up of said toxic aggregation-prone proteins', ultimately leading to a block of autophagy and photoreceptor cell death through apoptosis (5).
Although each disorder results from mutations in different genes, they all share a common biochemical characteristic: abnormal accumulation of substances resulting in autophagy dysfunction. To date, no effective therapy to counteract autophagy impairment in RP has been developed.
Furthermore, autophagy is becoming more and more clearly involved in the pathogenesis of many diseases of various origins, spanning from cancer to neurodegenerative diseases, to metabolic diseases and lysosomal storage disorders. Thus, there is a need for autophagy enhancing drugs which act in a tissue specific manner to increase the autophagy process with therapeutic effects.
Ezrin is a member of the ERM (Ezrin/Radixin/Moesin) family of proteins and is conserved through evolution both structurally and functionally [19]. By regulating membrane cytoskeleton complexes, it plays key roles in normal cellular processes like maintenance of membrane dynamics, survival, adhesion, motility, cytokinesis, phagocytosis and integration of membrane transport with signaling pathways [20]. Both in vivo and in vitro studies show that ezrin function is actively regulated by its conformational changes [19]. Ezrin exists in an inactive conformation, in which the membrane and actin binding sites are masked by intramolecular interaction of the N-terminal and the last 100 amino acids of the long Carboxy terminal domains [21]. In its active- open confirmation, it functions as a crosslinker between the plasma membrane and the cortical cytoskeleton. Two factors are reported to be involved in this conformational transition, binding of N-terminal domain to the phosphotidylinositol 4,5 biphosphates (PIP2) and phosphorylation of a conserved threonine at residue 567 (T567) in the F-actin binding site [19]. Several studies have described the expression of Ezrin in many tissues [22]. In adult mouse tissues, Ezrin is expressed at high levels in small intestine, stomach, lung, pancreas, and kidney; at intermediate levels in spleen, thymus, lymph nodes, and bone marrow; at very low levels in heart, brain, and testis; and undetectable in muscle and liver [23, 24]. Importantly, Ezrin is highly expressed in the RPE [25]. Zhan et al., [26] describe that Ezrin is downregulated in a well-recognized AMD model, the light induced RPE degeneration, hypothesizing that downregulation of Ezrin has a role in the pathogenesis of AMD.
Ezrin inhibitors are described in WO2012064396 and in [27, 28] as inhibitors of cancer cells growth, and as such as potential therapeutic agents for the treatment of metastatic osteosarcoma (OS) and multiple cancers including pancreatic cancer, ovarian cancer and rhabdomyosarcoma.
Ezrin inhibitors have not been reported to induce autophagy in a subject. There remains a need in the art for therapeutic methods of inducing autophagy.
Summary of the invention
The present invention is based on the surprising finding that inhibitors of Ezrin induce lysosomal biogenesis and function and increase autophagy-mediated cell clearance. The invention is also based on the finding that MAGT1 is an ezrin interactor that acts downstream of ezrin, that inhibition of Ezrin induces a Mg2+ influx in RPE cells, thus promoting a Mucolipin 1- mediated Ca2+-influx resulting in activation of Calcineurin, and nuclear translocation of the transcription factor EB (TFEB), the master transcriptional regulator of lysosome biogenesis and function. This molecular network converges onto the mTOR pathway, with inhibition of Ezrin inducing a TSC (Tuberous sclerosis complex) lysosomal translocation followed by downregulation of mTOR pathway.
The present inventors have surprisingly found that inhibition of Ezrin induces autophagy both in the RPE and in other tissues and activates lysosome functions as characterized by an increase of Cathepsin B activity; they have demonstrated that inhibition of Ezrin is effective in treating disorders characterized by impaired autophagy, particularly eye disorders or eye diseases, preferably retinal disorders as well as lysosomal storage disorders, metabolic disorders and neurodegenerative storage disorders.
Diseases of particular interest for the present invention are diseases in which an increase of cellular clearance by means of increased autophagy and/or increased lysosomal functions is beneficial in order to clear accumulation of biomolecules including peptides, nucleic acids, carbohydrates, lipids and proteins , of misfolded proteins and/or aggregates of proteins and/or lipids which result toxic for the cell lifespan.
Lysosomal function includes at least one of the following features: a) ability in waste clearance due to lysosomal enzymatic activity (i.e. hydrolases, lipases; etc.), b) lysosomal exocytosis meaning the ability to empty waste-content outside the cell; c) fusion with autophagosomes and phagosomes to start degradative processes.
Lysosomal function includes but not is limited to lysosomal exocytosis.
Preferred diseases of the invention are disorders characterized by accumulation of toxic debris and impaired autophagy, particularly eye disorders or eye diseases, particularly retinal disorders as well as lysosomal storage disorders, metabolic disorders and neurodegenerative disorders. Among eye disorders, Glaucoma , retinal diseases including but not limited to: retinitis pigmentosa (eg autosomal dominant retinitis pigmentosa, autosomal recessive retinitis pigmentosa, X-linked retinitis pigmentosa), macular degeneration (eg macular dystrophies, age related macular degeneration, inherited macular degeneration, Stargardt disease), Leber congenital Amaurosis, Cone-rod dystrophies, cone dystrophies. Further preferred disorders of the invention are neurodegenerative disorders, eg neurodegenerative storage disorders, including but not limited to: Alzheimer's disease, Parkinson's disease. Preferred Lysosomal storage disorders of the invention are Mucopolysaccharidoses (eg mucopolysaccharidosis selected from the group consisting of Sanfilippo syndrome (MPS III), Hurler syndrome (MPS IH), Hurler-Scheie syndrome (MPS l-H/S), Scheie syndrome (MPS IS), Hunter syndrome (MPS II), Morquio syndrome (MP IV), Maroteaux-Lamy syndrome (MPS VI), Sly syndrome (MPS VII), and MPS IX) , Batten disease , Fabry's disease, Pompe's disease. Metabolic diseases within the meaning of the present invention are diabetes (eg type 2 diabetes), insulin resistance, dyslipidemia.
In the present invention, Ezrin has been identified by inventors as a direct target of miR-211. miR-211/autophagy and Ezrin show opposite day/night expression pattern: light induces up- regulation of miR-211 and induction of autophagy in RPE, while ezrin levels are decreased. Further, miR-211 over-expression induces autophagy in vitro in human adult retinal pigment epithelium 19 (ARPE19) cell line and in vivo in the retina of LC3II-GFP transgenic (Tg) mice. It decreases ezrin levels in RPE.
It was also surprisingly found that both siRNA-mediated and drug-mediated (NSC668394 and NSC305787) inhibition of ezrin induce autophagy in vitro in human adult retinal pigment epithelium 19 (ARPE19) cell line. Furthermore, pharmacological inhibition of Ezrin activity by NSC668394 and NSC305787 induces autophagy in LC3II-GFP Tg mice, showing that modulation of Ezrin activity also have an effect on autophagy pathway in vivo. Conversely, expression of a constitutively active form of Ezrin in normally fed cells results in autophagy pathway downshift. Further, pharmacological inhibition of Ezrin by NSC668394 and NSC305787 reduces pathologic accumulation of lipofuscin granules in vitro in human adult retinal pigment epithelium 19 (ARPE19) cell line treated with A2E. Pharmacological inhibition of Ezrin by NSC668394 and NSC305787 reduces pathologic accumulation of dextran in vitro in human adult retinal pigment epithelium 19 (ARPE19) cell line. Pharmacological inhibition of Ezrin by NSC668394 and NSC305787reduces pathologic accumulation of lipofuscin granules and rescues cone photoreceptor degeneration in miR-211 -/- mouse. Pharmacological inhibition of Ezrin by NSC668394 and NSC305787rescues photoreceptor degeneration in Aipll -/- mice (model of LCA4 retinal disease, in which the chaperone-like protein Aipll is absent) with a significant reduction in the number of apoptotic photoreceptor cells. Pharmacological inhibition of Ezrin by NSC668394 ameliorates bone phenotype in an MPS VII mouse model. Pharmacological inhibition of Ezrin by NSC668394 rescues phenotype of RHO-P23H mouse model of autosomal dominant Retinitis Pigmentosa (adRP).
Then, the invention provides a pharmaceutical composition comprising an inhibitor of ezrin or of its active form for use in the treatment and/or prevention of a condition or disease selected from the group consisting of: eye disease, retinal disease, neurodegenerative disease, preferably neurodegenerative storage disease, lysosomal storage disease and metabolic disease.
Preferably said inhibitor of ezrin or of its active form induces autophagy and/or activates lysosomal function in a subject.
Induction of autophagic flux is determined by any known method in the art, in particular by LC3II lipidation in starved cells, in the presence of bafilomycin (baf) and Baf/starvation condition compared to feed control cells as previously described in Guidelines for the use and interpretation of assays for monitoring autophagy (3rd edition). Autophagy. 2016;12(l):l-222. doi: 10.1080/15548627.2015.1100356.
Lysosomal function is the ability of the lysosome to clear waste through increased activity of lysosomal enzymes such as hydrolases, Cathepsin B, Cathepsin D, leading to recycling of nutrients via lysosomal exocytosis. Lysosomal function can be measured or assessed by any known method in the art or as described herein.
In the present invention the disease or condition is characterized by accumulation of toxic debris (i.e. misfolded protein) and impaired autophagy resulting in the decreased clearance of cellular waste via autophagy pathways (i.e. macroautophagy, microautophagy, chaperone-mediated autophagy etc. etc.).
Impaired autophagy is defined as impairment of the overall process that constitutes the autophagic pathway including autophagosome formation, impairment of lysosome- autophagosome fusion, lysosomes dysfunction (i.e. defect in enzymatic lysosomal hydrolases, Cathepsin B, Cathepsin D ).
Eye diseases are any of the diseases or disorders that affect the human eye and could lead to vision loss.
Of particular interest for the present invention are disorders of the inner eye, including the uveal tract (ie uveitis), diseases and disorders of the lens, diseases of the retina, (ie retinal detachment and retinal degeneration and dystrophy, macular degenerations and dystrophies), disorders of the optic nerve (ie glaucoma)
Preferably the retinal diseases is retinitis pigmentosa, macular degeneration, Leber congenital Amaurosis, cone-rod dystrophy, cone dystrophy, wherein the neurodegenerative disease is a neurodegenerative storage disorder, wherein the lysosomal storage disorders is a mucopolysaccharidosis, Batten disease, Fabry's disease, Pompe's disease and wherein the metabolic disease is diabetes, insulin resistance or dyslipidemia.
Still preferably the retinitis pigmentosa is autosomal dominant retinitis pigmentosa, autosomal recessive retinitis pigmentosa or X-linked retinitis pigmentosa, the macular degeneration is macular dystrophy, age-related macular degeneration, inherited macular degeneration or Stargardt disease, the neurodegenerative disease is Alzheimer's disease or Parkinson's disease, the mucopolysaccharidosis is Sanfilippo syndrome (MPS III), Hurler syndrome (MPS IH), Hurler- Scheie syndrome (MPS l-H/S), Scheie syndrome (MPS IS), Hunter syndrome (MPS II), Morquio syndrome (MP IV), Maroteaux-Lamy syndrome (MPS VI), Sly syndrome (MPS VII) or MPS IX and diabetes is type 2 diabetes.
Particularly preferred diseases of the invention are age-related macular degeneration, Stargardt's disease, retinitis pigmentosa (recessive or autosomal dominant), Leber congenital Amaurosis, cone-rod dystrophy, cone dystrophy, Batten disease, Alzheimer's disease, Parkinson's disease, Fabry's disease, Mucopolysaccharidoses, Pompe's disease, Glaucoma. More preferably the inhibitor is selected from the group consisting of:
a) a polypeptide; b) a polynucleotide coding for said polypeptide or a polynucleotide that inhibits or blocks ezrin or its active form expression and/or function;
c) a vector comprising or expressing said polynucleotide;
d) a host cell genetically engineered expressing said polypeptide or said polynucleotide; e) a small molecule;
f) a peptide, a protein, an antibody, an antisense oligonucleotide, a siRNA, antisense expression vector or recombinant virus or any other agent that inhibits or blocks ezrin or its active form expression and/or function.
Preferably the inhibitor is a siRNA or a miR, preferably said siRNA has the sequence: GCUCAAAGAUAAUGCUAUG (SEQ ID No. 1).
Preferably the inhibitor is NSC668394 or NSC305787 or analog thereof.
Still preferably the inhibitor is a MAGT1 inhibitor.
Still preferably, the inhibitor inhibits mTOR and/or induces Ca2+ flux into a cell.
More preferably the pharmaceutical composition further comprises a therapeutic agent, wherein said further therapeutic agent is for the treatment and/or prevention of eye disease, retinal disease, neurodegenerative disease, lysosomal storage disease and metabolic disease. Preferred diseases are as defined above.
In certain embodiments the prophylactic and/or therapeutic methods described herein involve ameliorating one or more of the above symptoms (e.g., one or more symptoms selected from macular degeneration and progressive loss of central vision causing blurry vision, difficulty to adapt in the dark, impaired color vision, photophobia), and/or delaying the onset, slowing, stopping, or reversing the progression of one or more of these symptoms.
The present invention will be illustrated by means of non-limiting examples in reference to the following drawings and figures.
Brief Description of the Drawings
Figure 1. Autophagy dysfunction in miR-211-/- mice, (a, b. a', b') Confocal images of representative eye cryosections immunostained with anti-GFP antibody from 2-months-old transgenic mice expressing the GFP-tagged autophagosome marker MAP1LC3 (GFP-LC3tg/+) sacrificed 3h after light off at 10 PM (DARK; a, c) and 3h after light on at 10 AM (LIGHT; b, d). Nuclei were counterstained with DAPI. At least n = 6 mice per group. Scale bar 100 pm. (c-d) RNA in situ hybridization analysis with a probe against miR-211 in 2-months-old WT mice sacrificed 3h after light off at 10 PM (DARK; c) and 3h after light on at 10 AM (LIGHT; d). At least n = 6 mice per group. Scale bar 100 pm.
(e) qRT-PCR assay for miR-211 from RPE 2-month-old WT mice sacrificed 3h after light off at 10 PM (DARK) and 3h after light on at 10 AM (LIGHT). The plot shows the expression level of miR- 211 normalized to the Hprt control. Bar graphs represent mean values ± s.e.m. of independent experiments (n=6 mice). Student's t-test (LIGHT vs DARK), *p < 0.05.
(f, f, g, g') Confocal images of representative eye cryosections immunostained with anti-Lampl (f, g') antibody from 2-months-old miR-211-/- mice sacrificed 3h after light off at 10 PM (DARK; f-f ) and 3h after light on at 10 AM (LIGHT; g-g'). Nuclei were counterstained with DAPI (f,g). At least n = 6 mice per group. Scale bar 100 pm.
(h) Representative Western blot to determine the expression levels of LC3II proteins in RPE isolated at 10 PM (DARK) and 10 AM (LIGHT) from 1-month-old WT and miR-211-/- mice. The plots show the quantification of the ratio of LC3II protein in light vs dark condition normalized to the jS-Actin loading control. Bar graphs represent mean values ± s.e.m. of independent experiments (n=6 mice). Student's t-test (miR-211-/- vs WT), ***p < 0.005.
(i) Representative Western blot analysis of the Lampl, SQSTMl/p62 and LC3II proteins from WT and miR-211-/- mice. The plots show the quantification of the indicated proteins normalized to the b- Actin loading control. Bar graphs represent mean values ± s.e.m. of independent experiments (n=6 mice) Student's t-test (miR-211-/- vs WT), *p < 0.05. (RPE) Retinal Pigment Epithelium; (OS) outer segment; (INL) inner nuclear layer; (ONL) outer nuclear layer.
Figure 2. MiR-211 participates in autophagy pathway, (a, b, b') EM analysis of RPE of 2-month- old WT (a) and miR-211_/ mice (b-b'). Scale bar 5 pm. Enlarged box in b' highlights phagolysosome-like structures containing poorly processed POS (black arrows) Scale bar 1.5 pm.
(c-d) Representative images of RPE shown at higher magnification also highlighted accumulation of lipofuscin (black arrows) accompanied by an enlargement of Bruch's membrane (dashed lines) in miR-211 ^ compared to control WT mice. Scale bar 500 nm.
(e) Graphs showing Bruch's membrane thickness from the RPE of mice as in c-d. Bar graphs represent mean values ± s.e.m. Student's t-test (miR-211-/- vs WT) ***p < 0.005.
(f) Graphs showing number of lipofuscin granules from the RPE of mice as in cd. Bar graphs represent mean values ± s.e.m. Student's t-test (miR-211-/- vs WT) **p < 0.01. (g, h, i, j) Electron microscopy analysis of lysosomal LAMP1 positive structures (black arrows) in ARPE-19 cells transfected with miR-ctrl, miR-211, anti-miR-ctrl, anti-miR-211. Scale bar 500 nm. (k-l) Quantifications of the number of lysosome-like structures and their size. Box plots graphs indicate the means values ± s.e.m. Student's t-test (miR-ctrl vs miR-211 and anti-miR-ctrl vs antimiR-211) *p < 0.05, **p < 0.01, ***p < 0.005.
Figure 3. miR-211 positively regulates autophagy in ARPE-19 cells. ARPE-19 cells transiently transfected with miR-ctrl (a, a', a"), miR-211 (b, b', b"), anti-miR-ctrl (c, c', c") or anti-miR-211 (d, d', d"). All cells were fixed and stained with anti-LC3 (a', b', c', d') and anti-LAMPl (a”, b", c", d") antibodies and nuclei were counterstained with DAPI (a, b, c, d). Scale bar 10 pm.
(e) The plot shows the quantification of the number of LC3/Lampl-positive dots per cell (n > 100) from three independent experiments. Student's t-test (miR-211 vs miR-ctrl and anti-miR- 211 vs anti-miR-ctrl) ***p < 0.005.
(f) Western blot analysis of the LAMP1, SQSTMl/p62 and LC3 proteins from miR-ctrl, miR-211, anti-miR-ctrl and anti-miR-211transfected cells. The plot shows the quantification of the indicated proteins normalized to the b-Actin loading control. Bar graphs represent mean values ± s.e.m. of at least 4 independent experiments. Student's t-test (miR-211 vs miR-ctrl and anti- miR-211 vs anti-miR-ctrl) *p < 0.05, ***p < 0.005.
(g) Western blot from ARPE-19 cells transiently transfected with miR-ctrl and miR-211 and cultured in normal medium (stv-), starved HBSS medium (stv+), or starved medium supplemented with bafilomycin (baf +) or without bafilomycin (baf -) and quantification of LC3- II intensity (relative to b-Actin as the loading control). Bar graphs represent mean values ± s.e.m. of at least 4 independent experiments. Student's t-test (unpaired) *p < 0.05, **p < 0.01.
(h) Western blot analysis of ARPE-19 cells transiently transfected with anti-miR-ctrl and anti- miR-211 and cultured in normal medium (stv-), starved HBSS medium (stv+), supplemented with bafilomycin (baf +) or without bafilomycin (baf -) as the quantification of LC3-II intensity (relative to b-Actin as the loading control). Bar graphs represent mean values ± s.e.m. of at least 4 independent experiments. Student's t-test (unpaired) *p < 0.05, ** p <0.01.
Figure 4. MiR-211 OE stimulates autophagy in vivo. Confocal images of eye cryosections immunostained with anti-GFP (a-b;) and anti-Lampl (a'-b') antibodies from three-months-old transgenic mice that express the green fluorescent protein (GFP)-tagged autophagosome marker MAP1LC3 (GFP-LC3tg/+) injected with scramble (a, a', a") or AAV 2/8 miR-211 (b, b', b''). Nuclei are counterstained with DAPI (a''-b"). At least n = 6 mice per group. Scale bar 100 pm. (c) Quantification of the number of LC3 positive dots per retinal section. At least n = 6 mice per group. Student's t-test (AAV 2/8-miR-211 vs scramble), *p < 0.05.
(d) Quantification of the number of Lampl positive dots per retinal section. At least n = 6 mice per group. Student's t-test (AAV 2/8-miR-211 vs scramble), *p < 0.05.
(e) Quantification of the number of LC3/Lampl positive dots per retinal section. At least n = 6 mice per group. Student's t-test (AAV 2/8-miR-211 vs scramble), *p < 0.05.
(f) western blot analysis of the Lampl and LC3II proteins from RPE and retina of three-months- old scramble and AAV 2/8-miR-211 GFP-LC3tg/+ injected mice. The plots show the quantification of the indicated proteins normalized by jS-Actin loading control. Bar graphs represent mean values ± s.e.m. of independent experiments (n=6 mice) Student's t-test (AAV 2/8-miR-211 vs scramble), *p < 0.05. (OS) outer segment; (ONL) outer nuclear layer.
(g, g', S" , h, h', h") Representative confocal images of eye cryosections immunostained with anti-Ezrin (a'-b"') antibody from 4-months-old WT mice, injected with scramble (a-a'") or AAV2/8-miR-211 together with AAV2/8-CMV:GFP. GFP marks transduced RPE/retina cells. Nuclei are counterstained with DAPI. At least n = 6 mice per group. Scale bar 10 pm.
(i) qRT-PCR assay for miR-211 from RPE 4-months-old WT mice sacrificed 3h after light on at 10 AM (diurnal condition - LIGHT). The plot shows the expression level of miR-211 normalized to the U6 snRNA control. Bar graphs represent mean values ± s.e.m. of independent experiments (n=6 mice). Student's t-test (scramble vs AAV2/8-miR-211), *p < 0.05.
Figure 5. Ezrin daily expression in RPE is inversely related to autophagy levels. Representative images of eye cryosections, immunostained with anti-Ezrin (a-b) or anti-Ezrin pT567 (c-d) antibodies, from 1-month-old WT mice sacrificed 3h after light off at 10 PM (DARK; a, c') and 3h after light on at 10 AM (LIGHT; b, d'). Nuclei were counterstained with DAPI (a', b', c', d'). At least n = 6 mice per group. Scale bar 100 pm. Representative images of eye cryosections, immunostained with an anti-Ezrin (e-f) or anti-Ezrin pT567 (g-h) antibodies, from 1-month-old miR-211-/- mice sacrificed at 10 PM (DARK; e, g') and 10 AM (LIGHT; f, h'). Nuclei were counterstained with DAPI (e', f , g', h'). At least n = 6 mice per group. Scale bar 100 pm.
(i) RPE were isolated at 10 PM (DARK) and 10 AM (LIGHT) from 1-month-old WT mice. Representative Western blots were performed to determine the expression levels of Ezrin and Ezrin pT567 proteins. The plots show the quantification of the indicated proteins normalized to the jS-Actin loading control. Bar graphs represent mean values ± s.e.m. of independent experiments (n=6 mice). Student's t-test (LIGHT vs DARK) *p < 0.05. (j) RPE were isolated at 10 PM (DARK) and 10 AM (LIGHT) from 1-month-old miR-211-/- mice. Representative Western blots were performed to determine the expression levels of Ezrin and Ezrin pT567 proteins. The plots show the quantification of the indicated proteins normalized to the b -Actin loading control. Bar graphs represent mean values ± s.e.m. of independent experiments (n=6 mice). (RPE) Retinal Pigment Epithelium; (OS) outer segment; (ONL) outer nuclear layer.
Figure 6. ARPE-19 cells transiently transfected with miR-ctrl (a), miR-211 (b), anti-miR-ctrl (c) or anti-miR-211 (d). All cells were fixed and stained with anti-EZRIN (a', b', c', d') antibody and nuclei were counterstained with DAPI (a-d). Scale bar 10 pm.
(e) qRT-PCR analysis for EZRIN was performed on ARPE-19 cells transfected with miR-ctrl, miR- 211, anti-miR-ctrl or anti-miR-211. At least 3 independent experiments were performed. Data are represented as mean +/- SEM. Student's t-test (miR-211 vs miR-ctrl and anti-miR-211 vs anti- miR-ctrl) *p < 0.05, ***p < 0.005.
(f) western blot analysis of EZRIN protein from miR-ctrl, miR-211, antimiR- Ctrl and anti-miR-211 transfected cells. The plot shows the quantification of the indicated proteins normalized by b- Actin loading control. Bar graphs represent mean values ± s.e.m. of at least 5 independent experiments. Student's t-test (miR-211 vs miR-ctrl and anti-miR-211 vs antimiR-ctrl) *p < 0.05, ***p < 0.005.
(g) Sequence alignment of miR-211 binding site in 3'-UTR of EZRIN shows a high level of complementarity and sequence conservation.
(h) Relative Luciferase activities as fold differences in the Luc/Renilla ratios normalized to the value of Luc reporter constructs. miR-211 addition significantly decreases Luc activity of the construct containing 3'- UTR of EZRIN when compared with controls (miR-ctrl and mutated 3'- UTR EZRIN). Bar graphs represent mean values ± s.e.m. of at least 3 independent experiments. Student's t-test *p < 0.05.
(i- ) Confocal images of eye cryosections immunostained with anti-Ezrin (I'-I') antibody from three-months-old WT (i-l') and miR-211 / (j-j') mice. Nuclei are counterstained with DAPI (l-l). At least n = 6 mice per group. Scale bar 100 pm.
(k-l') Confocal images of representative eye cryosections immunostained with anti-Ezrin (k', I') antibody from three-months-old WT mice injected with AAV 2/8 miR-211 (k-k') or scramble (I- I'). Nuclei are counterstained with DAPI (k,l). At least n = 6 mice per group. Scale bar 100 pm. (m) western blot analysis of Ezrin protein from RPE of three-months-old WT, miR-211-/-, AAV 2/8-miR-211 and scramble injected mice. The plots show the quantification of the indicated protein normalized by jS-Actin loading control. Bar graphs represent mean values ± s.e.m. of independent experiments (n=6 mice) Student's t-test (miR-211-/- vs WT and AAV 2/8-miR-211 vs scramble), *p < 0.05.
(n) qRT-PCR assay for Ezrin from RPE of three-months-old WT, miR-211-/-, AAV 2/8-miR-211 and scramble injected mice. The plot shows the expression level of Ezrin normalized by Hprt control. Bar graphs represent mean values ± s.e.m. of independent experiments (n=6 mice). Student's t- test (miR-211-/- vs WT and AAV 2/8-miR-211 vs scramble), *p < 0.05. (RPE) Retinal Pigment Epithelium; (OS)outer segment; (ONL) outer nuclear layer.
Figure 7. Ezrin pharmacological inhibition results in autophagy induction in ARPE-19 cells.
ARPE-19 cells treated with DMSO (a, a', a'') and NSC668394 (b, b', b"). All cells were fixed and stained with anti-LAMPl (a'-b') and anti-LC3 (a"-b") antibodies and nuclei were counterstained with DAPI (a-b). Scale bar 5 pm.
(c) quantification of the numbers of LC3/Lampl-positive dots per cell (n > 100) from 3 independent experiments. Student's t-test (NSC668394 vs DMSO) ***p < 0.005.
(d-e") Representative images of RFP-GFPLC3assay in ARPE-19 cells transiently transfected with RFP-GFP-LC3 and treated with DMSO (d, d', d'') or NSC668394 (e, e', e"). Nuclei were counterstained with DAPI (blue). Scale bars: 5 pm.
(f) Quantitative analysis of RFP+GFP+ puncta (Autophagosome) and RFP+GFP- puncta (Autolysosome). Box plots showing the mean values ± s.e.m of representative data (n > 100 cells) from 3 independent experiments. Student's t-test (NSC668394 vs DMSO) *p < 0.05.
(g) Western blots analysis of LAMP1, EZRIN pT567, SQSTMl/p62, and LC3 proteins from DMSO or NSC668394 treated cells. The plot shows the quantification of the indicated proteins normalized to the b-Actin loading control. Bar graphs represent mean values ± s.e.m. of at least n = 4 independent experiments. Student's t-test (NSC668394 vs DMSO) *p < 0.05, **p < 0.01, ***p < 0.005.
(h) Western blot analysis of ARPE-19 cells treated with NSC668394 or DMSO and cultured in normal medium (stv-), starved HBSS medium (stv+), supplemented with bafilomycin (baf +) or without bafilomycin (baf -) as the quantification of LC3-II intensity (relative to b-Actin as the loading control). Bar graphs represent mean values ± s.e.m. of at least 4 independent experiments. Student's t-test (unpaired). *p < 0.05, **p < 0.01, ***p < 0.005. (i-j") ARPE-19 cells transiently transfected with anti-miR-211and treated with DMSO (i- ) or NSC668394 (j-j"). All cells were fixed and stained with anti-LC3 (I, j) and anti-LAMPl (I', j') antibodies and nuclei were counterstained with DAPI (I", j"). Scale bar 10 mhi.
