WO2020068482A1 - Recombinant adenovirus-based interferon biotherapeutics in swine - Google Patents

Recombinant adenovirus-based interferon biotherapeutics in swine Download PDF

Info

Publication number
WO2020068482A1
WO2020068482A1 PCT/US2019/051425 US2019051425W WO2020068482A1 WO 2020068482 A1 WO2020068482 A1 WO 2020068482A1 US 2019051425 W US2019051425 W US 2019051425W WO 2020068482 A1 WO2020068482 A1 WO 2020068482A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
acid sequence
adenovirus genome
adenovirus
activity
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2019/051425
Other languages
French (fr)
Inventor
James J. Zhu
Elizabeth A. BISHOP
Palaniappan Ramanathan
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
US Department of Agriculture USDA
Original Assignee
US Department of Agriculture USDA
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by US Department of Agriculture USDA filed Critical US Department of Agriculture USDA
Publication of WO2020068482A1 publication Critical patent/WO2020068482A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52Cytokines; Lymphokines; Interferons
    • C07K14/555Interferons [IFN]
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027New or modified breeds of vertebrates
    • A01K67/0275Genetically modified vertebrates, e.g. transgenic
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702Regulators; Modulating activity
    • C07K14/4703Inhibitors; Suppressors
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52Cytokines; Lymphokines; Interferons
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/575Hormones
    • C07K14/61Growth hormone [GH], i.e. somatotropin
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90Stable introduction of foreign DNA into chromosome
    • C12N15/902Stable introduction of foreign DNA into chromosome using homologous recombination
    • C12N15/907Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2207/00Modified animals
    • A01K2207/15Humanized animals
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00Genetically modified animals
    • A01K2217/05Animals comprising random inserted nucleic acids (transgenic)
    • A01K2217/054Animals comprising random inserted nucleic acids (transgenic) inducing loss of function
    • A01K2217/056Animals comprising random inserted nucleic acids (transgenic) inducing loss of function due to mutation of coding region of the transgene (dominant negative)
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00Genetically modified animals
    • A01K2217/07Animals genetically altered by homologous recombination
    • A01K2217/072Animals genetically altered by homologous recombination maintaining or altering function, i.e. knock in
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00Genetically modified animals
    • A01K2217/15Animals comprising multiple alterations of the genome, by transgenesis or homologous recombination, e.g. obtained by cross-breeding
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00Genetically modified animals
    • A01K2217/20Animal model comprising regulated expression system
    • A01K2217/206Animal model comprising tissue-specific expression system, e.g. tissue specific expression of transgene, of Cre recombinase
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00Animals characterised by species
    • A01K2227/10Mammal
    • A01K2227/108Swine
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00Animals characterised by purpose
    • A01K2267/01Animal expressing industrially exogenous proteins
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/8509Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
    • C12N2015/8518Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic expressing industrially exogenous proteins, e.g. for pharmaceutical use, human insulin, blood factors, immunoglobulins, pseudoparticles
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/10011Adenoviridae
    • C12N2710/10311Mastadenovirus, e.g. human or simian adenoviruses
    • C12N2710/10341Use of virus, viral particle or viral elements as a vector
    • C12N2710/10343Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/50Vector systems having a special element relevant for transcription regulating RNA stability, not being an intron, e.g. poly A signal
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2840/00Vectors comprising a special translation-regulating system
    • C12N2840/10Vectors comprising a special translation-regulating system regulates levels of translation