(k) Western blots analysis of LAMP1, SQSTMl/p62 and LC3 proteins from ARPE-19 cells transiently transfected with anti-miR-211 and treated with DMSO or NSC668394. The plot shows the quantification of the indicated proteins normalized to the b-Actin loading control. Bar graphs represent mean values ± s.e.m. of n = 4 independent experiments. Student's ttest (anti-miR-211+DMSO vs anti-miR-ctrl and anti-miR-211+NSC668394 vs anti-miR- 211+DMSO) *p < 0.05, ***p < 0.005.
(l-m') Endolysosomal chatepsin activity was revealed by incubation with cathepsin B Magic Red substrate for 20 min and images of the living cell collected on the HC analysis.
(n) Graph showing the mean values of intensity of crysel violet fluorescence ± s.e.m of representative data (n > 100 cells) from 3 independent experiments. Student's t-test (NSC668394 vs DMSO) ***p < 0.005.
Figure 8. Pharmacological and genetic inhibition of Ezrin induce autophagy. (a-b) Electron microscopy analysis of NSC668394-treated ARPE-19 cells. Lysosomal LAMP1- positive structures in DMSO and NSC668394-treated ARPE-19 cells. Scale bar 500 nm
(c) Quantifications of the number of lysosome-like structures. Box plots indicate the means values ± s.e.m. Student's t-test (NSC668394 vs DMSO) ***p < 0.005.
(d-e) Electron microscopy analysis of ARPE-19 cells transfected with siCTRL and siEZR. Lysosomal LAMPl-positive structures were highlighted by blue color (siCTRL) and pink color (siEZR). Scale bar 500 nm.
(f) Quantifications of the number of lysosome-like structures. Box plots indicate the means values ± s.e.m. Student's t-test (NSC668394 vs DMSO) **p < 0.01
Figure 9. siRNA mediated silencing of EZRIN results in autophagy induction. ARPE-19 cells transiently transfected with siCTRL (a, a', a'') and siEZR (b, b', b"). All cells were fixed and stained with anti-LC3 (a", b") and anti-LAMPl (a', b') antibodies and nuclei were counterstained with DAPI (a, b). Scale bar 10 pm.
(c) The plot shows the quantification of the numbers of LC3/Lampl-positive dots per cell (n > 100) from 3 independent experiments. Student's t-test (siEZR vs siCTRL) ***p < 0.005.
(d-e") RFP-GFP-LC3 assay in ARPE-19 cells transiently co-transfected with RFP-GFP-LC3 and siCTRL (d-d") and siEZR (e-e"). Scale bars 5 pm. (f) Quantitative analysis of RFP+GFP+ puncta (Autophagosome) and RFP+GFP- puncta (Autolysosome). Box plots indicate the mean values ± s.e.m of representative data (n > 100 cells) from 3 independent experiments. Student's t-test (siEZRIN vs siCTRL) ***p < 0.005.
(g) Western blots analysis of LAMP1, EZRIN, SQSTMl/p62, and LC3 proteins from siCTRL or siEZRIN transfected cells. The plot shows the quantification of the indicated proteins normalized to the b-Actin loading control. Bar graphs represent mean values ± s.e.m. of at least n = 4 independent experiments. Student's t-test (siEZR vs siCTRL) *p < 0.05, ***p < 0.005.
(h) Western blot analysis of ARPE-19 cells transiently transfected with siEZR or siCTRL and cultured in normal medium (stv-), starved HBSS medium (stv+), supplemented with bafilomycin (baf +) or without bafilomycin (baf -) as the quantification of LC3-II intensity (relative to b-Actin as the loading control). Bar graphs represent mean values ± s.e.m. of at least 4 independent experiments. Student's t-test (unpaired). *p < 0.05, **p < 0.01.
ARPE-19 cells transiently co-transfected with antimiR-211 and siCTRL (i-i") or siEZR (j-j"). All cells were fixed and stained with anti-LC3 (i, j) and anti-LAMPl (i', j') antibodies and nuclei were counterstained with DAPI (i'', j"). Scale bar 10 pm.
(k) Western blot analysis of LAMP1 and LC3 proteins from ARPE-19 cells transiently cotransfected with anti-miR-211-ctrl or anti-miR-211 and siCTR or siEZR. The plot shows the quantification of the indicated proteins normalized to the b-Actin loading control. Bar graphs represent mean values ± s.e.m. of n = 4 independent experiments. Student's t-test (anti-miR- 211+siCTRL vs anti-miR-ctrl+siCTRL and anti-miR-211+siEZRIN vs anti-miR-211+siCTRL), ***p< 0.005.
Figure 10. NSC668394 rescues inhibition of the autophagy mediated by EZRIN. ARPE-19 cells transiently transfected with GFP (a-a'') or EZRIN GFP (b-c") and treated with DMSO or NSC668394, respectively. All cells were fixed and stained with anti-LAMPl (a"-c") antibody and nuclei were counterstained with DAPI (a-c). Scale bar 10 pm.
(d) Western blot analysis of LAMP1, SQSTMl/p62 and LC3 proteins from ARPE-19 cells transiently transfected with GFP or EZRIN-GFP and treated with DMSO or NSC668394. The plot shows the quantification of the indicated proteins normalized to the b-Actin loading control. Bar graphs represent mean values ± s.e.m. of n = 3 independent experiments. Student's t-test (EZRINGFP DMSO vs GFP DMSO and EZRIN-GFP+NSC668394 vs EZRIN-GFP+DMSO), *p < 0.05,
**p < 0.01. ARPE-19 cells transfected with siEZR and treated with DMSO (e, e', e") or NSC668394 (f, f, f"). All cells were fixed and stained with anti-LAMPl (e"-f") and LC3 (e'-f ) antibodies and nuclei were counterstained with DAPI (e-f). Scale bar 5 pm.
(g) Western blot analysis of LAMP1, SQSTMl/p62 and LC3 proteins from ARPE-19 cells transiently transfected with siEZR and treated with DMSO or NSC668394. The plot shows the quantification of the indicated proteins normalized to the b-Actin loading control. Bar graphs represent mean values ± s.e.m. of n = 3 independent experiments.
Figure 11. MAGT1 is a new ezrin interactor, (a) Immunoprecipitation experiments of the EZRIN- GFP: ARPE-19 cells were transiently transfected with GFP or EZRIN-GFP. whole protein extracts were immunoprecipitated with Agarose Anti-Green Fluorescent Protein. The immuno complex was washed with lysis buffer, and the immunoprecipitation (IP) was revealed with anti-MAGTl.
(b) Immunoprecipitation experiments of EZRIN-GFP were coupled to quantitative nanoflow liquid chromatography-mass spectrometry (LC-MS) analysis. Volcano plot of EZRIN-GFP interactors in ARPE-19 cells.
(c) List of most statistically significant interactors of Ezrin.
(d-e") Proximity Ligation Assay (PLA) performed on ARPE-19 cells transfected with GFP (d-d") or MAGT1-GFP (e-e"). Interactions (<40 nm) of MAGT1 with EZRIN are indicated as dots. Nuclei were counterstained with DAPI (d-e). Scale bar 10 pm.
(f-g") ARPE-19 cells transiently transfected with siCTRL (f-f") or siMAGTl (g-g"). All cells were fixed and stained with anti-LC3 (f, g') and anti-LAMPl (f", g") antibodies and nuclei were counterstained with DAPI (f, g). Scale bar 10 pm.
(h) Western blot analysis of LAMP1, SQSTMl/p62, MAGT1 and LC3 proteins from siCTRL or siMAGTl transfected cells. The plot shows the quantification of the indicated proteins normalized to the b-Actin loading control. Bar graphs represent mean values ± s.e.m. of at least n = 4 independent experiments. Student's t-test (siMAGTl vs siCTRL) *p < 0.05, ***p < 0.005.
(i) Western blot analysis from ARPE-19 cells transiently transfected with siCTRL or siMAGTl cultured in normal medium (stv-), starved HBSS medium (stv+), supplemented with bafilomycin (baf +) or without bafilomycin (baf -). The plot shows the quantification of the indicated proteins normalized to the b-Actin loading control. Bar graphs represent mean values ± s.e.m. of at least n = 4 independent experiments. Student's t-test (unpaired). *p < 0.05, **p < 0.01.
Figure 12. Ezrin inhibition results in TFEB nuclear translocation, (a) Mg2+ influx (MagFluo4) in ARPE-19 cells stimulated with NSC668394 and silenced or not with siMAGTl. The left panel shows representative fluorescence readings (dots) and corresponding exponential fits in ARPE- 19 cells exposed to high extracellular Mg2+. The bar graph (right) reports the maximal rate of Mg2+ influx for the indicated conditions. Graphs represent the fold change of the slope of Mg2+ flux in ARPE-19 cells either unstimulated or stimulated with NSC668394 and silenced or not with siMAGTl. Each bar represents the mean values ± s.e.m. of at least 10 independent experiments. Student's t-test (NSC668394, siMAGTl and siMAGTl + NSC668394 vs WT) *p < 0.05, **p < 0.01, ***p < 0.005.
(b-k) Analysis of TFEB nuclear translocation in HeLaTFEB-GFP cells transfected with siCTRL (b-f) or siPPP3CB (g-k) and treated with DMSO (b-g) or NSC668394 (c-h), silenced for EZRIN (d-i) or for EZRIN and MAGT1 (e-j) or serum-starved (f, k).Both pharmacological inhibition (c) and silencing (d) of Ezrin induced TFEB nuclear localization in stable HeLaTFEB-GFP cells. Silencing of MAGT1 rescues siEZR-mediated TFEB nuclear localization in HeLaTFEB-GFP (e). Starvation (stv) was used as control (f). Nuclear translocation of TFEB in stable HeLaTFEB-GFP cells subjected to the indicated conditions is reduced after silencing of PPP3CB (g-k). Representative images from HC assay of HeLaTFEB-GFP cells transfected with control (siCTRL) or siPPP3CB, and subjected to the indicated conditions. Scale bar 5 pm.
(L) The graph shows the mean ± s.e.m. of the percentage of nuclear TFEB translocation in Ezrin- inhibited cells compared with DMSO. At least 4 independent experiments were performed. Student's t-test (NSC668394, siEZR, siEZR + siMAGTl and stv vs DMSO) ***p < 0.005.
(m) The graph shows the mean ± s.e.m. of the percentage of nuclearTFEB translocation in Ezrin- inhibited cells and subjected to the silencing of PPP3CB. At least 4 independent experiments were performed. Student's t-test (siPPP3CB vs siCTRL) ***p < 0.005.
(n) Both pharmacological inhibition and silencing of EZRIN induce downshift of endogenous TFEB electrophoretic mobility.
(o-t) Nuclear translocation of TFEB in stable HeLaTFEB-GFP cells subjected to the indicated conditions is reduced after Ca2+ chelator BAPTA treatment. Scale bar 5 pm.
(u) The graph shows the mean ± s.e.m. of the percentage of nuclear TFEB translocation in Ezrin- inhibited cells compared with DMSO under Ca2+ chelator BAPTA treatment. At least 4 independent experiments were performed. Student's t-test (stv, stv+BAPTA, BAPTA, NSC668394, NSC668394+BAPTA vs DMSO) *p < 0.05, ***p < 0.005.
(v) qRT-PCR analysis for TFEB target genes (MCOLN1, BECLIN, MAPLC3B and LAMP1) was performed on ARPE-19 cells treated with DMSO or NSC668394. Bar graphs represent mean values ± s.e.m. of at least 3 independent experiments. Student's t-test *p < 0.05, **p < 0.01, ***p < 0.005.
(w-x") HeLaTFEB-KO cells treated with DMSO (w-w") and NSC668394 (x-x"). All cells were fixed and stained with anti-LC3 (w'-x') and anti-LAMPl (w''-x") antibodies and nuclei were counterstained with DAPI (w-x). Scale bar 5 pm.
(y) Representative Western blots of LAMP1, SQSTMl/p62 and LC3 proteins from DMSO or NSC668394-treated HeLaTFEB-KO cells. The plot shows the quantification of the indicated proteins normalized to the b-Actin loading control. Bar graphs represent mean values ± s.e.m. of at least n = 3 independent experiments.
(z) Representative Western blots of LAMP1, SQSTMl/p62 and LC3 proteins from HeLaTFEB-KO cells transfected with GFP or EZRINGFP. The plot shows the quantification of the indicated proteins normalized to the b-Actin loading control. Bar graphs represent mean values ± s.e.m. of at least n = 3 independent experiments.
Figure 13. MAGT1 silencing rescues miR-211 OE and EZRIN downregulation effects on autophagy.
(a-g") endogenous LAMP1 (a"-g") and LC3 (a'-g') from ARPE-19 cells. Silencing of MAGT1 reduces induction of autophagy in Ezrin-inhibited cells by miR-211, siEZR, and NSC668394 treatment. Nuclei were counterstained with DAPI (a-g). Scale bar 5 pm.
(h) Western blot analysis of LAMP1, SQSTMl/p62 and LC3 proteins from ARPE-19 cells transfected with miR-211 or miR-211 together with siMAGTl. miR-ctrl was used as a control. The plot shows the quantification of the indicated proteins normalized to the b-Actin loading control. Bar graphs represent mean values ± s.e.m. of 4 independent experiments. Student's t- test (miR-211 vs miR-211-ctrl and miR-211+siMAGTl vs miR-211), *p < 0.05, ***p < 0.005.
(i) Western blot analysis of LAMP1, SQSTMl/p62 and LC3 proteins from ARPE-19 cells transfected with siEZRIN or siEZRIN together with siMAGTl. siCTRL was used as a control. The plot shows the quantification of the indicated proteins normalized to the b-Actin loading control. Bar graphs represent mean values ± s.e.m. of n = 4 independent experiments. Student's t-test (siEZRIN vs siCTRL and siEZRIN+siMAGTl vs siEZRIN), *p < 0.05, ***p < 0.005.
(j) Western blot analysis of LAMP1, SQSTMl/p62 and LC3 proteins from ARPE-19 cells transfected with siMAGTl and treated with DMSO or NSC668394. The plot shows the quantification of the indicated proteins normalized to the b-Actin loading control. Bar graphs represent mean values ± s.e.m. of 4 independent experiments. Student's t-test (NSC668394 vs DMSO and siMAGTl+DMSO vs NSC668394), *p < 0.05, ***p < 0.005.
Figure 14. NSC668394 rescues autophagy impairment in miR-211-/- mice, (a-b") Confocal images of eye cryosections immunostained with anti-GFP (a"-b") and anti-Lampl (a'-b') antibodies from 1-month-old transgenic mice that express the green fluorescent protein (GFP)- tagged autophagosome marker MAP1LC3 (GFPLC3 tg/+) sacrificed 2 months after DMSO (a-a") or NSC668394 (b-b") treatment. Nuclei are counterstained with DAPI (a, b). At least n = 6 mice per group. Scale bar 100 pm.
(c) RPE and retina from DMSO or NSC668394 treated GFP-LC3tg/+mice. Western blot analysis on proteins from these tissues were performed to determine the expression levels of Lampl and LC3II. The plots show the quantification of the indicated proteins normalized to the ?-Actin loading control. Bar graphs represent mean values ± s.e.m. of independent experiments (n=6 mice). Student's t-test (NSC668394 vs DMSO), *p < 0.05, ***p < 0.005.
(d-k') Confocal images of representative eye cryosections immunostained with anti-Lampl (d'- e'), anti-SQSTMl/p62 (f-g), anti-Ezrin (h'-l') and Ezrin pT567 (j'-k') antibodies from 1-month-old miR-211-/- sacrificed five months after DMSO (d, d', f, h, h', j, j') of NSC668394 (e, e', g, I, I', k, k') treatment. Nuclei are counterstained with DAPI (d, e, h, I, j, k). At least n = 6 mice per group. Scale bar 100 pm.
(I) RPE and retina from DMSO or NSC668394 treated miR-211-/- mice. Western blot analysis was performed to determine the expression levels of Lampl and LC3II. The plots show the quantification of the indicated proteins normalized to the /?-Actin loading control. Bar graphs represent mean values ± s.e.m. of independent experiments (n=6 mice). Student's t-test (DMS vs WTO NSC668394 vs DMSO), *p < 0.05, **p<0.001. (RPE) Retinal Pigment Epithelium; (OS) outer segment; (ONL) outer nuclear layer.
Figure 15. Pharmacological inhibition of Ezrin rescues the miR-211-/- phenotype, (a-c') Images of retina cryosections immunostained with anti-Cone Arrestin (a'-c') antibody from WT and miR- 211-/- mice at three months of age after DMSO or NSC668394 treatment. Nuclei are counterstained with DAPI (a-c). N = at least 6 mice per group. Scale bar 100 pm.
(d) Graphs show cone percentage (cones/area) from the retina of mice treated as in a-c. Error bars represent s.e.m. Student's t-test (DMSO vs WT and NSC668394 vs DMSO treated mice) *p < 0.05, **p < 0.01. (e) Representative flicker traces at three months of age show the rescue of flicker responses of NSC668394-treated miR-211-/- mice (green lines) compared to DMSO-treated miR- 211-/- control mice (red lines). WT mice were used as a control (black lines). Flicker recordings were performed with light intensities ranging from 10-4 to 15 cd s/m2 in steps of 0.6 logarithmic units at 6 Hz frequency.
(f) Flicker responses, plotted as a function of stimulus intensity, from WT (black lines), DMSO- treated miR-211-/- (red lines) and NSC668394-treated miR-211-/- (green lines) mice, at three months of age. The amplitude of the recordings from NSC668394 miR-211-/- treated mice is significantly rescued compared to DMSO-treated miR-211-/- mice. WT mice were used as a control. Error bars represent s.e.m. ANOVA test (DMSO vs WT and NSC668394 vs DMSO treated mice) **p < 0.01, ***p < 0.005.
(g-l') Confocal images of representative eye cryosections immunostained with anti-Rhodopsin (g'-i') antibody from WT and miR-211-/- mice at three months of age after DMSO or NSC668394 treatment. Nuclei are counterstained with DAPI (g-i). At least n = 6 mice per group. Scale bar 100 pm. The enlarged box highlights rhodopsin accumulation in the RPE (white spots).
(j-l) conventional EM analysis of RPE of WT (j), DMSO-treated miR-211-/- mice and NSC668394- treated miR-211-/- 2-month-old mice. NSC668394-treated miR-211-/- mice show rescue of engulfment of double-membrane phagolysosome-like structures containing poorly processed POS (black arrows) compared to DMSO-treated miR-211-/- mice. Scale bar 1 mm.
(m) Graphs showing Bruch's membrane thickness from the RPE of mice as in j-l. Bar graphs represent mean values ± s.e.m. Student's t-test (DMSO treated miR-211-/- vs WT and NSC668394 treated miR-211-/- vs DMSO treated miR-211-/-) *p < 0.05, ***p < 0.005. (OS) outer segment; (ONL) outer nuclear layer; (RPE) Retinal Pigment Epithelium; (PR) Photoreceptors, (h-r') Autofluorescence from lipofuscin granules from WT and miR-211-/- mice at three months of age after DMSO or NSC668394 treatment. Nuclei were counterstained with DAPI.
(q) Graphs showing number of lipofuscin granules from the RPE of mice as in a-c. Bar graphs represent mean values ± s.e.m. Student's t-test (miR-211-/- DMSO vs WT and miR-211-/- NSC668394 vs DMSO treated mice) ***p < 0.005. *p < 0.05.
Figure 16. Pharmacological inhibition of Ezrin rescues Rho-P23H. (a-b') images of TUNEL staining (a', b') of retina cryosections from P19 day-old DMSO-treated Rho-P23H (a, a') and NSC668394-treated Rho-P23H (b, b') mice. Nuclei are counterstained by DAPI (a-b). n = 6 mice per group. Scale bars: lOOpm. (c) The plot shows the percentage of TUNEL positive cells from the retina of mice treated as in a-b. A significant decrease of cell death in the eye of NSC668394-treated mice was observed compared to control mice. Error bars represent s.e.m. Student's t-test (NSC668394 vs DMSO treated mice) *p < 0.05.
(d-g') Representative images of retinal cryosections immunostained with anti-Rhodopsin (d', e') or anti-Cone Arrestin (f, g') antibodies from 1-month-old Rho-P23H mice sacrificed 1 month after DMSO (d, d', f, f ) or NSC668394 (e, e', g, g') treatment. Scale bars: 100 pm.
(h) The plot shows the percentage of ONL density from the retina of mice treated as in d-g. A significant rescue is visible in the number of rods and in ONL density between NSC668394- treated Rho-P23H and DMSO-treated Rho-P23H mice, n = 6 mice per group. Error bars represent s.e.m. Student's t-test (NSC668394 vs DMSO treated mice) ***p < 0.005.
(i) ERG responses (a- and b-wave), plotted as a function of stimulus intensity, from WT (black lines), DMSO-treated Rho-P23H and NSC668394-treated Rho-P23H mice, at two months of age. Error bars represent s.e.m. ANOVA test (NSC668394 vs DMSO treated mice) *p < 0.05, **p < 0.01, ***p < 0.005.
(j) Representative ERG (a- and b-wave) at two months of age show the rescue of ERG responses of NSC668394-treated Rho-P23H mice compared to DMSO-treated Rho-P23H control mice. WT mice were used as a control. (ONL) outer nuclear layer.
Figure 17. Model of Ezrin mediated regulation of autophagy. Under light phase conditions Ezrin is repressed by miR-211. The inhibition of Ezrin releases the MAGT1 transporter from its repression, thus increasing a Mg2+ microdomain influx .and the corresponding PLCyl-mediated induction of Ca2+ flux into cells. This leads to calcineurin activation and autophagy induction via TFEB nuclear translocation. Under night phase conditions Ezrin is upregulated and represses MAGTl-mediated autophagy process.
Figure 18. Pharmacological inhibition of Ezrin ameliorates Aipll^ retinal phenotype. Partial preservation of retinal structure in AΐrIG/_ mice following NSC668394 treatment, a-f) Starting from P4, daily injections of NSC668394, 5 times a week, over two consecutive weeks was efficient in ameliorating retinal degeneration in AΐrIG/_ mice (d-f), compared to control injected animals (a-c). Confocal microscopy images of rod marker rhodopsin (b, e) and cone marker cone arrestin (c, f) immunolabelling on retinal sections at P21. An increased staining for rod and cone photoreceptor markers is observed at the ONL of the retina of NSC668394-treated AΐrIG/_ mice compared to AΐrIG/_ mice treated with vehicle. DAPI-staining of retinal sections (a, d) at P19 showing partial preservation of retinal thickness (number of photoreceptor cell nuclei), g) The graph shows the rows of photoreceptor's nuclei from the retina of NSC668394-treated AΐrIG/_ mice compared to AΐrIG/_ mice treated with vehicle. A significant rescue is visible in the number of rows between NSC668394-treated AΐrIG/_ and DMSO-treated AΐrIG/_ mice, n = 3 mice per group. Error bars represent s.e.m. ANOVA test (NSC668394 vs DMSO treated mice) *p < 0.05. (RPE) Retinal Pigment Epithelium; (ONL) outer nuclear layer; (INL) inner nuclear layer. Figure 19. Pharmacological inhibition of Ezrin ameliorates Abca4 -/- retinal phenotype, (a-d) Representative images from A2E-loaded ARPE-19 cells treated with DMSO (a-b) and NSC668394 (c-d). All cells were fixed and were stained with DAPI (a, c). A significant reduction of A2E accumulation was observed in NSC668394-treated (d) compared to DMSO-treated ARPE-19 cells (b).
(e) The graph shows the quantification (mean ± sem) of the numbers of A2E-positive spots per cell (n > 100) from 3 independent experiments. Student's t-test (NSC668394 vs DMSO) *p < 0.05. (f-i) Representative pictures of lipofuscin autofluorescence (g, i) in the RPE of pigmented NSC668394-treated Abca4_/ mice (i) of compared to Abca4_/ mice treated with DMSO (g). Scale bars: 100 pm).
(j) The graph shows the quantification (mean ± sem) of the intensity of autofluorescent of Lipofuscin per RPE from 3 independent experiments. RPE: retinal pigment epithelium; ONL: outer nuclear layer; INL: inner nuclear layer; GCL: ganglion cell layer. The arrows indicate lipofuscin signal.
Figure 20. Analysis of femur and tibia lengths in MPSVII mice treated with NSC668394. (a-b) Representative images of Alcian blue and Alizarin red staining to identify cartilage and bone, respectively, (a) Alcian blue staining of femurs and Tibia isolated from GUSB +/+ (WT), GUSB-/- (MPSVII) and GUSB-/-; NSC668394 mice at P15. b) Alizarin red staining of femurs and Tibia isolated from GUSB +/+ (WT), GUSB-/- (MPSVII) and GUSB-/-; NSC668394 mice at P15.
(c) The graph shows the mean ± sem of Femur and tibia lengths from wild-type (WT), MPSVII mice and MPSVI mice treated with NSC668394. Student t-test *p<0,05. At least 5 mice/genotype were analyzed.
Figure 21. Pharmacological or genetic inhibition of Ezrin induces Ca2+ flux via Mucolipinl and lysosomal function a) Representative traces of MLl-GCaMP3 normalized fluorescence recorded in transiently transfected ARPE-19 cells. During time-lapse recording, cells were stimulated with ML-SA1 (20 mM) after addition (arrowhead) of DMSO or NSC668394. Where indicated, the specific ML1 inhibitor ML-SI3 (10 mM) was added, (b) Bar graph reports the mean values ± s.e.m. of the time required by fluorescence to decay to half of the ML-SAl-induced peak, n = 50 cells from 3 independent experiments. ***p<0.005 by Mann and Whitney test, (c) Representative traces of MLl-GCaMP3 normalized fluorescence recorded in transiently transfected ARPE-19 cells. During time-lapse recording, cells were stimulated with ML-SA1 (20 mM) after transfection with siCTRL or siEZR. (d) Bar graph reports the mean values ± s.e.m. of the time required by fluorescence to decay to half of the ML-SAl-induced peak, n = 50 cells from 3 independent experiments. ***p<0.005 by Mann and Whitney test, (e) Cathepsin B (CtsB) activity in lysates from A/5C66S394-treated and DMSO-control ARPE-19 cells. Graph showing the percentage of values of CtsB activity from 4 independent experiments. Mann and Whitney test ( NSC668394 vs DMSO) *p < 0.05. (f) Cathepsin B (CtsB) activity in RPE lysates from miR-2ir/_ and control mice sacrificed 3h after light on at 10 AM (diurnal condition). RPE was isolated 1 week after DMSO or NSC668394 treatment from 2-month-old miR-2ir/_ mice. CtsB was rescued in NSC668394- treated miR-2ir/_ compared to DMSO-control miR-2ir/_ mice. Bar graphs represent percentage of CtsB activity ± s.e.m. of independent experiments (n=3 mice) Mann and Whitney test (DMSO-miR-2ir/_ vs WT; NSC668394- \R-211 /- vs DMSO-miR-211 / ), *p < 0.05.
Figure 22. Pharmacological inhibition of Ezrin induces mTOR inhibition through lysosomal TSC complex translocation.
Representative confocal images of ARPE-19 cells treated with DMSO (a, a', a") and NSC668394 (b, b', b"). All cells were fixed and stained with anti-LAMP2 (a'-b') and anti-TSCl (a"-b") antibodies and nuclei were counterstained with DAPI (a-b). Scale bar 5 pm.
Representative confocal images of ARPE-19 cells treated with DMSO (c, c', c") and NSC668394 (d, d', d"). All cells were fixed and stained with anti-LAMP2 (a'-b') and anti-TSC2 (a"-b'') antibodies and nuclei were counterstained with DAPI (a-b). Scale bar 5 pm.
(e) Representative Western blots of pT567-Ezrin, Ezrin, P-S6 Kinase-thr389, S6 kinase, p4EBP-l, and 4EBP-1 proteins from DMSO-, TORIN- or NSC668394-treated ARPE-19 cells. The plot shows the quantification of the indicated proteins normalized to the b-Actin and GAPDH loading controls. Bar graphs represent mean values ± s.e.m. of at least n = 3 independent experiments. Representative confocal images of ARPE-19 cells transiently transfected with GFP (f-g'") or EZRIN-T567D-GFP (h-l'"), a constitutively active form of Ezrin, in feed (f-f h-h"') and starvation (g-g'"; i-l'") conditions. All cells were fixed and stained with anti-TSCl (f", g", h", I") and anti- LAMP2 (f"', g"', h"', I'") antibodies and nuclei were counterstained with DAPI. Scale bar 5 pm. (j) Representative Western blots of P-S6 Kinase-thr389, S6 kinase, p4EBP-l, and 4EBP-1 proteins from GFP or EZRIN-T567D-GFP transfected ARPE-19 cells upon feed and starvation conditions. The plot shows the quantification of the indicated proteins normalized to the GAPDH loading controls. Bar graphs represent mean values ± s.e.m. of at least n = 3 independent experiments. Figure 23. Pharmacological NSC305787-mediated Ezrin inhibition results in autophagy induction in ARPE-19 cells. ARPE-19 cells treated with DMSO (a, a', a”) and NSC305787 (b, b', b"). All cells were fixed and stained with anti-LAMPl (a'-b') and anti-LC3 (a"-b") antibodies and nuclei were counterstained with DAPI (a-b). Scale bar 5 pm.
Representative confocal images of ARPE-19 cells treated with DMSO (c, c', c") and NSC305787 (d, d', d"). All cells were fixed and stained with anti-TSCl (c'-d') and anti-Lamp2 (c"-d") antibodies and nuclei were counterstained with DAPI (c-d). Scale bar 5 pm.
Representative confocal images of ARPE-19 cells treated with DMSO (e, e', e") and NSC305787 (f, f , f"). All cells were fixed and stained with anti-TSC2 (e'-f ) and anti- LAMP2 (e"-f ') antibodies and nuclei were counterstained with DAPI (e-f). Scale bar 5 pm.
(g) Western blots analysis of LAM PI, EZRIN, EZRIN pT567, CLN5, TRPML1, SQSTMl/p62, CTSD and LC3 proteins from DMSO or NSC305787 treated cells. The plot shows the quantification of the indicated proteins normalized to the GAPDH loading control. Bar graphs represent mean values ! s.e.m. of at least n = 4 independent experiments. Student's t-test (NSC305787 vs DMSO) *p < 0.05, **p < 0.01, ***p < 0.005.
(h) Western blots analysis of LAMP1, EZRIN, EZRIN pT567, CLN5, TRPML1, SQSTMl/p62, CTSD and LC3 proteins from DMSO or NSC668394 treated cells. The plot shows the quantification of the indicated proteins normalized to the GAPDH loading control. Bar graphs represent mean values ± s.e.m. of at least n = 2 independent experiments.
(i) Western blot analysis of ARPE-19 cells treated with NSC305787 or DMSO and cultured in normal medium (stv-), starved HBSS medium (stv+), supplemented with bafilomycin (baf +) or without bafilomycin (baf -) as the quantification of LC3-II intensity (relative to b-Actin as the loading control). Bar graphs represent mean values ± s.e.m. of at least 2 independent experiments. Figure 24. Pharmacological NSC305787-mediated Ezrin inhibition results in autophagy induction in vivo
(a-b') Confocal images of eye cryosections immunostained with anti-GFP antibody from 1- month-old transgenic mice that express the green fluorescent protein (GFP)-tagged autophagosome marker MAP1LC3 (GFPLC3 tg/+) sacrificed 1 week after DMSO (a-a') or NSC305787 (b-b') treatment. Nuclei are counterstained with DAPI (a, b). At least n = 3 mice per group. Scale bar 100 pm.
Figure 25. Model of Ezrin mediated regulation of autophagy Brief Description of the Sequences in the Sequence listing
The expression "ezrin" or "ezrin protein" is intended to include also the corresponding protein encoded from an ezrin orthologous or homologous genes, functional mutants, functional derivatives, functional fragments or analogues, isoforms thereof.
Human —UUUGUAACAUUAGUUUUAAAAAGGGAAAGUUUU
Mouse —UUUGUAACUUAGUUUUAAAAAAGGGAAAGUUUU
Rabbit —UUGGUGACAUUAGUUUCAAAAAGGGAAAGCCUU
Opossum —GUUGUAAAUUAGUUUAAAAAAGGGAAAAGUUUU
Chicken —AUUGCAGAGUAGUAGUUUAAAAGGGAAAUAGUU
hEZR 5' . UAACAUUAGUUUUAAAAAGGGAA ...
Figure imgf000026_0001
3 ' UCCGCUUCCUACUGUUUCCCUU hsa-miR-211 (SEQ ID No. 8) Homo sapiens ezrin (EZR), mRNA NM _001111077.1 (SEQ ID No. 9)
1 ggcgtggtcc cgggacccgc cccgccgggg cttttgggag cgcgggcagc gagcgcactc
61 ggcggacgca agggcggcgg ggagcacacg gagcactgca ggcgccgggt tgggacagcg
121 tcttcgctgc tgctggatag tcgtgttttc ggggatcgag gatactcacc agaaaccgaa
181 aatgccgaaa ccaatcaatg tccgagttac caccatggat gcagagctgg agtttgcaat
241 ccagccaaat acaactggaa aacagctttt tgatcaggtg gtaaagacta tcggcctccg
301 ggaagtgtgg tactttggcc tccactatgt ggataataaa ggatttccta cctggctgaa
361 gctggataag aaggtgtctg cccaggaggt caggaaggag aatcccctcc agttcaagtt
421 ccgggccaag ttctaccctg aagatgtggc tgaggagctc atccaggaca tcacccagaa
481 acttttcttc ctccaagtga aggaaggaat ccttagcgat gagatctact gcccccctga
541 gactgccgtg ctcttggggt cctacgctgt gcaggccaag tttggggact acaacaaaga
601 agtgcacaag tctgggtacc tcagctctga gcggctgatc cctcaaagag tgatggacca
661 gcacaaactt accagggacc agtgggagga ccggatccag gtgtggcatg cggaacaccg 721 tgggatgctc aaagataatg ctatgttgga atacctgaag attgctcagg acctggaaat 781 gtatggaatc aactatttcg agataaaaaa caagaaagga acagaccttt ggcttggagt 841 tgatgccctt ggactgaata tttatgagaa agatgataag ttaaccccaa agattggctt 901 tccttggagt gaaatcagga acatctcttt caatgacaaa aagtttgtca ttaaacccat 961 cgacaagaag gcacctgact ttgtgtttta tgccccacgt ctgagaatca acaagcggat 1021 cctgcagctc tgcatgggca accatgagtt gtatatgcgc cgcaggaagc ctgacaccat 1081 cgaggtgcag cagatgaagg cccaggcccg ggaggagaag catcagaagc agctggagcg 1141 gcaacagctg gaaacagaga agaaaaggag agaaaccgtg gagagagaga aagagcagat 1201 gatgcgcgag aaggaggagt tgatgctgcg gctgcaggac tatgaggaga agacaaagaa 1261 ggcagagaga gagctctcgg agcagattca gagggccctg cagctggagg aggagaggaa 1321 gcgggcacag gaggaggccg agcgcctaga ggctgaccgt atggctgcac tgcgggctaa 1381 ggaggagctg gagagacagg cggtggatca gataaagagc caggagcagc tggctgcgga 1441 gcttgcagaa tacactgcca agattgccct cctggaagag gcgcggaggc gcaaggagga 1501 tgaagttgaa gagtggcagc acagggccaa agaagcccag gatgacctgg tgaagaccaa 1561 ggaggagctg cacctggtga tgacagcacc cccgccccca ccaccccccg tgtacgagcc 1621 ggtgagctac catgtccagg agagcttgca ggatgagggc gcagagccca cgggctacag 1681 cgcggagctg tctagtgagg gcatccggga tgaccgcaat gaggagaagc gcatcactga 1741 ggcagagaag aacgagcgtg tgcagcggca gctgctgacg ctgagcagcg agctgtccca 1801 ggcccgagat gagaataaga ggacccacaa tgacatcatc cacaacgaga acatgaggca 1861 aggccgggac aagtacaaga cgctgcggca gatccggcag ggcaacacca agcagcgcat 1921 cgacgagttc gaggccctgt aacagccagg ccaggaccaa gggcagaggg gtgctcatag 1981 cgggcgctgc cagccccgcc acgcttgtgt ctttagtgct ccaagtctag gaactccctc 2041 agatcccagt tcctttagaa agcagttacc caacagaaac attctgggct gggaaccagg 2101 gaggcgccct ggtttgtttt ccccagttgt aatagtgcca agcaggcctg attctcgcga 2161 ttattctcga atcacctcct gtgttgtgct gggagcagga ctgattgaat tacggaaaat 2221 gcctgtaaag tctgagtaag aaacttcatg ctggcctgtg tgatacaaga gtcagcatca 2281 ttaaaggaaa cgtggcagga cttccatctg tgccatactt gttctgtatt cgaaatgagc 2341 tcaaattgat tttttaattt ctatgaagga tccatctttg tatatttaca tgcttagagg 2401 ggtgaaaatt attttggaaa ttgagtctga agcactctcg cacacacagt gattccctcc 2461 tcccgtcact ccacgcagct ggcagagagc acagtgatca ccagcgtgag tggtggagga 2521 ggacacttgg attttttttt ttgttttttt tttttttgct taacagtttt agaatacatt
2581 gtacttatac accttattaa tgatcagcta tatactattt atatacaagt gataatacag 2641 atttgtaaca ttagttttaa aaagggaaag ttttgttctg tatattttgt taccttttac 2701 agaataaaag aattacatat gaaaaaccct ctaaaccatg gcacttgatg tgatgtggca 2761 ggagggcagt ggtggagctg gacctgcctg ctgcagtcac gtgtaaacag gattattatt 2821 agtgttttat gcatgtaatg gactatgcac acttttaatt ttgtcagatt cacacatgcc
2881 actatgagct ttcagactcc agctgtgaag agactctgtt tgcttgtgtt tgtttgtttg
2941 cagtctctct ctgccatggc cttggcaggc tgctggaagg cagcttgtgg aggccgttgg
3001 ttccgcccac tcattccttc tcgtgcactg ctttctcctt cacagctaag atgccatgtg
3061 caggtggatt ccatgccgca gacatgaaat aaaagctttg caaaggcacg aagcaaaaaa 3121 aaaaaaaaaa aaaaaaaa
Table I: Ezrin siRNA
Figure imgf000028_0001
miR211
mature mouse miRNA-211 (miRBase Accession No. MIMAT0000668) (SEQ ID No. 20) UUCCCUUUGUCAUCCUUUGCCU-
Human mature miR-211 (miRBase Accession No. MIMAT0000268) (SEQ ID No. 21) UUCCCUUUGUC AUCCUUCGCCU
Detailed of the Invention
Ezrin inhibitors In the present invention an ezrin inhibitor or an inhibitor of ezrin active form may be any inhibitor known in the art. In particular, the inhibitor may be a) a polypeptide; b) a polynucleotide coding for said polypeptide or a polynucleotide able to inhibit or block ezrin or its active form expression and/or function; c) a vector comprising or expressing said polynucleotide; d) a host cell genetically engineered expressing said polypeptide or said polynucleotide; e) a small molecule; f) a peptide, a protein, an antibody, an antisense oligonucleotide, a siRNA, a microRNA , an antisense expression vector or recombinant virus or any other agent able to inhibit or block ezrin or its active form expression and/or function.
The inhibitor of ezrin or of its active form induces autophagy and/or induces activation of lysosomal function in a subject. Further, it induces TFEB dephosphorylation and its translocation to the nucleus. , inhibits MAGT1 and /or mTOR and/or induces Ca2+ flux into a cell.
Small molecule ezrin inhibitors have been disclosed in WO 2012064936 and in [27] , all incorporated by reference, as potential therapeutic agents for metastatic osteosarcoma and multiple cancers including pancreatic cancer, ovarian cancer and rhabdomyosarcoma.
Further Ezrin inhibitors have been described [28]: MMV667492, MMV020549, MMV666069, identified at Georgetown University as anticancer drugs by screening the Medicine for malaria venture (MMV) portfolio, based on the close structure similarity of the initial compounds to commonly used quinoline- based antimalarial drugs.
Further inhibitors are reported in Table II.
Table II: Ezrin inhibitors
Figure imgf000030_0001
Figure imgf000031_0001
Figure imgf000032_0001
Figure imgf000033_0001
Particularly preferred ezrin inhibitors are NSC668394 (7-(3,5-dibromo-4 hydroxyphenethylamino)quinoline-5,8-dione), and NSC305787 ([6,8-Dichloro-2-
(tricyclo[4.3.1.03,8]dec-8-yl)-4-quinolinyl](2-piperidinyl)methanol), identified by G. Bulut et al. [27], who screened 3081 small molecules from four libraries (Challenge Set, Diversity Set, Mechanistic Set and Natural Product Set) provided by the Developmental Therapeutics Program of the National Cancer Institute and selected inhibitors based on their ability to inhibit ezrin function in multiple functional assays and their higher ezrin-binding affinity (~ 10 mM). Among other compounds of interest, NSC668394 and NSC305787 were found to inhibit ezrin T567 phosphorylation primarily via binding to ezrin. In maximum tolerable dose studies all animals in survived a 5-day intraperitoneal treatment of NSC668394 at 2.26 mg/kg/day, and 2.4 mg/kg/d ay respectively. £elik et al. [29] treated mice with 240 pg/kg body weight of NSC305787and 226 pg/kg body weight of NSC668394, once daily, 5 times a week to test whether the compounds would inhibit metastatic lung cancer development in a murine model. The lack of NSC668694 activity was found possibly linked to its pharmacokinetics: plasma concentrations of NSC668394 were monitored over a 6h time course after a single i.p. injection at a dose of 226 pg/kg: NSC668394 was undetectable after lh. Furthermore, monitoring of plasma concentrations of over an extended time period after a single i.v.injection at the same dose resulted in a monophasic elimination profile similar to i.p. administration; upon i.v. administration, NSC668394 was undetectable after 0.5h.
In the same experimental settings, treatment of mice with NSC305787 significantly suppressed pulmonary metastasis compared with the vehicle-treated control. Pharmacokinetics studies demonstrated a triphasic elimination profile of NSC305787 after i.v. administration. NSC305787 had an elimination half-life and clearance of 13.6 h and 9.6 mL/min/kg, respectively miRNA inhibitors of Ezrin
miR211
miR-150 [30]
mature mouse miRNA-150 (miRBase Accession No. MIMAT0000160) (SEQ ID No. 22)
ucucccaacccuuguaccagug
Human mature miR-150 (miRBase Accession No. MIMAT0000451) (SEQ ID No. 23)
ucucccaacccuuguaccagug miR-183 [31]
mature mouse miRNA-183 (miRBase Accession No. MIMAT0000212) (SEQ ID No. 24)
uauggcacugguagaauucacu
Human mature miR-183 (miRBase Accession No. MIMAT0000261) (SEQ ID No. 25)
uauggcacugguagaauucacu miR-22 [32] mature mouse miRNA-22 (miRBase Accession No. MIMAT0004629) (SEQ ID No. 26) aguucuucaguggcaagcuuua
Human mature miR-22 (miRBase Accession No. MIMAT0004495) (SEQ ID No. 27) aguucuucaguggcaagcuuua miR-204 [33]
mature mouse miRNA-204 (miRBase Accession No. MIMAT0000237) (SEQ ID No. 28) uucccuuugucauccuaugccu
Human mature miR-204 (miRBase Accession No. MIMAT0000265) (SEQ ID No. 29) uucccuuugucauccuaugccu miR-96 [34]
mature mouse miRNA-96 (miRBase Accession No. MIMAT0000541) (SEQ ID No. 30) uuuggcacuagcacauuuuugcu
Human mature miR-96 (miRBase Accession No. MIMAT0000095) (SEQ ID No. 31) uuuggcacuagcacauuuuugcu miR-184 [35]
mature mouse miRNA-184 (miRBase Accession No. MIMAT0022690) (SEQ ID No. 32) ccuuaucacuuuuccagccagc
Human mature miR-184 (miRBase Accession No. MIMAT0000454) (SEQ ID No. 33) uggacggagaacugauaagggu hsa-miR-1271 (MIMAT0005796) (SEQ ID No. 34)
cuuggcaccuagcaagcacuca
hsa-miR_205 (MIMAT0000266) (SEQ ID No. 35)
uccuucauuccaccggagucug
hsa-miR-4778-5p (MIMAT0019936) (SEQ ID No. 36)
aauucuguaaaggaagaagagg
hsa-miR-6832 (MIMAT0027565) (SEQ ID No. 37)
acccuuuuucucuuucccag
hsa-miR-3686 (MIMAT0018114) (SEQ ID No. 38) aucuguaagagaaaguaaauga
hsa-miR-589 (MIMAT0003256) (SEQ ID No. 39) ucagaacaaaugccgguucccaga
hsa-miR-548m MIMAT0005917 (SEQ ID No. 40) caaagguauuugugguuuuug
hsa-miR-548c (MIMAT0003285) (SEQ ID No. 41) caaaaaucucaauuacuuuugc
hsa-miR-548ag (MIMAT0018969) (SEQ ID No. 42) aaagguaauugugguuucugc
hsa-miR-548ba (MIMAT0031175) (SEQ ID No. 43) aaagguaacugugauuuuugcu
hsa-miR-548ai (MIMAT0018989) (SEQ ID No. 44) aaagguaauugcaguuuuuccc
hsa-mir-548p (MIMAT0005934) (SEQ ID No. 45) uagcaaaaacugcaguuacuuu
miR-3607 (MIMAT0017985) (SEQ ID No. 46) acuguaaacgcuuucugaug
hsa-miR-5006 (MIMAT0021034) (SEQ ID No. 47) uuucccuuuccauccuggcag
hsa-miR-4755 (MIMAT0019895) (SEQ ID No. 48) uuucccuucagagccuggcuuu
miR-6802 (MIMAT0027505) (SEQ ID No. 49) uucaccccucucaccuaagcag
miR-570 (MIMAT0022707) (SEQ ID No. 50) aaagguaauugcaguuuuuccc
hsa-miR-4428 (MIMAT0018943) (SEQ ID No. 51) caaggagacgggaacauggagc
hsa-miR-376a (MIMAT0000729) (SEQ ID No. 52) aucauagaggaaaauccacgu
hsa-miR-367b (MIMAT0002172) (SEQ ID No. 53) aucauagaggaaaauccauguu
hsa-miR-643 (MIMAT0003313) (SEQ ID No. 54) acuuguaugcuagcucagguag
hsa-miR-6838 (MIMAT0027579) (SEQ ID No. 55) aaguccugcuucuguugcag
hsa-miR-8055 (MIMAT0030982) (SEQ ID No. 56) cuuugagcacaugagcagacgga
hsa-miR-4446 (MIMAT0019233) (SEQ ID No. 57) auuucccugccauucccuuggc
hsa-miR-4294 (MIMAT0016849) (SEQ ID No. 58) gggagucuacagcaggg
hsa-miR-4492 (MIMAT0019027) (SEQ ID No. 59) ggggcugggcgcgcgcc
hsa-miR-551b (MIMAT0004794) (SEQ ID No. 60) gaaaucaagcgugggugagacc
hsa-miR-6818 (MIMAT0027536) (SEQ ID No. 61) uugugugaguacagagagcauc
hsa-miR-3160 (MIMAT0019212) (SEQ ID No. 62) ggcuuucuagucucagcucucc
hsa-miR-1281 (MIMAT0005939) (SEQ ID No. 63) ucgccuccuccucuccc
hsa-miR-1185-1 (MIMAT0022838) (SEQ ID No. 64) auauacagggggagacucuuau
hsa-let-7f-2 (MIMAT0004487) (SEQ ID No. 65) cuauacagucuacugucuuucc
hsa-miR-1185-2 (MIMAT0022713) (SEQ ID No. 66) auauacagggggagacucucau
hsa-miR-3689d (MIMAT0019008) (SEQ ID No. 67) gggaggugugaucucacacucg
hsa-miR-6851 (MIMAT0027602) (SEQ ID No. 68) aggaggugguacuaggggccagc
hsa-miR-648 (MIMAT0003318) (SEQ ID No. 69) aagugugcagggcacuggu
hsa-miR-6897 (MIMAT0027634) (SEQ ID No. 70) uguguguguagaggaagaaggga
hsa-miR-4753 (MI AT0019890) (SEQ ID No. 71) caaggccaaaggaagagaacag
hsa-miR-6867 (MIMAT0027436) (SEQ ID No. 72) cacacaggaaaagcggggcccug
hsa-miR-4508 (MIMAT0019045) (SEQ ID No. 73) gcggggcugggcgcgcg
hsa-miR- 4297 (MIMAT0016846) (SEQ ID No. 74) ugccuuccugucugug
hsa-miR- 7151 (MIMAT0028213) (SEQ ID No. 75) cuacaggcuggaaugggcuca
hsa-miR- 5095 (MIMAT0020600) (SEQ ID No. 76) uuacaggcgugaaccaccgcg
hsa-miR- 5096 (MIMAT0020603) (SEQ ID No. 77) guuucaccauguuggucaggc
hsa-miR- 3613 (MIMAT0017991) (SEQ ID No. 78) acaaaaaaaaaagcccaacccuuc
hsa-miR- 4731 (MIMAT0019854) (SEQ ID No. 79) cacacaaguggcccccaacacu
hsa-miR- 4801 (MIIVIAT0019980) (SEQ ID No. 80) uacacaagaaaaccaaggcuca
hsa-miR- 6500 (MIMAT0025455) (SEQ ID No. 81) acacuuguugggaugaccugc
hsa-miR- 7977 (MIMAT0031180) (SEQ ID No. 82) uucccagccaacgcacca
hsa-miR- 3670 (MIMAT0018093) (SEQ ID No. 83) agagcucacagcuguccuucucua
MAGT1 inhibitor
Table III: MAGT1 siRNA
Figure imgf000038_0001
Figure imgf000039_0001
siRNA and miRNA
It should be noted that mature miRNAs may usually have a length of about 19-24 nucleotides (and any range in between), particularly 21, 22 or 23 nucleotides. The miRNAs, however, may be also provided as a precursor which may have a length of about 70 to about 100 nucleotides (pre-miRNA). It should be noted that the precursor may be produced by processing of a primary transcript which may have a length of greater than about 100 nucleotides (pri-miRNA). The miRNA as such may usually be a single-stranded molecule, while the miRNA-precursor may usually be in the form of an at least partially self-complementary molecule capable of forming double-stranded portions, e.g. stem- and loop-structures. DNA molecules encoding the miRNA, pre-miRNA and pri-miRNA molecules are also be encompassed by the invention. The nucleic acids may be selected from RNA, DNA or nucleic acid analog molecules, such as sugar- or backbone-modified ribonucleotides or deoxyribonucleotides. It should be noted, however, that other nucleic analogs, such as peptide nucleic acids (PNA) or locked nucleic acids (LNA), may also be suitable.
The nucleic acid molecules of the invention may be obtained by chemical synthesis methods or by recombinant methods, e.g. by enzymatic transcription from synthetic DNA-templates or from DNA-plasmids isolated from recombinant organisms. Typically, phage RNA- polymerases are used for transcription, such as T7, T3 or SP6 RNA-polymerases.
The invention may also relate to a recombinant expression vector comprising a recombinant nucleic acid operatively linked to an expression control sequence, wherein expression, i.e. transcription and optionally further processing results in a miRNA-molecule or miRNA precursor (pri- or pre-miRNA) molecule as described above. The vector may be an expression vector suitable for nucleic acid expression in eukaryotic, more particularly mammalian cells. The recombinant nucleic acid contained in said vector may be a sequence which results in the transcription of the miRNA-molecule as such, a precursor or a primary transcript thereof, which may be further processed to give the miRNA-molecule.
In a preferred embodiment said agent is provided within a delivery vehicle, optionally wherein the delivery vehicle is selected from a viral vector, microspheres, liposomes, colloidal gold particles, lipopolysaccharides, polypeptides, polysaccharides, or pegylation of viral vehicles. Preferably said agent is selected from the group consisting of: a miRNA, a miRNA precursor, a mature miRNA, a miRNA mimetic or a mixture of miRNA mimetics, a RNA or DNA molecule encoding for said miRNA, for said miRNA precursor, for said mature miRNA, for said miRNA mimetic or mixture of miRNA mimetics, or any combination thereof.
In some aspects, the agent capable of increasing the level of one or more miRNA may be an RNA- or DNA molecule, which may contain at least one modified nucleotide analog, i.e. a naturally occurring ribonucleotide or deoxyribonucleotide is substituted by a non-naturally occurring nucleotide. The modified nucleotide analog may be located for example at the 5'-end and/or the 3 '-end of the nucleic acid molecule.
Nucleotide analogs may be selected from sugar- or backbone-modified ribonucleotides. It should be noted, however, that also nucleobase-modified ribonucleotides, i.e. ribonucleotides, containing a non-naturally occurring nucleobase instead of a naturally occurring nucleobase, such as uridines or cytidines modified at the 5-position, e.g. 5-(2-amino)propyl uridine, 5- bromo uridine; adenosines and guanostnes modified at the 8-position, e.g. 8-bromo guanosine; deaza nucleotides, e.g. 7-deaza-adenosine; O- and N-alkylated nucleotides, e.g. N6-methyl adenosine may be suitable. In sugar-modified ribonucleotides the 2'-OH-group is replaced by a group selected from H, OR, R, halo, SH, SR, NH 2 , NHR, NR 2 or CN, wherein R is C 1 -C 6 alkyl, alkenyl or alkynyl and halo is F, Cl, Br or I. In preferred backbone-modified ribonucleotides the phosphoester group connecting to adjacent ribonucleotides is replaced by a modified group, e.g. of phosphothioate group. It should be noted that the above modifications may be combined.
In the present invention "miR mimics or mimetics" are small double-stranded RNA oligonucleotides, that can be chemically modified and that mimic endogenous miRNAs and enable miRNA functional analysis by up-regulation of miRNA activity. The mimic or mimetic sequence corresponds to the sequence of the miRNA mature sequence.
In the present invention miRs may be delivered to the retina via the subretinal injection of AAV constructs. However, it is important to point out that the mature forms of miRNAs could also be administered to the retina as double stranded RNA oligonucleotides (microRNA mimics) whose delivery can be enhanced by conjugation with other molecular structures or encapsulation with carriers such as liposomes or nanoparticles. Moreover, both the miR AAV constructs or miR mimics can also be prepared in the form of injectable suspension, eye lotion or ophthalmic ointment that can be delivered to the retina with a non-invasive procedure. The administration of oligonucleotides of the present invention may be carried out by known methods, wherein a nucleic acid is introduced into a desired target cell in vitro or in vivo.
Combination
In a preferred embodiment, the inhibitor as above defined (a) is combined with at least one therapeutic agent (b) to define a combination or combined preparation. The therapeutic agent (b) may be an agent used to treat and/or prevent the disease of the invention, an anti-apoptotic agent, an anti-inflammatory agent, an immune suppressive agent, adjuvant therapy in organ transplantation, protective agent in cell therapy approach a pain reliever.
The additional therapeutic agent (b) may be a recombinant expression vector comprising the wild type form of the coding sequence responsible for the disease of the invention under the control of an appropriate promoter. Additional therapeutic agents may include a neuroprotective molecule such as: growth factors such as ciliary neurotrophic factor (CNTF), glial-derived neurotrophic factor (GDNF), cardiotrophin-1, brain-derived neurotrophic factor (BDNF) and basic fibroblast growth factor (bFGF) or the rod-derived cone viability factors such as RdCVF and RdCVF2.
The therapeutic agent (b) may be any therapeutic intervention for the treatment of lysosomal storage disorders, for example as reported in Table IV.
Table IV: Therapeutic agents for the treatment of lysosomal storage disorders
Therapeutic i Rationale S'=ir i.-n ·’! cl:n: .:il/exptf nmn!H fif ! ri
Figure imgf000042_0001
Figure imgf000043_0001
The terms "combination" and "combined preparation" as used herein also define a "kit of parts" in the sense that the combination partners (a) and (b) as defined above can be dosed independently or by use of different fixed combinations with distinguished amounts of the combination partners (a) and (b), i.e. simultaneously or at different time points. The parts of the kit of parts can then, e.g., be administered simultaneously or chronologically staggered, that is at different time points and with equal or different time intervals for any part of the kit of parts. The ratio of the total amounts of the combination partner (a) to the combination partner (b) to be administered in the combined preparation can be varied, e.g. in order to cope with the needs of a patient sub-population to be treated or the needs of the single.
The combination therapy may result in unexpected improvement in the treatment of the disorders of the invention. When administered simultaneously, sequentially or separately, the inhibitor and the other therapeutic agent may interact in a synergistic manner to reduce disorders or diseases of the invention. This unexpected synergy allows a reduction in the dose required of each compound, leading to a reduction in the side effects and enhancement of the clinical effectiveness of the compounds and treatment. Determining a synergistic interaction between one or more components, the optimum range for the effect and absolute dose ranges of each component for the effect may be definitively measured by administration of the components over different w/w ratio ranges and doses to patients in need of treatment. For humans, the complexity and cost of carrying out clinical studies on patients renders impractical the use of this form of testing as a primary model for synergy. However, the observation of synergy in one species can be predictive of the effect in other species and animal models exist, as described herein, to measure a synergistic effect and the results of such studies can also be used to predict effective dose and plasma concentration ratio ranges and the absolute doses and plasma concentrations required in other species by the application of pharmacokinetic/pharmacodynamic methods. Established correlations between disease models and effects seen in man suggest that synergy in animals may e.g. be demonstrated in the models as described in the Examples below.
The above pharmaceutical compositions are preferably for systemic, oral, locally, preferably rectally, or topical administration.
In the present invention the active ingredients may also be entrapped in microcapsule prepared, for example, by coacervation techniques or by interfacial polymerization, for example, hydroxymethylcellulose or gelatin-microcapsule and poly-(methylmethacylate) microcapsule, respectively, in colloidal drug delivery systems (for example, liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules) or in macroemulsions. Such techniques are disclosed in Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980).
The formulations to be used for in vivo administration must be sterile. This is readily accomplished by filtration through sterile filtration membranes.
Sustained-release preparations may be prepared. Suitable examples of sustained-release preparations include semipermeable matrices of solid hydrophobic polymers containing the antibody, which matrices are in the form of shaped articles, e.g., films, or microcapsule. Examples of sustained-releabe matrices include polyesters, hydrogels (for example, poly(2- hydroxyethyl-methacrylate), or poly(vinylalcohol)), polylactides (U.S. Pat. No. 3,773,919), copolymers of L-glutamic acid and [gamma] ethyl-L-glutamate, non-degradable ethylene-vinyl acetate, degradable lactic acid-glycolic acid copolymers such as injectable microspheres composed of lactic acid-glycolic acid copolymer and leuprolide acetate, and poly-D-(- )-3- hydroxybutyric acid. While polymers such as ethylene- vinyl acetate and lactic acid-glycolic acid enable release of molecules for over 100 days, certain hydrogels release proteins for shorter time periods. When encapsulated antibodies remain in the body for a long time, they may denature or aggregate as a result of exposure to moisture at 37°C, resulting in a loss of biological activity and possible changes in immunogenicity. Rational strategies can be devised for stabilization depending on the mechanism involved. For example, if the aggregation mechanism is discovered to be intermolecular S- S bond formation through thio-disulfide interchange, stabilization may be achieved by modifying sulfhydryl residues, lyophilizing from acidic solutions, controlling moisture content, using appropriate additives, and developing specific polymer matrix compositions.
According to the present invention, an "effective amount" of a composition is one that is sufficient to achieve a desired biological effect, in this case an amelioration or the treatment of the disease of the invention.
It is understood that the effective dosage will be dependent upon the age, sex, health, and weight of the recipient, kind of concurrent treatment, if any, frequency of treatment, and the nature of the effect desired. The provided ranges of effective doses of the inhibitor or molecule of the invention (e.g. from 1 mg/kg to 1000 mg/kg, in particular systemically administered) are not intended to limit the invention and represent preferred dose ranges. However, the preferred dosage can be tailored to the individual subject, as is understood and determinable by one of skill in the art, without undue experimentation.
The administration of oligonucleotides of the present invention may be carried out by known methods, wherein a nucleic acid is introduced into a desired target cell in vitro or in vivo.
An aspect of the present invention comprises a nucleic acid construct comprised within a delivery vehicle. A delivery vehicle is an entity whereby a nucleotide sequence can be transported from at least one media to another. Delivery vehicles may be generally used for expression of the sequences encoded within the nucleic acid construct and/or for the intracellular delivery of the construct. It is within the scope of the present invention that the delivery vehicle may be a vehicle selected from the group of RNA based vehicles, DNA based vehicles/vectors, lipid-based vehicles, virally based vehicles and cell-based vehicles. Examples of such delivery vehicles include biodegradable polymer microspheres, lipid-based formulations such as liposome carriers, coating the construct onto colloidal gold particles, lipopolysaccharides, polypeptides, polysaccharides, pegylation of viral vehicles.
In one embodiment of the present invention may comprise a virus as a delivery vehicle, where the virus may be selected from: adenoviruses, retroviruses, lentiviruses, adeno-associated viruses, herpesviruses, vaccinia viruses, foamy viruses, cytomegaloviruses, Semliki forest virus, poxviruses, RNA virus vector and DNA virus vector. Such viral vectors are well known in the art. Commonly used gene transfer techniques include calcium phosphate, DEAE-dextran, transfection, electroporation and microinjection and viral methods. Another technique for the introduction of DNA into cells is the use of cationic liposomes. Commercially available cationic lipid formulations are e.g. Tfx 50 (Promega) or Lipofectamin 2000 (Life Technologies).
The compositions of the present invention may be in form of a solution, e.g. an injectable solution, a cream, ointment, tablet, suspension or the like. The composition may be administered in any suitable way, e.g. by injection, particularly by intraocular injection, by oral, topical, nasal, rectal application etc. The carrier may be any suitable pharmaceutical carrier. Preferably, a carrier is used, which is capable of increasing the efficacy of the RNA molecules to enter the target-cells. Suitable examples of such carriers are liposomes, particularly cationic liposomes.
The recombinant expression vector of the invention can be any suitable recombinant expression vector and can be used to transform or transfect any suitable host. Suitable vectors include those designed for propagation and expansion or for expression or both, such as plasmids and viruses. The recombinant expression vectors of the invention can be prepared using standard recombinant DNA techniques. Constructs of expression vectors, which are circular or linear, can be prepared to contain a replication system functional in a prokaryotic or eukaryotic host cell. Replication systems can be derived, e.g., from ColEI, 2 m plasmid, l, SV40, bovine papilloma virus, and the like.