Definitions

  • Foot-and-mouth disease virus is a positive-sense, single- stranded RNA virus belonging to the Aphthovirus genus of the Picomaviridae family and causes an acute vesicular disease in cloven-hoofed animals including cattle, swine, goats, and sheep. It is one of the most contagious animal viruses and could have a devastating economic effect on livestock industries if outbreaks occurred, especially in FMD-free countries. There are commercial FMD vaccines available, however it takes approximately a week for the vaccine to induce protective immunity. Development of a countermeasure with a rapid onset of immunity would greatly facilitate the control of this disease.
  • FMDV has been known to be very sensitive to the inhibition of type I interferons (IFN) (Chinsangaram, J., et ah, J. Virol., 73: 9891-9898 (1999); Sellers, R.F., Nature. 198, 1228-1229 (1963)). Because of their rapid and potent antiviral effects, type I IFN genes have been used to induce rapid onset of immune protection against FMDV in swine. Pigs can be completely protected against FMDV challenge 24 h after injection with a replication-defective human adenovirus 5 (Ad5) inserted with an IFNa gene (Chinsangaram, J., et ah, J.
  • IFN interferons
  • the type I IFN gene family consists of several subtypes in all mammalian species, and some subtypes contain multiple genes (Roberts, R.M., et al., Interferon Cytokine Res., 18: 805-816 (1998).
  • the antiviral activities of the genes differ a great deal (Moll, H.P., et al., Cytokine, 53: 52-59 (2011)).
  • This MTT-CPER assay is more cost-effective, has higher throughput, is less labor intensive, and is more sensitive than the plaque reduction assay.
  • FMDV-susceptible porcine cell lines are used in the assay to measure anti-FMDV specific activity.
  • This assay to compare the antiviral activities of porcine IFN expressed in-vitro to identify the best IFN gene, to test the effect of Suppressor Of Cytokine Signaling 1 (SOCS1) gene on IFN expression in order to improve the existing IFN biotherapeutics, and to measure anti-FMDV activity in pigs after treatments .
  • SOCS1 Cytokine Signaling 1
  • adenovirus genome comprising a heterologous nucleic acid inserted into a cloning site of said genome, said heterologous nucleic acid comprising:
  • a first nucleic acid sequence comprising an adenovirus tripartite sequence (e.g., SEQ ID NO:l) operably linked to a second nucleic acid sequence encoding an interferon (e.g., SEQ ID NO:2);
  • a third nucleic acid sequence comprising a bovine growth hormone polyA termination sequence operably linked to said second nucleic acid sequence (e.g., SEQ ID NO:3);
  • a fourth nucleic acid sequence comprising a porcine elongation factor 1 -alpha (EFla) promoter (e.g., SEQ ID NO:4);
  • EFla porcine elongation factor 1 -alpha
  • a fifth nucleic acid sequence operably linked to said fourth nucleic acid sequence, said fifth nucleic acid sequence encoding a suppressor of cytokine signaling 1 (SOCS1) protein (e.g., SEQ ID NO:5).
  • SOCS1 cytokine signaling 1
  • a method of producing interferon in an animal comprising, introducing into said animal an effective amount of the recombinant virus.
  • a method of producing interferon in tissue culture comprising, growing a cell comprising the adenovirus genome under in vitro conditions allowing for the production of interferon, thereby producing interferon.
  • an immunomodulatory composition comprising the recombinant virus and a veterinary or pharmaceutically acceptable carrier.
  • FIG. 1 shows western blotting of supernatants from cultured LFBK- anb ⁇ transfected with pcDNA3.l plasmids inserted with porcine interferon a genes or plasmid vector only (Fane 1-7 and 10-12: IFNa; Fane 8: Protein molecular weight markers, Fane 9:
  • FIG. 2A and FIG. 2B show the optical density (OD) readings of MTT-based CPER assays using IBRS-2 and supernatants harvested from FFBK-anb ⁇ cells transfected with plasmid DNA inserted with porcine IRNb or the best porcine IFNa coding sequences; at Days 2 (FIG.2A) and 4 (FIG. 2B) post transfection as described below.
  • OD optical density
  • FIG. 3 shows the OD readings of MTT-based CPER assays using FFBK-anb ⁇ and supernatants harvested from FFBK-anb ⁇ cells infected with two different MOI (multiplicity of infection) of recombinant adenoviruses inserted with the best (Ad5-IFNl9) or previously tested interferon (Ad5-IFNa) coding sequences at Day 1 post infection as described below.
  • FIG. 4B show the OD readings of MTT -based CPER assays using IBRS-2 cells and supernatants harvested from FFBK-avP6cells transfected with plasmid DNA inserted with porcine IFNa coding sequences; at Days 2 (FIG. 4A) and 4 (FIG. 4B) post DNA transfection as described below.
  • FIG. 5 A and FIG. 5B show the OD readings of MTT -based CPER assays using IBRS-2 and supernatants harvested from FFBK-anb ⁇ cells transfected with plasmid DNA inserted with the best porcine interferon or miniature pig IFNa coding sequences; at Days 2 (FIG. 5A) and 4 (FIG. 5B) as described below.
  • FIG. 6 shows the OD readings of MTT-based CPER assays using FFBK-anb ⁇ from supernatants harvested from ERBK-anb ⁇ cells infected with different MOI of recombinant adenoviruses Ad5-IFNa post infection as described below.
  • FIG. 7 A, FIG. 7B, FIG. 7C, and FIG. 7D show the OD readings of MTT-based CPER assays using FFBK-anb ⁇ and supernatants harvested from FFBK-anb ⁇ cells co-transfected with plasmid DNA containing an IFNa gene with or without an adenovirus tripartite non-coding sequence (NCS) in the 5’-end of the interferon coding sequence; at days 2 (FIG. 7A), 4 (FIG. 7B) and 6 (FIG. 7C) post-transfection and using supernatants from the cells infected with adenoviruses containing an IFNa gene with or without the NCS at day 6 post infection (FIG. 7D) as described below.
  • NCS adenovirus tripartite non-coding sequence
  • FIG. 8 A, FIG. 8B, FIG. 8C, FIG. 8D, FIG. 8E, and FIG. 8F show the OD readings of MTT-based CPER assay using FFBK-anb ⁇ and supernatants harvested from FFBK-anb ⁇ cells co-transfected with different ratios of plasmid DNA inserted with IFNa and SOCS1 or vector only; at days 2 (FIG. 8A, FIG. 8B), 4 (FIG. 8C, FIG. 8D) and 6 (FIG. 8E, FIG. 8F) post-transfection as described below.
  • FIG. 9A and FIG. 9B show the OD readings of MTT-based CPER assay using FFBK-anb ⁇ and supernatants harvested from HEK293 (Fig. 9A) and FFBK-anb ⁇ (FIG. 9B) cells transfected with plasmid DNA containing an IFNa gene inserted at 3’ end of CMV or EF1 a promoters at day 1 post-transfection as described below.
  • Exemplary FIG. 10 shows the squences of three pocine EFla promoters as described below.
  • FIG. 11A and FIG. 11B show the OD readings of MTT -based CPER assay using FFBK-anb ⁇ and supernatants harvested from FFBK-anb ⁇ cells transfected with plasmid DNA containing three different porcine EFla promoters inserted at 5’ end of IFN19 coding sequence; at days 1 (FIG. 11 A) and 2 (FIG. 11B) post-transfection as described below.
  • FIG. 12A, FIG. 12B, and FIG. 12C show the OD readings of MTT - based CPER assay using FFBK-anb ⁇ and supernatants harvested from FFBK-anb ⁇ cells transfected with plasmid DNA containing an NCS-IFN19 + polyA termination sequence + porcine EFla promoter + SOCS1 or codon-optimized SOCS1 + polyA termination sequence + porcine EFla promoter + optimized NCS-IFN19 at day 2 post-transfection; at days 1 (FIG. 12A), 2 (FIG. 12B) and 3 (FIG. 12C) post transfection as described below.
  • FIG. 13 A and FIG. 13B show the OD readings of MTT -based CPER assay using FFBK-anb ⁇ and supernatants harvested from FFBK-anb ⁇ cells transfected with plasmid DNA containing an NCS-IFN19 + polyA termination sequence + porcine EFla promoter + SOCS1 or SOCS1 + polyA termination sequence + porcine EFla promoter + NCS- IFN19; at days 2 (FIG. 13A) and 3 (FIG. 13B) post-transfection as described below.
  • FIG. 14 shows the OD readings of MTT-CPER assays using IBRS-2 and supernatants harvested from FFBK-anb ⁇ cells infected with 46 MOI of Ad5-IFNl9+ or Ad5- IFNa virus at Days (D) 1, 2 and 3 post infection as described below.
  • FIG. 15 shows the differences in anti-FMDV activities between Ad5-IFNl9+ and Ad5-IFNa at days 1, 2-3 and 4 post infection of different MOI as described below.
  • FIG. 16A, FIG. 16B, FIG. 16C, FIG. 16D, FIG. 16E, FIG. 16F, Fig. 16G, and FIG. 16H show anti-FMDV activities (OD readings) in sera of pig treated with Ad5- IFNa (dash lines) and Ad5-IFNl9+ (solid line) at a dose of 10 9 PFU (triangle) or 10 10 PFU (circle) one day before treatment (FIG. 16A) and days 1, 2, 3, 4, 5, 6, and 7 post-treatment ( FIG. 16B, FIG. 16C, FIG. 16D, FIG. 16E, FIG. 16F, Fig. 16G, and FIG. 16H, respectively) as described below.
  • FIG. 17 shows the structure of the Ad5-blue plasmid used to produce Ad5-IFNl9+ recombinant adenovirus where hCMV (human cytomegalovirus promoter), Ad-NCS (adenovirus tripartite non-coding sequence), IFN19 (the porcine IFNa coding sequence of GQ415066), pA-SS (the poly-A signal sequence of bovine growth hormone), EFla-promoter (the promoter of porcine EFla gene), and SOCS1 (the porcine SOCS1 coding sequence) were concatenated and inserted between Clal and Xba restriction sites of the Ad5-blue vector.
  • hCMV human cytomegalovirus promoter
  • Ad-NCS adenovirus tripartite non-coding sequence
  • IFN19 the porcine IFNa coding sequence of GQ415066
  • pA-SS the poly-A signal sequence of bovine growth hormone
  • EFla-promoter the promote
  • ACTCTCTTCGCATCGCTGTCTGCGAGGGCGAGCTGTTGGGCTCGCGGTTGA GGACAAACTCTTCGCGGTCTTTCCAGTACTCTTGGATCGGAAACCCGTCGG CCTCCGAACGGTACTCCGCCACCGAGGGACCTGAGCGGTCCGCATCGACCG GATCGGAAAACCTCTCGAGAAAGGCGTCTAACCAGTCACAGTCGCAAG is adenovirus Ad5 tripartite sequence (Zhang Y., et al., J. Biol. Chem., 264(18): 10679-84 (1989)).
  • CTGCAGGAGAAGTCCTACAGCCCATGCGCTTGGGAGATCATCAGGGCTGAA GTGATGAGAGTGTTCAGCTCCAGCCGGAACCTGCAGGACAGGCTGCGGAAG AAGGAGTGA is a porcine interferon alpha codon optimized from GQ415066 (IFN19).
  • TTTTGTCGTCTTAGGTGTCGTGAAAGCCATCGCTAAAAGCT is a porcine elongation factor 1 -alpha (EFla) promoter.
  • CTTCCAGATTTGA is a porcine suppressor of cytokine signaling 1 (SOCS1) open reading frame sequence codon-optimized from NM_00l204768.
  • ACTACCTGAGCTCCTTCCCCTTCCAGATTTGATCTAGA is the nucleotide sequence inserted in plasmid Ad5 Blue vector between restriction sites Clal and Xhal.
  • nucleic acid or protein“consisting essentially of’ means: 1) nucleic acids that differ from a reference sequence by 20 or fewer nucleic acid residues and also perform the function of the reference nucleic acid sequence, and 2) proteins that differ from a reference sequence by 10 or fewer nucleic acids and also perform the function of the reference protein sequence.
  • Such variants include sequences which are shorter or longer than the reference sequence, have different residues or amino acids at particular positions, or a combination thereof.
  • An isolated nucleic acid is a nucleic acid the structure of which is not identical to that of any naturally occurring nucleic acid.
  • the term therefore covers, for example, (a) a DNA which has the sequence of part of a naturally occurring genomic DNA molecule but is not flanked by both of the coding or noncoding sequences that flank that part of the molecule in the genome of the organism in which it naturally occurs; (b) a nucleic acid incorporated into a vector or into the genomic DNA of a prokaryote or eukaryote in a manner such that the resulting molecule is not identical to any naturally occurring vector or genomic DNA; (c) a separate molecule such as a cDNA, a genomic fragment, a fragment produced by polymerase chain reaction (PCR), or a restriction fragment; and (d) a recombinant nucleotide sequence that is part of a hybrid gene, i.e., a gene encoding a fusion protein.
  • PCR polymerase chain reaction
  • nucleic acids present in mixtures of (i) DNA molecules, (ii) transformed or transfected cells, and (iii) cell clones, e.g., as these occur in a DNA library such as a cDNA or genomic DNA library.
  • recombinant nucleic acids refers to polynucleotides which are made by the combination of two otherwise separated segments of sequence accomplished by the artificial manipulation of isolated segments of polynucleotides by genetic engineering techniques or by chemical synthesis. In so doing one may join together polynucleotide segments of desired functions to generate a desired combination of functions.
  • the virus is an adenovirus.
  • Such modification can involve deletion of all or a portion of a target gene or regulatory sequence, such as a promoter, including but not limited to the open reading frame of a target locus, transcriptional regulators such as promoters of a target locus, and any other regulatory nucleic acid sequences positioned 5’ or 3’ from the open reading frame.
  • a target gene or regulatory sequence such as a promoter, including but not limited to the open reading frame of a target locus, transcriptional regulators such as promoters of a target locus, and any other regulatory nucleic acid sequences positioned 5’ or 3’ from the open reading frame.
  • Such deletional mutations can be achieved using any technique known to those of skill in the art.
  • Mutational, insertional, and deletional variants of the disclosed nucleotide sequences and genes can be readily prepared by methods which are well known to those skilled in the art. It is well within the skill of a person trained in this art to make mutational, insertional, and deletional mutations which are equivalent in function to the specific ones disclosed herein.
  • DNA constructs prepared for introduction into a viral genome will typically comprise a replication system (i.e., vector) recognized by a target host or viral replication machinery, including the intended DNA fragment encoding a desired
  • Expression systems can include, for example, an origin of replication or autonomously replicating sequence (ARS) and expression control sequences, a promoter, an enhancer and necessary processing information sites, such as ribosome-binding sites, RNA splice sites, polyadenylation sites, transcriptional terminator sequences, and mRNA stabilizing sequences.
  • ARS autonomously replicating sequence
  • Expression systems can comprise a recombinant viral genome, such that the modified virus is produced following introduction of a vector containing the genome of the virus, or several vectors which, in combination, comprise the genome of the recombinant virus which is then reconstituted upon introduction into a host cell and expression of the recombinant genome.
  • Selectable markers useful in practicing the methodologies of the invention disclosed herein can be positive selectable markers.
  • positive selection refers to the case in which a genetically altered cell can survive in the presence of a toxic substance only if the recombinant polynucleotide of interest is present within the cell.
  • Negative selectable markers and screenable markers are also well known in the art and are contemplated by the present invention. One of skill in the art will recognize that any relevant markers available can be utilized in practicing the inventions disclosed herein.
  • Hybridization procedures are useful for identifying polynucleotides, such as those modified using the techniques described herein, with sufficient homology to the subject regulatory sequences to be useful as taught herein.
  • the particular hybridization techniques are not essential to the subject invention.
  • Hybridization probes can be labeled with any appropriate label known to those of skill in the art.
  • Hybridization conditions and washing conditions for example temperature and salt concentration, can be altered to change the stringency of the detection threshold. See, e.g., Sambrook et al. (1989) vide infra or Ausubel et al. (1995) Current Protocols in Molecular Biology, John Wiley & Sons, NY, N.Y., for further guidance on hybridization conditions.
  • PCR Polymerase Chain Reaction
  • PCR is a repetitive, enzymatic, primed synthesis of a nucleic acid sequence. This procedure is well known and commonly used by those skilled in this art (see Mullis, U.S. Pat. Nos. 4,683,195, 4,683,202, and 4,800,159; Saiki et al., Science, 230:1350-1354 (1985)). PCR is based on the enzymatic amplification of a DNA fragment of interest that is flanked by two oligonucleotide primers that hybridize to opposite strands of the target sequence.
  • the primers are oriented with the 3' ends pointing towards each other. Repeated cycles of heat denaturation of the template, annealing of the primers to their complementary sequences, and extension of the annealed primers with a DNA polymerase result in the amplification of the segment defined by the 5' ends of the PCR primers. Since the extension product of each primer can serve as a template for the other primer, each cycle essentially doubles the amount of DNA template produced in the previous cycle. This results in the exponential accumulation of the specific target fragment, up to several million-fold in a few hours.
  • a thermostable DNA polymerase such as the Taq polymerase, which is isolated from the thermophilic bacterium Thermus aquaticus, the amplification process can be completely automated. Other enzymes which can be used are known to those skilled in the art.
  • Nucleic acids and proteins of the present invention can also encompass homologues of the specifically disclosed sequences.
  • Homology can be 50%-l00%. In some instances, such homology is greater than 80%, greater than 85%, greater than 90%, or greater than 95%.
  • the degree of homology or identity needed for any intended use of the sequence(s) is readily identified by one of skill in the art.
  • percent sequence identity of two nucleic acids is determined using an algorithm known in the art, such as that disclosed by Karlin and Altschul, Proc. Natl. Acad. Sci. USA, 87:2264-2268 (1990), modified as in Karlin and Altschul, Proc. Natl. Acad. Sci. USA, 90:5873-5877 (1993).
  • any suitable bacterial, protist, animal or fungal host capable of allowing replication of the virus or its genome can be utilized. Even more preferably, non-pathogenic and non-toxigenic strains of such host cells are utilized in practicing embodiments of the disclosed inventions. Examples of workable combinations of cell lines and expression vectors are described in Sambrook et al. (1989); Ausubel et al. (Eds.) (1995) Current Protocols in Molecular Biology, Greene Publishing and Wiley Interscience, New York; and Metzger et al., Nature, 334: 31-36 (1988).
  • nucleic acid(s) encoding the viruses and protein(s) of the present invention can be introduced by any means known to the art which is appropriate for the particular type of cell, including without limitation, transformation, lipofection, electroporation or any other methodology known by those skilled in the art.
  • compositions may be added to the composition provided they do not substantially interfere with the intended activity and efficacy of the composition; whether or not a compound interferes with activity and/or efficacy can be determined, for example, by the procedures utilized below.
  • composition may or may not contain a known immunomodulating agent and that this description includes
  • compositions that contain and do not contain a known immunomodulating agent are compositions that contain and do not contain a known immunomodulating agent.
  • the phrase “optionally adding a known immunomodulating agent” means that the method may or may not involve adding a known immunomodulating agent and that this description includes methods that involve and do not involve adding a known immunomodulating agent
  • an effective amount of a compound or property as provided herein is meant such amount as is capable of performing the function of the compound or property for which an effective amount is expressed.
  • the exact amount required will vary from process to process, depending on recognized variables such as the compounds employed and the processing conditions observed. Thus, it is not possible to specify an exact "effective amount.” However, an appropriate effective amount may be determined by one of ordinary skill in the art using only routine experimentation.
  • the virus utilized is an adenovirus that comprises an adenoviral vector (e.g., Ad5 Blue) encoding an exogenous gene construct.
  • an adenoviral vector e.g., Ad5 Blue
  • the exogenous gene construct encodes a protein that interferes with FMDV.
  • a gene construct e.g., interferon
  • a promoter e.g., human Cytomegalovirus promoter
  • another promoter porcine EFla promoter
  • an adenovirus can be a replication-incompetent adenovirus.
  • host cells capable of complementing replication can be utilized, such as HEK 293 cells and other appropriate cells known in the art.
  • host cells may be harvested and lysed ex situ using a hypotonic solution, hypertonic solution, freeze-thaw, sonication, impinging jet, microfluidization or a detergent.
  • the cells are harvested and lysed in situ using a hypotonic solution, hypertonic solution, or a detergent (e.g., Tween-20®, Brij-58®, Triton X®- 100 or octyl glucoside).
  • a detergent e.g., Tween-20®, Brij-58®, Triton X®- 100 or octyl glucoside.
  • Cells can also be lysed through autolysis of infected cells.
  • Virus collection from tissue culture can utilize any methodology known in the art.
  • the term“/V? situ” refers to the cells being located within a tissue culture apparatus and“ex situ” refers to the cells being removed from the tissue culture apparatus.
  • Modified viruses described herein can be administered to a target animal (e.g., swine) by intramuscular, subcutaneous, or intranasal inoculation, or injection in an amount which is effective to protect the animal against challenge by a virulent strain of viruses such as FMDV, or induce the production of a protective amount of interferon.
  • This amount may vary according to the animal being inoculated, taking into consideration the size and weight of the animal.
  • the viruses according to the invention comprise an effective dosage of the interferon-expressing genomes to induce a significantly higher level of protection in a recipient animal population against mortality and clinical symptoms of FMDV compared to untreated animals.
  • the recombinant viruses according to the invention prevents a proportion of animals vaccinated against FMDV from developing symptoms prior to the onset of protective immunity.
  • the viruses are administered in a dose of 10 9 -10 10 PFU, but other doses can be utilized. Effective amounts may be experimentally determined as necessary by those of skill in the art by following the guidance provided herein, or by any methodology known in the art.