Desirably, the recombinant expression vector comprises regulatory sequences, such as transcription and translation initiation and termination codons, which are specific to the type of host (e.g., bacterium, fungus, plant, or animal) into which the vector is to be introduced, as appropriate and taking into consideration whether the vector is DNA- or RNA- based. The recombinant expression vector can include one or more marker genes, which allow for selection of transformed or transfected hosts. Marker genes include biocide resistance, e.g., resistance to antibiotics, heavy metals, etc., complementation in an auxotrophic host to provide prototrophy, and the like. Suitable marker genes for the inventive expression vectors include, for instance, neomycin/G418 resistance genes, hygromycin resistance genes, histidinol resistance genes, tetracycline resistance genes, and ampicillin resistance genes. The recombinant expression vector can comprise a native or normative promoter operably linked to the nucleotide sequence encoding the PCYOX1 inhibitor (including functional portions and functional variants thereof), or to the nucleotide sequence which is complementary to or which hybridizes to the nucleotide sequence encoding the RNA. The selection of promoters, e.g., strong, weak, inducible, tissue- specific and developmental-specific, is within the ordinary skill of the artisan. Similarly, the combining of a nucleotide sequence with a promoter is also within the skill of the artisan. The promoter can be a non-viral promoter or a viral promoter, e.g., a cytomegalovirus (CMV) promoter, an SV40 promoter, an RSV promoter and a promoter found in the long-terminal repeat of the murine stem cell virus.
The inventive recombinant expression vectors can be designed for either transient expression, for stable expression, or for both. Also, the recombinant expression vectors can be made for constitutive expression or for inducible expression.
Lysosomal biogenesis, function and autophagy
The following assays can be used to evaluate lysosomal biogenesis and function: 1) Lysosomal morphometries, 2) Lysosomal pH and membrane integrity, 3) Lysosomal exocytosis and calcium signalling, 4) Lysosomal degradation and clearance capacity, 5) Autophagy.
1) Lysosomal morphometries: Lysosomes are highly dynamic organelles that can vary substantially in shape, position and number. These changes may be the result of specific perturbations or environmental cues and may be mediated by different pathways. Most importantly, the lysosome undergoes significant morphological changes in LSDs, as a result of the accumulation of un-degraded storage material in the lysosomal lumen. It is possible to perform the quantification of lysosomal number, morphology, and positioning by using antibodies against the abundant lysosomal membrane proteins LAMP1 and LAMP2A, and Bodipy-Pepstatin. The use of three different lysosomal markers allow to unequivocally identify lysosomes (Bodipy-Pepstatin will also enable us to distinguish lysosomes form late lysosomes).
2) Lysosomal pH and membrane integrity: pH changes in the lysosomal lumen strongly alter lysosomal function by impairing the activity of lysosomal hydrolases. It is possible to measure lysosomal acidification using the weak amine base lysostracker (fixable format), coupled to immunofluorescence with antibodies to galectin-3, a cytosolic protein that translocates to the lysosome after lysosomal membrane permeabilization, thus labelling individual damaged lysosomes. Live cells can be loaded with lysotracker red, fixed and stained with anti-galectin3 antibodies. Then it is possible to detect lysotracker mean intensity and vesicular structures stained with galectin-3 antibodies.
3) Lysosomal exocytosis and calcium signaling: Lysosomes are also involved in a secretory pathway known as lysosomal exocytosis, which requires movement of lysosomes to cell periphery, docking and fusion to the plasma membrane. Activation of lysosomal exocytosis promotes cellular clearance in LSDs, thus indicating a potential therapeutic application for this process. It is possible to measure lysosomal exocytosis by detecting the translocation of lysosomal membrane markers to the plasma membrane. Highly specific monoclonal antibodies that react with lumenal epitopes of LAMP1 are available, allowing sensitive immunofluorescence detection of LAMP1 translocation to the plasma membrane in non- permeabilized cells.
4) Lysosomal degradative and clearance capacity: To quantify the general degradative activity of the lysosome, a red BODIPY dye conjugated to bovine serum albumin (DQ-BSA, Molecular Probes) may be used. This substrate is so heavily labelled that the fluorophore is self-quenched. However, lysosomal proteolysis of BSA results in de-quenching and release of bright fluorescent fragments.
5) Autophagy: Autophagy substrates are degraded by the lysosome A major step of the autophagic pathway is the fusion between autophagosomes and lysosomes. It is possible to monitor autophagy by using a cell-based assay to quantify the formation of autophagosomes with antibodies against endogenous LC3 protein in combination with autophagosome staining with lysosome staining using LAMP1. Perturbations inducing autophagy will result in an increased co-localization of the two proteins.
Other assays are described in Guidelines for the use and interpretation of assays for monitoring autophagy (3rd edition). Autophagy. 2016;12(l):l-222. doi: 10.1080/15548627.2015.1100356 8incorporated by reference).
Diseases to be treated or prevented Diseases of particular interest for the present inventions are diseases in which an increase of cellular clearance by means of increased autophagy and/or lysosomal exocytosis is beneficial in order to clear accumulation of misfolded proteins and/or aggregates of proteins and/or lipids, such as retinal disease, in particular inherited retinal dystrophies, neurodegenerative diseases, lysosomal storage disorders; particularly preferred diseases of the invention are: age-related macular degeneration, Stargardt's disease, retinitis pigmentosa (recessive or autosomal dominant), Leber congenital Amaurosis, cone-rod dystrophies, cone dystrophies, Batten disease, Alzheimer's disease, Parkinson's disease, Fabry's disease, Mucopolysaccharidoses, Pompe's disease.
Inherited retinal dystrophies (IRDs) represent one of the most frequent causes of genetic blindness in the western world. The primary condition that underlies this group of diseases is the degeneration of photoreceptors, i.e., the cells that convert the light information into chemical and electrical signals that are then transmitted to the brain through the visual circuits. There are two types of photoreceptor cells in the human retina: rods and cones. Rods represent about 95% of photoreceptor cells in the human retina and are responsible for sensing contrast, brightness and motion, whereas fine resolution, spatial resolution and color vision are perceived by cones.
IRDs can be subdivided into different groups of diseases, namely Retinitis Pigmentosa (RP), Leber Congenital Amaurosis (LCA), cone-rod dystrophies and cone dystrophies.
RP a frequent form of inherited retinal dystrophy with an approximate frequency of about 1 in 4,000 individuals [36]. RP is characterized by broad variability in age of onset, rate of progression and secondary clinical manifestations. Affected individuals generally first develop night blindness (nyctalopia) due to loss of rod function, often in adolescence or earlier. They then develop peripheral visual field impairment, and overtime loss of central vision, usually at late stages, often around midlife. Central visual acuity loss may occur at any age as a result of cystoid macular edema or photoreceptor loss. Posterior subcapsular cataracts are common and severity is age dependent. Reduced color vision may also be found. Fundus examination reveals bone spicule pigment deposits, attenuated retinal vessels, retinal atrophy and waxy optic nerve pallor, reduced or absent electroretinogram (ERG). RP can be either isolated or syndromic, i.e., associated with extraocular manifestations such as in Usher syndrome or in Bardet-Biedle syndrome. From a genetic point of view, RP is highly heterogeneous, with autosomal dominant, autosomal recessive and X-linked patterns of inheritance. A significant percentage of RP patients, however, are apparently sporadic. To date, around 50 causative genes/loci have been found to be responsible for non-syndromic forms of RP and over 25 for syndromic RPs (RETnet web site: http://www.sph.uth.tmc.edu/RetNet/).
LCA has a prevalence of about 2-3 in 100,000 individuals and is characterized by a severe visual impairment that starts in the first months/years of life [37]. LCA has retinal, ocular as well as extraocular features, and occasionally systemic associations. LCA is inherited as an autosomal recessive trait in the large majority of patients, while autosomal dominant inheritance has been described only in a limited number of cases. LCA is genetically heterogeneous and, to date, mutations have been identified in 15 different genes: GUCY2D (locus name: LCA1), RPE65 (LCA2), SPATA 7 (LCA3), AIPL1 (LCA4), LCA5 (LCA5), RPGRIP1 (LCA6), CRX (LCA7), CRB1 (LCA8), CEP290 (LCA10), IMPDH1 (LCA11), RD3 (LCA12), NMNAT1 (LCA9), LRAT (LCA 14), TULP1 (LCA 15), and RDH12 (LCA13). The diagnosis of LCA is established by clinical findings. Molecular genetic testing is clinically available for the 15 genes currently known to be associated with LCA. Collectively, mutations in these genes are estimated to account for approximately 40%-50% of all LCA cases, depending on the survey.
Cone-rod dystrophies (CRDs) have a prevalence of 1/40,000 individuals and are characterized by retinal pigment deposits visible upon fundus examination, predominantly localized to the macular region. In contrast to typical RP, which is characterized by primary loss in rod photoreceptors, later followed by the secondary loss in cone photoreceptors, CRDs reflect the opposite sequence of events. CRD is characterized by a primary cone involvement, or, sometimes, by concomitant loss of both cones and rods that explains the predominant symptoms of CRDs: decreased visual acuity, color vision defects, photo-aversion and decreased sensitivity in the central visual field, later followed by progressive loss in peripheral vision and night blindness [38]. Mutations in at least 20 different genes have been associated with CRD (RETnet web site: http://www.sph.uth.tmc.edu/RetNet/).
Cone dystrophies (CD) are conditions in which cone photoreceptors display a selective dysfunction that does not extend to rods. They are characterized by visual deficit, abnormalities of color vision, visual field loss, and a variable degree of nystagmus and photophobia. In CDs, cone function is absent or severely impaired on electroretinography (ERG) and psychophysical testing [39]. Similar to the other forms of inherited retinal dystrophies, CDs are heterogeneous conditions that can be caused by mutations in at least 10 different genes (RETnet web site: http://www.sph.uth.tmc.edu/RetNet/). Stargardt disease is an inherited retinal disease the most prevalent childhood-onset macular dystrophywith an estimated prevalence of 1 in 10,000 individuals . Most often it presents in the first or second decade with diminished visual acuity and the classic examination findings of bull's-eye maculopathy, pisciform flecks, and relative hypofluorescence of the choroid on fluorescein angiography. Many individuals progress to central GA with profound central vision loss.
It usually has an autosomal recessive inheritance caused by mutations in the ABCA4 gene, also known as Stargardt 1 (STGD1). Rarely said disease has an autosomal dominant inheritance due to defects with ELOVL4 or PROM1 genes.
The autosomal recessive form of the disease typically presents within the first two decades of life, even though symptoms can also appear during adulthood and as late as the seventh decade. Although disease progression and severity vary widely, STGD1 is usually characterized by macular degeneration and progressive loss of central vision causing blurry vision and, occasionally, an increasing difficulty to adapt in the dark. Peripheral vision is usually normal. Most affected individuals also have impaired color vision. Photophobia may be present.
STGD1 has been linked to mutations in the ABCA4 gene, which encodes an adenosine triphosphate (ATP)-binding cassette transporter (ABCR) expressed specifically in the cones and rods of the retina. Defects in ABCR function cause the accumulation of all-trans-retinal and its cytotoxic derivatives (e.g., diretinoid-pyridinium-ethanolamine) (lipofuscin pigments) in photoreceptors and retinal pigment epithelial (RPE) cells, ultimately causing RPE cell death and the subsequent loss of photoreceptors. Mutations in ABCA4 have been linked to a spectrum of phenotypes ranging from STGD1 to cone rod dystrophy and severe early-onset retinal dystrophy.
In STGD4, a butterfly pattern of dystrophy is caused by mutations in a gene that encodes a membrane bound protein that is involved in the elongation of very long chain fatty acids. Macular dystrophy refers to a group of heritable disorders that cause ophthalmoscopically visible abnormalities in the portion of the retina bounded by the temporal vascular arcades. Macular dystrophies include but are not limited to Best macular dystrophy, Stargardt disease, Stargardt-like dominant macular dystrophy, Pattern dystrophy, Sorsby fundus dystrophy, Autosomal dominant radial drusen, North Carolina macular dystrophy, Spotted cystic dystrophy, Dominant cystoid macular edema Age-related macular degeneration (AMD) is the most common cause of irreversible central vision loss in elderly patients. AMD has a significant genetic component. However, the genes that cause AMD interact with each other and with the environment in a sufficiently non- Mendelian fashion that it is not typically considered one of the macular dystrophies. Diagnosis is based on dilated funduscopic findings are diagnostic; color photographs, fluorescein angiography, and optical coherence tomography AMD is the leading cause of permanent, irreversible vision loss in the elderly. Age related macular degeneration occurs in two forms: Dry (nonexudative or atrophic); and Wet (exudative or neovascular). Dry AMD causes changes of the retinal pigment epithelium, typically visible as dark pinpoint areas. The retinal pigment epithelium plays a critical role in keeping the cones and rods healthy and functioning well. Accumulation of waste products from the rods and cones can result in drusen, which appear as yellow spots. Areas of chorioretinal atrophy (referred to as geographic atrophy) occur in more advanced cases of dry AMD. There is no elevated macular scar (disciform scar), edema, hemorrhage, or exudation. Wet AMD occurs when new abnormal blood vessels develop under the retina in a process called choroidal neovascularization (abnormal new vessel formation). Localized macular edema or hemorrhage may elevate an area of the macula or cause a localized retinal pigment epithelial detachment. Eventually, untreated neovascularization causes a disciform scar under the macula.
Glaucoma is a progressive optic neuropathy characterized by axonal degeneration and retinal ganglion cells loss. Several factors have been postulated to play a role in glaucoma, elevated intraocular pressure (IOP) being the best well-known causative factor. The mechanisms leading to ocular hypertension and glaucoma are still not fully understood, yet increasing number of evidence indicates a role of autophagy in the pathophysiological process of ocular hypertension and glaucoma. In certain embodiments the prophylactic and/or therapeutic methods described herein involve ameliorating one or more of the above symptoms (e.g., one or more symptoms selected from the group consisting of drusen or waste deposits on the surface of the retina, changes in color (pigment) of the macula, blurred or fuzzy vision, the illusion that straight lines are wavy; the illusion that some objects are smaller than they really are, the appearance of a gray, dark or empty area in the center of the visual field, and fading of color vision), and/or delaying the onset, slowing, stopping, or reversing the progression of one or more of these symptoms. Lysosomal storage diseases (LSDs) are a group of about 70 inherited metabolic disorders that result from defects in lysosomal function. Lysosomes are intracellular compartments that contain enzymes that digest large molecules and pass the fragments on to other parts of the cell for recycling. This process requires several critical enzymes and if one or more of these enzymes is defective, e.g., because of a mutation, the large molecules accumulate within the cell, eventually killing it.
Lysosomal storage disorders are caused by lysosomal dysfunction usually as a consequence of deficiency of a single enzyme required for the metabolism of lipids, glycoproteins, or so-called mucopolysaccharides. Individually, LSDs occur with incidences of less than 1:100,000; however, as a group, the incidence is about 1:5,000 - 1:10,000 (see, e.g., Meikle et al. (1999) JAMA, 281(3): 249-254). Most of these disorders are autosomal recessively inherited such as Niemann-Pick disease, type C, but a few are X-linked recessively inherited, such as Fabry disease and Hunter syndrome (MPS II).
Lysosomal disorders are usually triggered when a particular lysosome enzyme exists in too small an amount or is missing altogether. When this happens, excess products destined for breakdown and recycling are stored in the cell.
Although each disorder results from different gene mutations that translate into a deficiency in enzyme activity, they all share a common biochemical characteristic - all lysosomal disorders originate from an abnormal accumulation of substances inside the lysosome.
The LSDs are generally classified by the nature of the primary stored material involved, and can be broadly broken into the following: 1) Lipid storage disorders, mainly sphingolipidoses (including Gaucher's and Niemann-Pick diseases); 2) Gangliosidosis (including Tay-Sachs disease; 3) Leukodystrophies; 4) Mucopolysaccharidoses (including Hunter syndrome and Hurler disease); 5) glycoprotein storage disorders; and 6) mucolipidoses.
In certain embodiments lysosomal storage diseases include but are not limited to, Sphingolipidoses, Ceramidase (e.g., Farber disease, Krabbe disease), Galactosialidosis, gangliosidoses including Alpha-galactosidases (e.g., Fabry disease (alpha-galactosidase A), Schindler disease (alpha-galactosidase B)), Beta-galactosidase (e.g., GM1 gangliosidosis, GM2 gangliosidosis, Sandhoff disease, Tay-Sachs disease), Glucocerebrosidoses (e.g., Gaucher disease (Type I, Type II, Type III), Sphingomyelinase (e.g., Lysosomal acid lipase deficiency, Niemann-Pick disease), Sulfatidosis (e.g., Metachromatic leukodystrophy. Multiple sulfatase deficiency), Mucopolysaccharidoses (e.g., Type I (MPS I (Hurler syndrome, MPS I S Scheie syndrome, MPS I H-S Hurler-Scheie syndrome), Type II (Hunter syndrome), Type III (Sanfilippo syndrome), Type IV (Morquio), Type VI (Maroteaux-Lamy syndrome), Type VII (Sly syndrome), Type IX (hyaluronidase deficiency)), mucolipidoses (e.g., Type I (sialidosis), Type II (l-cell disease), Type III (pseudo-Hurler polydystrophy/phosphotransferase deficiency), Type IV (mucolipidin 1 deficiency)), lipidoses (e.g., Niemann-Pick disease), Neuronal ceroid lipofuscinoses (e.g., Type 1 Santavuori-Haltia disease/ infantile NCL (CLN1 PPT1)), Type 2 Jansky-Bielschowsky disease / late infantile NCL (CLN2/LI CLTPP1), Type 3 Batten-Spielmeyer- Vogt disease / juvenile NCL (CLN3), Type 4 Kufs disease / adult NCL (CLN4), Type 5 Finnish Variant / late infantile (CLN5), Type 6 Late infantile variant (CLN6), Type 7 CLN7, Type 8 Northern epilepsy (CLN8), Type 8 Turkish late infantile (CLN8), Type 9 German/Serbian late infantile, Type 10 Congenital cathepsin D deficiency (CTSD)), Wolman disease, Oligosaccharidoses (e.g., Alpha- mannosidosis, Beta-mannosidosis, Aspartylglucosaminuria, Fucosidosis), lysosomal transport diseases (e.g., Cystinosis, Pycnodysostosis, Salla disease / sialic acid storage disease, Infantile free sialic acid storage disease), Glycogen storage diseases, e.g., Type II Pompe disease, Type lib Danon disease), Cholesteryl ester storage disease, and the like.
Mucopolysaccharidoses (e.g., Type I (MPS I (Hurler syndrome, MPS I S Scheie syndrome, MPS I H-S Hurler-Scheie syndrome), Type II (Hunter syndrome), Type III (Sanfilippo syndrome), Type IV (Morquio), Type VI (Maroteaux-Lamy syndrome), Type VII (Sly syndrome), Type IX (hyaluronidase deficiency))
Mucopolysaccharidosis type III (MPS III), is characterized by severe and rapid intellectual deterioration. Deficiencies in one of the four enzymes required for heparan sulfate (HS) degradation are responsible for each of the MPS III subtypes: heparan sulfamidase for MPS IIIA, alpha-N-acetylglucosaminidase for MPS NIB, alpha-glucosaminide N-acetyltransferase for MPS MIC, and N-acetylglucosamine-6-sulfate sulfatase for MPS HID.
Hurler syndrome, also known as mucopolysaccharidosis type I (MPS I), Hurler's disease, also gargoylism, is a genetic disorder that results in the buildup of glycosaminoglycans (a.k.a. mucopolysaccharides) due to a deficiency of alpha-L iduronidase, an enzyme responsible for the degradation of mucopolysaccharides in lysosomes. Without this enzyme, a buildup of dermatan sulfate and heparan sulphate occurs in the body. Symptoms appear during childhood and early death can occur due to organ damage. MPS I is divided into three subtypes based on severity of symptoms. All three types result from an absence of, or insufficient levels of, the enzyme a- L-iduronidase. MPS I H or Hurler syndrome is the most severe of the MPS 1 subtypes. The other two types are MPS I S or Scheie syndrome and MPS I H-S or Hurler-Scheie syndrome.
Mucopolysaccharidosis type II (MPS II), also known as Hunter syndrome, is a condition that affects many different parts of the body and occurs almost exclusively in males. It is a progressively debilitating disorder.
At birth, individuals with MPS II typically do not display any features of the condition. Between ages 2 and 4, they develop full lips, large rounded cheeks, a broad nose, and an enlarged tongue (macroglossia). The vocal cords also enlarge, which results in a deep, hoarse voice. Narrowing of the airway causes frequent upper respiratory infections and short pauses in breathing during sleep (sleep apnea). As the disorder progresses, individuals need medical assistance to keep their airway open.
Mucopolysaccharidosis type VII (MPS VII), also known as Sly syndrome, is a progressive condition that affects most tissues and organs. The most severe cases of MPS VII are characterized by hydrops fetalis, a condition in which excess fluid builds up in the body before birth. Most babies with hydrops fetalis are stillborn or die soon after birth.
Other people with MPS VII typically begin to show signs and symptoms of the condition during early childhood. The features of MPS VII include a large head (macrocephaly), a buildup of fluid in the brain (hydrocephalus), distinctive-looking facial features that are described as "coarse," and a large tongue (macroglossia). Affected individuals also frequently develop an enlarged liver and spleen (hepatosplenomegaly), heart valve abnormalities, and a soft out-pouching around the belly-button (umbilical hernia) or lower abdomen (inguinal hernia).
Illustrative, non-limiting examples of neuronal ceroid lipofuscinoses include, but are not limited to, infantile NCL (Santavuori-Haltia disease), late infantile NCL (Jansky-Bielschowsky disease, Juvenile NCL (CLN1, Batten disease), adult NCL (Kufs disease), Finnish Late Infantile NCL, Variant Late Infantile NCL, CLN7 NCL, CLN8 NCL (Northern Epilepsy, progressive epilepsy with mental retardation (EPMR)), Turkish Late Infantile Variant NCL, and CLN10 NCL (Congenital, Cathepsin D Deficiency).
Neuronal ceroid lipofuscinoses (NCLs) are typically characterized by the progressive, permanent loss of motor and psychological ability with a severe intracellular accumulation of lipofuscins. There are four classic diagnoses that have received the most attention from researchers and the medical field, differentiated from one another by age of symptomatic onset, duration, early- onset manifestations such as blindness or seizures, and the forms which lipofuscin accumulation takes.
In the early infantile variant of NCL (also called INCL or Santavuori-Haltia), individuals appear normal at birth, but early visual loss leading to complete retinal blindness by the age of 2 years is the first indicator of the disease; by 3 years of age a vegetative state is reached and by 4 years isoelectric encephalograms confirm brain death. Late infantile variant usually manifests between 2 and 4 years of age with seizures and deterioration of vision. The maximum age before death for late infantile variant is 10-12 years. Juvenile NCL (JNCL, Batten Disease, or Spielmeyer-Vogt), with a prevalence of 1 in 100,000, usually arises between 4 and 10 years of age; the first symptoms include considerable vision loss due to retinal dystrophy, with seizures, psychological degeneration, and eventual death in the mid- to late-20s or 30s ensuing. Adult variant NCL (ANCL or Kufs Disease) generally manifests milder symptoms; however, while symptoms typically appear around 30 years of age, death usually occurs ten years later.
Examples
Example 1
miR-211-/- mice display an impaired autophagic pathway.
MiR-211 expression levels are known to respond rapidly to dark-light transitions in mouse retinal neurons [40]. The inventors found that the peak in miR-211 expression levels coincided with light dependent activation of autophagy in the RPE/retina at 10:00 AM 3h after light on, as shown in Figure 1 (a-e, h).
Thus, the inventors considered whether miR211 may be involved in light-mediated autophagy activation.
Firstly, they assessed whether autophagy was affected in the RPE/retina as consequence of miR- 211 ablation in 2-month-old mice (Figure 1 f-i). The conversion from LC3 (LC3I) to the autophagosome-associated lipidated form LC3II was quantified and a significant decrease in the LC3II levels in the RPE at 10:00 AM. [3h after light on; (see Figure 1 i)] and an alteration of autophagy fluctuation during the light/dark transition were observed, as seen in Figure lh. This downregulation was accompanied by a reduction of the lysosomal marker Lampl in both retina and RPE as seen in Figure lf-i, an increase of the SQSTMl/p62 autophagy substrate (Figure 1 i). Secondly, they assessed whether the lysosomal biogenesis was affected in the RPE/retina as consequence of miR-211 ablation in 2-month-old mice. Interestingly, an engulfment of both phagosomes and double-membrane phagolysosomes containing poorly processed POS within the RPE of miR-211-/-mice was observed by transmission electron microscopy (TEM) as seen in Figure 2 a-b' wherein miR-211-/- mice show apical engulfment of double-membrane phagolysosome-like structures. The enlarged box in b' highlights phagolysosome-like structures containing poorly processed POS (black arrows).
Notably, engulfed phagolysosomes were located more basally than in controls at comparable time points, indicating both normal LAP processing and their ability to move through the RPE cells [8]. Furthermore, from the age of 1 month onward, miR-211-/- mice showed an accumulation of lipofuscin accompanied by an enlargement of Bruch's membrane as shown in Figure 2 c-f, wherein in panels c-d RPE shown at higher magnification also highlighted accumulation of lipofuscin (black arrows) accompanied by an enlargement of Bruch's membrane (dashed lines) in miR-211-/- compared to control WT mice; Graphs in Figure 2 (e) show Bruch's membrane thickness from the RPE of mice as in c-d. This phenotype was consistent with what was previously shown for dysfunctional phagocytic/autophagic-lysosomal pathways in age-related macular degeneration and Stargardt disease, both characterized by lipofuscin accumulation and impairment of cone -photoreceptor's function and survival, reinforcing the relevance of miR-211 in these cellular processes in RPE/PR crosstalk.
Consistently, lack of miR-211 function in the human ARPE-19 (retinal pigment epithelium) cell line induced reduction of both Lampl and LC3 expression accompanied by a decrease in the number of LC3/Lampl-positive vesicles and an increase of SQSTMl/p62 (Figure 3 c-f). In addition, silencing of miR-211 blunted the increase in LC3II levels both in normal and starved conditions, in either the presence or absence of bafilomycin (baf) (Figure 3 f, h). Moreover, miR- 211 depletion induced a significant decrease in the number of lysosomal vesicles, which appeared lacking Lampl as shown in Figure 2 g-l, suggesting an impairment of lysosomal biogenesis.
Consistent with an effect on lysosomal biogenesis and autophagy, miR-211 overexpression increased Lampl and LC3II levels (Figure 3 (a-b"), (e-f)) and induced the autophagic flux as determined by LC3II lipidation in starved cells and in the presence of baf (Figure 3 g). Autophagy induction was accompanied by an increase in autophagosome-lysosome fusion as demonstrated by the increased number of LC3/Lampl-positive vesicles (Figure 3 e) and reduction in the SQSTMl/p62 autophagy substrate (Figure 3 f) compared with control cells. The increase of Lampl-staining on lysosomal vesicles was also confirmed in miR-211-overexpressing ARPE-19 cells compared with control cells as demonstrated by TEM (Figure 2 (g-l)).
Importantly, three-month-old GFP-LC3 transgenic mice [41, 42] were subretinally injected with an adeno-associated virus (AAV) vector encoding the human miR-211 precursor (AAV2/8-miR- 211). Both retina and RPE specimens from miR-211-injected animals showed a significant increase in the number of both GFP-LC3-positive and GFP-LC3/Lampl-positive vesicles as shown in Figure 4 (a-e) as well as a significant increase in both lysosomal marker LAMP1 and lipidated LC3II levels [at 10:00 AM 3h after light on as shown in Figure 4 f]. At the same time retina and RPE specimens from miR-211-injected animals showed a significant decrease of Ezrin staining Figure 4 g., confirming the miR-211-mediated targeting of Ezrin.
The overexpression level of miR-211 in both retina and RPE specimens from miR-211-injected animals compared to control animals was monitored by qRT-PCR Figure 4 i.
Example 2
Identification of Ezrin as a suppressor of lysosomal biogenesis and autophagy
Autophagy in the retina shows circadian rhythmicity [43] and is associated with lipofuscin accumulation in rod and cone photoreceptors [44] . By performing immunofluorescence assays, the inventors surprisingly found that during the dark/light transitions the protein Ezrin was expressed in the retina and RPE with an opposite correlation to the LC3 autophagy marker. The eyes of mice that ubiquitously express the autophagosome marker MAP1LC3 tagged with green fluorescent protein (GFP) (GFP-LC3tg/+) [41] were analyzed in order to confirm the correlation between circadian rhythm and autophagy markers. Very few autophagic vesicles (AVs) were detected 3h after light off (10:00 PM) in the retina and RPE of mice (P60) (Figure 5 a - a'). Sections of the eye obtained from mice (P60) at 10:00 AM 3h after light on showed a progressive light-dependent increase in the number of AVs (Fig. 5b -b'), as previously described [10], confirming that autophagy is induced during the light cycle and is reduced during the dark cycle. Ezrin is a member of the ERM (Ezrin/Radixin/Moesin) family of proteins [19] which regulates membrane cytoskeleton complexes, playing key roles in cellular processes like maintenance of membrane dynamics, survival, adhesion, motility, cytokinesis, phagocytosis and integration of membrane transport with signaling pathways. Analysis of Ezrin expression in GFP-LC3tg/+ mice using antibodies that recognize the endogenous Ezrin and the active phosphorylated form (pT567-Ezrin), shows that Ezrin and pT567-Ezrin expression are inversely related to LC3 expression, with a high expression detected 3h after light off (10:00 PM - dark) (Figure 5 c, e) and a very low expression detected 3h after light on (10:00 AM -light) (Figure 5 d, f).
The inventors then separated the retina from the RPE in order to specifically collect RPE tissue, which actively participates to the visual cycle [8] for photoreceptor outer segments (POS) degradation as well as maintenance of retinoid levels to support a proper vision [8]. The protein levels of both Ezrin and its pT567-Ezrin phosphorylated form in RPE of wild type mice at different dark and light conditions were quantified by western blot, as shown in Figure 5 g. Specifically, total protein was extracted from the collected samples and the expression levels were measured by western blot. In agreement with the immunofluorescence findings, a high expression of Ezrin was detected 3h after light-off (10:00 PM - dark) and a very low expression detected 3h after light-on (10:00 AM -light) (Figure 5 g). The simultaneous expression pattern of both Ezrin and its active form suggested that Ezrin might negatively modulate the induction of autophagy in both retina and RPE.
Furthermore, the inventors found that physiological expression of Ezrin and of its pT567-Ezrin active form were opposed to that of miR-211 and autophagy-related genes (Figure 5 a-d, i), with a very low expression detected 3h after light on (10:00 AM) and a high expression detected 3h after light off (10:00 PM) in the RPE of wild type mice.
The assessment of whether and how Ezrin and its pT567-Ezrin active form regulate cell clearance has remained largely elusive so far. The inventors therefore investigated whether Ezrin was directly targeted by miR-211 and might play a relevant role in repressing lysosomal biogenesis and autophagy in the RPE. Validation of this target gene by multiple approaches indicated that Ezrin, which was recently found upregulated in absence of Lampl [35], was a promising downstream target for miR-211. Notably, a decrease and increase in endogenous Ezrin was detected at both RNA and protein levels in miR-211-overexpressing and miR-211- downregulated ARPE-19 cells respectively, as shown in Figure 6 (a-f). The validity of these findings was supported by dual Luciferase reporter assays shown in Figure 6 (g-h), indicating that Ezrin is a direct target of miR-211 in ARPE-19 cells. In further support of these findings, the inventors observed that the RPE of AAV2/8-miR-211-injected animals showed a significant decrease of Ezrin at both mRNA and protein levels as shown in Figure 6 (k-n). Consistently, both Ezrin mRNA and protein accumulated in the RPE of miR-211-/- mice compared to control littermates (Figure 6 (i-j), (m-n)). Remarkably, aberrant expression levels of both Ezrin and its active form were detected in the RPE at 10:00 AM (3h after light on) (Figure 5 (e-h), j), when physiologically they should be poorly expressed, supporting the hypothesis that an imbalance in the circadian expression of Ezrin could affect autophagy in the RPE of miR-211-/- mice. The impact of Ezrin function on both lysosomal biogenesis and autophagy was tested using both pharmacologically- and genetically- based inhibition approaches. Importantly, phosphorylation at amino acid residue 567 (Thr567), within the COOH-terminal ERM association domain (C-ERMAD) leads to an open conformation and enables the interaction of Ezrin with other cellular proteins [21, 45-48]. T567-Ezrin phosphorylation has been reported to be specifically inhibited by the small molecule NSC668394 through its direct binding to Ezrin [27]. ARPE-19 cells were cultured in the presence of NSC668394 for 6h and autophagy was assessed. Immunostaining showed an increase of both LC3 and Lampl staining and of their co-localization, strongly supporting enhancement of autophagosome-lysosome fusion (Figure 7 (a-c)). Consistently, an increased rate of autophagosome-lysosome fusion in NSC668394-treated compared with control ARPE-19 cells was also observed using an LC3 protein tandem-tagged with red fluorescent protein-green fluorescent protein (RFP-GFP) [42, 49]. Autophagosomes (GFP- and RFP-positive) were discriminated from autophagolysosomes (GFP-negative and RFP-positive) because of quenching of the GFP signal (but not of RFP) inside the acidic lysosomal compartment (Figure 7 (d-f)). Furthermore, Western blot analysis showed an increase of both lipidated LC3II and Lampl as well as reduced levels of the autophagy substrate SQSTMl/p62 (Figure 7 g) in NSC668394- treated compared with control ARPE-19 cells. Notably, treated cells also displayed an increase of Lampl-positive structures as detected by immuno-electron microscopy (EM) analysis (Figure 8 (a-c)). Consistent with this observation, treatment under starvation and with baf showed a further increase of LC3II in NSC668394-treated ARPE-19 cells (Figure 7 h), confirming the presence of increased autophagic flux, and excluding that lipidated LC3II accumulation was due to a block along the autophagy pathway. Notably, autophagic cells were not apoptotic, as indicated by their normal nuclear morphology (Figure 7 (a-e")).
The inventors thus reasoned that if inhibition of Ezrin directly controls expression of lysosomal biogenesis and function, the levels of the enzymatic activity of lysosomal cathepsin B should be increased and the autophagy substrates should be reduced, respectively. Therefore, a Magic red assay was carried out, based on a cathepsin B-specific substrate that, upon hydrolysis, liberates membrane-impermeable fluorescent cresyl violet within lysosomes containing catalytically active cathepsin B, in living cells. An increase of intensity of the Magic Red in NSC668394-treated compared with control cells was found (figure 7 (l-m)). Similar results were obtained when Ezrin was silenced (Figure 8 (d-f) and 9 (a-h)). The inventors next sought to determine whether the miR-211 phenotype was indeed related to abnormal activation of Ezrin expression. Both pharmacological and siRNA-mediated inhibition of Ezrin rescued autophagy pathway in the miR-211 loss-of function (LoF; Figure 7 (i-k) and Figure 9 (i-k)). To further demonstrate that increased Ezrin expression levels can account for lysosomal biogenesis and autophagy defects observed in miR-211 deficiency, a GFP-tagged version of Ezrin [50] was overexpressed in normally fed ARPE-19 cells. Ezrin-GFP expression resulted in repression of autophagy as assessed by immunofluorescence staining for Lampl (Figure 10 ( a-b')) and Western blot analysis for autophagic markers. Importantly, Ezrin overexpression led to a reduction of both lipidated LC3II and Lampl and an increase of SQSTMl/p62 autophagy substrate (Figure 10 d). Notably, NSC668394 treatment rescued the Ezrin-mediated inhibition of autophagy, supporting the ability of NSC668394 in targeting and repressing Ezrin (Figure 10 a-d). Moreover, the specificity of NSC668394 in mediating autophagy induction through Ezrin repression was further confirmed by no additional increment of autophagy in Ezrin-silenced ARPE-19 cells (Figure 10 (e-g). Altogether, these data demonstrate that Ezrin acts downstream of miR-211 and suggest that Ezrin and its active form were not only necessary but also sufficient to inhibit autophagy in the RPE.
Example 3
Ezrin inhibition results in autophagy induction through promotion of MAGTl-dependent Mg2+ flux
The impact of inhibition of Ezrin on autophagy was tested initially in a retinal pigment epithelium cell line (ARPE-19) in which Ezrin is expressed [35]. Phosphorylation at amino acid residue 567 (Thr567), within the COOH-termimal ERM association domain (C-ERMAD), leads to an Ezrin active form with open conformation and enables the interaction of Ezrin with other cellular proteins [51]. Furthermore, T567-Ezrin phosphorylation has been reported to be specifically inhibited by the small molecule NSC668394 through its direct binding to Ezrin [29]. The ARPE-19 cell line was cultured in the presence of NSC668394 for 6h and autophagy was assessed. Immunostaining showed an increased staining of autophagy markers LC3 and Lampl and their co-localization, indicative of enhancement of autophagosome-lysosome fusion, which in turn is a sign of increased autophagy activity (Figure 7 (a-c)). Consistently, as shown in Figure 7 (d-f), an increased rate of autophagosome-lysosome fusion was observed in NSC668394- treated cells compared with control ARPE-19 cells using an LC3 protein tandem-tagged with red fluorescent protein-green fluorescent protein (RFP-GFP) [52]. Autophagosomes (GFP- and RFP- positive) were discriminated from autophagolysosomes (GFP-negative and RFP-positive) because of quenching of the GFP signal (but not of RFP) inside the acidic lysosomal compartment. NSC668394-treated cells showed increase of both autophagosomes and autophagolysosomes, confirming induction of autophagy. Furthermore, Western blot analysis showed an increase of lipidated LC3II and Lampl as well as reduced levels of the autophagy substrate SQSTMl/p62 in NSC668394-treated cells compared with control ARPE-19 cells, as shown in figure 7 g. Notably, treated cells also displayed an increase of Lampl-positive structures as detected by immuno-electron microscopy (EM) analysis as shown in figure 8 (a-c). To investigate this further, autophagic flux was measured by monitoring LC3II protein levels in different conditions. The most well-known inducer of autophagy is nutrient starvation, both in cultured cells and in intact organisms, ranging from yeast to mammals. Moreover, if cells are treated with bafilomycin Al, which inhibits acidification inside the lysosome, the degradation of LC3-II is blocked, resulting in the accumulation of LC3-II [53]. Accordingly, a gradual increase has to be observed in the amount of LC3-II between samples in starvation, in the presence of bafilomycin Al and in starvation in presence of lysosomal inhibitors such as bafilomycin Al, representing the amount of LC3 that is delivered to lysosomes for degradation (i.e., autophagic flux). Thus, if most of the changes in LC3II protein levels caused by NSC668394 are due to increase of autophagy, additional treatment with starvation and bafilomycin Al should show gradual increase of expression levels in NSC668394-treated ARPE-19 cells. Consistently with this observation, treatment with bafilomycin Al under starvation showed a further increase of LC3II in NSC668394-treated ARPE-19 cells (Figure 7 h), confirming an increased autophagic flux, and excluding that lipidated LC3II accumulation was due to a block along the autophagy pathway. Notably, autophagic cells were not apoptotic, as indicated by their normal nuclear morphology as shown in figure 7 (a-e").
The inventors developed additional Ezrin inhibitors by using siRNA oligonucleotides targeting Ezrin mRNA, as indicated in Table I above.
ARPE-19 cells were transfected with siRNA oligonucleotides specific for Ezrin or with control siRNA. 48h later cells were left untreated, serum starved or treated with bafilomycin Al, and then LC3II was measured as shown above. siRNA mediated inhibition of Ezrin further increased both LC3 and Lampl protein levels as well as their co-localization, strongly supporting enhancement of autophagosome-lysosome fusion (Figure 9 (a-c)). Consistently, an increased rate of autophagosome-lysosome fusion in Ezrin-siRNA-treated ARPE-19 cells using the LC3 protein tandem-tagged with red fluorescent protein-green fluorescent protein (RFP-GFP) was observed, as shown in figure 9 (d-f). Furthermore, Western blot analysis showed an increase of both lipidated LC3II and Lampl as well as reduced levels of the autophagy substrate SQSTMl/p62 (Figure 9 g) in Ezrin-siRNA-treated ARPE-19 compared with control ARPE-19 cells. Notably, treated cells also displayed an increase of Lampl-positive structures as detected by immuno-electron microscopy (EM) analysis (Figure 8 (d-f)). Furthermore, consistently with NSC668394 treatment, silencing of Ezrin gradually increased LC3-II protein levels in the following conditions: under starvation, in presence of bafilomycin A1 and starvation, in presence of bafilomycin A1 alone, respectively (Figure 9 h), confirming the presence of increased autophagic flux, and excluding that lipidated LC3II accumulation was due to a block along the autophagy pathway.
Autophagy is the homeostatic process through which damaged proteins and organelles are cleared from the cells, physiologically activated for survival under a broad range of cellular stress-inducing conditions, mediating the degradation of protein aggregates, oxidized lipids, damaged organelles and intracellular pathogens. In the last decades, extensive resources and effort have documented the physiological role of the transcription factor EB (TFEB) as major player in the regulation of lysosomal biogenesis. In particular, physiological activation of autophagy requires the cellular activation of a transcriptional program controlling major steps of the autophagic pathway, including autophagosome formation, autophagosome-lysosome fusion and substrate degradation. Nuclear localization and activity of TFEB coordinates this program by driving expression of both autophagy and lysosomal genes. Therefore, the autophagy induction can be assessed by measuring the intracellular localization of TFEB (nuclear vs cytosolic) [54]. Notably, TFEB nuclear translocation induced by nutrient starvation is strictly associated to a lower molecular weight compared to that of normally fed cells, as revealed by western blot analysis. Most importantly, induction of TFEB, a master gene for lysosomal biogenesis and autophagy [42], reduces the pathologic accumulation of glycosaminoglycans in different neurodegenerative Lysosomal Storage Disorder (LSD) models, ameliorates tissue pathology in a murine mode! of Parkinson's disease, and, as was recently discovered, also promotes cellular clearance and rescues neurotoxicity in a murine model of Huntington disease [1, 55-58]. Remarkably, both Mg2+ and Ca2+ influx modulates the protein phosphatase Calcineurin (PPP3CB) [54, 59, 60], which in turn dephosphorylates and activates the transcription factor EB (TFEB) [54], a master regulator of lysosomal biogenesis and the autophagy pathway [42]. Both pharmacological inhibition and silencing of Ezrin significantly promoted nuclear translocation of both endogenous and overexpressed TFEB in normally fed HeLa (HeLaTFEB-GFP) and ARPE-19 cell lines as shown in Figure 12 (b,c,d), similarly to what was described previously for starvation [54], suggesting an involvement of Calcineurin activity. Interestingly, Ezrin has been reported to be essential for the regulation of phosphate and calcium homeostasis [61]. The inventors next sought to determine whether the Ezrin-mediated activation of autophagy via TFEB nuclear translocation was indeed related to Mg2+ and Ca2+ influx. Ezrin cellular interacting proteins candidates were identified by coupling immunoprecipitation experiments of GFP:tagged-Ezrin in ARPE-19 cells to quantitative high pressure nanoflow liquid chromatography-mass spectrometry-based proteomics (HPLC-MS) [62] The candidates, listed in Table 2, were then analyzed for biological function by using the publicly available Functional Annotation data [63] established in the AmiGO and the GO Consortium's annotation toolkit [64, 65]. In agreement with the results of transcriptome analysis in miR-211-/- mice [66], the analysis showed many terms related to "metabolism". In particular, 105 out of the total 418 Biological Process terms (BPs) were annotated as metabolic- related processes i.e. "children" of the Metabolic Process term (G0:0008152). The 32 identified Ezrin interactors were ranked from the most to the least enriched with respect to metabolism. MAGT1, a highly selective transporter of Mg2+, showed 96% of its BPs related to metabolic processes, and its activation is known to promote a significant increase in free Mg2+ concentrations enhancing PLCyl activation and Ca2+ signaling [67], which in turn activates Calcineurin [54, 59, 60].
Table VI: Ezrin interactors
Figure imgf000064_0001
Figure imgf000065_0001
Figure 11 (a) ARPE-19 cells were transiently transfected with GFP or EZRIN-GFP. After cell lysis, whole protein extracts were immunoprecipitated with Agarose Anti-Green Fluorescent Protein. The immuno complex was washed with lysis buffer, and the immunoprecipitation (IP) was revealed with anti-MAGTl. (b) Immunoprecipitation experiments of the EZRIN-GFP form were coupled to quantitative nanoflow liquid chromatography-mass spectrometry (LC-MS) analysis. Volcano plot of EZRIN-GFP interactors in ARPE-19 cells, (c) List of most statistically significant interactors of Ezrin. The inventors formulated the hypothesis that Ezrin might modulate autophagy by controlling MAGTl-dependent Mg2+ flux followed to Ca2+ signaling and modulation of TFEB nuclear translocation in the RPE. A physical interaction between EZRIN and MAGT1 at cytoplasmic membrane was further confirmed, using Proximity Ligation Assay (PLA) [68] on the endogenous Ezrin protein in MAGTl-transfected living cells (Figure 11 (d-e')). Mg2+ ion uptake was measured in untreated and NSC668394-treated ARPE-19 cells using a fluorescent sensitive probe for Mg2+ (Magfluo4-AM) [67]. Notably, a significant increase of Mg2+ influx in NSC668394-treated compared to untreated ARPE-19 cells was observed as shown in Figure 12 a, wherein ARPE-19 cells were stimulated with NSC668394 and silenced or not with siMAGTl. The left panel shows representative fluorescence readings (dots) and corresponding exponential fits in ARPE-19 cells exposed to high extracellular Mg2+. The bar graph (right) reports the maximal rate of Mg2+ influx for the indicated conditions. Graphs represent the fold change of the slope of Mg2+ flux in ARPE-19 cells either unstimulated or stimulated with NSC668394 and silenced or not with siMAGTl. Most remarkably, the NSC668394-induced Mg2+ influx was abolished following silencing of MAGT1 expression, which is consistent with the activation of MAGT1 in response to Ezrin inhibition. As control, no Mg2+ influx was discernible in MAGTl-silenced ARPE-19 cells. Next, the hypothesis that the induction of a Mg2+ flux might promote a Ca2+-dependent activation of Calcineurin, thus promoting TFEB nuclear translocation, was examined. Figure 12 (b-k) shows representative experiments of TFEB nuclear translocation in HeLaTFEB-GFP cells transfected with siCTRL (b,f) or siPPP3CB (g,k) and treated with DMSO (b,g) or NSC668394 (c,h), silenced for EZRIN (d,i) or for EZRIN and MAGT1 (e,j) or serum-starved (f,k). Both pharmacological inhibition (c) and silencing (b) of Ezrin induced TFEB nuclear localization in stable HeLaTFEB-GFP cells (d). Silencing of MAGT1 rescues siEZR- mediated TFEB nuclear localization in HeLaTFEB-GFP. Starvation (stv) was used as control since it was previously described to activate TFEB by promoting its nuclear translocation. Nuclear translocation of TFEB in stable HeLaTFEB-GFP cells subjected to the indicated conditions is reduced after silencing of PPP3CB (Calcineurin B gene) (g-k). Representative images from HC assay of HeLaTFEB-GFP cells transfected with control (siCTRL) or siPPP3CB and subjected to the indicated conditions. Quantification of the results is shown in Figures 121 and 12m.
Notably, Both pharmacological inhibition and silencing of EZRIN induce downshift of endogenous TFEB electrophoretic mobility in fed cells as shown in Figure 12n, confirming its dephosphorylation as assessed by Western blot analysis (TORIN, previously described to promote TFEB nuclear translocation associated to downshift of TFEB protein in western blot analysis, was used as a control) [69].
Most remarkably, siRNA-mediated inhibition of either MAGT1 or calcineurin abolished the TFEB nuclear translocation as shown in (Figure 12 panels e, g-k), suggesting that MAGTl-dependent Mg2+ acting as a second messenger was sufficient to trigger Ca2+ influx inducing the activation of calcineurin, which in turn promotes dephosphorylation and TFEB nuclear translocation. Consistent with this hypothesis, treatment with the specific Ca2+ chelator BAPTA-AM significantly reduced TFEB nuclear translocation in Ezrin-inhibited cells, further suggesting that Ca2+-dependent calcineurin activation acts downstream of MAGTl-dependent Mg2+. In figure 12, panels o-u show nuclear translocation of TFEB in stable HeLaTFEB-GFP cells subjected to the indicated conditions is reduced after Ca2+ chelator BAPTA treatment. The graph of Figure 12 u, shows the mean ± s.e.m. of the percentage of nuclear TFEB translocation in Ezrin-inhibited cells compared with DMSO under Ca2+ chelator BAPTA treatment.
The ability of Ezrin to modulate TFEB-mediated lysosomal biogenesis and autophagy was further confirmed by the upregulation of TFEB target genes expression as shown in Figure 12 v, representing qRT-PCR analysis for TFEB target genes MCOLN1, BECLIN, MAPLC3B and LAMP1 performed on ARPE-19 cells treated with DMSO or NSC668394.
Consistently, immunostaining showed an increase of both LC3 and Lampl staining and of their co-localization, strongly supporting enhancement of autophagosome-lysosome fusion Figure 12 w-x".
Furthermore, the absence of alteration of the autophagic markers after either inhibition or overexpression (Figure 12 z) of Ezrin in HeLaTFEB-KO cells 48 was observed.
The inventors further investigated whether silencing of MAGT1 would inhibit autophagy and reestablish normal lipidated LC3II and Lampl expression levels in both miR-211 gain-of-function (GoF) and Ezrin loss of function (LoF) models. As shown in Figure llh, siRNA-mediated silencing of MAGT1 strongly reduced autophagic flux and led to a reduction of both lipidated LC3II and Lampl and an increase of the autophagy substrate SQSTMl/p62 in ARPE-19 cells. Figure 11 f- g" shows representative images from ARPE-19 cells transiently transfected with siCTRL (f-g") or siMAGTl (f'-g"). Figure llh shows Western blot analysis of LAMP1, SQSTMl/p62, MAGT1 and LC3 proteins from siCTRL or siMAGTl transfected cells. The plot shows the quantification of the indicated proteins normalized to the b-Actin loading control. Figure Hi shows Western blot analysis from ARPE-19 cells transiently transfected with siCTRL or siMAGTl cultured in normal medium (stv-), starved HBSS medium (stv+), supplemented with bafilomycin (baf +) or without bafilomycin (baf -) as the quantification of LC3-II intensity.
Furthermore, silencing of MAGT1 abolished autophagy upregulation in both miR-211 GoF and Ezrin LoF, as seen in Figure 13 (a-j), wherein staining of endogenous LAMP1 and LC3 from ARPE- 19 cells: represents how silencing of MAGT1 reduces induction of autophagy in Ezrin-inhibited cells by miR-211, siEZR, and NSC668394 treatment.
In summary, MAGT1 is identified as an Ezrin-interacting protein that acts downstream of Ezrin in the regulation of autophagy and that modulation of its activity may interfere with Ezrin- mediated autophagy control.
Example 4
Therapeutic inhibition of Ezrin rescues retinal degeneration in vivo.
The relevance of autophagy-mediated clearance induced by therapeutic inhibition of Ezrin in the treatment of eye disease was further investigated in vivo.
GFP-LC3 transgenic mice were injected daily intraperitoneally with NSC668394, at a dose of 0.26 mg/Kg, whose pharmacokinetic studies demonstrated a monophasic elimination after 1-2 hours from the plasma [29]. Notably, daily injections of NSC668394 at 8:00 AM, 5 times a week, over two consecutive weeks was efficient in inducing autophagy in the RPE/retina of 3-month-old GFP-LC3 transgenic mice. Both retina and RPE specimens from injected animals showed a significant increase in the number of GFP-LC3-positive and GFP-LC3/Lampl-positive vesicles as well as a significant increase in both the lysosomal marker LAMP1 and lipidated LC3II levels (2h after injections) when compared with vehicle-injected control animals (Figure 14 a-c).
Next, 1-month-old miR-211-/- mice were injected daily with with NSC668394, at a dose of 0.26 mg/Kg at 8:00 AM, 5 times a week over five consecutive months. Notably, NSC668394 treated, but not vehicle treated, rescued upregulation of Ezrin levels, as shown in Figure 14 (h-k) and in turn normalized the daily autophagy activation in the RPE/retina miR-211-/-, as demonstrated by recovery of both the lysosomal marker LAMP1 and lipidated LC3II levels and reduction in the autophagy substrate SQSTMl/p62 upon the switch from dark to light conditions as demonstrated in both western and immunofluorescence assays (Figure 14 d-l).