  • the LFBK-anb ⁇ cells were cultured in Dulbecco’s Modified Eagle medium (DMEM, GIBCO, Grand Island, NY) containing high glucose, 10% fetal bovine serum (FBS) (HyClone, Logan, UT), and supplemented with 1% Antibiotics-Antimycotic 100X (GIBCO) and 1%
  • DMEM Modified Eagle medium
  • FBS fetal bovine serum
  • GIBCO Antibiotics-Antimycotic 100X
  • IBRS-2 and HEK 293 cells were grown in Minimum Essential Medium (MEM, GIBCO) with 10% FBS, 1% L-Glutamine, 1% Antibiotics, and Non- Essential Amino Acids 100X (GIBCO). All cell culture media and reagents were purchased from Life Technologies (Carlsbad, CA) unless specified otherwise. FMDV type A24 Cruzeiro strain was produced in baby hamster kidney (BHK) cells and used in this study.
  • Interferon protein Expression Full-length coding sequences of 19 porcine IFNa and 5 IFNP genes were identified from the pig genome sequences released in Aug. 2011 (SGSC Sscrofal0.2/susScr3 Assembly) using the UCSC Genome Browser. Additionally, 13 IFNa coding sequences of miniature pigs were retrieved from the genomic sequences deposited in NCBI GenBank from Accession #: PRJNA176189, AJKK01153980, AJKK01221111, AJKK01220487, AJKK01240321, AJKK01266018, AJKK01153977, and AJKK01148380.
  • the expressed IFN proteins were detected with Western blotting using a rabbit anti- porcine IFN-a antibody and the WestemDot 625 Goat Anti-Rabbit Western Blot Kit (ThermoFisher Scientific). The imaging was performed using a GelDoc imager (BioRad).
  • MTT-CPER assay The anti-FMDV activity of the harvested cell culture supernatants was measured with an MTT-CPE reduction (MTT-CPER) assay we developed (Ramanathan et ah, 2015). Briefly, IBRS-2 and/or LFBK-anb ⁇ cells were plated in 96-well flat- bottomed tissue culture plates to 100% confluency after overnight incubation. Then the cells were treated with two-fold serially diluted cell culture supernatants harvested from the cells transfected with plasmid DNA or infected with Ad5 recombinant viruses.
  • MTT-CPER MTT-CPE reduction
  • MTT 3-(4, 5-dimethylthiazolyl-2-yl)-2, 5-diphenyltetrazolium bromide substrate (ATCC, Manassas, VA) was added to each well and the plates were stored in the dark for 3 hours. Then a detergent reagent provided by ATCC was added to each well for another 3 hours incubation at room temperature before spectrometry.
  • the absorbance or optical density (OD) readings in each well was measured using an ELx808 Absorbance Microplate Reader at 570 nm with the reference filter set at 650 nm (BioTek, Winooski, VT). The blank values were subtracted from the absorbance values. There were three technical replicates per sample in the assays. The OD readings were used as the indicator of anti-FMDV activity (cells protected by IFN against FMDV infection).
  • EC50 concentration used as the indicator of anti-FMDV activity were calculated using the software based on the fold dilutions of the supernatants and the OD readings of the culture wells.
  • IFN gene GQ415066/IFN19 was used as a reference in all DNA transfections and antiviral assays for comparison among the genes.
  • the gene with the highest anti-FMDV activity was given an arbitrary index number of 1 as an anti-FMDV activity.
  • the EC50 of other genes was divided by the gene with the highest activity to normalize the antiviral activity. Differences in anti-FMDV activity between the Ad5 viruses created in this study and the Ad5 viruses tested previously were calculated by taking both MOI and EC50 into account.
  • NM_001172040 was cloned into pcDNA3.l -vector (Life Technologies) between the Nhel and Notl restriction sites and named as pcDNA3. l-IFNa.
  • an adenovirus tripartite sequence was placed in the 5’ ends of the IFNa coding sequence and inserted into pcDNA3.l plasmid between Nhel and Notl restriction sites. All plasmids were purified with Qiagen plasmid miniprep kits (Qiagen, Germantown, MD). The plasmid inserted with the IFNa coding sequence only was used as the control.
  • NM_001204768 was inserted into the pcDNA3.l plasmid between Nhel and Notl restriction sites.
  • the plasmid containing a SOCS1 gene was used to co-transfect LFBK-anb ⁇ cells with a pcDNA3.l plasmid inserted with the interferon a gene at 1:1 and 1:3 (pcDN A3. l-IFNa vs pcDNA3.l-SOCSl) of DNA using the transfection procedure described earlier.
  • Transcription activity of EFla Promoters To insert two genes into the Ad5- blue vector, we designed and constructed two promoters containing Mfel and Nhel site sequences in 5’ and 3’ end, respectively, using the sequences of bovine and porcine EFla genes. These promoter sequences start from -350 bp upstream of the transcription start sites to the start codon of EFla coding sequences. A sequence fragment located within the first intron (579 bp for bovine promoter and 338 bp for the porcine promoter that are less homologous among species) was deleted to reduce the length of the promoters to 760 bp, which are very close to the length of CVM promoter.
  • the pcDNA3.l plasmid inserted with the interferon a gene between Nhel and Notl sites was digested with Mfel and Nhel restriction enzymes (New England Biolabs, Ipswich, MA) and ligated with Mfel and Nhel restriction enzyme digested bovine and/or porcine promoter DNA fragments, which replaced the hCMV promoter of the pcDNA3.l plasmid vector (pcDNA3.l_hCMV-IFNa).
  • pcDNA3.l_hCMV-IFNa The two plasmids containing bovine and porcine promoters were named as pcDNA3. l_bEFla-IFNa and pcDNA3. l_sEFlaTFNa, respectively.
  • These three plasmid DNA samples were used to transfect HEK293 and LFBK-anb ⁇ cells to measure anti- FMDV activity induced in the culture supernatants as described earlier.
  • pEFla_2 with mutated 2nd TATA box (from TTTAAAG to TATAAAT) and (2) pEFla_3 with additional 70 nucleotide deletion in the first intron of pEFla_2 as shown in FIG. 1.
  • These promoters were cloned into pcDNA3.l plasmid for DNA transfection and the test of the induced antiviral activity as described earlier.
  • Codon frequency can affect the translation efficiency of mRNA. Transcription activity of CMV and pEFla promoter is different in different cells. Differences in the expression levels between IFN19 and SOCS1 may affect the magnitude of antiviral activity induced from the cells transfected with these genes.
  • codon frequency and gene locations we synthesized three DNA fragments containing (1) NCS-IFN19 + polyA termination sequence + porcine EFla promoter + SOCS1 as shown in FIG. 2, (2) the fragment 1 with codon-optimized IFN19 and SOCS1 provided by Genescript, and (3) the fragment 1 with location swap between SOCS1 and NCS-IFN19. These three fragments were inserted into pcDNA3.l vector to test effects of codon optimization and gene swap on anti-FMDV activity induced from DNA transfected cells as described earlier.
  • Ad5 Blue plasmid vector (Moraes, M.P., et ah, Biotechniques, 31: 1050 (Nov. 2001) was used to produce recombinant adenoviruses expressing the genes of interest.
  • a porcine IFNa gene previously tested in pigs (Chinsangaram et al., 2003) and the IFN with the highest anti-FMDV activity identified in our study (IFN19) were cloned into the vector between Clal and Xbal restriction sites.
  • the plasmids with the correct inserts were purified with Qiagen plasmid miniprep kits (Qiagen) and used to transfect HEK293 cells with Lipofectamine in Opti-MEM after linearization with Pad restriction enzyme (New England Biolabs, Ipswich, MA).
  • Qiagen Qiagen plasmid miniprep kits
  • the recombinant viruses were isolated from the plaques, propagated in HEK293 cells, and purified with CsCl gradient centrifugation. These two recombinant adenoviruses were named as Ad5_IFNa (previously tested) and Ad5-IFNl9 (Ad5 with the best IFN gene).
  • a poly-A termination sequence, the promoter of porcine EFla gene, and the coding sequence of porcine SOCS1 were inserted at the 3’-end of the coding sequence of the best IFN gene (FIG. 15).
  • This DNA fragment was inserted into the Ad5-blue vector to produce the recombinant adenovirus as described earlier.
  • the recombinant virus produced from the plasmid was named as Ad5-IFNl9+SOCSl or Ad5-IFNl9+.
  • Adenovirus titration Titers of recombinant adenoviruses were determined based on tissue culture infectious dose (TCID50) using HEK293 cell monolayer in 96 well plates according to Moraes et al. (Moraes, M.P., et al., Vaccine, 20(11-12): 1631-1639 (2002)). Briefly, the cells were plated at a density of lxlO 4 cells per well, incubated at 37°C with 5% C0 2 for 3 days or 95-100% confluency.
  • Antiviral activity induced by adenoviruses To measure the anti-FMDV activity of the recombinant adenoviruses, LFBK-anb ⁇ cells cultured in 24-well plates were infected at different MOIs of recombinant adenoviruses (2-fold serial dilution with the serum-free medium) for 1 hour. After the infection, the viruses were removed and the wells were washed three times with medium. Fresh growth medium was added to each well and cell culture supernatants were collected at different time points after the infection and filtered using Centricon® 30 filters (Millipore, Billerica, MA). The anti-FMDV activity of the supernatants was measured with the MTT-CPER assay as described earlier.
  • Animal testing Commercial pigs (body weight at 50-60 FB) were injected subcutaneously with one of three recombinant adenoviruses (the existing adenovirus: Ad5-IFNa and Ad5IFNl9+) at 10 10 (FMD protective dose) and/or 10 9 plaque forming unit (PFU) per pig. There were four pigs per treatment group including a control group injected with PBS only. The available amount of Ad5-IFNl9+ was enough only for three pigs at 10 9 PFU per animal. Blood samples (5 ml) were collected at one day before injection and at days 1, 2, 3, 4, 5, 6 and 7 post injection.
  • Ad5-IFNa and Ad5IFNl9+ the existing adenovirus
  • PFU plaque forming unit
  • Sera were prepared from the blood samples for measuring anti-FMDV activity using MTT-CPER assay as described earlier. 2-fold serial dilutions of serum samples (2 to 2 ) were used in the assay. Three replications per sample were conducted in the MTT-CPER assay. The animal use protocol was reviewed and approved by Animal Use Review Committees at the University of Kansas and the in-vivo experiment was conducted in the animal facility located at the College of Veterinary Medicine, University of Kansas. The serum samples were shipped to Plum Island Animal Disease Center on dry ice for MTT-CPER assays.
  • FIG. 1 shows very similar intensity of the protein bands on the Western blot for the supernatants harvested from the transfections of equal amount of DNA plasmids inserted with different IFNa genes. The results indicated that the transient IFN expression is a reliable approach to produce IFN proteins for comparing the antiviral activity of the IFN genes.
  • the supernatants from the DNA transfections of one IFN gene (AJKK01221111) from the miniature pig and three (GQ415061, NM_00l 164860, and XM_003121882) from the commercial pigs surprisingly could not fully protect the cells against FMDV infection at the 16-fold dilutions (the highest tested concentration of the supernatants in this study).
  • the differences in anti-FMDV activity between the best IFNa gene and others tested ranged from approximately 2- to more than 1, 000-fold.
  • Ad5-IFNl9 A recombinant Ad5 virus containing GQ415066 or IFN19 gene (Ad5-IFNl9) was produced and validated by DNA sequencing.
  • Ad5 viruses were titrated twice and used to infect LFBK-anb ⁇ cells at different MOI (six 2-fold serial dilutions starting at MOI of 46).
  • the anti-FMDV activities of the supernatants from Ad5-IFNa and Ad5-IFNl9 infections decreased linearly with the dilution factors (data not shown). No CPE was observed in the cells infected with these two viruses at the MOI tested.
  • the EC50 values for the Ad5-IFNl9 virus surprisingly were approximately four-fold higher than those of Ad5-IFNa (only two MOI shown in FIG. 6), which suggested that the anti-FMDV activity of the recombinant adenovirus containing the best porcine IFN gene was surprisingly about four time higher than that of the adenovirus previously tested.
  • Adenovirus-based IFN bio therapeutics is very effective in completely protecting pigs against FMDV infection (Chinsangaram et al., 2003; Dias et al., 2011; Moraes et al., 2003); however, this approach requires a protective dose approximately 100 times higher than adenovirus-based vaccines. Reducing the protective dose is critical for making the bio therapeutics feasible.
  • One objective of this study was to identify the most potent IFN genes for use in the biotherapeutics. To identify the best IFN gene, we applied an approach similar to the method used by Zanotti et al.
  • porcine type I interferons have been tested against PRRSV and VSV infection in different cell lines (Sang et al., 2010; Zanotti et al., 2015). There were substantial differences among the genes tested.
  • porcine IFNa6 GQ415060
  • IFNal2 GQ415066 or IFN 19 in our study
  • IFNa6 was the interferon with the highest anti-VSV activity and IFNal2 was the second best; however, it is unknown if the coding sequence of the IFNal2 is identical to GQ415066.
  • IFN 19 has also been demonstrated to be the most potent interferon against CSFV (classical swine fever virus) in swine macrophages (Femandez-Sainz, L, et al., Virology, 483: 284-290 (2015)). Our results indicated that IFN 19 or IFNal2 was the best anti-FMDV interferon.
  • IFNp genes decreased surprisingly more rapidly than that by IFNa genes. It has been reported that IFNP displays a higher anti-proliferation activity in some cell types (Rosenblum, M.G., et al., J. Interferon Res., 10: 141-151 (1990)), and tyk2-deficient cells retain partial responsiveness to IFN-b but are completely unresponsive to IFN-as (John, J., et al., Mol. Cell Biol., 11: 4189-4195 (1991)), which, without being bound by theory, may explain the rapid decrease in its antiviral activity after treatment.
  • porcine IFNp may not be a good candidate for antiviral bio therapeutics due to its lower and short lasting antiviral effect compared to IFNa.
  • porcine IFNp may not be a good candidate for antiviral bio therapeutics due to its lower and short lasting antiviral effect compared to IFNa.
  • Example 2 Effect of non-coding sequence (NCS) on IFN production: FIG.
  • FIG. 7A, FIG. 7B, and FIG. 7C show that the transfection of the plasmid inserted with IFNa containing the adenovirus tripartite NCS surprisingly induced higher (approximately 2 fold) antiviral activity than that of plasmid inserted with IFNa without the NCS in the supernatants harvested at days 2, 4 and 6 post transfection.
  • surprisingly there were no differences between the supernatants from transfections with plasmids inserted with IFNa containing 3’ end NCS of ACTA data not shown).
  • NCS- IFNa and IFNa two recombinant adenoviruses were produced from the Ad5 virus inserted with the IFNa genes with and without the NCS.
  • NCS-IFNa surprisingly induced approximately 2-fold higher antiviral activity than Ad5-IFNa did in the supernatants harvested at days 2, 4 and 6 from the cells infected at MOI of 20 (only day 6 shown in FIG. 7D). Therefore, both in-vitro tests using plasmids and adenoviruses showed that the adenovirus tripartite NCS surprisingly enhanced the expression of the recombinant IFN from the Ad5 virus.
  • porcine EFla promoter was higher than the hCMV promoter in porcine cells.
  • Mutation of second TATA box slightly increased (less than 2-fold) the induced anti-FMDV activity of the supernatants from cell culture transfected with the plasmid DNA at day 1 post DNA transfection, while the deletion of additional 70 nucleotide did not have the effect on the activity (FIG. 11). The differences became much smaller at day 2 post transfection. Without being bound by theory, these results suggested that changing the second TATA box like sequence to the censuses sequence increased the transcription activity of the promoter and the intron might have little effect on transcription.
  • FIG. 12 shows that transfection of plasmid DNA containing codon-optimized IFN19 and SOCS1 open reading frames surprisingly induced higher the anti-FMDV activity by approximately 2-fold than that of non-optimized sequences.
  • the differences between optimized and non-optimized sequence were greater at day 2 than those at day 1, while the differences remain the same at day 3 post transfection.
  • FIG. 13 showed that there was an effect of promoter and gene pairing on the antiviral activity induced with DNA transfection. Plasmids constructed using pCMV-NCS-IFNl9 and pEFla-SOCSl produced higher antiviral activity by more than 2-fold that those with pCMV-SOCSl and pEFla-NCS- IFN19 at days 1, 2 and 3 post-transfection (only day 2 and 3 shown in FIG. 12). Together with other results presented earlier, these results suggested that the expression level of SOCS1 surprisingly plays a more important role in inducing anti-FMDV activity than that of IFN19.
  • Ad5-IFNl9+ A recombinant adenovirus inserted with IFN19 containing the adenovirus tripartite NCS (NCS- IFN19) and the SOCS1 gene with porcine EFla promoter (EFla-SOCSl) was produced and named as Ad5-IFNl9+ (FIG. 17).
  • Ad5-IFNl9+ A recombinant adenovirus inserted with IFN19 containing the adenovirus tripartite NCS (NCS- IFN19) and the SOCS1 gene with porcine EFla promoter (EFla-SOCSl) was produced and named as Ad5-IFNl9+ (FIG. 17).
  • Ad5-IFNl9+ To compare Ad5-IFNl9+ with Ad5-IFNa, we infected LFBK- anb ⁇ cells with the viruses at MOI of 46. Unlike Ad5-IFNa and Ad5-IFNl9 infections, Ad5- IFN19+ infection
  • FIG. 4 shows the antiviral activities induced by Ad5-IFNl9+ infection at days 1, and 2 post-infection surprisingly was approximately 16 times (24 fold) higher than those by Ad5-IFNa infection, whereas the differences at day 3 post infection were much smaller ( ⁇ 4 time), presumably, without being bound by theory, due to CPE.
  • Ad5-IFNl9+ virus infection surprisingly produced approximately 16-30-fold higher antiviral activity in day 1 post-infection than Ad5-IFNa.
  • the differences in anti-FMDV activity decreased when MOI was greater than 10.
  • the differences in antiviral activity among infection doses suggested that the effect of SOCS1 and the cytotoxicity were correlated with induced anti-FMDV activity.
  • Anti-FMDV activity induced by Ad5-IFNa displayed a positive dose effect equivalent to the difference between the doses.
  • the antiviral activity at day 1 post injection was the highest and then decreased by at least two-fold each day (FIG. 6).
  • the anti- viral activity fell below the full protection level at day 4 post injection with 10 9 PFU (FIG. 6E) and at day 6 with 10 10 PFU (FIG. 6G).
  • Adenovirus-based IFN bio therapeutics are very effective in completely protecting pigs against FMDV infection (Chinsangaram et al. 2003; Dias et al. 2011; Moraes et al. 2003); however, this approach requires a protective dose approximately 100 times higher than adenovirus-based vaccines. Reducing the protective dose is critical for making the bio therapeutics feasible.
  • NCS Non-coding sequences
  • ACTA1 Non-coding sequences
  • the second approach was to reduce the negative impacts of intrinsic effects of the expressed recombinant protein IFN.
  • a porcine EF1 a promoter that showed a higher transcription activity than the human CMV promoter in the porcine cells.
  • SOCS1 another gene
  • This recombinant adenovirus surprisingly induced an in-vitro anti-FMDV activity up to l70-fold higher than the existing Ad5-IFNa virus.
  • a recombinant adenovirus genome comprising (or consisting essentially of or consisting of) a heterologous nucleic acid inserted into a cloning site of said genome, said heterologous nucleic acid comprising (or consisting essentially of or consisting of):
  • a first nucleic acid sequence comprising (or consisting essentially of or consisting of) an adenovirus tripartite sequence operably linked to a second nucleic acid sequence encoding an interferon;
  • a third nucleic acid sequence comprising (or consisting essentially of or consisting of) a bovine growth hormone polyA termination sequence operably linked to said second nucleic acid sequence;
  • a fourth nucleic acid sequence comprising (or consisting essentially of or consisting of) a porcine elongation factor 1 -alpha (EFla) promoter;
  • a fifth nucleic acid sequence operably linked to said fourth nucleic acid sequence, said fifth nucleic acid sequence encoding a suppressor of cytokine signaling 1 (SOCS1) protein.
  • heterologous nucleic acid comprises SEQ ID NO:6.
  • the above adenovirus genome wherein said adenovirus genome further comprises vector sequences, said vector sequences allowing for replication of an adenovirus in a host cell.
  • the adenovirus genome, wherein said host cell is a bacterial cell.
  • the adenovirus genome, wherein said bacterial cell is an E. coli cell.
  • a host cell comprising (or consisting essentially of or consisting of) the above adenovirus genome.
  • a recombinant virus produced by the above recombinant adenovirus genome [0111] A recombinant virus produced by the above recombinant adenovirus genome.
  • a method of producing interferon in an animal comprising (or consisting essentially of or consisting of) introducing into said animal (e.g., swine) an effective amount of the above recombinant virus.
  • the method wherein said introducing is by intramuscular, subcutaneous, oral or intranasal inoculation.
  • the method comprising introducing into said animal an effective amount of the virus and a veterinary or pharmaceutically acceptable carrier.
  • a method of producing interferon in tissue culture comprising (or consisting essentially of or consisting of) growing a cell comprising the above adenovirus genome under in vitro conditions allowing for the production of interferon, thereby producing interferon.
  • the method wherein the cell is a bacterial cell.
  • An immunomodulatory composition comprising (or consisting essentially of or consisting of) the above recombinant virus and a veterinary or pharmaceutically acceptable carrier.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Environmental Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Virology (AREA)
  • Endocrinology (AREA)
  • Cell Biology (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Animal Husbandry (AREA)
  • Mycology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Public Health (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