Most importantly, a significant recovery of cone number and density defects in NSC668394- treated miR-211-/- mice at 3 and 6 months of age compared to control miR-211-/- mice were recorded, as shown in Figure 15 (a-c ) with representative images of retina cryosections immunostained with anti-Cone Arrestin antibody from WT and miR-211-/- mice at three months of age after DMSO or NSC668394 treatment. Nuclei were counterstained with DAPI in Figure 15(d), graphs show cone percentage (cones/area) from the retina of mice treated as in a-c.
As a consequence, a progressive rescue in retinal function was observed by both standard electroretinographic (ERG) and 6-Hz scotopic flicker ERG recordings [70] in NSC668394-treated miR-211-/- mice compared to control mice. Both rod and cone responses in NSC668394-treated miR-211-/- mice were similar to those recorded in WT mice as shown in Figure 15 (e-f).
In Figure 15 (e) representative flicker traces at three months of age show the rescue of flicker responses of NSC668394-treated miR-211-/- mice (green lines) compared to DMSO-treated miR-211-/- control mice (red lines). WT mice were used as a control (black lines). Flicker recordings were performed with light intensities ranging from 10-4 to 15 cd s/m2 in steps of 0.6 logarithmic units at 6 Hz frequency. Figure 15 (f) shows flicker responses, plotted as a function of stimulus intensity, from WT (black lines), DMSO-treated miR-211-/- (red lines) and NSC668394-treated miR-211-/- (green lines) mice, at three months of age. The amplitude of the recordings from NSC668394 miR-211-/- treated mice was significantly rescued compared to DMSO-treated miR-211-/- mice. WT mice were used as a control.
Crucially, the changes described above were associated with rescue of both engulfment of POS and lipofuscin accumulation in the RPE as shown in Figure 15 (g-q).
Next, the inventors tested this therapeutic approach for other retinal degeneration conditions in which mistrafficking and accumulation of mutated and unfolded proteins induce toxicity in PR cells.
The main group of genetic disorders affecting the eye is represented by inherited retinal dystrophies (IRD), which include, among others, Retinitis Pigmentosa (RP), one of the leading causes of inherited blindness. These diseases, for which there are currently few disease modifying therapies, show a great diversity in clinical phenotypes; patients may develop visual loss in early childhood, whereas others may remain asymptomatic until mid-adulthood. They share a common pathological hallmark, death of rod cells, resulting in the development of night blindness with visual field restrictions, accompanied by subsequent loss of cone cells leading to a complete loss of visual fields. Notably, proof-of-concept studies are shedding new light on the pathological mechanisms behind eye disorders. Recent advances have pointed out the role of mistrafficking and accumulation of mutated and unfolded protein in impairing normal cellular function and inducing toxicity in photoreceptor cells. AMD as well as other forms of retinal degeneration are often associated with impaired function of degradation of oxidatively damaged proteins. Indeed, the degradation process becomes less efficient with aging, possibly because of a decrease in proteasomal function. Hence, it is becoming clear that new therapeutic strategies must aim at alleviating pathological protein and lipid accumulation and re establishing normal degradation in the retinal cells.
The inventors first investigated an autosomal dominant form of retinitis pigmentosa (adRP) for which an animal model is available: the P23H-Rho+/ mouse model for adRP, in which mutated Rhodopsin accumulated in the ER. This knock-in mouse line carries a copy of the human Rhodopsin gene harboring a proline-to-histidine substitution in position 23 of the protein. This mutation is responsible for a form of RP in human patients. The retinal phenotype in this mouse model appears up to 1 month of postnatal life.
Notably, NSC668394 injections daily at 8:00 AM to postnatal days 6-old P23H-Rho+/- knockin mice, 5 times a week over two consecutive months, but not vehicle, protected P23H-Rho+/- rod PR from cell death, reducing by 60% the number of TUNEL positive cells at P19 corresponding to the maximum peak in photoreceptor cell death as shown in Figure 16 (a-c)).
An amelioration of the outer segment of both cones and rods and a significant increase in rod density in P23H-Rho+/- treated animals, compared to P23H-Rho+/- control mice was also detected by immunostaining with anti-cone Arrestin and anti-Rhodopsin antibodies, which mark cones and rods, respectively, as shown in Figure 16 (d-h)).
Furthermore, a rescue in retinal function was observed by standard electroretinographic (ERG) in NSC668394-treated P23H-Rho+/- animals compared to control mice. Additionally, rod and cone responses in NSC668394-treated P23H-Rho+/- mice were similar to those recorded in WT mice as shown in Figures 16 i-j).
Figure 16 (i) shows ERG responses (a- and b-wave), plotted as a function of stimulus intensity, from WT (black lines), DMSO-treated Rho-P23H (red lines) and NSC668394-treated Rho-P23H (green lines) mice, at two months of age.
Figure 16 (j) shows representative ERG (a- and b-wave) at two months of age show the rescue of ERG responses of NSC668394-treated Rho-P23H mice (green lines) compared to DMSO- treated Rho-P23H control (red lines) mice. WT mice were used as a control (black lines).
Thus, the present inventors unmasked a molecular network in daily autophagy induction in the RPE that requires the miR-211-mediated activation of MAGT1 through repression of Ezrin and identify a new and effective drug for the treatment of blinding disease. Figure 17 shows a Model of Ezrin mediated regulation of autophagy: under light phase conditions Ezrin is repressed by miR-211. The inhibition of Ezrin releases the MAGT1 transporter from its repression, thus increasing a Mg2+ microdomain influx .and the corresponding PLCyl- mediated induction of Ca2+ flux into cells. This leads to calcineurin activation and autophagy induction via TFEB nuclear translocation. Under night phase conditions Ezrin is upregulated and represses MAGTl-mediated autophagy process.
The present findings further support an Ezrin-exerted inhibition of lysosomal pathway as very likely to be Ca2+-dependent and mediated by regulation of Calcineurin and its target TFEB gene. Importantly, Ezrin has been reported to participate in retaining Ca2+-ion channels within multiprotein complex at cytoplasmic membrane and regulate Ca2+ homeostasis in different cell types [33-35]. Here, the inventors found a yet unreported function of Ezrin inhibition in inducing an increased rate of Ca2+-mediated activation of Calcineurin through Mucolipin 1 channel and the corresponding activation of lysosomal biogenesis and autophagy via TFEB nuclear translocation. More importantly, these molecular events converge and integrate to mTOR pathway due the fact that Ezrin participates to TSC lysosomal translocation and mTOR pathway.
Example 5
Pharmacological modulation of Ezrin for therapy of Leber Congenital amaurosis
The present inventors tested pharmacological Ezrin-inhibitor-based therapy on a model for an autosomal recessive form of IRD caused by a homozygous null mutation in the Aryl hydrocarbon interacting protein like 1 (Aipll) gene (Aipll knockout mice). In humans, mutations in the AIPL1 gene are associated with an early childhood blinding disease called Leber congenital amaurosis (LCA), RP, and cone-rod dystrophy. Aipll-/- animals exhibited rapid degeneration of both rods and cones and did not produce any light-dependent electrical response at any age tested. Biochemical studies show that Aipll plays a crucial role in the stability and folding of phosphodiesterase 6 (PDE6) in rods and cones.
Aipll-/ mice were injected daily intraperitoneally starting at postnatal day (P) 6, 5 times a week over two consecutive weeks, with NSC668394, at a dose of 0.26 mg/Kg; mice were sacrificed at P21. At this stage, in the eyes of Aipll-/- untreated mice only a single row of photoreceptor nuclei is present (Figure 18). In contrast, a significant increase in the number of preserved rows as well as an increase in density of photoreceptor nuclei were observed in the eyes of the NSC668394-treated Aipll-/- animals, (Figure 18). These results clearly demonstrate a slower progression of retinal degeneration in NSC668394-based therapy. Moreover, an increased staining for both rod (rhodopsin) and cone photoreceptors (cone arrestin and M-opsin) markers in the ONL of eyes of the NSC668394-treated Aipll_/ animals compared to the control animals were observed, as assessed by immunofluorescence analysis as shown in Figure 18). Finally, the cone structure and outer segments were better preserved in the eyes of the NSC668394-treated Aipll_/ animals, compared to the eyes of the control animals as shown by immunolabelling with cone arrestin (Figure 18).
Example 6
Pharmacological modulation of Ezrin for Lipofuscin clearance in Stargardt disease
Stargardt's Disease (STGD) is an autosomal recessive hereditary disease included in the group of degenerative macular diseases, which consists in progressive loss of cones in the fovea of both eyes, leading to variable levels of central vision loss. At fundoscopy, the presence of yellowish flecks around the macula is often observed, a condition called fundus flavimaculatus. It usually develops between 7 and 12 years of age, with an estimated prevalence of 1/10,000 individuals, which makes this disease the largest cause of inherited macular degeneration affecting the photoreceptor cells in the first and second decades of life, and correspond to 7% of all retinal dystrophies. This disease was first described as an autosomal recessive inherited disease, but there are some described cases of dominant pattern. The recessive pattern, which includes more than 90% of cases, is due to a defect at chromosome Iq21-pl3. The dominant pattern seems to be related to a change at chromosome 6, but some studies also reported the location on chromosome 12. The gene responsible for recessive Stargardt's disease has been identified as the ABCA4 gene. A photoreceptor cell-specific ATP-binding transporter gene (ABCR) is mutated in recessive Stargardt macular dystrophy. Other diseases associated with mutations in ABCA4 include cone-rod dystrophy. The impact of pharmacological inhibition of Ezrin based on NSC668394 treatment of a model of Stargardt's disease was evaluated base on treatment of Abca4_/ mice that accumulate lipofuscin granules in a thicker RPE.
In an in vitro model of lipofuscin accumulation, loading and accumulation of synthetic A2E, a component of lipofuscin, in ARPE-19 cells was fully cleared following 6h of NSC668394 administration in vitro as shown in figure (Figure 19 a-e): a reduction of autofluorescent A2E spots was observed in NSC668394-treated cells compared to control. Reduction of spots was quantified as shown in the graph of figure 19e. Upon 2 months of pharmacological treatment with NSC668394, a significant impact on the clearance of pathological A2E accumulation was observed, with a beneficial effect in the Abca4 / mice as model for autosomal recessive Stargardt disease, whose hallmark is an accumulation of A2E-lipofuscin granules in the RPE exhibiting increased fundus autofluorescence and thickness of RPE cells [71]. As shown in figure 19 f-j, Abca4 / mice were injected intraperitoneally daily starting at postnatal day P30 using the previous described procedure and dose; mice were sacrificed at P90. At this stage, the Abca4 / untreated mice show an onset of accumulation of Lipofuscin in the RPE as shown in Figure 19 g In contrast, a significant decrease of abnormal content of autofluorescent lipofuscin material in the RPE of the NSC668394-treated Abca4 / animals was observed as shown in Figure 9i compared to Abca4 / untreated mice (Figure 19 f, h). These results clearly demonstrate a clearance of lipofuscin granules upon inhibition of Ezrin, as evidenced in Figure 19 j.
Example 7
Ezrin inhibitors for therapy of MPS VII
Ezrin inhibition was further tested in a model of Mucopolysaccharidosis type 7 (MPS VII or Sly syndrome) that is a rare lysosomal storage disease belonging to the group of mucopolysaccharidoses, resulting from a deficiency of b- glucuronidase (GUSB). Less than 40 patients with neonatal to moderate presentation have been reported since the initial description of the disease by Sly in 1973. However, the frequency of the disease may be underestimated as the most frequent presentation is the antenatal form, which remains underdiagnosed. Prevalence is lower than 1:1,000,000. MPS VII is characterized by the inability to degrade glucuronic acid-containing glycosaminoglycans. The phenotype ranges from severe lethal hydrops fetalis to mild forms with survival into adulthood. Most patients with the intermediate phenotype show hepatomegaly, skeletal anomalies, coarse facies, and variable degrees of mental impairment. Currently, MPS VII lacks an efficient treatment. Newborn MPS VII mice were injected daily intraperitoneally with NSC668394 at a dose of 0.26 mg/Kg, 5 times a week over two consecutive weeks. Control mice were injected with vehicle only. Mice were sacrificed after 15 days (P 19). At postnatal day 19 (P19) untreated MPSVII mice show significant reduced femur and tibia lengths compared to wild type mice as shown in Figure 20 a,b. Histological analysis of femoral and tibial growth plates from P15 MPSVII mice showed altered architecture and shorter length of pre -hypertrophic and hypertrophic zones compared to wild type mice (Figure 20). In vivo, intraperitoneal injection of the NSC668394, rescues femoral and tibial growth retardation in MPSVII as measured and graphed in Figure 20 c.
MATERIAL AND METHODS
Animals
The miR-211 knockout mouse line (mmu-mir-211-/-) employed in this study was generated by the Wellcome Trust Sanger Institute [72] as previously described [66]. The Rho-P23 transgenic mice (/?ho-P23H) is the most used animal model for the autosomal dominant Retinitis Pigmentosa as previously described [73]. The Aipll / mice, a model for a Leber congenital amaurosis (LCA) that accounts for at least 5% of all inherited retinal disease and is the most severe inherited retinopathy as previously described [74]. The Abca4 / mice, a model for the Stargardt disease as previously described [75]. The GusB / mice, a model for MPSVII were previously described [76]. All studies on animals were conducted in strict accordance with the institutional guidelines for animal research and approved by the Italian Ministry of Health; Department of Public Health, Animal Health, Nutrition and Food Safety in accordance with the law on animal experimentation (article 7; D.L. 116/92; protocol number: 00001/11/IGB; approval date June 6, 2011). Furthermore, all animal treatments were reviewed and approved in advance by the Ethics Committee of Ospedale Cardarelli (Naples, Italy). MiR-211 / mice were maintained on the C57BI/6J background. In all experiments, the inventors used as controls aged- matched littermates of miR-211 / mice.
AAV vector production and characterization
Recombinant AAV vectors containing the murine precursor sequence of mmu-miR-211 under the cytomegalovirus (CMV) promoter were constructed by using the following oligonucleotides: 5' -AT AAG AAT G CGG CCG CT CT G ACCAT GCAAT CACAG -3' and 5'-
CGCGGATCCAATGGATCAGGGTGGCATC-3' for miR-211. The fragment was then cloned into the Notl-BamHI sites of the pAAV2.1-CMV-EGFP plasmid and used for the production of AAV2/8 vectors. AAV vectors were produced by the TIG EM AAV Vector Core by triple transfection of HEK293 cells followed by two rounds of CsCh purification, as previously described [77].
Subretinal injection of AAV vectors in mice GFP-LC3 mice were housed at the Institute of Genetics and Biophysics animal house (Naples, Italy) and maintained under a 12-h light/dark cycle (10-50 lux exposure during the light phase). Mice were anesthetized as previously described [78], then AAV2/8 vectors were delivered subretinally via a trans-scleral trans-choroidal approach as described by Liang et al. [79]. All eyes were treated with 1 mI of AAV2/8 vector solution, at a dose of lxlO9 genome copies/eye. Mice were sacrificed 1 month post-injection as previously described [80]. Overnight dark-adaptation of mice was performed before sacrifice. This study was carried out in accordance with the Association for Research in Vision and Ophthalmology Statement for the Use of Animals in Ophthalmic and Vision Research and with the Italian Ministry of Health regulation for animal procedures. All procedures were submitted to the Italian Ministry of Health; Department of Public Health, Animal Health, Nutrition and Food Safety. Surgery was performed under anesthesia and all efforts were made to minimize suffering.
Drug treatments and Light/Dark Adaptation of Mice for Tissue Isolation
Drug treatments were performed by once daily intraperitoneal injection of NSC668394, at a dose of 0.26 mg/Kg, and of NSC305787 at a dose of 0.24 mg/kg, as previously described [29]. Light/Dark adaptation of treated mice was performed following standard procedures [40]. Light adapted animals were kept in a room at 450 lux. For dark adaptation, animals were kept in a dark chamber with a maximum of 0.4 lux. Tissues from DA mice were isolated under dim red light.
Electrophysiological Recordings
Scotopic and photopic electrophysiological recordings were performed as described [81]. A CSO RETIMAX with a LED Ganzfeld stimulator (Costruzione Strumenti Oftalmici, Florence, Italy) was used for Rho-P23H. Briefly, mice were dark-adapted for 3 hours. Animals were anesthetized and positioned in a stereotaxic apparatus under dim red light. Their pupils were dilated with a drop of 0.5% tropicamide (Visufarma, Rome, Italy) and body temperature was maintained at 37.5°C. The electrophysiological signals were recorded through gold-plate electrodes inserted under the lower eyelids in contact with the cornea. The electrodes in each eye were referred to a needle electrode inserted subcutaneously at the level of the corresponding frontal region. The different electrodes were connected to a two-channel amplifier. For ERG analysis in dark- adapted conditions (scotopic), eyes were stimulated with light flashes. 11 different light intensity stimuli were used ranging from 1 x 10-4 to 20 cd*s/m2. Amplitudes of a- and b-waves were plotted as a function of increasing light intensity. After completion of responses obtained in scotopic conditions, the recording session continued with the purpose of dissecting the cone pathway through the photopic ERG. Photopic cone responses were isolated in light conditions with a constant background illumination of 50 cd/m2, with 10 flashes and a light intensity of 20 cd*s/m2. Cone response was then better isolated using Flicker analysis [82]. Mice were stimulated with a fixed frequency of 6 Hz and flashes of 13 different light intensities, ranging from 10-4 to 15 cd*s/m 2 generated by the Ganzfeld stimulator. To minimize the noise, different responses evoked by light were averaged for each luminance step.
Cell culture and Treatments
Human retinal pigment epithelial cells (ARPE-19) and HeLa were obtained from American Type Culture Collection (ATCC) and were cultured respectively in Dulbecco's Modified Eagle Medium (DMEM)/F-12 and Dulbecco's Modified Eagle Medium (DMEM) (Gibco) supplemented with 10% (v/v) FBS and 5% penicillin-streptomycin, respectively. All cell lines were maintained at 37°C, 5% C02 in a humidified incubator according to the guidelines provided by the vendors. Stably HeLaTFEB-GFP and HeLaTFEB-KO cell lines were described in [69, 83]. To analyse the autophagic flux, cells were treated with 200 nM Bafilomycin A1 (Sigma-Aldrich, B1793) for 3h in an incubator and maintained in starvation for 30 min in HBSS medium (Thermo Fischer Scientific, 14025092) supplemented with 10 mM HEPES (Thermo Fischer Scientific, 15630080) [84].
Drug treatment
Cells were plated for 24 hours and then treated for 6 hours with 10mM of NSC668394 (Ezrin Inhibitor) ([27, 35]) or DMSO. For dose-response assays, serial dilutions of NSC668394 were obtained from the dilution of 10-mM stock into complete medium and added to plates starting at 30 mM to 0,1 mM. Final concentration of DMSO did not exceed 0.25% in the dose-response assays. Cells were incubated toghether with drugs from 6 to 48 h at 37 °C and 5% C02. For cell clearance assay, ARPE19 cells loaded with 100mM A2E (ACME BIOSCIENCE INC, AB4344 (MLL)) for 5 hours.
Plasmids
The plasmids used were: Ezrin-GFP, Ezrin T567D, Ezrin T567A, have been already described by Coscoy et al and were a gift from S. Coscoy lab (Institute Curie, Paris) ([50]).
RFP-GFP-Tandem tagged LC3 was provided by C.Settembre's lab (Tigem, Pozzuoli) [42, 49]. The MAGT1-GFP expressing vector has been described by Cherepanova et al and was
a gift from Gilmore's lab (University of Massachusetts Medical School) (Cherepanova et al., 2014).
Transfections
Cells were transfected at 70 to 80% confluence with 25 nM of Ezrin siRNA and non-targeting siRNA (Dharmacon) for 24 h using Interferin (Polyplus, 409-10). For plasmids transfections either Lipofectamine LTX (Invitrogene, 15338100) or Lipofectamine 2000 (Invitrogen, 12566014) were used, following manufacturer's protocol.
Western Blot Analysis
Mouse eyes were enucleated and the RPE was separated from the retina. Cells were collected after transfections or treatments to extract total protein. Both mice and cell samples were lysed by using RIPA buffer (150 mM sodium chloride, 1% Triton X-100, 0.5% sodium deoxycholate, 0.1% sodium dodecyl sulfate, 50 mM Tris, pH 8.0) with inhibitors cocktail (...). The concentration of total protein was determined by Bradford analysis and quantified by using NanoDrop ND- 8000 spectrophotometer (NanoDrop Technologies). Proteins were fractionated by sodium dodecyl sulfate polyacrilamide gel electrophoresis (SDS-PAGE) and transferred to PVDF membranes (EMD Millipore, IPVH00010), then blocked in Tris-buffered saline containing 5% nonfat milk or 1% Bovine Serum Albumine (Sigma- Aldrich, 9048-46-8) for lhr at RT and subsequently incubated overnight at 4°C with primary antibodies. For western blot analysis the following antibodies were used: mouse Anti-Lampl (1:500, Sigma-Aldrich, L1418), Anti-LC3 (1:1000, Novus LC3B/MAP1LC3B), mouse Amti-SQSTMl/p62(l:1000, Sigma-Aldrich, P0067), mouse Anti-Ezrin (1:1000, Novex, 357300), rabbit Anti-phosphoEzrin (Th567) (1:700 Sigma- Aldrich, PA5-37763 ), Anti-Beclin (1:1000, Cell Signaling ), Rabbit Anti-Cln5 (1:1000, Abeam AB126306), Rabbit Anti-Trpmll (1:1000, ALOMONE Lab ACC-081), Mouse Anti-CtsD (1:1000, Santa Cruz SC-377124), rabbit Anti-TSCl (1:1000, Cell signalling, #6935), rabbit Anti-TSC2 (1:1000, Cell signalling, #4308), mouse Anti- -Actin (1: 700, Sigma-Aldrich, A5441). After washing with 1% TBS, the membranes were incubated, for lhr at room temperature, with the following secondary anibodies: Goat Anti-Rabbit IgG Antibody, HPR conjugate and Goat Anti- Mouse IgG Antibody HPR conjugate (1:10000 EMD Millipore, 12-348; 12-349). Western blot detection was done with GE detector (GE Healthcare Life Sciences) and quantified using ImageJ software.
Immunoprecipitation Analyses
For immunoprecipitation, cells were transfected with GFP-tagged vectors. Then cells were solubilized in lysis buffer (TRIS-HCI 1,5M pH7.5, NaCI 150mM, 1% EDTA and 2% Tryton 100X) added with protease inhibitors and phosphatase inhibitors (Thermo Fischer Scientific, 78420). An equal amount of each protein lysate was incubated with Agarose Anti-Green Fluorescent Protein (Vector, MB0732) overnight at 4°C on a rotating wheel. The day after the immuno complex was washed 6 times with the following Buffer added with detergent (TRIS-HCI 1,5M pH7.5, NaCI 150mM, 1% EDTA and 2% Tryton 100X) and 2 times with buffer without detergent (TRIS-HCI 1,5M pH7.5, NaCI 150mM, 1% EDTA) by centrifugation for 3 min at 8000rpm. The immune complex was analysed by Western Blot analysis.
Bacterial strains and plasmids transformation
The Escherichia coli strains DH5a (Invitrogen, Carlsbad, CA, USA) were used for propagation and construction of all plasmid constructs. For each transformation, 10-50 ng of DNA was added to 100 mI of chemically competent cells and incubated on ice for 30 minutes, followed by heat shock at 42°C for 1 min and incubation on ice for 2 minutes. The cells were allowed to recover in 1 ml Luria-Bertani broth (LB broth: 1% Bacto-Tryptone, 1% NaCI and 0.5% Bacto-Yeast extract) broth and then incubated for lhr at 37°C with shaking (200-250 rpm). Cells were plated on LB- agar plate containing appropriate antibiotics and incubated at 37°C overnight to select the tranformants. The colonies obtained were inoculated overnight at 37°C with shaking (200-250 rpm). In the end large-scale plasmid DNA isolation were carried out using PureLink HiPure Plasmid Midiprep Kit (Thermo Fischer Scientific, K210004) as following the manufacturer's protocol.
Immunoflorescence
Immunostaining was performed on cryosections. Mouse eyes were fixed overnight in 4% paraformaldehyde in PBS at 4°C, then were cryopreserved by treatment first with 15% and then with 30% sucrose in phosphate-buffered saline and embedded in OCT. Twelve-micrometer cryosections were collected on slides (Superfrost Plus; Fisher Scientific, Pittsburgh, PA). Cells were fixed with 4% formaldehyde (Sigma-Aldrich) for 10 min at RT followed by washing with 1% PBS. After the fixation the cell were permeated with blocking buffer (0,5% BSA, 0,005% saponin, 0,02% N3Na, 50 mM) for 1 hr at RT. The following primary antibodies were used: mouse Anti- Lampl (Hybridoma Bank 1D4B), rat Anti-Lampl (Santa Cruz 1D4B: scl9992), rabbit Anti-LC3B (1:100, Novus bio NB100-2220), rabbit Anti-Cone-Arrestin) (1:1000, EMD Millipore, AB15282, mouse Anti-Ezrin (1:100, Novex, 357300), rabbit Anti-phosphoEzrin (Th567) (1:100, Sigma- Aldrich, PA5-37763 ) and mouse Anti-Rhodopsin ( 1:5000, Abeam, ab3267). All the incubations were performed overnight at 4°C. After washing with 1% PBS, slides were incubated with the following secondary antibodies: Alexa 594 goat anti rabbit/mouse (1:1000, Invitrogene A-11037 rabbit, A-11032 mouse) or Alexa 488 goat anti rabbit/mouse (1:1000, Invitrogene A-11008 rabbit, A-11001 mouse) and DAPI (1:500, Vector Laboratories H-1200) for 45 min at RT, then the slides were washed with 1% PBS and mounted with PBS/Glycerol and imaged with Zeiss
LSM700.
Dextran Assay
Cells were seeded at 50% of confluence in 96-well plates and allowed to attach overnight. The day after cells were loaded with 0,2 pg/mI of Dextran, Alexa Fluor 568 (Invitrogen) in complete medium for 6 hours then the Dextran was wash with PBS and cell were incubate for further 48h with different concentration of NSC668394. Cells were fixed with 4% paraformaldehyde and washed three times in PBS. Nuclei were counter-stained with Hoechst (Invitrogen) and cytoplasm were stained with cellMask deep red (Invitrogen). Images were acquired on random fields per well using Opera (PerkinElmer) with 40x objective; Image analysis were performed using "Columbus image data storage and analysis System".
High content LysoTracker ® Red (LTR)
ARPE-19 cells were seeded in 96-well or 6-well plates and allowed to attach overnight. The day after cells were transfected with either control siRNA or ezrin siRNA for 48 hours or treated with NSC668394 for 6 hours. After the treatment cells were incubated with 100 nM LysoTracker Red probes (Life Technologies) for 30 minutes in complete medium. For Opera analysis cells were fixed with 4% paraformaldehyde and washed three times in PBS. Nuclei were counter-stained with Hoechst (Invitrogen) and cytoplasm were stained with cellMask deep red (Invitrogen). Images were acquired on random fields per well using Opera (PerkinElmer) with 40x objective; Image analysis were performed using "Columbus image data storage and analysis System". For FACS analysis adherent cells are detached by trypsinization, followed by centrifugation and resuspension in PBS. LysoTracker intensity was detected by BD FACS Aria III.
Proximity Ligation Assay
ln-situ MAGT1-GFP and Ezrin interactions, revealed as red fluorescent dots, were detected using the Duolink II PLAkit (Olink Bioscience, Uppsala, Sweden), according to the manufacturer's instructions. GFP transfection was used as a negative control. Immunofluorescence was performed using an anti-GFP antibody in combination with an anti-Ezrin antibody. Nuclei were counterstained with DAPI.
TFEB nuclear translocation assay
TFEB nuclear translocation analysis was performed as previous described [54]. HeLaTFEB GFP cells were seeded in 96-well plates and allowed to attach overnight. The day after cells were pre incubated with 10 mM BAPTA-AM (Invitrogen) for 30 minutes and then were treated with starvation medium (HBSS, 10 mM HEPES) or with NSC668394 with or without 10 mM BAPTA-AM for 3 h. Cells were fixed with 4% paraformaldehyde and washed three times in PBS. Nuclei were counter-stained with Hoechst (Invitrogen) and the cytoplasm was stained with cellMask deep red (Invitrogen). Images were acquired on random fields per well using Opera (PerkinElmer) with a 20x objective, Image analysis was performed using "Columbus image data storage and analysis System". For the ARPE-19 cell line TFEB nuclear translocation analysis was analysed using immunofluorescence with anti-TFEB (1:100 Cell Signalling, 4240) as previously described [54],
Mg2+ influx experiments
Cells were seeded in 96-well microplates (25,000 cells/well) in 100 mI medium and transfected with si MAGT1 for 48 h. Cells were incubated for 18 h with a Mg2+-free solution (150 mM NaCI, 0.1 mM CaCI2, 10 mM HEPES, 10 mM mannitol, 10 mM glucose, MEM non-essential amino acids lx, MEM amino acids lx, pH 7.4), and then loaded with 1 mM MagFluo-4-AM (M14206, Invitrogen) for 1 h at 37 °C in the same solution. After washings, cells were incubated with 60 mI/well of the Mg2+-free solution and treated with NSC668394 and transferred to a microplate reader (FLUOstar Omega; BMG Labtech) equipped with appropriate excitation and emission filters (ex: 500 ± 10 nm; em: 535 ± 15 nm). For each well, cell fluorescence was measured for 5 seconds before and 4 min after the injection of 170 mI of a solution containing 75 mM MgCh, 10 mM HEPES, 10 mM glucose and 85 mM mannitol, pH 7.4. Where indicated this solution also contained EGF (10 ng/ml). After background subtraction, cell fluorescence recordings were normalized for the initial value, fitted with exponential function and differentiated to derive the initial slope of the fluorescence increase corresponding to the maximal influx of Mg2+ into the cells.
Electron microscopy analysis
Mice retina were fixed using the mixture of 2% paraformaldehyde and 1% glutaraldehyde prepared in 0.2 M HEPES buffer (pH 7.4) for 24 h at 4°C. ARPE19 cells were fixed with the mixture of 4% PFA and 0.05% GA for 10 min at RT, then washed with 4% PFA once to remove the residual GA and fixed again with 4% PFA for 30 min at RT. Next the cells were incubated with the blocking/permeabilizing mixture (0.5% BSA, 0.1% saponin, 50 mM NH4CI) for 30 min and subsequently with the primary monoclonal antibody against LAMP1, diluted 1:500 in blocking/ permeabilizing solution. The following day, the cells were washed and incubated with the secondary antibody, the anti-rabbit Fab fragment coupled to 1.4-nm gold particles (diluted 1:50 in blocking/ permeabilizing solution) for 2h at RT. All specimens (retina and cells) then were post-fixed as described in [85]. After dehydration the specimens were embedded in epoxy resin and polymerized at 60°C for 72 hr. Thin 60 nm sections were cut at the Leica EM UC7 microtome. EM images were acquired from thin sections using a FEI Tecnai-12 electron microscope equipped with a VELETTA CCD digital camera (FEI, Eindhoven, The Netherlands). Morphometric analysis on the size of lysosomes and the distribution of gold particles at the lysosomal structures was performed using iTEM software (Olympus SYS, Germany).
Cone and rod photoreceptor cell counts and ONL thickness measures
Cone cell counts
Two groups of six mice for both treated and untreated animals were analysed for each time point. The same number of retina sections from both genotypes was immunostained with the cone marker cone-Arrestin and counterstained with the Dapi nuclear acid stain. Evaluation of the number of cones was performed by counting the cells positive for cone-Arrestin staining in standard areas of comparable regions respect to the distance from the optic nerve. The number of cones /area was evaluated by manual counts with a Leica DM-6000 microscope, with the objective Leica °/0.17/D, HCX PL FLUOTAR, 40X/0.75 that has an area of 0.31 mm2.
Rod cell counts and ONL thickness measurement
The same retina sections on which cones were counted, were imaged by a Confocal microscopy Leica TCS SPE 40x, using Z-stacks in the wavelength of the Dapi. Then the images were used to calculate the number of the ONL nuclei (ONL cell density) and ONL thickness. The evaluation of the number of ONL nuclei was performed by counting the Dapi stained nuclei in areas of comparable regions respect to the distance from the optic nerve. The selection of each area and the nuclei counting were manually done, using the ITEM Analysis Image Processing program that stores and then processes the results. Finally, the ONL thickness was manually measured close the optic nerve head, in both superior and inferior retina using the ITEM Analysis Image Processing program.
RNA in Situ Hybridization
For miR-211 detection, the inventors used the miRCURYLNA detection miR-211 probe from Exiqon (double 5' -3' dig). In situ hybridization of 30 nM of probe was performed using the miRCURY LNA microRNA ISH Optimization kit according to the manufacturer's protocol (Exiqon), with minor modifications. As a negative control, a double-DIG-labeled LNA scrambled microRNA probe, included in the above kit, was hybridized in parallel at the same concentration and optimal hybridization temperature (50°C). Mouse cryosections were treated with 5 pg/mL proteinase K for 15 min. After washes with 2 mg/mL glycine and post-fixation with 4% PFA-0.2%, glutaraldehyde, sections were prehybridized with 50% formamide, 5X sodium saline citrate buffer (SSC) and citric acid pH 6, 1% sodium dodecyl sulfate (SDS), 500 pg/mL yeast tRNA, and 50 pg/mL heparin. Hybridization with the digoxigenin-labeled probes was performed overnight at a temperature of approximately 20-22°C below the DNA temperature of the probe (miR-211, 50°C). Hybridized sections were washed with 50% formamide, 2X SSC at the hybridization temperature. Sections were blocked for 1 h with 1% blocking reagent (Roche) in 100 mM maleic acid, 150 mM NaCI, and 0.1% Tween 20 (pH 7.5; MABT) containing 10% sheep serum and incubated with alkaline phosphatase (AP)-labeled anti-digoxigenin antibody (1:2000; Roche) in 1% blocking reagent in MABT overnight at 4°C. After extensive washes with PBS containing 0.1% Tween 20 (PBT), sections were exposed to the alkaline phosphatase substrate nitroblue tetrazolium and 5-bromo-4-chloro-3-indoyl phosphate (NBT-BCIP; Sigma-Aldrich, St. Louis, MO). The reaction was stopped by washing with PBS (pH 5.5) followed by post-fixation in 4% PFA for 20 min. Slides were covered with a coverslip with 70% glycerol in PBS or dehydrated and mounted (Eukitt Mounting Medium; EMS, Fort Washington, PA).
RNA extraction, retrotrascription and quantitative Real Time PCR
Total RNA was extracted from the mouse eyes and from ARPE-19 cells, using the miRNeasy Kit (QIAGEN 217004) according to the manufacturer's instructions. RNA was quantified using a NanoDrop ND-8000 spectrophotometer (NanoDrop Technologies). The cDNAs were generated using the QuantiTect Reverse Transcription Kit (Qiagen) for the qRT-PCR analysis. The qRT-PCR reactions were performed with nested primers and carried out with the Roche Light Cycler 480 system. The PCR reaction was performed using cDNA (200-500 ng), 10 mI of the SYBR Green Master Mix (ROCHE) and 400 nM primers, in a total volume of 20 mI. The PCR conditions for all the genes were as follows: preheating, 95°C for 60 s; cycling, 45 cycles of 95°C for 10 s, 60°C for 10 s and 72°C for 15 s. Quantified results were expressed in terms of cycle threshold (Ct). The
Ct values were averaged for each triplicate. The HPRT gene was used as the endogenous control for the experiments. Differences between the mean Ct values of the tested genes and those of the reference gene were calculated as DCtgene = Ctgene - Ctreference. Relative expression was analysed as 2 DCt. Relative fold changes in expression levels were determined as 2 DDCt.
Figure imgf000083_0001
Figure imgf000084_0001
Luciferase reporter assay
Plasmids containing either the WT 3'UTR sequence or its mutated version containing three point mutations in the seed of the predicted miR-211 target site of the human EZRIN gene, and psiUx plasmid constructs containing the hsa-pre-miR-211 sequence were used in Luciferase assays, as previously described [86]. Each assay was performed in triplicate, and all results are shown as means ± SD of at least three independent assays. The primer sequences used to amplify each transcript, both WT and with mutagenized miR-211 target site were 3'UTR-EZR Forward 5'- CAGTTCT AG AAT ACATT GTAC-3' (SEQ ID No. 102) and 3'UTR-EZR Reverse 5'- TCAAGTGCCATGGTCTAGAGG-3' (SEQ ID No. 103). The mutant 3'UTR region of human Ezrin gene was generated using mutagenic primers 3'UTR-EZR-MUT Forward 5'- CATTAGTTTTAAGCTAGCAGTTTTGTTC-3' (SEQ ID No. 104) and 3'UTR-EZR-MUT Reverse 5'- G A ACA A A ACT G CT AG CTT AAA ACT AAT G -3' (SEQ ID No. 105). AP-MS
GFP beads were washed three times with 50 mM Tris, pH 7.5. Then, purified proteins were digested and eluted by adding 2 M urea in 50 mM Tris, pH 7.5, 1 mM DTT, and 150 ng EndoLysC (Wako Chemicals USA, Inc.) and 150 ng trypsin (Promega). The digestion was stopped by adding 1 mI trifluoroacetic acid, and peptides of each experiment were purified on C18 Stage Tips.
LC-MS/MS analysis
Peptides were loaded on a 50 cm reversed phase column (75 pm inner diameter, packed in- house with ReproSil-Pur C18-AQ 1.9 pm resin [Dr. Maisch GmbH]). Column temperature was maintained at 50°C using a homemade column oven. An EASY-nLC 1000 system (Thermo Fisher Scientific) was directly coupled online with a mass spectrometer (Q Exactive, Thermo Fisher Scientific) via a nano-electrospray source, and peptides were separated with a binary buffer system of buffer A (0.1% formic acid [FA]) and buffer B (80% acetonitrile plus 0.1% FA), at a flow rate of 250nl/min. Peptides were eluted with a gradient of 5-30% buffer B over 60 min followed by 30-95% buffer B over 10 min. The mass spectrometer was programmed to acquire in a data- dependent mode (Topl5) using a fixed ion injection time strategy. Full scans were acquired in the Orbitrap mass analyzer with resolution 60,000 at 200 m/z (3E6 ions were accumulated with a maximum injection time of 25 ms). The top intense ions (N for TopN) with charge states >2 were sequentially isolated to a target value of 1E5 (maximum injection time of 120 ms, 20% underfill), fragmented by HCD (NCE 25%, Q Exactive) and detected in the Orbitrap (Q Exactive, R= 15,000 at m/z 200).
Data processing and analysis
Raw MS data were processed using MaxQuant version 1.5.3.15 (Cox and Mann, 2008; Cox et al., 2011) with an FDR < 0.01 at the level of proteins, peptides and modifications. Searches were performed against the Human UniProt FASTA database (September 2014). Enzyme specificity was set to trypsin, and the search included cysteine carbamidomethylation as a fixed modification and N-acetylation of protein, oxidation of methionine, and/or phosphorylation of Ser, Thr, Tyr residue (PhosphoSTY) as variable modifications. Up to three missed cleavages were allowed for protease digestion, and peptides had to be fully tryptic. Quantification was performed by MaxQuant, 'match between runs' was enabled, with a matching time window of 0.5-0.7 min. Bioinformatic analyses were performed with Perseus (doi:10.1038/nmeth.3901). Significance was assessed using two-sample student's t-test, for which replicates were grouped, and statistical tests performed with permutation-based FDR correction for multiple hypothesis testing. Missing data points were replaced by data imputation after filtering for valid values (all valid values in at least one experimental group).
Functional annotation of the EZR putative protein partners
The Functional Annotation analysis [63, 87] was performed to understand the distinctive biological nature of the EZR putative protein partners. The significantly modulated proteins (Student T Test, FDR O.l) obtained by MS experiment were characterized for the Biological Processes (BPs) in which they are mainly involved. The DAVID online tool (DAVID Bioinformatics Resources 6.7) was used restricting the output to all Biological Process terms (BP_ALL). The study gave Functional Annotation (FA) results for 28 EZR putative protein partners genes. The inventors summarized all this information for each gene the inventors have a subset of Biological Processes GO terms based on the AmiGO and the GO Consortium's annotation toolkit [64, 65]. All BP terms found at least in one putative EZRIN protein partners are listed and for each BP term the frequency into the gene list was calculated.
Specific annotation of the putative EZRIN protein partners into the Metabolic Process
The inventors focused their attention on the Metabolic Process (G0:0008152) term. The list of 418 BP terms was mapped on the GO hierarchy [88] rooted in the Metabolic Process (G0:0008152) term: the inventors found that in the list of all Biological Processes found at least in one putative EZRIN protein partners, 105 terms were "children" of the Metabolic Process. Finally, the inventors calculated the percent of these "children" terms for each gene, MAGT1 was the gene with the highest percent: 96% (24 "children" of the Metabolic Process out of 25 BPs terms).
Magic Red and Cathepsin B activity assays
The Magic Red™ Cathepsin B kit (ICT938 Biorad) uses a quick and easy method to analyse intracellular Cathepsin B protease activity in whole living cells. Cells were seeded at 50% confluence. The day After were incubated with Ezrin Inhibitor lOuM for 3h. After treatment cells were washed with medium and loaded with Magic Red™ Cathepsin B in plain medium for 20 minutes and counter-stained with hoechst 3325, finally cells were washed and quickly analysed with Opera (Perkin Elmer). Single cell quantitative high content imaging was utilized for automated fluorescence imaging to determine the average spot area stained by Cathepsin B. Cathepsin B activity was measured by a fluorometric assay kit (AB65300; Abeam, Cambridge, MA, USA) following manufacturer's instructions.
Calcium imaging
ARPE-19 cells were seeded in m-slide 8 well (IBIDI) and transfected with a plasmid encoding the perilysosomal-localized MLl-GCaMP3 calcium probe (Medina et al 2015). After 24 hours, cells were washed with PBS and incubated with 150 mI of PBS for 5 minutes at room temperature. Then, the slide was moved on the stage of an inverted microscope equipped with GFP filter, 40X oil immersion objective (Olympus), LAMBDA DG4 (Sutter Instrument), Prime emos camera (Photometries) and MetaMorph Imaging Acquisition Software (Molecular Devices). Time-lapse experiments were carried-out with 200 ms exposure time, 500 ms interval and 5-6 minutes total duration. Analysis was performed with MetaMorph Software in single cell ROI. After background subtraction, fluorescence recordings were normalized for the initial value. Data are presented as representative fluorescence recording traces and as bar graph showing the mean values ± s.e.m. of the time required by fluorescence to decay to half of the peak elicited by ML-
SA1.
Example 8
Inhibition of Ezrin induces lysosomal Ca2+ release through mucolipin 1 (TRPML1) channel and activates lysosomal function.
Ezrin, is a widely expressed protein that links the actin cytoskeleton to various proteins and has been shown to be involved in a large spectra of cellular functions (i.e. cell motility, cell-cell and cell-matrix recognition, etc.) directly depending on its conformational states and its interactors [89]. Ezrin has been also reported to regulate Ca2+ homeostasis in different cell types through its essential role in retaining ion-channels within multiprotein complex at plasma membrane [61, 90, 91]. Release of lysosomal Ca2+ mediated by mucolipin 1 (TRPML1) channel modulates the protein phosphatase Calcineurin (PPP3CB) [54], which in turn dephosphorylates and activates TFEB [54], a master regulator of CLEAR (Coordinated Lysosomal Expression and Regulation) network, lysosomal biogenesis and autophagy pathway [42, 92]. The inventors hypothesized that the link between Ezrin and lysosomal biogenesis might involve TRPML1- dependent Ca2+ release. To test this hypothesis, calcium dynamics in the close proximity of lysosomal membrane were monitored using tihe fluorescent calcium-sensitive GCaMP3 probe fused to TRPML1 [54]. TRPML1 activity was triggered with the selective activator ML-SA1. Addition of this compound resulted in a rapid localized calcium increase that showed a fast decline to near resting levels in approximately 100 s (Fig. 21). Notably, cells receiving NSC668394, or genetically silenced for Ezrin, showed a much more sustained response to ML- SA1 (Fig. 21). Furthermore, this sustained phase was highly sensitive to ML-SI3, a specific inhibitor of TRPML1 (Fig. 21), strongly supporting that Ezrin inhibition results in a potentiation of TRPML1 sensitivity to activating stimuli. Next the inventors reasoned that if inhibition of Ezrin directly controls expression of lysosomal biogenesis and function, the levels of the enzymatic activity of lysosomal Cathepsin B should be increased in vitro and in vivo. Consistent with this hypothesis, an increase of intensity of the Cathepsin B activity was observed in NSC668394- treated compared with control ARPE-19 cells (Fig. 21). Moreover, NSC668394 daily injections to 1-month-old miR-211-/- mice for 1 week, but not vehicle, restored the Cathepsin B activity (Fig. 21). Example 9
Inhibition of Ezrin induces TSC lysosomal translocation and mTOR pathway decrease
Ezrin coordinates and integrates important membrane-tyrosine-kinase-mediated signaling events and through the regulation of its tyrosine and threonine phosphorylation, mediates the signal transduction pathways orchestrated by MAPK, AKT/PKB, Rho GTPase and has been showed to be involved in the mTOR pathway [89]. mTORCl is a major regulator of the autophagy and is regulated by starvation, growth factors and cellular stressors [93]. The activation state of mTORCl on lysosomal surface is directly controlled by TSC complex playing a critical role in turning off the activity of Rheb, an essential activator of mTORCl [93]. However, how the TSC complex traffic to the lysosome, where the TSC complex resides when dissociated from the lysosomes and which proteins control TSC complex localization is not yet completely understood [93]. The inventors found that pharmacological inhibition of Ezrin by NSC668394 results in lack of the previously described Ezrin/TSC interaction [94] followed by translocation of TSC complex on the lysosomes and inhibition of mTORCl, as monitored by phosphorylation of its classic substrates S6K1 and 4E-BP1 phosphorylation levels (Fig. 22). On the contrary, Ezrin overexpression results in an unsensitive cells to nutrient-sensing and insulin-sensing pathways, which were demonstrated to be necessary for the lysosomal TSC-complex dissociation and mTOR activation. Thus, overexpression of Ezrin induced mTOR pathway and reduced autophagy (Fig. 10). These findings provide the key role of Ezrin in daily controlling the lysosomal biogenesis and function.
Example 10
Inhibition of Ezrin induces lysosomial biogenesis
T567-Ezrin phosphorylation has been reported to be also specifically inhibited by the small molecule NSC305787 through its direct binding to Ezrin [27]. ARPE-19 cells were cultured in the presence of NSC305787 for 6h and autophagy was assessed. Immunostaining showed an increase of both LC3 and Lampl staining and of their co-localization, strongly supporting enhancement of autophagosome-lysosome fusion (Figure 23 (a-b")). Moreover, a TSC lysosomal translocation was also noticed (Fig. 23 c-f"), along with activation of lysosomal biogenesis and function (Fig. 23 g).. NSC305787 administration led to an induction of both lipidated Lampl, CLN5, TRPML1, CTSD and LC3II, and a decrease of SQSTMl/p62 autophagy substrate (Fig. 23 g). These results were similar to what observed with NSC668394 administration (Fig 23 h).
Consistent with this observation, treatment under starvation and with baf showed a further increase of LC3II in NSC305787-treated ARPE-19 cells, confirming the presence of increased autophagic flux, and excluding that lipidated LC3II accumulation was due to a block along the autophagy pathway (Fig. 23 i).
Notably, daily injections of NSC305787 at 8:00 AM, 5 times a week, over two consecutive weeks was efficient in inducing autophagy in the RPE/retina of 3-month-old GFP-LC3 transgenic mice. Both retina and RPE specimens from injected animals showed a significant increase in the number of GFP-LC3-positive vesicles when compared with vehicle-injected control animals (Figure 24 a-b').
As depicted in Fig. 25, under light phase conditions Ezrin is repressed by miR-211. The inhibition of Ezrin releases the MAGT1 transporter from its repression, thus increasing a Mg2+ microdomain influx and the corresponding PLCyl-mediated induction of Ca2+ flux into cells. Ca2+ flux depending on the lysosomal Mucolipin 1 activity. This leads to calcineurin (Cn) activation and autophagy induction via TFEB nuclear translocation. At the same time, inhibition of Ezrin induces TSC lysosomal translocation and inhibition of mTOR pathway supporting both lysosomal biogenesis and function. Under night phase conditions Ezrin is upregulated and induces TSC cytoplasmic translocation, represses MAGT1 and consequently reduces autophagy process.
References
1. Settembre, C., et al., Nat Rev Mol Cell Biol, 2013. 14(5): p. 283-96.
2. Strauss, O., H. Kolb, E. Fernandez, and R. Nelson, Editors. 1995: Salt Lake City (UT).
3. Rizzolo, L.J., Exp Eye Res, 2014. 126: p. 16-26.
4. Strauss, O., Physiol Rev, 2005. 85(3): p. 845-81.
5. Gal, A., et al., Nat Genet, 2000. 26(3): p. 270-1.
6. Nandrot, E.F., Y. Chang, and S.C. Finnemann, Adv Exp Med Biol, 2008. 613: p. 369-75.
7. Davidson, A.E., et al., Invest Ophthalmol Vis Sci, 2011. 52(6): p. 3730-6.
8. Kim, J.Y., et al., Cell, 2013. 154(2): p. 365-76.
9. Yao, J., et al., Autophagy, 2016. 12(12): p. 2439-2450.
10. Yao, J., et al., Invest Ophthalmol Vis Sci, 2014. 55(5): p. 3237-46.
11. Miao, G., et al., Autophagy, 2016. 12(12): p. 2263-2270.
12. Sinha, D., et al., Exp Eye Res, 2016. 144: p. 46-53.
13. Frost, L.S., C.H. Mitchell, and K. Boesze-Battaglia, Exp Eye Res, 2014. 124: p. 56-66.
14. Sethna, S., et al., J Biol Chem, 2016. 291(12): p. 6494-506.
15. Bhattacharya, S., et al., Invest Ophthalmol Vis Sci, 2017. 58(4): p. 2366-2387.
16. Boya, P., et al., Prog Retin Eye Res, 2016. 55: p. 206-245.
17. Griciuc, A., L. Aron, and M. Ueffing, Trends Mol Med, 2011. 17(8): p. 442-51. 18. Tam, L.C., et al., Hum Mol Genet, 2010. 19(22): p. 4421-36.
19. Fievet, B., D. Louvard, and M. Arpin, Biochim Biophys Acta, 2007. 1773(5): p. 653-60.
20. Bretscher, A., K. Edwards, and R.G. Fehon, Nat Rev Mol Cell Biol, 2002. 3(8): p. 586-99.
21. Gary, R. and A. Bretscher, Mol Biol Cell, 1995. 6(8): p. 1061-75.
22. Xie, J.J., et al., J Histochem Cytochem, 2011. 59(11): p. 1001-8.
23. Berryman, M., Z. Franck, and A. Bretscher, J Cell Sci, 1993. 105 ( Pt 4): p. 1025-43.
24. Shaffer, M.H., et al., PLoS One, 2010. 5(8): p. el2404.
25. Bonilha, V.L., et al., Exp Eye Res, 2006. 82(4): p. 720-9.
26. Zhang, Y.Q., et al., Int J Ophthalmol, 2017. 10(7): p. 1040-1045.
27. Bulut, G., et al., Oncogene, 2012. 31(3): p. 269-81.
28. Celik, H., et al., Mol Cancer Ther, 2015. 14(11): p. 2497-507.
29. Celik, H., et al., J Biol Chem, 2016. 291(25): p. 13257-70.
30. Zhan, C, et al., Oncol Lett, 2016. 12(5): p. 3457-3462.
31. Wang, G., W. Mao, and S. Zheng, FEBS Lett, 2008. 582(25-26): p. 3663-8.
32. Zhou, L, J. He, and Y. Zhang, J Int Med Res, 2013. 41(4): p. 1009-16.
33. Mao, J., et al., Mol Cell Biochem, 2014. 396(1-2): p. 117-28.
34. Yu, N., et al., J Exp Clin Cancer Res, 2015. 34: p. 107.
35. Murad, N., et al., FEBS J, 2014. 281(23): p. 5251-64.
36. Berson, E.L., Invest Ophthalmol Vis Sci, 1993. 34(5): p. 1659-76.
37. Cremers, F.P., et al., Hum Mol Genet, 2002. 11(10): p. 1169-76.
38. Hamel, C.P., Orphanet J Rare Dis, 2007. 2: p. 7.
39. Michaelides, M., et al., Surv Ophthalmol, 2006. 51(3): p. 232-58.
40. Krol, J., et al., Cell, 2010. 141(4): p. 618-31.
41. Mizushima, N., et al., Mol Biol Cell, 2004. 15(3): p. 1101-11.
42. Settembre, C., et al., Science, 2011. 332(6036): p. 1429-33.
43. Reme, C. and A. Wirz-Justice, Klin Monbl Augenheilkd, 1985. 186(3): p. 175-9.
44. Iwasaki, M. and H. Inomata, Invest Ophthalmol Vis Sci, 1988. 29(5): p. 671-9.
45. Barret, C., et al., J Cell Biol, 2000. 151(5): p. 1067-80.
46. Matsui, T., et al., J Cell Biol, 1998. 140(3): p. 647-57.
47. Matsui, T., et al., Curr Biol, 1999. 9(21): p. 1259-62.
48. Turunen, O., T. Wahlstrom, and A. Vaheri, J Cell Biol, 1994. 126(6): p. 1445-53.
49. Kimura, S., T. Noda, and T. Yoshimori, Autophagy, 2007. 3(5): p. 452-60.
50. Coscoy, S., et al., Proc Natl Acad Sci U S A, 2002. 99(20): p. 12813-8.
51. Zhu, L, et al., Am J Physiol Cell Physiol, 2007. 293(3): p. C874-84.
52. Kimura, S., et al., Methods Enzymol, 2009. 452: p. 1-12.
53. Tanida, L, et al., Autophagy, 2005. 1(2): p. 84-91.
54. Medina, D.L., et al., Nat Cell Biol, 2015. 17(3): p. 288-99.
55. Polito, V.A., et al., EMBO Mol Med, 2014. 6(9): p. 1142-60.
56. Medina, D.L., et al., Dev Cell, 2011. 21(3): p. 421-30.
57. Decressac, M., et al., Proc Natl Acad Sci U S A, 2013. 110(19): p. E1817-26.
58. La Spada, A.R., Autophagy, 2012. 8(12): p. 1845-7.
59. Klee, C.B., T.H. Crouch, and M.H. Krinks, Proc Natl Acad Sci U S A, 1979. 76(12): p. 6270-3.
60. Wiesenberger, G., et al., Eukaryot Cell, 2007. 6(4): p. 592-9.
61. Hatano, R., et al., Kidney Int, 2013. 83(1): p. 41-9.
62. Hein, M.Y., et al., Cell, 2015. 163(3): p. 712-23.
63. Dennis, G., Jr., et al., Genome Biol, 2003. 4(5): p. P3.
64. Carbon, S., et al., Bioinformatics, 2009. 25(2): p. 288-9.
65. Gene Ontology, C., Nucleic Acids Res, 2015. 43(Database issue): p. D1049-56.
66. Barbato, S., et al., Sci Rep, 2017. 7(1): p. 17004.
67. Li, F.Y., et al., Nature, 2011. 475(7357): p. 471-6.
68. Soderberg, O., et al., Nat Methods, 2006. 3(12): p. 995-1000.
69. Settembre, C., et al., EMBO J, 2012. 31(5): p. 1095-108.
70. Alfano, G., et al., Development, 2011. 138(2): p. 261-71. 71. Charbel Issa, P., et al., invest Ophthalmol Vis Sci, 2013. 54(8): p. 5602-12.
72. Prosser, H.M., et al., Nat Biotechnol, 2011. 29(9): p. 840-5.
73. Sakami, S., et al., J Biol Chem, 2011. 286(12): p. 10551-67.
74. Testa, F., et al., Invest Ophthalmol Vis Sci, 2011. 52(8): p. 5618-24.
75. Weng, J., et al., Cell, 1999. 98(1): p. 13-23.
76. Bartolomeo, R., et al., J Clin Invest, 2017. 127(10): p. 3717-3729.
77. Doria, M., A. Ferrara, and A. Auricchio, Hum Gene Ther Methods, 2013. 24(6): p. 392-8.
78. Gargiulo, S., et al., ILAR J, 2012. 53(1): p. E70-81.
79. Liang, F.Q., et al., Methods Mol Med, 2001. 47: p. 125-39.
80. Botta, S., et al., Elife, 2016. 5: p. el2242.
81. Surace, E.M., et al., Mol Ther, 2005. 12(4): p. 652-8.
82. An, J., et al., J Neurogenet, 2012. 26(3-4): p. 363-73.
83. Nezich, C.L., et al., J Cell Biol, 2015. 210(3): p. 435-50.
84. Mizushima, N., T. Yoshimori, and B. Levine. Cell, 2010. 140(3): p. 313-26.
85. Polishchuk, E.V. and R.S. Polishchuk, Methods Cell Biol, 2013. 118: p. 243-58.
86. Conte, I., et al., Proc Natl Acad Sci U S A, 2010. 107(35): p. 15491-6.
87. Huang da, W., B.T. Sherman, and R.A. Lempicki, Nat Protoc, 2009. 4(1): p. 44-57.
88. Ashburner, M., et al., Nat Genet, 2000. 25(1): p. 25-9.
89. Brambilla, D. and S. Fais, Int J Cancer, 2009. 125(10): p. 2239-45.
90. Padanyi, R., et al., J Biol Chem, 2010. 285(41): p. 31704-12.
91. Lockwich, T., et al., J Biol Chem, 2001. 276(45): p. 42401-8.
92. Settembre, C. and D.L. Medina, Methods Cell Biol, 2015. 126: p. 45-62.
93. Dibble, C.C. and L.C. Cantley, Trends Cell Biol, 2015. 25(9): p. 545-55.
94. Lamb, R.F., et al., Nat Cell Biol, 2000. 2(5): p. 281-7.