Disclosed herein is a recombinant adenovirus genome, said adenovirus genome comprising a heterologous nucleic acid inserted into a cloning site of said genome, said heterologous nucleic acid comprising: (a) a first nucleic acid sequence comprising an adenovirus tripartite sequence (e.g., SEQ ID NO:1) operably linked to a second nucleic acid sequence encoding an interferon (e.g., SEQ ID NO:2); (b) a third nucleic acid sequence comprising a bovine growth hormone polyA termination sequence operably linked to said second nucleic acid sequence (e.g., SEQ ID NO:3); (c) a fourth nucleic acid sequence comprising a porcine elongation factor 1-alpha (EF1α) promoter (e.g., SEQ ID NO:4); (d) a fifth nucleic acid sequence operably linked to said fourth nucleic acid sequence, said fifth nucleic acid sequence encoding a suppressor of cytokine signaling 1 (SOCS1) protein (e.g., SEQ ID NO:5). Furthermore, there is disclosed a method of producing interferon in an animal (e.g., swine).

Description

Recombinant Adenovirus-Based Interferon Biotherapeutics in Swine
Reference to Related Application
[0001] This application claims the benefit of U.S. Provisional Application No.
62/737,438, filed 27 September 2018, which is incorporated herein by reference in its entirety.
Government License Rights
[0002] This invention was made with funds provided by National Pork Board (Project #: 14-014) and government support under contract number HSHQDC-11-X-00189 awarded by U.S. Department of Homeland Security. The government has certain rights in the invention.
Background Of The Invention
[0003] Foot-and-mouth disease virus (FMDV) is a positive-sense, single- stranded RNA virus belonging to the Aphthovirus genus of the Picomaviridae family and causes an acute vesicular disease in cloven-hoofed animals including cattle, swine, goats, and sheep. It is one of the most contagious animal viruses and could have a devastating economic effect on livestock industries if outbreaks occurred, especially in FMD-free countries. There are commercial FMD vaccines available, however it takes approximately a week for the vaccine to induce protective immunity. Development of a countermeasure with a rapid onset of immunity would greatly facilitate the control of this disease.
[0004] FMDV has been known to be very sensitive to the inhibition of type I interferons (IFN) (Chinsangaram, J., et ah, J. Virol., 73: 9891-9898 (1999); Sellers, R.F., Nature. 198, 1228-1229 (1963)). Because of their rapid and potent antiviral effects, type I IFN genes have been used to induce rapid onset of immune protection against FMDV in swine. Pigs can be completely protected against FMDV challenge 24 h after injection with a replication-defective human adenovirus 5 (Ad5) inserted with an IFNa gene (Chinsangaram, J., et ah, J. Virol., 77: 1621-1625 (2003); Dias, C.C.A., et ah, Journal of Interferon & Cytokine Research, 31: 227-236 (2011); Moraes, M.P., et al., Vaccine, 22: 268-279 (2003)). However, this biotherapeutic required a protecting dose approximately 100 times higher than Ad5-based FMDV vaccines (Dias et al., 2011; Pena, L., et al., Vaccine, 26: 5689-5699 (2008)) and the protective activity lasted less than a week. These disadvantages limit its field application. Thus there is a need for a feasible biotherapeutic s that can induce rapid and long lasting protection against FMDV which can significantly facilitate the control of the disease during outbreaks.
[0005] The type I IFN gene family consists of several subtypes in all mammalian species, and some subtypes contain multiple genes (Roberts, R.M., et al., Interferon Cytokine Res., 18: 805-816 (1998). The antiviral activities of the genes differ a great deal (Moll, H.P., et al., Cytokine, 53: 52-59 (2011)). In pigs, seven subtypes (a, aw, b, d, e, k, and w) have been reported (Sang, Y., et al., Physiol., 42: 248-258 (2010)), and the antiviral activities against Porcine reproductive and respiratory syndrome virus (PRRSV) and Vesicular stomatitis virus (VSV) infection differ significantly among genes and in different cell lines (Sang et al., 2010; Zanotti, C., et al., J. Interferon Cytokine Res., 35: 990-1002 (2015)). There are substantial polymorphisms in the genes among individuals, which account for significant differences in antiviral activity among the genes (Sang, Y., et al., BMC, 5: S8 (2011)). These results indicate that it is important in terms of biotherapeutic potency to screen a large number of genes and to test in multiple cell lines in order to identify genes with the highest virus-specific antiviral activity.
[0006] We previously developed a (3-(4, 5-dimethylthiazolyl-2-yl)-2, 5- diphenyltetrazolium bromide) colorimetric cytopathic effect reduction assay (MTT-CPER assay) to measure anti-FMDV activity (Ramanathan, P., et al., Veterinary Immunology and
Immunopathology, 164: 74-78 (2015)). This MTT-CPER assay is more cost-effective, has higher throughput, is less labor intensive, and is more sensitive than the plaque reduction assay. FMDV-susceptible porcine cell lines are used in the assay to measure anti-FMDV specific activity. We used this assay to compare the antiviral activities of porcine IFN expressed in-vitro to identify the best IFN gene, to test the effect of Suppressor Of Cytokine Signaling 1 (SOCS1) gene on IFN expression in order to improve the existing IFN biotherapeutics, and to measure anti-FMDV activity in pigs after treatments . After testing the effect of various techniques on IFN production, we applied the promising ones to produce a new recombinant adenovirus for testing in pigs.
Summary Of The Invention
[0007] Disclosed herein is a recombinant adenovirus genome, said adenovirus genome comprising a heterologous nucleic acid inserted into a cloning site of said genome, said heterologous nucleic acid comprising:
a. a first nucleic acid sequence comprising an adenovirus tripartite sequence (e.g., SEQ ID NO:l) operably linked to a second nucleic acid sequence encoding an interferon (e.g., SEQ ID NO:2);
b. a third nucleic acid sequence comprising a bovine growth hormone polyA termination sequence operably linked to said second nucleic acid sequence (e.g., SEQ ID NO:3);
c. a fourth nucleic acid sequence comprising a porcine elongation factor 1 -alpha (EFla) promoter (e.g., SEQ ID NO:4);
d. a fifth nucleic acid sequence operably linked to said fourth nucleic acid sequence, said fifth nucleic acid sequence encoding a suppressor of cytokine signaling 1 (SOCS1) protein (e.g., SEQ ID NO:5).
[0008] Also disclosed is a host cell comprising the adenovirus genome.
[0009] In addition, there is disclosed a recombinant virus produced by the recombinant adenovirus genome.
[0010] Furthermore, there is disclosed a method of producing interferon in an animal (e.g., swine) comprising, introducing into said animal an effective amount of the recombinant virus. [0011] Also disclosed is a method of producing interferon in tissue culture comprising, growing a cell comprising the adenovirus genome under in vitro conditions allowing for the production of interferon, thereby producing interferon.
[0012] In addition, there is disclosed an immunomodulatory composition comprising the recombinant virus and a veterinary or pharmaceutically acceptable carrier.
[0013] This summary is provided to introduce a selection of concepts in a simplified form that are further described below in the detailed description. This summary is not intended to identify key features or essential features of the claimed subject matter, nor is it intended as an aid in determining the scope of the claimed subject matter.
Brief Description Of The Drawings
[0014] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
[0015] Exemplary FIG. 1 shows western blotting of supernatants from cultured LFBK- anbό transfected with pcDNA3.l plasmids inserted with porcine interferon a genes or plasmid vector only (Fane 1-7 and 10-12: IFNa; Fane 8: Protein molecular weight markers, Fane 9:
plasmid vector) as described below.
[0016] Exemplary FIG. 2A and FIG. 2B show the optical density (OD) readings of MTT-based CPER assays using IBRS-2 and supernatants harvested from FFBK-anbό cells transfected with plasmid DNA inserted with porcine IRNb or the best porcine IFNa coding sequences; at Days 2 (FIG.2A) and 4 (FIG. 2B) post transfection as described below.
[0017] Exemplary FIG. 3 shows the OD readings of MTT-based CPER assays using FFBK-anbό and supernatants harvested from FFBK-anbό cells infected with two different MOI (multiplicity of infection) of recombinant adenoviruses inserted with the best (Ad5-IFNl9) or previously tested interferon (Ad5-IFNa) coding sequences at Day 1 post infection as described below. [0018] Exemplary FIG. 4A and FIG. 4B show the OD readings of MTT -based CPER assays using IBRS-2 cells and supernatants harvested from FFBK-avP6cells transfected with plasmid DNA inserted with porcine IFNa coding sequences; at Days 2 (FIG. 4A) and 4 (FIG. 4B) post DNA transfection as described below.
[0019] Exemplary FIG. 5 A and FIG. 5B show the OD readings of MTT -based CPER assays using IBRS-2 and supernatants harvested from FFBK-anbό cells transfected with plasmid DNA inserted with the best porcine interferon or miniature pig IFNa coding sequences; at Days 2 (FIG. 5A) and 4 (FIG. 5B) as described below.
[0020] Exemplary FIG. 6 shows the OD readings of MTT-based CPER assays using FFBK-anbό from supernatants harvested from ERBK-anbό cells infected with different MOI of recombinant adenoviruses Ad5-IFNa post infection as described below.
[0021] Exemplary FIG. 7 A, FIG. 7B, FIG. 7C, and FIG. 7D show the OD readings of MTT-based CPER assays using FFBK-anbό and supernatants harvested from FFBK-anbό cells co-transfected with plasmid DNA containing an IFNa gene with or without an adenovirus tripartite non-coding sequence (NCS) in the 5’-end of the interferon coding sequence; at days 2 (FIG. 7A), 4 (FIG. 7B) and 6 (FIG. 7C) post-transfection and using supernatants from the cells infected with adenoviruses containing an IFNa gene with or without the NCS at day 6 post infection (FIG. 7D) as described below.
[0022] Exemplary FIG. 8 A, FIG. 8B, FIG. 8C, FIG. 8D, FIG. 8E, and FIG. 8F show the OD readings of MTT-based CPER assay using FFBK-anbό and supernatants harvested from FFBK-anbό cells co-transfected with different ratios of plasmid DNA inserted with IFNa and SOCS1 or vector only; at days 2 (FIG. 8A, FIG. 8B), 4 (FIG. 8C, FIG. 8D) and 6 (FIG. 8E, FIG. 8F) post-transfection as described below.
[0023] Exemplary FIG. 9A and FIG. 9B show the OD readings of MTT-based CPER assay using FFBK-anbό and supernatants harvested from HEK293 (Fig. 9A) and FFBK-anbό (FIG. 9B) cells transfected with plasmid DNA containing an IFNa gene inserted at 3’ end of CMV or EF1 a promoters at day 1 post-transfection as described below. [0024] Exemplary FIG. 10 shows the squences of three pocine EFla promoters as described below.
[0025] Exemplary FIG. 11A and FIG. 11B show the OD readings of MTT -based CPER assay using FFBK-anbό and supernatants harvested from FFBK-anbό cells transfected with plasmid DNA containing three different porcine EFla promoters inserted at 5’ end of IFN19 coding sequence; at days 1 (FIG. 11 A) and 2 (FIG. 11B) post-transfection as described below.
[0026] Exemplary FIG. 12A, FIG. 12B, and FIG. 12C show the OD readings of MTT - based CPER assay using FFBK-anbό and supernatants harvested from FFBK-anbό cells transfected with plasmid DNA containing an NCS-IFN19 + polyA termination sequence + porcine EFla promoter + SOCS1 or codon-optimized SOCS1 + polyA termination sequence + porcine EFla promoter + optimized NCS-IFN19 at day 2 post-transfection; at days 1 (FIG. 12A), 2 (FIG. 12B) and 3 (FIG. 12C) post transfection as described below.
[0027] Exemplary FIG. 13 A and FIG. 13B show the OD readings of MTT -based CPER assay using FFBK-anbό and supernatants harvested from FFBK-anbό cells transfected with plasmid DNA containing an NCS-IFN19 + polyA termination sequence + porcine EFla promoter + SOCS1 or SOCS1 + polyA termination sequence + porcine EFla promoter + NCS- IFN19; at days 2 (FIG. 13A) and 3 (FIG. 13B) post-transfection as described below.
[0028] Exemplary FIG. 14 shows the OD readings of MTT-CPER assays using IBRS-2 and supernatants harvested from FFBK-anbό cells infected with 46 MOI of Ad5-IFNl9+ or Ad5- IFNa virus at Days (D) 1, 2 and 3 post infection as described below.
[0029] Exemplary FIG. 15 shows the differences in anti-FMDV activities between Ad5-IFNl9+ and Ad5-IFNa at days 1, 2-3 and 4 post infection of different MOI as described below.
[0030] Exemplary FIG. 16A, FIG. 16B, FIG. 16C, FIG. 16D, FIG. 16E, FIG. 16F, Fig. 16G, and FIG. 16H show anti-FMDV activities (OD readings) in sera of pig treated with Ad5- IFNa (dash lines) and Ad5-IFNl9+ (solid line) at a dose of 109 PFU (triangle) or 1010 PFU (circle) one day before treatment (FIG. 16A) and days 1, 2, 3, 4, 5, 6, and 7 post-treatment ( FIG. 16B, FIG. 16C, FIG. 16D, FIG. 16E, FIG. 16F, Fig. 16G, and FIG. 16H, respectively) as described below.
[0031] Exemplary FIG. 17 shows the structure of the Ad5-blue plasmid used to produce Ad5-IFNl9+ recombinant adenovirus where hCMV (human cytomegalovirus promoter), Ad-NCS (adenovirus tripartite non-coding sequence), IFN19 (the porcine IFNa coding sequence of GQ415066), pA-SS (the poly-A signal sequence of bovine growth hormone), EFla-promoter (the promoter of porcine EFla gene), and SOCS1 (the porcine SOCS1 coding sequence) were concatenated and inserted between Clal and Xba restriction sites of the Ad5-blue vector.
Brief Description Of The Sequences
[0032] SEQ ID NO. 1:
ACTCTCTTCGCATCGCTGTCTGCGAGGGCGAGCTGTTGGGCTCGCGGTTGA GGACAAACTCTTCGCGGTCTTTCCAGTACTCTTGGATCGGAAACCCGTCGG CCTCCGAACGGTACTCCGCCACCGAGGGACCTGAGCGGTCCGCATCGACCG GATCGGAAAACCTCTCGAGAAAGGCGTCTAACCAGTCACAGTCGCAAG is adenovirus Ad5 tripartite sequence (Zhang Y., et al., J. Biol. Chem., 264(18): 10679-84 (1989)).
[0033] SEQ ID NO. 2:
ATGGCTCCCACCTCCGCCTTCCTGACCGTGCTGGTGCTGCTGAGCTGCAAC
GCCATCTGCTGCCTGGGATGCGACCTGCCACAGACCCACTCCCTGGCTCAC
ACCAGGGCCCTGAGACTGCTGGCTCAGATGAGGAGGATCTCCCCCTTCAGC
TGCCTGGACCACAGGAGAGACTTCGGCAGCCCACACGAGGCCTTCGGCGGA
AACCAGGTGCAGAAGGCTCAGGCTATGGCCCTGGTGCACGAGATGCTGCAG
CAGACCTTCCAGCTGTTCTCCACCGAGGGCAGCGCCGCCGCCTGGGACGAG
TCCCTGCTGCACCAGTTCTGCACCGGCCTGGACCAGCAGCTGCGCGACCTG
GAGGCCTGCGTGATGCAGGAGGCTGGCCTGGAGGGCACCCCACTGCTGGAG
GAGGACAGCATCCTGGCCGTGCGCAAGTACTTCCACCGGCTGACCCTGTAC
CTGCAGGAGAAGTCCTACAGCCCATGCGCTTGGGAGATCATCAGGGCTGAA GTGATGAGAGTGTTCAGCTCCAGCCGGAACCTGCAGGACAGGCTGCGGAAG AAGGAGTGA is a porcine interferon alpha codon optimized from GQ415066 (IFN19).
[0034] SEQ ID NO. 3:
GCGGCCGCCTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCC
CGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATA
AAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGG
GGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAG
GCATGCTGGGGATGCGGTGGGCTCTATGis a bovine growth hormone polyA termination sequence.
[0035] SEQ ID NO. 4:
GCGGAGAGTAATTCATACAAAAGGAGGACTCTCCTCAGCCAGGGAAATCC
CAGGGACCGTCGATAAACTCCCACTAAACCTAGAACCGAGTGAGCGCTCG
ACCCCGCCTCCCACCCACCAGCAGTCGTCATCCTCCTGGTTGAGAGGAGC
ATGCGCCGGGCGCCGTGTGCTCGTCAGTGGGCTGAACGCACATCGCCCAC
GGTCCCCGAAGATGGGGGGAGGGGACGGCGGTGGAACCGGTGCCGGGTGG
AGGTGGCGCGGGGTAAACTGGGAAAGTGGTGTCGTGTGCTGGCTCCGCCC
TTTTCCCCGAGGGTGGGGGAGGACCATATATAAGCGCCGTGGTCCCCGCG
AACGTTCTTTTTCGCAACGGGTTTGCCGCCAGGACACAGGTGAGTACGGG
TGTGGCCTCCGTCCGCATGGCCTCCGCCGGTGGCCACGGCCTTAGCGTGC
CTCCCGGCCCCCCGCGCGTAGAGGGCTCTGCGCCCTGGTCCTGATTCCGA
GCTGCGGGCGGGGGGAGGTGGAGAACTCGAGGCCCTCCGCTCTCGCGGTT
CCCTACCGCGTGCCCGGTGGCGGCCTGCTGGGGCGCCGTGGCCGCCGCGT
GCGATCCGCGCCTTCGCGCCCGGTCGTCGGGACAGTAGTATAAATAAGGT
TTTTGTCGTCTTAGGTGTCGTGAAAGCCATCGCTAAAAGCT is a porcine elongation factor 1 -alpha (EFla) promoter.
[0036] SEQ ID NO. 5:
ATGGTGGCTCACAACCAGGTGGCTGCTGACAACGCCATCAGCACCGCTGC TGAGCCACGCCGGAGGCCCGAGCACAGCTCCAGCTCCAGCTCCAGCTCCA
GCTCCAGCTCCAGCTCCAGCTCCCCCGGCGTGCCCGCCCGGCCCAGGCCC
TGCCCAGCTGCCCCCGCTCCAGCTCCAGGCGACACCCACTTCCGGACCTT
CAGGAGCCACGCCGACTACAGAAGGATCACCAGGGCCTCCGCCCTGCTGG
ACGCTTGCGGCTTCTACTGGGGACCACTGTCCGTGCACGGCGCTCACGAG
AGACTGAGGGCTGAGCCCGTGGGCACCTTCCTGGTGAGAGACAGCCGGCA
GAGGAACTGCTTCTTCGCTCTGTCCGTGAAGATGGCCAGCGGACCCACCT
CCATCAGAGTGCACTTCCAGGCTGGCCGCTTCCACCTGGACGGCAGCCGG
GAGTCCTTCGACTGCCTGTTCGAGCTGCTGGAGCACTACGTGGCTGCTCC
AAGGAGGATGCTGGGAGCTCCACTGAGACAGAGACGCGTGCGCCCCCTGC
AGGAGCTGTGCAGACAGAGGATCGTGGCTACCGTGGGAAGGGAGAACCTG
GCTCGCATCCCCCTGAACCCCGTGCTGCGGGACTACCTGAGCTCCTTCCC
CTTCCAGATTTGA is a porcine suppressor of cytokine signaling 1 (SOCS1) open reading frame sequence codon-optimized from NM_00l204768.
[0037] SEQ ID NO. 6:
ATCGATACTCTCTTCGCATCGCTGTCTGCGAGGGCGAGCTGTTGGGCTCG
CGGTTGAGGACAAACTCTTCGCGGTCTTTCCAGTACTCTTGGATCGGAAA
CCCGTCGGCCTCCGAACGGTACTCCGCCACCGAGGGACCTGAGCGGTCCG
CATCGACCGGATCGGAAAACCTCTCGAGAAAGGCGTCTAACCAGTCACAG
TCGCAAGCTAGCCACCATGGCTCCCACCTCCGCCTTCCTGACCGTGCTGG
TGCTGCTGAGCTGCAACGCCATCTGCTGCCTGGGATGCGACCTGCCACAG
ACCCACTCCCTGGCTCACACCAGGGCCCTGAGACTGCTGGCTCAGATGAG
GAGGATCTCCCCCTTCAGCTGCCTGGACCACAGGAGAGACTTCGGCAGCC
CACACGAGGCCTTCGGCGGAAACCAGGTGCAGAAGGCTCAGGCTATGGCC
CTGGTGCACGAGATGCTGCAGCAGACCTTCCAGCTGTTCTCCACCGAGGG
CAGCGCCGCCGCCTGGGACGAGTCCCTGCTGCACCAGTTCTGCACCGGCC
TGGACCAGCAGCTGCGCGACCTGGAGGCCTGCGTGATGCAGGAGGCTGGC CTGGAGGGCACCCCACTGCTGGAGGAGGACAGCATCCTGGCCGTGCGCAA
GTACTTCCACCGGCTGACCCTGTACCTGCAGGAGAAGTCCTACAGCCCAT
GCGCTTGGGAGATCATCAGGGCTGAAGTGATGAGAGTGTTCAGCTCCAGC
CGGAACCTGCAGGACAGGCTGCGGAAGAAGGAGTGAGCGGCCGCCTGTGC
CTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTG
ACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAAT
TGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGG
GGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGG
GATGCGGTGGGCTCTATGGCGGAGAGTAATTCATACAAAAGGAGGACTCT
CCTCAGCCAGGGAAATCCCAGGGACCGTCGATAAACTCCCACTAAACCTA
GAACCGAGTGAGCGCTCGACCCCGCCTCCCACCCACCAGCAGTCGTCATC
CTCCTGGTTGAGAGGAGCATGCGCCGGGCGCCGTGTGCTCGTCAGTGGGC
TGAACGCACATCGCCCACGGTCCCCGAAGATGGGGGGAGGGGACGGCGGT
GGAACCGGTGCCGGGTGGAGGTGGCGCGGGGTAAACTGGGAAAGTGGTGT
CGTGTGCTGGCTCCGCCCTTTTCCCCGAGGGTGGGGGAGGACCATATATA
AGCGCCGTGGTCCCCGCGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAG
GACACAGGTGAGTACGGGTGTGGCCTCCGTCCGCATGGCCTCCGCCGGTG
GCCACGGCCTTAGCGTGCCTCCCGGCCCCCCGCGCGTAGAGGGCTCTGCG
CCCTGGTCCTGATTCCGAGCTGCGGGCGGGGGGAGGTGGAGAACTCGAGG
CCCTCCGCTCTCGCGGTTCCCTACCGCGTGCCCGGTGGCGGCCTGCTGGG
GCGCCGTGGCCGCCGCGTGCGATCCGCGCCTTCGCGCCCGGTCGTCGGGA
CAGTAGTATAAATAAGGTTTTTGTCGTCTTAGGTGTCGTGAAAGCCATCG
CTAAAAGCTGCTAGTCACCATGGTGGCTCACAACCAGGTGGCTGCTGACA
ACGCCATCAGCACCGCTGCTGAGCCACGCCGGAGGCCCGAGCACAGCTCC
AGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCCCCGGCGT
GCCCGCCCGGCCCAGGCCCTGCCCAGCTGCCCCCGCTCCAGCTCCAGGCG
ACACCCACTTCCGGACCTTCAGGAGCCACGCCGACTACAGAAGGATCACC AGGGCCTCCGCCCTGCTGGACGCTTGCGGCTTCTACTGGGGACCACTGTC
CGTGCACGGCGCTCACGAGAGACTGAGGGCTGAGCCCGTGGGCACCTTCC
TGGTGAGAGACAGCCGGCAGAGGAACTGCTTCTTCGCTCTGTCCGTGAAG
ATGGCCAGCGGACCCACCTCCATCAGAGTGCACTTCCAGGCTGGCCGCTT
CCACCTGGACGGCAGCCGGGAGTCCTTCGACTGCCTGTTCGAGCTGCTGG
AGCACTACGTGGCTGCTCCAAGGAGGATGCTGGGAGCTCCACTGAGACAG
AGACGCGTGCGCCCCCTGCAGGAGCTGTGCAGACAGAGGATCGTGGCTAC
CGTGGGAAGGGAGAACCTGGCTCGCATCCCCCTGAACCCCGTGCTGCGGG
ACTACCTGAGCTCCTTCCCCTTCCAGATTTGATCTAGA is the nucleotide sequence inserted in plasmid Ad5 Blue vector between restriction sites Clal and Xhal.
Detailed Description Of The Invention
[0038] Technical and scientific terms used herein have the meanings commonly understood by one of ordinary skill in the art to which the instant invention pertains, unless otherwise defined. Reference is made herein to various materials and methodologies known to those of skill in the art. Standard reference works setting forth the general principles of recombinant DNA technology include Sambrook et ah,“Molecular Cloning: A Laboratory Manual”, 2d ed., Cold Spring Harbor Laboratory Press, Plainview, N.Y., 1989; Kaufman et ah, eds.,“Handbook of Molecular and Cellular Methods in Biology and Medicine”, CRC Press,
Boca Raton, 1995; and McPherson, ed.,“Directed Mutagenesis: A Practical Approach”, IRL Press, Oxford, 1991. Standard reference literature teaching general methodologies and principles of fungal genetics useful for selected aspects of the invention include: Sherman et al.“Laboratory Course Manual Methods in Yeast Genetics”, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1986 and Guthrie et ah,“Guide to Yeast Genetics and Molecular Biology”, Academic, New York, 1991.
[0039] The term a nucleic acid or protein“consisting essentially of’, and grammatical variations thereof, means: 1) nucleic acids that differ from a reference sequence by 20 or fewer nucleic acid residues and also perform the function of the reference nucleic acid sequence, and 2) proteins that differ from a reference sequence by 10 or fewer nucleic acids and also perform the function of the reference protein sequence. Such variants include sequences which are shorter or longer than the reference sequence, have different residues or amino acids at particular positions, or a combination thereof.
[0040] An isolated nucleic acid is a nucleic acid the structure of which is not identical to that of any naturally occurring nucleic acid. The term therefore covers, for example, (a) a DNA which has the sequence of part of a naturally occurring genomic DNA molecule but is not flanked by both of the coding or noncoding sequences that flank that part of the molecule in the genome of the organism in which it naturally occurs; (b) a nucleic acid incorporated into a vector or into the genomic DNA of a prokaryote or eukaryote in a manner such that the resulting molecule is not identical to any naturally occurring vector or genomic DNA; (c) a separate molecule such as a cDNA, a genomic fragment, a fragment produced by polymerase chain reaction (PCR), or a restriction fragment; and (d) a recombinant nucleotide sequence that is part of a hybrid gene, i.e., a gene encoding a fusion protein. Specifically excluded from this definition are nucleic acids present in mixtures of (i) DNA molecules, (ii) transformed or transfected cells, and (iii) cell clones, e.g., as these occur in a DNA library such as a cDNA or genomic DNA library.
[0041] The term recombinant nucleic acids refers to polynucleotides which are made by the combination of two otherwise separated segments of sequence accomplished by the artificial manipulation of isolated segments of polynucleotides by genetic engineering techniques or by chemical synthesis. In so doing one may join together polynucleotide segments of desired functions to generate a desired combination of functions.
[0042] In practicing some embodiments of the invention disclosed herein, it can be useful to modify the genome of a recombinant strain of a virus producing the interferon or other proteins of the immunogenic compositions. In preferred embodiments, the virus is an adenovirus. Such modification can involve deletion of all or a portion of a target gene or regulatory sequence, such as a promoter, including but not limited to the open reading frame of a target locus, transcriptional regulators such as promoters of a target locus, and any other regulatory nucleic acid sequences positioned 5’ or 3’ from the open reading frame. Such deletional mutations can be achieved using any technique known to those of skill in the art. Mutational, insertional, and deletional variants of the disclosed nucleotide sequences and genes can be readily prepared by methods which are well known to those skilled in the art. It is well within the skill of a person trained in this art to make mutational, insertional, and deletional mutations which are equivalent in function to the specific ones disclosed herein.
[0043] Where a recombinant nucleic acid is intended for expression, cloning, or replication of a particular sequence, DNA constructs prepared for introduction into a viral genome will typically comprise a replication system (i.e., vector) recognized by a target host or viral replication machinery, including the intended DNA fragment encoding a desired
polypeptide, and can also include transcription and translational initiation regulatory sequences operably linked to a polypeptide-encoding segment. Expression systems (expression vectors) can include, for example, an origin of replication or autonomously replicating sequence (ARS) and expression control sequences, a promoter, an enhancer and necessary processing information sites, such as ribosome-binding sites, RNA splice sites, polyadenylation sites, transcriptional terminator sequences, and mRNA stabilizing sequences. Expression systems can comprise a recombinant viral genome, such that the modified virus is produced following introduction of a vector containing the genome of the virus, or several vectors which, in combination, comprise the genome of the recombinant virus which is then reconstituted upon introduction into a host cell and expression of the recombinant genome.
[0044] Selectable markers useful in practicing the methodologies of the invention disclosed herein can be positive selectable markers. Typically, positive selection refers to the case in which a genetically altered cell can survive in the presence of a toxic substance only if the recombinant polynucleotide of interest is present within the cell. Negative selectable markers and screenable markers are also well known in the art and are contemplated by the present invention. One of skill in the art will recognize that any relevant markers available can be utilized in practicing the inventions disclosed herein.
[0045] Screening and molecular analysis can be performed utilizing nucleic acid hybridization techniques. Hybridization procedures are useful for identifying polynucleotides, such as those modified using the techniques described herein, with sufficient homology to the subject regulatory sequences to be useful as taught herein. The particular hybridization techniques are not essential to the subject invention. As improvements are made in hybridization techniques, they can be readily applied by one of skill in the art. Hybridization probes can be labeled with any appropriate label known to those of skill in the art. Hybridization conditions and washing conditions, for example temperature and salt concentration, can be altered to change the stringency of the detection threshold. See, e.g., Sambrook et al. (1989) vide infra or Ausubel et al. (1995) Current Protocols in Molecular Biology, John Wiley & Sons, NY, N.Y., for further guidance on hybridization conditions.
[0046] Additionally, screening and molecular analysis of genetically altered viruses, as well as creation of desired isolated nucleic acids can be performed using Polymerase Chain Reaction (PCR). PCR is a repetitive, enzymatic, primed synthesis of a nucleic acid sequence. This procedure is well known and commonly used by those skilled in this art (see Mullis, U.S. Pat. Nos. 4,683,195, 4,683,202, and 4,800,159; Saiki et al., Science, 230:1350-1354 (1985)). PCR is based on the enzymatic amplification of a DNA fragment of interest that is flanked by two oligonucleotide primers that hybridize to opposite strands of the target sequence. The primers are oriented with the 3' ends pointing towards each other. Repeated cycles of heat denaturation of the template, annealing of the primers to their complementary sequences, and extension of the annealed primers with a DNA polymerase result in the amplification of the segment defined by the 5' ends of the PCR primers. Since the extension product of each primer can serve as a template for the other primer, each cycle essentially doubles the amount of DNA template produced in the previous cycle. This results in the exponential accumulation of the specific target fragment, up to several million-fold in a few hours. By using a thermostable DNA polymerase such as the Taq polymerase, which is isolated from the thermophilic bacterium Thermus aquaticus, the amplification process can be completely automated. Other enzymes which can be used are known to those skilled in the art.
[0047] Nucleic acids and proteins of the present invention can also encompass homologues of the specifically disclosed sequences. Homology (identity) can be 50%-l00%. In some instances, such homology is greater than 80%, greater than 85%, greater than 90%, or greater than 95%. The degree of homology or identity needed for any intended use of the sequence(s) is readily identified by one of skill in the art. As used herein percent sequence identity of two nucleic acids is determined using an algorithm known in the art, such as that disclosed by Karlin and Altschul, Proc. Natl. Acad. Sci. USA, 87:2264-2268 (1990), modified as in Karlin and Altschul, Proc. Natl. Acad. Sci. USA, 90:5873-5877 (1993). Such an algorithm is incorporated into the NBLAST and XBLAST programs of Altschul et ah, J. Mol. Biol., 215:402- 410 (1990). BLAST nucleotide searches are performed with the NBLAST program, score=l00, wordlength=l2, to obtain nucleotide sequences with the desired percent sequence identity. To obtain gapped alignments for comparison purposes, Gapped BLAST is used as described in Altschul et ah, Nucl. Acids. Res., 25:3389-3402 (1997). When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (NBLAST and XBLAST) are used. See www.ncbi.nih.gov.
[0048] In practicing the disclosure herein, any suitable bacterial, protist, animal or fungal host capable of allowing replication of the virus or its genome can be utilized. Even more preferably, non-pathogenic and non-toxigenic strains of such host cells are utilized in practicing embodiments of the disclosed inventions. Examples of workable combinations of cell lines and expression vectors are described in Sambrook et al. (1989); Ausubel et al. (Eds.) (1995) Current Protocols in Molecular Biology, Greene Publishing and Wiley Interscience, New York; and Metzger et al., Nature, 334: 31-36 (1988). The nucleic acid(s) encoding the viruses and protein(s) of the present invention can be introduced by any means known to the art which is appropriate for the particular type of cell, including without limitation, transformation, lipofection, electroporation or any other methodology known by those skilled in the art.
[0049] Other compounds (e.g., a known immunomodulating agent) may be added to the composition provided they do not substantially interfere with the intended activity and efficacy of the composition; whether or not a compound interferes with activity and/or efficacy can be determined, for example, by the procedures utilized below.
[0050] "Optional" or "optionally" means that the subsequently described event or circumstance may or may not occur, and that the description includes instances in which said event or circumstance occurs and instances where it does not. For example, the phrase
"optionally comprising a known immunomodulating agent" means that the composition may or may not contain a known immunomodulating agent and that this description includes
compositions that contain and do not contain a known immunomodulating agent. Also, by example, the phrase "optionally adding a known immunomodulating agent " means that the method may or may not involve adding a known immunomodulating agent and that this description includes methods that involve and do not involve adding a known
immunomodulating agent.
[0051] By the term "effective amount" of a compound or property as provided herein is meant such amount as is capable of performing the function of the compound or property for which an effective amount is expressed. As will be pointed out below, the exact amount required will vary from process to process, depending on recognized variables such as the compounds employed and the processing conditions observed. Thus, it is not possible to specify an exact "effective amount." However, an appropriate effective amount may be determined by one of ordinary skill in the art using only routine experimentation.
[0052] While this invention may be embodied in many different forms, there are described in detail herein specific preferred embodiments of the invention. The present disclosure is an exemplification of the principles of the invention and is not intended to limit the invention to the particular embodiments illustrated. All patents, patent applications, scientific papers, and any other referenced materials mentioned herein are incorporated by reference in their entirety. Furthermore, the invention encompasses any possible combination of some or all of the various embodiments and characteristics described herein and/or incorporated herein. In addition, the invention encompasses any possible combination that also specifically excludes any one or some of the various embodiments and characteristics described herein and/or incorporated herein.
[0053] The amounts, percentages and ranges disclosed herein are not meant to be limiting, and increments between the recited amounts, percentages and ranges are specifically envisioned as part of the invention. All ranges and parameters disclosed herein are understood to encompass any and all subranges subsumed therein, and every number between the endpoints. For example, a stated range of“1 to 10” should be considered to include any and all subranges between (and inclusive of) the minimum value of 1 and the maximum value of 10 including all integer values and decimal values; that is, all subranges beginning with a minimum value of 1 or more, (e.g., 1 to 6.1), and ending with a maximum value of 10 or less, (e.g. 2.3 to 9.4, 3 to 8, 4 to 7), and finally to each number 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10 contained within the range.
[0054] Unless otherwise indicated, all numbers expressing quantities of ingredients, properties such as molecular weight, reaction conditions (e.g., reaction time, temperature), percentages and so forth as used in the specification and claims are to be understood as being modified in all instances by the term“about.” Accordingly, unless otherwise indicated, the numerical properties set forth in the following specification and claims are approximations that may vary depending on the desired properties sought to be obtained in embodiments of the present invention. As used herein, the term“about” refers to a quantity, level, value, or amount that varies by as much as 10% to a reference quantity, level, value, or amount.
[0055] The term“consisting essentially of’ excludes additional method (or process) steps or composition components that substantially interfere with the intended activity of the method (or process) or composition, and can be readily determined by those skilled in the art (for example, from a consideration of this specification or practice of the invention disclosed herein). [0056] The invention illustratively disclosed herein suitably may be practiced in the absence of any element (e.g., method (or process) steps or composition components) which is not specifically disclosed herein. Thus, the specification includes disclosure by silence (“Negative Limitations In Patent Claims,” AIPLA Quarterly Journal, Tom Brody, 41(1): 46-47 (2013):
..Written support for a negative limitation may also be argued through the absence of the excluded element in the specification, known as disclosure by silence...Silence in the
specification may be used to establish written description support for a negative limitation. As an example, in Ex parte Lin [No. 2009-0486, at 2, 6 (B.P.A.I. May 7, 2009)] the negative limitation was added by amendment...In other words, the inventor argued an example that passively complied with the requirements of the negative limitation...was sufficient to provide support...This case shows that written description support for a negative limitation can be found by one or more disclosures of an embodiment that obeys what is required by the negative limitation....”
[0057] In preferred embodiments of the present disclosure, the virus utilized is an adenovirus that comprises an adenoviral vector (e.g., Ad5 Blue) encoding an exogenous gene construct. In preferred embodiments of the present invention it is contemplated that the exogenous gene construct encodes a protein that interferes with FMDV. Typically, a gene construct (e.g., interferon) is operatively linked to a promoter (e.g., human Cytomegalovirus promoter). In particular embodiments, another promoter (porcine EFla promoter) is inserted in the 3’ end of the gene transcribed by the CMV promoter in order to express another protein that can enhance the expression of the gene transcribed by CMV promoter. In practicing the present disclosure, an adenovirus can be a replication-incompetent adenovirus. In such embodiments, host cells capable of complementing replication can be utilized, such as HEK 293 cells and other appropriate cells known in the art.
[0058] In certain aspects of the present invention, host cells may be harvested and lysed ex situ using a hypotonic solution, hypertonic solution, freeze-thaw, sonication, impinging jet, microfluidization or a detergent. In other aspects, the cells are harvested and lysed in situ using a hypotonic solution, hypertonic solution, or a detergent (e.g., Tween-20®, Brij-58®, Triton X®- 100 or octyl glucoside). Cells can also be lysed through autolysis of infected cells. Virus collection from tissue culture can utilize any methodology known in the art. As used herein the term“/V? situ” refers to the cells being located within a tissue culture apparatus and“ex situ” refers to the cells being removed from the tissue culture apparatus.
[0059] Modified viruses described herein can be administered to a target animal (e.g., swine) by intramuscular, subcutaneous, or intranasal inoculation, or injection in an amount which is effective to protect the animal against challenge by a virulent strain of viruses such as FMDV, or induce the production of a protective amount of interferon. This amount may vary according to the animal being inoculated, taking into consideration the size and weight of the animal. The viruses according to the invention comprise an effective dosage of the interferon-expressing genomes to induce a significantly higher level of protection in a recipient animal population against mortality and clinical symptoms of FMDV compared to untreated animals. In particular, the recombinant viruses according to the invention prevents a proportion of animals vaccinated against FMDV from developing symptoms prior to the onset of protective immunity. Typically, the viruses are administered in a dose of 109-1010 PFU, but other doses can be utilized. Effective amounts may be experimentally determined as necessary by those of skill in the art by following the guidance provided herein, or by any methodology known in the art.
[0060] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are now described.
[0061] The following examples are intended only to further illustrate the invention and are not intended to limit the scope of the invention as defined by the claims.
Examples [0062] Cells and viruses: Immortalized LFBK-anbό kidney cells (LaRocco, M., et al., J. Clin. Microbiol.,5l: 1714-1720 (2013); Swaney, L.M., Vet. Microbiol., 18: 1-14 (1988)), IBRS-2 kidney cells (House, J.A., et ak, Journal of the Tissue Culture Association, 24: 677-682 (1988)), and HEK 293 cells (Graham, F.L., et ak, J. Gen. Virol., 36: 59-74 (1977)) were obtained from the Foreign Animal Disease Diagnostic Laboratory at the Plum Island Animal Disease Center. The LFBK-anbό cells were cultured in Dulbecco’s Modified Eagle medium (DMEM, GIBCO, Grand Island, NY) containing high glucose, 10% fetal bovine serum (FBS) (HyClone, Logan, UT), and supplemented with 1% Antibiotics-Antimycotic 100X (GIBCO) and 1%