Claims

1. A pharmaceutical composition comprising an inhibitor of ezrin or of its active form for use in the treatment and/or prevention of a condition selected from the group consisting of: eye disease, retinal disease, neurodegenerative disease, lysosomal storage disease and metabolic disease.
2. The pharmaceutical composition according to claim 1, wherein said inhibitor of ezrin or of its active form induces autophagy and/or activates lysosomal function in a subject.
3. The pharmaceutical composition for use according to claim 1 or 2 wherein the retinal diseases is retinitis pigmentosa, macular degeneration, Leber congenital Amaurosis, cone-rod dystrophy, cone dystrophy, wherein the neurodegenerative disease is a neurodegenerative storage disorder, wherein the lysosomal storage disorders is a mucopolysaccharidosis, Batten disease, Fabry's disease, Pompe's disease and wherein the metabolic disease is diabetes, insulin resistance or dyslipidemia.
4. The pharmaceutical composition for use according to claim 3 wherein the retinitis pigmentosa is autosomal dominant retinitis pigmentosa, autosomal recessive retinitis pigmentosa or X-linked retinitis pigmentosa, wherein the macular degeneration is macular dystrophy, age-related macular degeneration, inherited macular degeneration or Stargardt disease, wherein the neurodegenerative disease is Alzheimer's disease or Parkinson's disease, wherein the mucopolysaccharidosis is Sanfilippo syndrome (MPS III), Hurler syndrome (MPS IH), Hurler-Scheie syndrome (MPS l-H/S), Scheie syndrome (MPS IS), Hunter syndrome (MPS II), Morquio syndrome (MP IV), Maroteaux-Lamy syndrome (MPS VI), Sly syndrome (MPS VII) or MPS IX and wherein diabetes is type 2 diabetes.
5. The pharmaceutical composition for use according to claim any one of previous claim wherein the subject is affected by a condition selected from the group consisting of: age- related macular degeneration, Stargardt's disease, retinitis pigmentosa (recessive or autosomal dominant), Leber congenital Amaurosis, cone-rod dystrophies, cone dystrophies, Batten disease, Alzheimer's disease, Parkinson's disease, Fabry's disease, Mucopolysaccharidoses, Pompe's disease, Glaucoma.
6. The pharmaceutical composition for use according to any one of previous claim wherein said inhibitor is selected from the group consisting of:
a) a polypeptide; b) a polynucleotide coding for said polypeptide or a polynucleotide that inhibits or blocks ezrin or its active form expression and/or function;
c) a vector comprising or expressing said polynucleotide;
d) a host cell genetically engineered expressing said polypeptide or said polynucleotide; e) a small molecule;
f) a peptide, a protein, an antibody, an antisense oligonucleotide, a siRNA, antisense expression vector or recombinant virus or any other agent that inhibits or blocks ezrin or its active form expression and/or function.
7. The pharmaceutical composition for use according to any one of previous claim wherein said inhibitor is a siRNA or a miR, preferably said siRNA has the sequence: GCUCAAAGAUAAUGCUAUG.
8. The pharmaceutical composition for use according to any one of previous claim wherein said inhibitor is NSC668394 or NSC305787.
9. The pharmaceutical composition for use according to any one of previous claim wherein said inhibitor is a MAGT1 inhibitor.
10. The pharmaceutical composition for use according to any one of previous claim wherein said inhibitor inhibits mTOR and/or induces Ca2+ flux into a cell.
11. The pharmaceutical composition for use according to any one of previous claim further comprising a therapeutic agent, wherein said further therapeutic agent is for the treatment and/or prevention of eye disease, retinal disease, neurodegenerative disease, lysosomal storage disease and metabolic disease.
PCT/EP2019/077110 2018-10-05 2019-10-07 Ezrin inhibitors and uses thereof WO2020070333A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP18198928 2018-10-05
EP18198928.6 2018-10-05

Publications (1)

Publication Number Publication Date
WO2020070333A1 true WO2020070333A1 (en) 2020-04-09

Family

ID=63965060

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2019/077110 WO2020070333A1 (en) 2018-10-05 2019-10-07 Ezrin inhibitors and uses thereof

Country Status (1)

Country Link
WO (1) WO2020070333A1 (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3773919A (en) 1969-10-23 1973-11-20 Du Pont Polylactide-drug mixtures
WO2012064396A2 (en) 2010-08-21 2012-05-18 Georgetown University Novel ezrin inhibitors and methods of making and using
WO2012064936A1 (en) 2010-11-10 2012-05-18 Air Products And Chemicals, Inc. Syngas produced by plasma gasification
WO2015112837A1 (en) * 2014-01-24 2015-07-30 Georgetown University Biomarkers and therapeutic targets for abnormal retinal pigment epithelium

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3773919A (en) 1969-10-23 1973-11-20 Du Pont Polylactide-drug mixtures
WO2012064396A2 (en) 2010-08-21 2012-05-18 Georgetown University Novel ezrin inhibitors and methods of making and using
WO2012064936A1 (en) 2010-11-10 2012-05-18 Air Products And Chemicals, Inc. Syngas produced by plasma gasification
WO2015112837A1 (en) * 2014-01-24 2015-07-30 Georgetown University Biomarkers and therapeutic targets for abnormal retinal pigment epithelium

Non-Patent Citations (96)

* Cited by examiner, † Cited by third party
Title
"Autophagy", vol. 12, 2016, article "Guidelines for the use and interpretation of assays for monitoring autophagy", pages: 1 - 222
"Remington's Pharmaceutical Sciences", 1980
ALFANO, G. ET AL., DEVELOPMENT, vol. 138, no. 2, 2011, pages 261 - 71
AN, J. ET AL., J NEUROGENET, vol. 26, no. 3-4, 2012, pages 363 - 73
ASHBURNER, M. ET AL., NAT GENET, vol. 25, no. 1, 2000, pages 270 - 9
BARBATO, S. ET AL., SCI REP, vol. 7, no. 1, 2017, pages 17004
BARRET, C. ET AL., J CELL BIOL, vol. 151, no. 5, 2000, pages 1067 - 80
BARTOLOMEO, R. ET AL., J CLIN INVEST, vol. 127, no. 10, 2017, pages 3717 - 3729
BERRYMAN, M.Z. FRANCKA. BRETSCHER, J CELL SCI, vol. 105, 1993, pages 1025 - 43
BERSON, E.L., INVEST OPHTHALMOL VIS SCI, vol. 34, no. 5, 1993, pages 1659 - 76
BHATTACHARYA, S. ET AL., INVEST OPHTHALMOL VIS SCI, vol. 58, no. 4, 2017, pages 2366 - 2387
BONILHA, V.L. ET AL., EXP EYE RES, vol. 82, no. 4, 2006, pages 720 - 9
BOTTA, S. ET AL., ELIFE, vol. 5, 2016, pages e12242
BOYA, P. ET AL., PROG RETIN EYE RES, vol. 55, 2016, pages 206 - 245
BRAMBILLA, D.S. FAIS, INT J CANCER, vol. 125, no. 10, 2009, pages 2239 - 45
BRETSCHER, A.K. EDWARDSR.G. FEHON, NAT REV MOL CELL BIOL, vol. 3, no. 8, 2002, pages 586 - 99
BULUT, G. ET AL., ONCOGENE, vol. 31, no. 3, 2012, pages 269 - 81
CARBON, S. ET AL., BIOINFORMATICS, vol. 25, no. 2, 2009, pages 288 - 9
CELIK, H. ET AL., MOL CANCER THER, vol. 14, no. 11, 2015, pages 2497 - 507
CHAO JIANG ET AL: "MicroRNA-184 promotes differentiation of the retinal pigment epithelium by targeting the <i>AKT2</i>/mTOR signaling pathway", ONCOTARGET, vol. 7, no. 32, 9 August 2016 (2016-08-09), XP055645748, DOI: 10.18632/oncotarget.10566 *
CHARBEL ISSA, P. ET AL., INVEST OPHTHALMOL VIS SCI, vol. 54, no. 8, 2013, pages 5602 - 12
CONTE, I. ET AL., PROC NATL ACAD SCI USA, vol. 107, no. 35, 2010, pages 15491 - 6
COSCOY, S. ET AL., PROC NATL ACAD SCI USA, vol. 99, no. 20, 2002, pages 12813 - 8
CREMERS, F.P. ET AL., HUM MOL GENET, vol. 11, no. 10, 2002, pages 1169 - 76
DAVIDSON, A.E. ET AL., INVEST OPHTHALMOL VIS SCI, vol. 52, no. 8, 2011, pages 5618 - 24
DECRESSAC, M. ET AL., PROC NATL ACAD SCI USA, vol. 110, no. 19, 2013, pages E1817 - 26
DENNIS, G., JR. ET AL., GENOME BIOL, vol. 4, no. 5, 2003, pages 3
DIBBLE, C.C.L.C. CANTLEY, TRENDS CELL BIOL, vol. 25, no. 9, 2015, pages 545 - 55
DORIA, M.A. FERRARAA. AURICCHIO, HUM GENE THER METHODS, vol. 24, no. 6, 2013, pages 392 - 8
FIEVET, B.D. LOUVARDM. ARPIN, BIOCHIM BIOPHYS ACTA, vol. 1773, no. 5, 2007, pages 653 - 60
FROST, L.S.C.H. MITCHELLK. BOESZE-BATTAGLIA, EXP EYE RES, vol. 124, 2014, pages 56 - 66
G BULUT ET AL: "Small molecule inhibitors of ezrin inhibit the invasive phenotype of osteosarcoma cells", ONCOGENE, vol. 31, no. 3, 27 June 2011 (2011-06-27), London, pages 269 - 281, XP055645906, ISSN: 0950-9232, DOI: 10.1038/onc.2011.245 *
GARGIULO, S. ET AL., ILAR J, vol. 53, no. 1, 2012, pages E70 - 81
GARY, R.A. BRETSCHER, MOL BIOL CELL, vol. 6, no. 8, 1995, pages 1061 - 75
GENE ONTOLOGY, C., NUCLEIC ACIDS RES, vol. 43, 2015, pages D1049 - 56
GRICIUC, A.L. ARONM. UEFFING, TRENDS MOL MED, vol. 17, no. 8, 2011, pages 442 - 51
HAMEL, C.P., ORPHANET J RARE DIS, vol. 2, 2007, pages 7
HATANO, R. ET AL., KIDNEY INT, vol. 83, no. 1, 2013, pages 41 - 9
HEIN, M.Y. ET AL., CELL, vol. 163, no. 3, 2015, pages 712 - 23
HUANG DA, W.B.T. SHERMANR.A. LEMPICKI, NAT PROTOC, vol. 4, no. 1, 2009, pages 44 - 57
IWASAKI, M.H. INOMATA, INVEST OPHTHALMOL VIS SCI, vol. 29, no. 5, 1988, pages 671 - 9
KIM, J.Y. ET AL., CELL, vol. 154, no. 2, 2013, pages 365 - 76
KIMURA, S. ET AL., METHODS ENZYMOL, vol. 452, 2009, pages 1 - 12
KIMURA, S.T. NODAT. YOSHIMORI, AUTOPHAGY, vol. 3, no. 5, 2007, pages 452 - 60
KLEE, C.B.T.H. CROUCHM.H. KRINKS, PROC NATL ACAD SCI USA, vol. 76, no. 12, 1979, pages 6270 - 3
LA SPADA, A.R., AUTOPHAGY, vol. 8, no. 12, 2012, pages 1845 - 7
LAMB, R.F. ET AL., NAT CELL BIOL, vol. 2, no. 5, 2000, pages 281 - 7
LI, F.Y. ET AL., NATURE, vol. 475, no. 7357, 2011, pages 471 - 6
LIANG, F.Q. ET AL., METHODS MOL MED, vol. 47, 2001, pages 125 - 39
LOCKWICH, T. ET AL., J BIOL CHEM, vol. 276, no. 45, 2001, pages 42401 - 8
MAO, J. ET AL., MOL CELL BIOCHEM, vol. 396, no. 1-2, 2014, pages 117 - 28
MARIANNA VITIELLO ET AL: "Context-dependent miR-204 and miR-211 affect the biological properties of amelanotic and melanotic melanoma cells , Omotayo Ope 10", ONCOTARGET, 6 March 2017 (2017-03-06), pages 25395 - 25417, XP055647371, Retrieved from the Internet <URL:https://doi.org/10.18632/oncotarget.15915> [retrieved on 20191128] *
MARTIN D. BOOTMAN ET AL: "The regulation of autophagy by calcium signals: Do we have a consensus?", CELL CALCIUM, vol. 70, 1 March 2018 (2018-03-01), GB, pages 32 - 46, XP055646860, ISSN: 0143-4160, DOI: 10.1016/j.ceca.2017.08.005 *
MATSUI, T. ET AL., CURR BIOL, vol. 9, no. 21, 1999, pages 1259 - 62
MATSUI, T. ET AL., J CELL BIOL, vol. 140, no. 3, 1998, pages 647 - 57
MEDINA, D.L. ET AL., DEV CELL, vol. 21, no. 3, 2011, pages 421 - 30
MEDINA, D.L. ET AL., NAT CELL BIOL, vol. 17, no. 3, 2015, pages 288 - 99
MEIKLE ET AL., JAMA, vol. 281, no. 3, 1999, pages 249 - 254
MIAO, G. ET AL., AUTOPHAGY, vol. 12, no. 12, 2016, pages 2263 - 2270
MICHAELIDES, M. ET AL., SURV OPHTHALMOL, vol. 51, no. 3, 2006, pages 232 - 58
MIZUSHIMA, N. ET AL., MOL BIOL CELL, vol. 15, no. 3, 2004, pages 1101 - 11
MIZUSHIMA, N.T. YOSHIMORIB. LEVINE, CELL, vol. 140, no. 3, 2010, pages 313 - 26
MURAD, N. ET AL., FEBS J, vol. 281, no. 23, 2014, pages 5251 - 64
NAJIBA MURAD ET AL: "miR-184 regulates ezrin, LAMP-1 expression, affects phagocytosis in human retinal pigment epithelium and is downregulated in age-related macular degeneration", FEBS JOURNAL, vol. 281, no. 23, 13 October 2014 (2014-10-13), GB, pages 5251 - 5264, XP055645512, ISSN: 1742-464X, DOI: 10.1111/febs.13066 *
NANDROT, E.F.Y. CHANGS.C. FINNEMANN, ADV EXP MED BIOL, vol. 613, 2008, pages 369 - 75
NEZICH, C.L. ET AL., J CELL BIOL, vol. 210, no. 3, 2015, pages 435 - 50
PADANYI, R. ET AL., J BIOL CHEM, vol. 285, no. 41, 2010, pages 31704 - 12
POLISHCHUK, E.V.R.S. POLISHCHUK, METHODS CELL BIOL, vol. 118, 2013, pages 243 - 58
POLITO, V.A. ET AL., EMBO MOL MED, vol. 6, no. 9, 2014, pages 1142 - 60
PROSSER, H.M. ET AL., NAT BIOTECHNOL, vol. 29, no. 9, 2011, pages 840 - 5
REME, C.A. WIRZ-JUSTICE, KLIN MONBL AUGENHEILKD, vol. 186, no. 3, 1985, pages 175 - 9
ROSSELLA RUSSO ET AL: "Rapamycin and fasting sustain autophagy response activated by ischemia/reperfusion injury and promote retinal ganglion cell survival", CELL DEATH & DISEASE, vol. 9, no. 10, 24 September 2018 (2018-09-24), XP055646651, DOI: 10.1038/s41419-018-1044-5 *
SAKAMI, S. ET AL., J BIOL CHEM, vol. 286, no. 12, 2011, pages 10551 - 67
SETHNA, S. ET AL., J BIOL CHEM, vol. 291, no. 25, 2016, pages 13257 - 506
SETTEMBRE, C. ET AL., EMBO J, vol. 31, no. 5, 2012, pages 1095 - 108
SETTEMBRE, C. ET AL., NAT REV MOL CELL BIOL, vol. 14, no. 5, 2013, pages 283 - 96
SETTEMBRE, C. ET AL., SCIENCE, vol. 332, no. 6036, 2011, pages 1429 - 33
SETTEMBRE, C.D.L. MEDINA, METHODS CELL BIOL, vol. 126, 2015, pages 45 - 62
SHAFFER, M.H. ET AL., PLOS ONE, vol. 5, no. 8, 2010, pages e12404
SINHA, D. ET AL., EXP EYE RES, vol. 144, 2016, pages 46 - 53
SODERBERG, O. ET AL., NAT METHODS, vol. 3, no. 12, 2006, pages 995 - 1000
STRAUSS, O., PHYSIOL REV, vol. 85, no. 3, 2005, pages 845 - 81
SURACE, E.M. ET AL., MOL THER, vol. 12, no. 4, 2005, pages 652 - 8
TANIDA, I. ET AL., AUTOPHAGY, vol. 1, no. 2, 2005, pages 84 - 91
TARN, L.C. ET AL., HUM MOL GENET, vol. 19, no. 22, 2010, pages 4421 - 36
TURUNEN, O.T. WAHLSTROMA. VAHERI, J CELL BIOL, vol. 126, no. 6, 1994, pages 1445 - 53
WANG, G.W. MAOS. ZHENG, FEBS LETT, vol. 582, no. 25-26, 2008, pages 3663 - 8
WENG, J. ET AL., CELL, vol. 98, no. 1, 1999, pages 13 - 23
WIESENBERGER, G. ET AL., EUKARYOT CELL, vol. 6, no. 4, 2007, pages 592 - 9
XIE, J.J. ET AL., J HISTOCHEM CYTOCHEM, vol. 59, no. 11, 2011, pages 1001 - 8
YAO, J. ET AL., INVEST OPHTHALMOL VIS SCI, vol. 55, no. 5, 2014, pages 3237 - 46
YU, N. ET AL., J EXP CLIN CANCER RES, vol. 34, 2015, pages 107
ZHAN, C. ET AL., ONCOL LETT, vol. 12, no. 5, 2016, pages 3457 - 3462
ZHANG, Y.Q. ET AL., INT J OPHTHALMOL, vol. 10, no. 7, 2017, pages 1040 - 1045
ZHOU, L.J. HEY. ZHANG, J INT MED RES, vol. 41, no. 4, 2013, pages 1009 - 16
ZHU, L. ET AL., AM J PHYSIOL CELL PHYSIOL, vol. 293, no. 3, 2007, pages C874 - 84

Similar Documents

Publication Publication Date Title
CA2904164C (en) Mir-204 and mir-211 and uses thereof
US20230174980A1 (en) Channel modulators
JP2022070913A (en) Use of single-stranded antisense oligonucleotides in prevention or treatment of genetic diseases involving trinucleotide repeat expansion
Han et al. MiR‐203a‐3p inhibits retinal angiogenesis and alleviates proliferative diabetic retinopathy in oxygen‐induced retinopathy (OIR) rat model via targeting VEGFA and HIF‐1α
JP6794409B2 (en) Blocking inflammatory proteases with theta defensins
CN104011208B (en) MiRNA-212/132 family as therapeutic targets
Li et al. MicroRNA-125b mimic inhibits ischemia reperfusion-induced neuroinflammation and aberrant p53 apoptotic signalling activation through targeting TP53INP1
Fu et al. Suppressing long noncoding RNA OGRU ameliorates diabetic retinopathy by inhibition of oxidative stress and inflammation via miR-320/USP14 axis
WO2007041282A2 (en) Methods and compositions for treatment of cystic fibrosis
Fei et al. Downregulation of Homer1b/c improves neuronal survival after traumatic neuronal injury
JP2020158506A (en) Compositions and methods for modulating neuronal excitability and motor behavior
MX2013004577A (en) TREATMENT OF MeCP2-ASSOCIATED DISORDERS.
Nie et al. Lithium chloride (LiCl) induced autophagy and downregulated expression of transforming growth factor β-induced protein (TGFBI) in granular corneal dystrophy
Chánez-Paredes et al. The Arp2/3 inhibitory protein arpin is required for intestinal epithelial barrier integrity
US10612021B2 (en) Therapeutic or prophylactic composition for TDP-43 proteinopathy
Liu et al. Circ_NNT suppresses the apoptosis and inflammation in glucose-induced human retinal pigment epithelium by regulating miR-320b/TIMP3 axis in diabetic retinopathy
WO2020070333A1 (en) Ezrin inhibitors and uses thereof
US20210113654A1 (en) Methods and Compositions to Alleviate Vascular Permeability
Dreixler et al. Protein kinase C subtypes and retinal ischemic preconditioning
Gong et al. Inhibiting autophagy by miR-19a-3p/PTEN regulation protected retinal pigment epithelial cells from hyperglycemic damage
Zhao et al. MicroRNA-210-3p mediates trabecular meshwork extracellular matrix accumulation and ocular hypertension–Implication for novel glaucoma therapy
CN115006534B (en) Use of potassium channel Kir4.1 inhibitors for treating depression and pharmaceutical compositions
EP3728599A1 (en) Ectopically expressed transcription factors and uses thereof
Shao et al. The hsa_circ_0004805/hsa_miR-149-5p/TGFB2 axis plays critical roles in the pathophysiology of diabetic retinopathy in vitro and in vivo
Hu et al. Kruppel-Like Factor (KLF6) Regulates Oxidative Stress and Apoptosis of Human Retinal Pigment Epithelial Cells Induced by High Glucose Through Transcriptional Regulation of USP22 and the Downstream SIRT1/Nrf2 Pathway

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19783532

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 19783532

Country of ref document: EP

Kind code of ref document: A1