Sodium Pyruvate 100X (GIBCO). The IBRS-2 and HEK 293 cells were grown in Minimum Essential Medium (MEM, GIBCO) with 10% FBS, 1% L-Glutamine, 1% Antibiotics, and Non- Essential Amino Acids 100X (GIBCO). All cell culture media and reagents were purchased from Life Technologies (Carlsbad, CA) unless specified otherwise. FMDV type A24 Cruzeiro strain was produced in baby hamster kidney (BHK) cells and used in this study.
[0063] Interferon protein Expression: Full-length coding sequences of 19 porcine IFNa and 5 IFNP genes were identified from the pig genome sequences released in Aug. 2011 (SGSC Sscrofal0.2/susScr3 Assembly) using the UCSC Genome Browser. Additionally, 13 IFNa coding sequences of miniature pigs were retrieved from the genomic sequences deposited in NCBI GenBank from Accession #: PRJNA176189, AJKK01153980, AJKK01221111, AJKK01220487, AJKK01240321, AJKK01266018, AJKK01153977, and AJKK01148380. These 37 coding DNA sequences with a Kozak sequence of GCCACC in the 5’ end of ATG and Nhel and Notl restriction site sequences in both ends were cloned into pcDNA3.l -vector (Life Technologies) between the Nhel and Notl restriction sites. The plasmids containing the inserts of interests as well as a vector only control were purified with Qiagen plasmid miniprep kits (Qiagen) and were transiently transfected into LFBK-anbό cells for the expression of their respective porcine IFN proteins using Lipofectamine 2000 (ThermoFisher Scientific). The cell culture supernatants were harvested at days 2 and 4 post-transfection and stored at -70°C until assayed. The expressed IFN proteins were detected with Western blotting using a rabbit anti- porcine IFN-a antibody and the WestemDot 625 Goat Anti-Rabbit Western Blot Kit (ThermoFisher Scientific). The imaging was performed using a GelDoc imager (BioRad).
[0064] MTT-CPER assay: The anti-FMDV activity of the harvested cell culture supernatants was measured with an MTT-CPE reduction (MTT-CPER) assay we developed (Ramanathan et ah, 2015). Briefly, IBRS-2 and/or LFBK-anbό cells were plated in 96-well flat- bottomed tissue culture plates to 100% confluency after overnight incubation. Then the cells were treated with two-fold serially diluted cell culture supernatants harvested from the cells transfected with plasmid DNA or infected with Ad5 recombinant viruses. After 18 hours of incubation, the IFN-containing media were removed and the cells were inoculated with FMDV A24 Cruzeiro at a multiplicity of infection (MOI) of 0.4 for 22-hour incubation. A MTT (3-(4, 5-dimethylthiazolyl-2-yl)-2, 5-diphenyltetrazolium bromide) substrate (ATCC, Manassas, VA) was added to each well and the plates were stored in the dark for 3 hours. Then a detergent reagent provided by ATCC was added to each well for another 3 hours incubation at room temperature before spectrometry. The absorbance or optical density (OD) readings in each well was measured using an ELx808 Absorbance Microplate Reader at 570 nm with the reference filter set at 650 nm (BioTek, Winooski, VT). The blank values were subtracted from the absorbance values. There were three technical replicates per sample in the assays. The OD readings were used as the indicator of anti-FMDV activity (cells protected by IFN against FMDV infection).
[0065] For the determination of anti-FMDV activity of the genes and the recombinant adenovirus, the OD readings were fit to a sigmoid dose-response curve using GraphPad Prism software package (PBL Assay Science, Piscataway, NJ). The half maximal effective
concentration (EC50) used as the indicator of anti-FMDV activity were calculated using the software based on the fold dilutions of the supernatants and the OD readings of the culture wells. IFN gene GQ415066/IFN19 was used as a reference in all DNA transfections and antiviral assays for comparison among the genes. The gene with the highest anti-FMDV activity was given an arbitrary index number of 1 as an anti-FMDV activity. The EC50 of other genes was divided by the gene with the highest activity to normalize the antiviral activity. Differences in anti-FMDV activity between the Ad5 viruses created in this study and the Ad5 viruses tested previously were calculated by taking both MOI and EC50 into account.
[0066] Effect of NCS on IFNa production: An interferon a coding sequence
(NM_001172040) was cloned into pcDNA3.l -vector (Life Technologies) between the Nhel and Notl restriction sites and named as pcDNA3. l-IFNa. To test the effect of NCS on IFN production, an adenovirus tripartite sequence (Kaufman 1985; Logan and Shenk 1984; Zhang et al 1989) was placed in the 5’ ends of the IFNa coding sequence and inserted into pcDNA3.l plasmid between Nhel and Notl restriction sites. All plasmids were purified with Qiagen plasmid miniprep kits (Qiagen, Germantown, MD). The plasmid inserted with the IFNa coding sequence only was used as the control. These plasmids were transfected with equal amounts of DNA into LFBK-anbό cells using Lipofectamine 2000 (ThermoFisher Scientific). After DNA transfection, the supernatants were harvested for MTT-CPER assay as described above at days 2, 4 and 6 post-transfection and stored at -70°C until assayed. All inserted DNA including these described in the following were synthesized by GenScript (Piscataway, NJ).
[0067] Effect of SOCS1 (suppressor of cytokine signaling 1) on IFNa production: To test the effect of SOCS1 on IFN production, the porcine SOCS1 coding sequence
(NM_001204768) was inserted into the pcDNA3.l plasmid between Nhel and Notl restriction sites. The plasmid containing a SOCS1 gene was used to co-transfect LFBK-anbό cells with a pcDNA3.l plasmid inserted with the interferon a gene at 1:1 and 1:3 (pcDN A3. l-IFNa vs pcDNA3.l-SOCSl) of DNA using the transfection procedure described earlier. A co
transfection with the same amount of plasmid pcDNA3.l vector without inserts and the plasmid inserted with the interferon gene was used as the control to assess the effect of the SOCS1 gene on the interferon expression. After DNA transfection, the supernatants were harvested for MTT- CPER assay as described above.
[0068] Transcription activity of EFla Promoters: To insert two genes into the Ad5- blue vector, we designed and constructed two promoters containing Mfel and Nhel site sequences in 5’ and 3’ end, respectively, using the sequences of bovine and porcine EFla genes. These promoter sequences start from -350 bp upstream of the transcription start sites to the start codon of EFla coding sequences. A sequence fragment located within the first intron (579 bp for bovine promoter and 338 bp for the porcine promoter that are less homologous among species) was deleted to reduce the length of the promoters to 760 bp, which are very close to the length of CVM promoter. The pcDNA3.l plasmid inserted with the interferon a gene between Nhel and Notl sites was digested with Mfel and Nhel restriction enzymes (New England Biolabs, Ipswich, MA) and ligated with Mfel and Nhel restriction enzyme digested bovine and/or porcine promoter DNA fragments, which replaced the hCMV promoter of the pcDNA3.l plasmid vector (pcDNA3.l_hCMV-IFNa). These two plasmids containing bovine and porcine promoters were named as pcDNA3. l_bEFla-IFNa and pcDNA3. l_sEFlaTFNa, respectively. These three plasmid DNA samples were used to transfect HEK293 and LFBK-anbό cells to measure anti- FMDV activity induced in the culture supernatants as described earlier.
[0069] There are two transcription start sites in bovine and porcine EFla promoters associated with two TATA box like sequences (lst TATATAA and 2nd TTTAAAG). The first TATA box is more resemble to the consensus sequence than the second one. To increase the transcription activity of porcine EFla promoter, pEFla_l, we constructed two new promoters,
(1) pEFla_2 with mutated 2nd TATA box (from TTTAAAG to TATAAAT) and (2) pEFla_3 with additional 70 nucleotide deletion in the first intron of pEFla_2 as shown in FIG. 1. These promoters were cloned into pcDNA3.l plasmid for DNA transfection and the test of the induced antiviral activity as described earlier.
[0070] Codon frequency can affect the translation efficiency of mRNA. Transcription activity of CMV and pEFla promoter is different in different cells. Differences in the expression levels between IFN19 and SOCS1 may affect the magnitude of antiviral activity induced from the cells transfected with these genes. To test the effects of codon frequency and gene locations, we synthesized three DNA fragments containing (1) NCS-IFN19 + polyA termination sequence + porcine EFla promoter + SOCS1 as shown in FIG. 2, (2) the fragment 1 with codon-optimized IFN19 and SOCS1 provided by Genescript, and (3) the fragment 1 with location swap between SOCS1 and NCS-IFN19. These three fragments were inserted into pcDNA3.l vector to test effects of codon optimization and gene swap on anti-FMDV activity induced from DNA transfected cells as described earlier.
[0071] Adenovirus production: Ad5 Blue plasmid vector (Moraes, M.P., et ah, Biotechniques, 31: 1050 (Nov. 2001)) was used to produce recombinant adenoviruses expressing the genes of interest. A porcine IFNa gene previously tested in pigs (Chinsangaram et al., 2003) and the IFN with the highest anti-FMDV activity identified in our study (IFN19) were cloned into the vector between Clal and Xbal restriction sites. The plasmids with the correct inserts were purified with Qiagen plasmid miniprep kits (Qiagen) and used to transfect HEK293 cells with Lipofectamine in Opti-MEM after linearization with Pad restriction enzyme (New England Biolabs, Ipswich, MA). The recombinant viruses were isolated from the plaques, propagated in HEK293 cells, and purified with CsCl gradient centrifugation. These two recombinant adenoviruses were named as Ad5_IFNa (previously tested) and Ad5-IFNl9 (Ad5 with the best IFN gene). To construct recombinant adenovirus containing IFN19 and SOCS1 coding sequences, a poly-A termination sequence, the promoter of porcine EFla gene, and the coding sequence of porcine SOCS1 were inserted at the 3’-end of the coding sequence of the best IFN gene (FIG. 15). This DNA fragment was inserted into the Ad5-blue vector to produce the recombinant adenovirus as described earlier. The recombinant virus produced from the plasmid was named as Ad5-IFNl9+SOCSl or Ad5-IFNl9+.
[0072] Adenovirus titration: Titers of recombinant adenoviruses were determined based on tissue culture infectious dose (TCID50) using HEK293 cell monolayer in 96 well plates according to Moraes et al. (Moraes, M.P., et al., Vaccine, 20(11-12): 1631-1639 (2002)). Briefly, the cells were plated at a density of lxlO4 cells per well, incubated at 37°C with 5% C02 for 3 days or 95-100% confluency. Tenfold serial dilutions starting at 10 to 10 in Minimum Essential Medium (MEM, GIBCO) were prepared in 1.7 ml sterile micro-centrifuge tubes. Prior to inoculation, the cell culture media was removed and 100 pl per well of the diluted samples was added. Sixteen replicates per dilution and eight dilutions per titration with two independent replications were performed. The plates were incubated at 37°C, 5% C02 and checked for the presence of CPE (cytopathic effect) daily for 10 days. Spearman-Karber 50% endpoint viral titers were calculated for TCID50.
[0073] Antiviral activity induced by adenoviruses: To measure the anti-FMDV activity of the recombinant adenoviruses, LFBK-anbό cells cultured in 24-well plates were infected at different MOIs of recombinant adenoviruses (2-fold serial dilution with the serum-free medium) for 1 hour. After the infection, the viruses were removed and the wells were washed three times with medium. Fresh growth medium was added to each well and cell culture supernatants were collected at different time points after the infection and filtered using Centricon® 30 filters (Millipore, Billerica, MA). The anti-FMDV activity of the supernatants was measured with the MTT-CPER assay as described earlier.
[0074] Animal testing: Commercial pigs (body weight at 50-60 FB) were injected subcutaneously with one of three recombinant adenoviruses (the existing adenovirus: Ad5-IFNa and Ad5IFNl9+) at 1010 (FMD protective dose) and/or 109 plaque forming unit (PFU) per pig. There were four pigs per treatment group including a control group injected with PBS only. The available amount of Ad5-IFNl9+ was enough only for three pigs at 109 PFU per animal. Blood samples (5 ml) were collected at one day before injection and at days 1, 2, 3, 4, 5, 6 and 7 post injection. Sera were prepared from the blood samples for measuring anti-FMDV activity using MTT-CPER assay as described earlier. 2-fold serial dilutions of serum samples (2 to 2 ) were used in the assay. Three replications per sample were conducted in the MTT-CPER assay. The animal use protocol was reviewed and approved by Animal Use Review Committees at the University of Nebraska and the in-vivo experiment was conducted in the animal facility located at the College of Veterinary Medicine, University of Nebraska. The serum samples were shipped to Plum Island Animal Disease Center on dry ice for MTT-CPER assays.
[0075] Results. Example 1. Expression of porcine IFNa and b genes: All porcine IFNa proteins were highly expressed in the cell line using Fipofectamine mediated transient DNA transfection with significant variations in expression levels based on Western blotting results (FIG. 1). All IFN tested displayed two bands (one with and another without
glycosylation) as expected. DNA transfection with pcDNA3.l -vector alone also induced low IFN expression on the Western blot (Lane 8 in FIG. 1). FIG. 1 shows very similar intensity of the protein bands on the Western blot for the supernatants harvested from the transfections of equal amount of DNA plasmids inserted with different IFNa genes. The results indicated that the transient IFN expression is a reliable approach to produce IFN proteins for comparing the antiviral activity of the IFN genes.
[0076] Anti-FMDV activity of porcine IFNa and b genes: The supernatants harvested from the transfections of DNA plasmid without IFN gene displayed very low anti-FMDV activity in the MTT-CPER assays (data not shown). To test the reproducibility of plasmid transfection and the MTT-CPER assay, supernatants harvested from two transfections using two independent plasmids with identical coding sequences displayed nearly identical OD readings in the MTT- CPER assay (data not shown), indicating the approach was accurate regarding assessing the antiviral activity of specific porcine IFN genes.
[0077] Among 32 porcine IFN a genes tested, surprisingly Gene GQ415066 (named IFN 19 in this study) consistently displayed the highest anti-FMDV activity in the MTT-CPER assays using two cell lines (IBRS-2 and LFBK-anbό) and cell culture supernatants harvested at two different time points (2 and 4 days post-DNA transfection) (Table 1, FIG. 2, FIG. 4, and FIG. 5). Table 1 shows the anti-FMDV EC50 of in-vitro expressed porcine interferons a and b calculated from the OD readings of MTT-based CPER assays as described below. Table 1 lists the normalized EC50 of tested IFN genes with indexes of anti-FMDV activity relative to the best gene. The activity at days 2 and 4 were highly correlated (r = 0.95 among IFNa). The supernatants from the DNA transfections of one IFN gene (AJKK01221111) from the miniature pig and three (GQ415061, NM_00l 164860, and XM_003121882) from the commercial pigs surprisingly could not fully protect the cells against FMDV infection at the 16-fold dilutions (the highest tested concentration of the supernatants in this study). Based on the calculated EC50, the differences in anti-FMDV activity between the best IFNa gene and others tested ranged from approximately 2- to more than 1, 000-fold.
[0078] Five reported porcine IFNp genes also showed substantial differences in anti- FMDV activity with a high correlation between days 2 and 4 (r = 0.99). The antiviral activity of the best IFNP gene (AY687281) was approximately 6-fold lower than that of the best IFNa, whereas the activity of JF906509 was not detectable in this study (Table 1 and FIG. 2).
Interestingly, the decreases in anti-FMDV activity from day 2 to 4 were much greater for IFNP (averaging -200 fold) than those for IFNa (averaging -30 folds), indicating porcine IFNP may not be good gene source for bio therapeutics.
[0079] Anti-FMDV activity of adenovirus containing IFN19: A recombinant Ad5 virus containing GQ415066 or IFN19 gene (Ad5-IFNl9) was produced and validated by DNA sequencing. The Ad5 virus (Ad5-IFNa) inserted with an IFNa gene previously tested in pigs (Chinsangaram et al., 2003; Dias et al., 2011; Moraes et al., 2003) was also produced to serve as a benchmark control. These Ad5 viruses were titrated twice and used to infect LFBK-anbό cells at different MOI (six 2-fold serial dilutions starting at MOI of 46). The anti-FMDV activities of the supernatants from Ad5-IFNa and Ad5-IFNl9 infections decreased linearly with the dilution factors (data not shown). No CPE was observed in the cells infected with these two viruses at the MOI tested. At the same MOI, the EC50 values for the Ad5-IFNl9 virus surprisingly were approximately four-fold higher than those of Ad5-IFNa (only two MOI shown in FIG. 6), which suggested that the anti-FMDV activity of the recombinant adenovirus containing the best porcine IFN gene was surprisingly about four time higher than that of the adenovirus previously tested.
[0080] In summary, we identified the best porcine IFN gene from 37 porcine IFNa and b genes. A new recombinant adenovirus inserted with this gene surprisingly was approximately 4-fold more potent to the one tested previously in pigs. Therefore, using this new adenovirus can improve the potency of the IFN bio therapeutics in pigs.
[0081] Discussion: Adenovirus-based IFN bio therapeutics is very effective in completely protecting pigs against FMDV infection (Chinsangaram et al., 2003; Dias et al., 2011; Moraes et al., 2003); however, this approach requires a protective dose approximately 100 times higher than adenovirus-based vaccines. Reducing the protective dose is critical for making the bio therapeutics feasible. One objective of this study was to identify the most potent IFN genes for use in the biotherapeutics. To identify the best IFN gene, we applied an approach similar to the method used by Zanotti et al. (Zanotti et al., 2015) to produce IFN for antiviral activity assays using a colorimetric MTT assay we previously developed (Ramanathan et al., 2015). Our results from two identical plasmids yielded nearly identical results, indicating these assays are highly reproducible.
[0082] The differences in the antiviral activity of porcine type I interferons have been tested against PRRSV and VSV infection in different cell lines (Sang et al., 2010; Zanotti et al., 2015). There were substantial differences among the genes tested. In the study by Sang et al. (Sang et al., 2010), porcine IFNa6 (GQ415060) was the top interferon against PRRSV and VSV in MARC-15 cells, whereas IFNal2 (GQ415066 or IFN 19 in our study) was the best interferon against VSV in PK-15 cells. Similarly, in the study by Zanotti et al. (Zanotti et al., 2015), IFNa6 was the interferon with the highest anti-VSV activity and IFNal2 was the second best; however, it is unknown if the coding sequence of the IFNal2 is identical to GQ415066. IFN 19 has also been demonstrated to be the most potent interferon against CSFV (classical swine fever virus) in swine macrophages (Femandez-Sainz, L, et al., Virology, 483: 284-290 (2015)). Our results indicated that IFN 19 or IFNal2 was the best anti-FMDV interferon.
[0083] One interesting result we found was that the antiviral activity provided by IFNp genes decreased surprisingly more rapidly than that by IFNa genes. It has been reported that IFNP displays a higher anti-proliferation activity in some cell types (Rosenblum, M.G., et al., J. Interferon Res., 10: 141-151 (1990)), and tyk2-deficient cells retain partial responsiveness to IFN-b but are completely unresponsive to IFN-as (John, J., et al., Mol. Cell Biol., 11: 4189-4195 (1991)), which, without being bound by theory, may explain the rapid decrease in its antiviral activity after treatment. It appears that porcine IFNp may not be a good candidate for antiviral bio therapeutics due to its lower and short lasting antiviral effect compared to IFNa. [0084] After identification of the best porcine IFN gene, we inserted it into the same Ad5-blue vector to produce a recombinant adenovirus to compare with the adenovirus previously tested in pigs. These in-vitro results surprisingly showed that this new adenovirus was approximately four-fold more potent in terms of inducing antiviral activity after infection than the one previously tested. We subsequently used other approaches in combination with this best IFN gene to further improve the potency in order to make the bio therapeutics feasible.
[0085] Example 2. Effect of non-coding sequence (NCS) on IFN production: FIG.
7A, FIG. 7B, and FIG. 7C show that the transfection of the plasmid inserted with IFNa containing the adenovirus tripartite NCS surprisingly induced higher (approximately 2 fold) antiviral activity than that of plasmid inserted with IFNa without the NCS in the supernatants harvested at days 2, 4 and 6 post transfection. In contrast, surprisingly there were no differences between the supernatants from transfections with plasmids inserted with IFNa containing 3’ end NCS of ACTA (data not shown). Based on these results, two recombinant adenoviruses were produced from the Ad5 virus inserted with the IFNa genes with and without the NCS (NCS- IFNa and IFNa, respectively). NCS-IFNa surprisingly induced approximately 2-fold higher antiviral activity than Ad5-IFNa did in the supernatants harvested at days 2, 4 and 6 from the cells infected at MOI of 20 (only day 6 shown in FIG. 7D). Therefore, both in-vitro tests using plasmids and adenoviruses showed that the adenovirus tripartite NCS surprisingly enhanced the expression of the recombinant IFN from the Ad5 virus.
[0086] Effect of SOCS1 on IFN production: Co-transfection of pcDNA3.l-IFNa and pcDNA3.l-SOCSl at 1:1 ratio surprisingly increased the antiviral activity of the supernatants harvested on days 4 and 6 but not on day 2 when it was compared to the co-transfection of pcDNA3.l-IFNa and pcDNA3.l vector only at the same ratio (FIG. 8A, FIG. 8C, FIG. 8E). Interestingly, when the ratios (IFNa: SOCS1) were increased to 1:3, the increases in anti-FMDV activity were observed on days 2, 4 and 6, indicating positive dose effect of SOCS1 on the antiviral activity (FIG. 8B, FIG. 8D, FIG. 8F). These results indicated that SOCS1 genes delivered together with an IFNa gene surprisingly increased the interferon expression. [0087] Transcription activity of EF 1 a promoters : The transfection of pcDNA3.1 - hCMV-IFNa produced the highest anti-FMDV activity among transfections of the three plasmids in HEK293 (FIG. 9A); however, the anti-FMDV activity of the supernatants from the
transfection of the pcDNA3.l-pEFla-IFNa was highest among the transfections in FFBK-anbό cells (FIG. 9B). These results indicated that the promoter activity was species specific.
Surprisingly, the transcription activity of porcine EFla promoter was higher than the hCMV promoter in porcine cells. Mutation of second TATA box slightly increased (less than 2-fold) the induced anti-FMDV activity of the supernatants from cell culture transfected with the plasmid DNA at day 1 post DNA transfection, while the deletion of additional 70 nucleotide did not have the effect on the activity (FIG. 11). The differences became much smaller at day 2 post transfection. Without being bound by theory, these results suggested that changing the second TATA box like sequence to the censuses sequence increased the transcription activity of the promoter and the intron might have little effect on transcription.
[0088] Effect of codon optimization of IFN19 and SOCS 1: FIG. 12 shows that transfection of plasmid DNA containing codon-optimized IFN19 and SOCS1 open reading frames surprisingly induced higher the anti-FMDV activity by approximately 2-fold than that of non-optimized sequences. The differences between optimized and non-optimized sequence were greater at day 2 than those at day 1, while the differences remain the same at day 3 post transfection. These results indicated that codon optimization increased transcription activity of the open reading frames.
[0089] Effect of position swap between IFN19 and SOCS 1: FIG. 13 showed that there was an effect of promoter and gene pairing on the antiviral activity induced with DNA transfection. Plasmids constructed using pCMV-NCS-IFNl9 and pEFla-SOCSl produced higher antiviral activity by more than 2-fold that those with pCMV-SOCSl and pEFla-NCS- IFN19 at days 1, 2 and 3 post-transfection (only day 2 and 3 shown in FIG. 12). Together with other results presented earlier, these results suggested that the expression level of SOCS1 surprisingly plays a more important role in inducing anti-FMDV activity than that of IFN19. [0090] Anti-FMDV activity of adenovirus containing NCS-IFN19 and EFla-SOCSl: A recombinant adenovirus inserted with IFN19 containing the adenovirus tripartite NCS (NCS- IFN19) and the SOCS1 gene with porcine EFla promoter (EFla-SOCSl) was produced and named as Ad5-IFNl9+ (FIG. 17). To compare Ad5-IFNl9+ with Ad5-IFNa, we infected LFBK- anbό cells with the viruses at MOI of 46. Unlike Ad5-IFNa and Ad5-IFNl9 infections, Ad5- IFN19+ infection induced CPE in the cells after infection at MOI of 46. FIG. 4 shows the antiviral activities induced by Ad5-IFNl9+ infection at days 1, and 2 post-infection surprisingly was approximately 16 times (24 fold) higher than those by Ad5-IFNa infection, whereas the differences at day 3 post infection were much smaller (~4 time), presumably, without being bound by theory, due to CPE. These results surprisingly demonstrated that SOCS1 significantly enhanced IFN expression.
[0091] To reduce CPE of Ad5-IFNl9+ on LFBK-anbό, we infected the cells with 2- fold serially diluted Ad5-IFNl9+ staring at MOI of 20. Ad5-IFNl9+ virus infection caused CPE at MOI of 10 and 20 with a dose effect. To assess the differences in the antiviral activity between Ad5-IFNa and Ad5-IFNl9+, we calculated EC50 for the antiviral activity of all supernatants harvested from different MOIs of infection. The differences in MOI and OD readings were also taken into account for the antiviral activity. FIG. 5 shows that Ad5-IFNl9+ virus infection surprisingly produced approximately 16-30-fold higher antiviral activity in day 1 post-infection than Ad5-IFNa. The fold differences surprisingly increased at days 2/3 and 4 ranging from approximately 50- to l70-fold except for MOIs of 20 and 46. The differences in anti-FMDV activity decreased when MOI was greater than 10. The differences in antiviral activity among infection doses suggested that the effect of SOCS1 and the cytotoxicity were correlated with induced anti-FMDV activity.
[0092] Anti-FMDV activity of Ad5-IFNl9+ in pigs: Before the injection of recombinant adenoviruses, the sera in all pigs showed very similar background anti-FMDV activities (FIG. 6A). All background activities could not fully protect the tested cells from FMDV infection at the highest tested serum concentration (2-fold dilution) based on the OD readings of the positive controls (wells without FMDV, OD readings at 0.60). The anti-FMDV activity in the sera of the group injected with PBS remained practically the same throughout the entire test period (data not shown). One pig injected with Ad5-IFNa and all with Ad5-IFNl9+ sho wed jaundice. All pigs injected with Ad5-IFNl9+ also displayed other symptoms of sickness and one had to be euthanized at day 2 post injection. The pigs with jaundice in the Ad5-IFNa group had the highest anti-FMDV activity in its group, likewise the antiviral activity of the euthanized pig was the highest in its group. The results show that jaundice and sickness after injection were highly correlated with anti-FMDV activity in the sera.
[0093] Anti-FMDV activity induced by Ad5-IFNa displayed a positive dose effect equivalent to the difference between the doses. The antiviral activity at day 1 post injection was the highest and then decreased by at least two-fold each day (FIG. 6). The anti- viral activity fell below the full protection level at day 4 post injection with 109 PFU (FIG. 6E) and at day 6 with 1010 PFU (FIG. 6G). There was a difference of more than four-fold in antiviral activity between individuals with the highest and the lowest anti-FMDV activity in this group.
[0094] Surprisingly, the pigs injected with Ad5-IFNl9+ displayed the highest anti- FMDV activity among the groups at all days post injection with no decrease at day 2 (FIG. 6B and FIG. 6C). Then the antiviral activity gradually decreased but surprisingly remained at very close to the full protection level at day 7 post injection (FIG. 6H). It appears that the differences between the groups injected with Ad5-IFNl9+ and Ad5-IFNa started at day 1 post injection and the differences increased up to day 4 and then decreased afterward, indicating antiviral effect induced by Ad5-IFNl9+ not only was surprisingly greater but also surprisingly lasted longer if taking both the dose and the activity into consideration.
[0095] In summary, based on these in-vitro and in-vivo results, we have improved the potency of an existing IFN bio therapeutics using four elements: (1) the IFN gene with the highest anti-FMDV activity (i.e., IFN19), (2) the adenovirus tripartite sequence, (3) the EFla promoter, and (4) the SOCS 1 gene. The improvement included surprisingly increased in both the magnitude and duration of induced anti-FMDV activity as showed in the in-vitro and in-vivo results though the differences between Ad5-IFNa and Ad-IFNl9+ in-vivo were smaller than those in-vitro. Taking both dose and antiviral activity into consideration, we have surprisingly improved the IFN bio therapeutics by more than 20-fold compared to the one tested previously.
[0096] Discussion: Adenovirus-based IFN bio therapeutics are very effective in completely protecting pigs against FMDV infection (Chinsangaram et al. 2003; Dias et al. 2011; Moraes et al. 2003); however, this approach requires a protective dose approximately 100 times higher than adenovirus-based vaccines. Reducing the protective dose is critical for making the bio therapeutics feasible. We have successfully applied several approaches to enhance the potency of the biotherapeutics. In our study described above, we identified the most potent IFN genes and used that gene to replace the one in the adenovirus previously tested in pigs. However, this approach improved the potency of the biotherapeutics surprisingly by only 4-fold. We then applied other approaches (use of the four elements described above) via enhancing IFN production to surprisingly improve the potency further.
[0097] The first approach was to increase the production of IFN by enhancing IFN mRNA stability and translation efficiency. Non-coding sequences (NCS) have been known to regulate mRNA stability and translation efficiency (Barrett, L.W., et al., Cell Mol. Life Sci., 69(21): 3613-3634 (2012)). We did not observe any effects of 3’end NCS of ACTA1 on IFN production, but found positive effect of the adenovirus tripartite sequence on the expression of the recombinant protein in our in-vitro testing. Without being bound by theory, the IFN production was increased probably via a mechanism associated with translation efficiency.
[0098] The second approach was to reduce the negative impacts of intrinsic effects of the expressed recombinant protein IFN. We constructed a porcine EF1 a promoter that showed a higher transcription activity than the human CMV promoter in the porcine cells. Using this promoter, we inserted another gene, SOCS1, into the adenovirus to reduce the effects from IFN signaling on IFN producing cells. This recombinant adenovirus surprisingly induced an in-vitro anti-FMDV activity up to l70-fold higher than the existing Ad5-IFNa virus. We observed very similar patterns of SOCS1 effect on induced antiviral activity in in-vitro and in-vivo tests, although much smaller differences were observed in pigs than those in cell culture. The differences probably were due, without being bound by theory, to hundreds-fold higher IFN concentrations induced in cell culture than those in animals, which provided an environment for SOCS 1 to play a bigger role in-vitro than in-vivo. Without being bound by theory, the effect of SOCS1 could be explained by reducing both apoptotic effect of IFN on IFN-producing cells and inhibitory effect of IFN on protein translation. Slower decreases of anti-FMDV activity induced by Ad5-IFNl9+ both in-vitro and in-vivo than those by Ad5-IFNa also support the explanations.
[0099] Taking the differences in injection doses, serum antiviral activities, and the euthanized pig (having the highest antiviral activity in its group) into consideration, we estimate that this new bio therapeutics has a potency surprisingly more than 20 times higher than the one tested previously. Other clinical observations also supported the increase of potency. Jaundice has been observed as a side-effect associated with high IFN concentrations in pigs
(Chinsangaram et al. 2003; Dias et al. 2011; Moraes et al. 2003). Even at ten-fold lower than the reported protective dose, all pigs injected with Ad5-IFNl9+ surprisingly showed more severe jaundice and other symptoms of sickness than other pigs in this study. In this study, these symptoms were positively correlated with the anti-FMDV activity in the sera. The Ad5-IFNl9+ also showed higher cytotoxicity in our in-vitro studies than the Ad5-IFNa.
[0100] In summary, we have significantly improved the potency of the existing IFN bio therapeutics for pigs surprisingly by greater than 20-fold using four biological elements.
Based on the scale of the enhancement, without being bound by theory, these four elements appeared to act synergistically. This new bio therapeutics can induce higher and longer anti- FMDV activity than the one previously tested in pigs.
[0101] All of the references cited herein, including U.S. Patents and U.S. Patent Application Publications, are incorporated by reference in their entirety. Also incorporated by reference in their entirety are the following references: Castaldello, A., et al., J. Cell Physiol., 224: 702-709 (2010); Chawla-Sarkar, M., et al., Apoptosis, 8(3): 237-49 (2003).
[0102] Thus, in view of the above, there is described (in part) the following: [0103] A recombinant adenovirus genome, said adenovirus genome comprising (or consisting essentially of or consisting of) a heterologous nucleic acid inserted into a cloning site of said genome, said heterologous nucleic acid comprising (or consisting essentially of or consisting of):
a. a first nucleic acid sequence comprising (or consisting essentially of or consisting of) an adenovirus tripartite sequence operably linked to a second nucleic acid sequence encoding an interferon;
b. a third nucleic acid sequence comprising (or consisting essentially of or consisting of) a bovine growth hormone polyA termination sequence operably linked to said second nucleic acid sequence;
c. a fourth nucleic acid sequence comprising (or consisting essentially of or consisting of) a porcine elongation factor 1 -alpha (EFla) promoter;
d. a fifth nucleic acid sequence operably linked to said fourth nucleic acid sequence, said fifth nucleic acid sequence encoding a suppressor of cytokine signaling 1 (SOCS1) protein.
[0104] The above adenovirus genome, wherein the second nucleic acid sequence is codon-optimized for a bacterial host cell. The adenovirus genome, wherein the bacterial host is E. coli.
[0105] The above adenovirus genome, wherein the fifth nucleic acid sequence is codon-optimized for a bacterial host cell. The adenovirus genome, wherein the bacterial host is E. coli.
[0106] The above adenovirus genome, wherein said fourth and fifth nucleic acid sequences are positioned 3’ to said third nucleic acid sequence.
[0107] The above adenovirus genome, wherein said heterologous nucleic acid comprises SEQ ID NO:6.
[0108] The above adenovirus genome, wherein said first nucleic acid sequence comprises SEQ ID NO:l, wherein said second nucleic acid sequence comprises SEQ ID NO:2, wherein said third nucleic acid sequence comprises SEQ ID NO:3, wherein said fourth nucleic acid sequence comprises SEQ ID NO:4, and wherein said fifth nucleic acid sequence comprises SEQ ID NO:5.
[0109] The above adenovirus genome, wherein said adenovirus genome further comprises vector sequences, said vector sequences allowing for replication of an adenovirus in a host cell. The adenovirus genome, wherein said host cell is a bacterial cell. The adenovirus genome, wherein said bacterial cell is an E. coli cell.
[0110] A host cell comprising (or consisting essentially of or consisting of) the above adenovirus genome.
[0111] A recombinant virus produced by the above recombinant adenovirus genome.
[0112] A method of producing interferon in an animal comprising (or consisting essentially of or consisting of) introducing into said animal (e.g., swine) an effective amount of the above recombinant virus. The method, wherein said introducing is by intramuscular, subcutaneous, oral or intranasal inoculation. The method said method comprising introducing into said animal an effective amount of the virus and a veterinary or pharmaceutically acceptable carrier.
[0113] A method of producing interferon in tissue culture comprising (or consisting essentially of or consisting of) growing a cell comprising the above adenovirus genome under in vitro conditions allowing for the production of interferon, thereby producing interferon. The method, wherein the cell is a bacterial cell.
[0114] An immunomodulatory composition comprising (or consisting essentially of or consisting of) the above recombinant virus and a veterinary or pharmaceutically acceptable carrier.
[0115] Other embodiments of the invention will be apparent to those skilled in the art from a consideration of this specification or practice of the invention disclosed herein. It is intended that the specification and examples be considered as exemplary only, with the true scope and spirit of the invention being indicated by the following claims. Table 1. The EC50 of porcine interferons a and b genes expressed from IBRS-2 cells transfected with pcDNA3.l inserted with interferon genes
Figure imgf000039_0001
©0418086 a S37025 1.000 21301 1,000
AOC 81091737 4 326558 0.514 22063 0,552
AJKKO 122048? *s 307724 0.673 7711 0,352
©0415060 u 29S136 0.661 6772 0,446
AJKKO 1153977 fit mm 0373 5059 0,232
W ..OO34S05O4 a 143237 0.267 6806 0.443
AO© R01164 72 a 101432 0.103 2670: 0,122
©0415058 «¾ 97004 0,161 6014 0,274
R jBOI 185335 ss 6578:8 0.160 4046 0,235
AJ 0114S3S0 a 32352 0.1 SO 1508 0,072
AJKK012 0321 <* 3337.7 0155 3164 0,146
A2KKD 153Q80 ss 8063® 0.150 180 0.282
C _003430305 « 76442 0.142 4702 0,22?
ACC 0:01194179 a 34342 0.135 2422 0,086
00672656 <t €7003 0.12S 26 6 0,138
AOCR61164172-2 « 6MS2 0.114 12:2:8 0.056
Nf¾4_001I68316 n 53063 0.069 2464 0,113
X j303 ®0SiQ7 ss 45761 0.065 2787 0.1.2?
XM 705880087 a 46206 0.064 274? 0,128
AOCRP 1027891 a 43572 0.081 1337 0,081
NM.OOl 165377 ¾ 3 52? 0.063 1460 0,083
C81_O©3366504 « 16092 0.034 574 0,026
N 00 164355 « 7022 0.032 836 0,038
RM.00 166111 16262 0.060 608 0,030
XM...0O343O465 a 75B5 0.014 488 0,022
AJ K'0 266018 a 701:5 0013 235 0.011
XS7 91 a 3223 .000 313 0.014
x: _0O33S6S07 a 90S 0002 69 0,003
©Q416061 :D : D
Figure imgf000039_0002

Claims

We claim:
1. A recombinant adenovirus genome, said adenovirus genome comprising a
heterologous nucleic acid inserted into a cloning site of said genome, said heterologous nucleic acid comprising:
a. a first nucleic acid sequence comprising an adenovirus tripartite sequence operably linked to a second nucleic acid sequence encoding an interferon; b. a third nucleic acid sequence comprising a bovine growth hormone polyA termination sequence operably linked to said second nucleic acid sequence; c. a fourth nucleic acid sequence comprising a porcine elongation factor 1- alpha (EFla) promoter;
d. a fifth nucleic acid sequence operably linked to said fourth nucleic acid sequence, said fifth nucleic acid sequence encoding a suppressor of cytokine signaling 1 (SOCS1) protein.
2. The adenovirus genome of claim 1, wherein the second nucleic acid sequence is codon-optimized for a bacterial host cell.
3. The adenovirus genome of claim 2, wherein the bacterial host is E. coli.
4. The adenovirus genome of claim 1, wherein the fifth nucleic acid sequence is codon-optimized for a bacterial host cell.
5. The adenovirus genome of claim 4, wherein the bacterial host is E. coli.
6. The adenovirus genome of claim 1, wherein said fourth and fifth nucleic acid sequences are positioned 3’ to said third nucleic acid sequence.
7. The adenovirus genome of claim 1, wherein said heterologous nucleic acid
comprises SEQ ID NO:6.
8. The adenovirus genome of claim 1, wherein said first nucleic acid sequence comprises SEQ ID NO:l, wherein said second nucleic acid sequence comprises SEQ ID NO:2, wherein said third nucleic acid sequence comprises SEQ ID NO:3, wherein said fourth nucleic acid sequence comprises SEQ ID NO:4, and wherein said fifth nucleic acid sequence comprises SEQ ID NO:5.
9. The adenovirus genome of claim 1, wherein said adenovirus genome further comprises vector sequences, said vector sequences allowing for replication of an adenovirus in a host cell.
10. The adenovirus genome of claim 9, wherein said host cell is a bacterial cell.
11. The adenovirus genome of claim 10, wherein said bacterial cell is an E. coli cell.
12. A host cell comprising the adenovirus genome according to claim 1.
13. A recombinant virus produced by the recombinant adenovirus genome of any of claims 1-11.
14. A method of producing interferon in an animal, said method comprising
introducing into said animal an effective amount of the virus of claim 13.
15. The method of claim 14, wherein said introducing is by intramuscular,
subcutaneous, oral or intranasal inoculation.
16. The method of claim 14, said method comprising introducing into said animal an effective amount of the virus of claim 13 and a veterinary or pharmaceutically acceptable carrier.
17. The method of claim 14, wherein said animal is swine.
18. A method of producing interferon in tissue culture comprising, growing a cell comprising the adenovirus genome of any of claims 1-11 under in vitro conditions allowing for the production of interferon, thereby producing interferon.
19. The method of claim 18, wherein the cell is a bacterial cell.
20. An immunomodulatory composition comprising the recombinant virus of claim 13 and a veterinary or pharmaceutically acceptable carrier.
PCT/US2019/051425 2018-09-27 2019-09-17 Recombinant adenovirus-based interferon biotherapeutics in swine Ceased WO2020068482A1 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201862737438P 2018-09-27 2018-09-27
US62/737,438 2018-09-27
US16/558,501 US11582956B2 (en) 2018-09-27 2019-09-03 Recombinant adenovirus-based interferon biotherapeutics in swine
US16/558,501 2019-09-03

Publications (1)

Publication Number Publication Date
WO2020068482A1 true WO2020068482A1 (en) 2020-04-02

Family

ID=69947649

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2019/051425 Ceased WO2020068482A1 (en) 2018-09-27 2019-09-17 Recombinant adenovirus-based interferon biotherapeutics in swine

Country Status (2)

Country Link
US (1) US11582956B2 (en)
WO (1) WO2020068482A1 (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040072752A1 (en) * 2000-10-09 2004-04-15 Andrew Nash Modulating cytokine or hormone signalling in an animal comprising up-regulating the expression of socs sequence in the animal
WO2007081336A1 (en) * 2006-01-13 2007-07-19 Five Prime Therapeutics, Inc. Mammalian vectors for high-level expression of recombinant proteins
WO2017132666A1 (en) * 2016-01-29 2017-08-03 Merial, Inc. Recombinant adenovirus vectored fmdv vaccines and uses thereof

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040072752A1 (en) * 2000-10-09 2004-04-15 Andrew Nash Modulating cytokine or hormone signalling in an animal comprising up-regulating the expression of socs sequence in the animal
WO2007081336A1 (en) * 2006-01-13 2007-07-19 Five Prime Therapeutics, Inc. Mammalian vectors for high-level expression of recombinant proteins
WO2017132666A1 (en) * 2016-01-29 2017-08-03 Merial, Inc. Recombinant adenovirus vectored fmdv vaccines and uses thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DU, YIJUN ET AL.: "Immune responses of recombinant adenovirus co-expressing VP1 of foot-and-mouth disease virus and porcine interferon a in mice and guinea pigs", VETERINARY IMMUNOLOGY AND IMMUNOPATHOLOGY, vol. 124, 2008, pages 274 - 283, XP022931204, DOI: 10.1016/j.vetimm.2008.04.011 *
ZHU ET AL.: "Improvement of interferon biotherapeutics for foot-and-mouth disease in swine", PORK CHECKOFF - NATIONAL PORK BOARD #14-014, 2017, pages 1 - 23, XP055701617, Retrieved from the Internet <URL:https://www.pork.org/research/improvement-interferon-biotherapeutics-foot-mouth-disease-swine> *

Also Published As

Publication number Publication date
US20200100479A1 (en) 2020-04-02
US11582956B2 (en) 2023-02-21

Similar Documents

Publication Publication Date Title
Kurita et al. Molecular epidemiology of koi herpesvirus
CN105886502A (en) Primer pair for preparing kit for detecting type-4 avian adenovirus and application thereof
HUP0600779A2 (en) Diagnostic assays for parvovirus b19
Lin et al. Pseudorabies virus (PRV) strain with defects in gE, gC, and TK genes protects piglets against an emerging PRV variant
US20200331970A1 (en) Non-naturally occuring porcine reproductive and respiratory syndrome virus (prrsv) and methods of using
Fang et al. Porcine deltacoronavirus nsp10 antagonizes interferon-β production independently of its zinc finger domains
CN112057611B (en) Application of African swine fever virus E120R protein as immunosuppressant and construction of immunosuppressive site knockout strain
Xie et al. A poxvirus ankyrin protein LSDV012 inhibits IFIT1 in a host-species-specific manner by compromising its RNA binding ability
Takenaka-Uema et al. Development of an improved reverse genetics system for Akabane bunyavirus
Rojas et al. Modification of foot-and-mouth disease virus O1 Caseros after serial passages in the presence of antiviral polyclonal sera
US11582956B2 (en) Recombinant adenovirus-based interferon biotherapeutics in swine
Banyard et al. A role for virus promoters in determining the pathogenesis of Rinderpest virus in cattle
Feng et al. Serotype and VP1 gene sequence of a foot-and-mouth disease virus from Hong Kong (2002)
CN110129288B (en) Application of TBK1 as an E3 ubiquitin ligase
Fan et al. Development and evaluation of immunogenicity and protective efficacy of two recombinant attenuated newcastle disease viruses expressing the VP2 protein of infectious bursal disease virus
Yousif et al. Cytopathic genotype 2 bovine viral diarrhea virus in dromedary camels
CN108866242A (en) For identifying the half Nest RT-PCR serotype specific primer and kit of different serotypes infectious bronchitis virus live vaccine
JP4676063B2 (en) Gene 62 of attenuated varicella virus Oka strain and identification method of attenuated live varicella vaccine virus strain using this gene 62
Peroulis‐Kourtis et al. Molecular characterisation of Victorian Newcastle disease virus isolates from 1976 to 1999
CN113527463A (en) Application of IFITM3 protein related substances in the preparation of drugs for diseases caused by avian reovirus
Osman et al. Genetic fusion of peste des petits ruminants virus haemagglutinin and fusion protein domains to the amino terminal subunit of glycoprotein B of bovine herpesvirus 1 interferes with transport and function of gB for BHV-1 infectious replication
Bremer et al. Discrimination between sheep-associated and wildebeest-associated malignant catarrhal fever virus by means of a single-tube duplex nested PCR
Parthiban et al. Molecular detection of canine adenovirus using polymerase chain reaction and sequencing
RU2812859C1 (en) Method of differentiating arriah-g333 genome of genetically modified strain from pb-97 vaccine strain of rabies virus using real-time polymerase chain reaction with high-resolution peak analysis
Rathore et al. Development of new PCR primers for detection of Koi Herpes Virus (KHV)

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19866947

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 19866947

Country of ref document: EP

Kind code of ref document: A1