WO2020056016A1 - Methods and compositions related to cardiovascular disorders - Google Patents

Abstract

This invention provides methods for identifying agents that can be used for treating or ameliorating symptoms of cardiovascular diseases (CVDs) or conditions, e.g., atherosclerosis. Specifically, the methods comprising contacting a plurality of candidate compounds with induced pluripotent stem cells (iPSCs) bearing CVD risk 9p21.3 haplotype, examining the compounds-contacted iPSCs' differentiation into vascular smooth muscle cells ("VSMC differentiation"), wherein an improved VSMC differentiation of iPSCs contacted with a specific candidate compound is identified as an agent for treating or ameliorating symptoms of CVDs.

Description

METHODS AND COMPOSITIONS RELATED TO

CARDIOVASCULAR DISORDERS

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] The subject patent application claims the benefit of priority to U.S.

Provisional Patent Application Numbers 62/730,248 (filed September 12, 2018). The full disclosure of the priority application is incorporated herein by reference in its entirety and for all purposes.

STATEMENT OF GOVERNMENT SUPPORT

[0002] This invention was made with government support under grant numbers TR001114, RR025774, HL105373, GM114833, and AG045428 awarded by the National Institutes of Health. The government has certain rights in the invention.

BACKGROUND OF THE INVENTION

[0003] Complications of cardiovascular diseases (CVD) represent one of the most prevalent medical problems that often lead to death of patients. There are certain medications available to treat major cardiac risk factors such as hypertension and hyperlipidemia These medications, including, e.g., beta blockers, ACE inhibitor, diuretics and aldosterone antagonists, have been shown to reduce cardiovascular mortality significantly in high-risk populations such as hemodialysis patients. However, several factors, including a wide range of adverse side effects, limit the utility of existing medications for preventing progression of cardiovascular disease or otherwise render these medications inadequate for treatment of CVD, particularly critical for high-risk populations.

[0004] There is still a need in the art for novel medications for CVDs as well as means for identifying additional drugs that can be useful for treating various cardiovascular diseases or conditions. The present invention is directed to this and other unmet needs. SUMMARY OF THE INVENTION

[0005] In one aspect, the present invention provides methods for identifying compounds for treating or ameliorating symptoms of cardiovascular diseases (CVDs).

These methods entail (a) contacting a plurality of candidate compounds with induced pluripotent stem cells (iPSCs) bearing 9p21.3 haplotypes with differing risks for CVD, (b) examining the compounds-contacted iPSCs’ differentiation into vascular smooth muscle cells (“VSMC differentiation”), and (c) examining VSMC differentiation of negative control cells, which are the same iPSCs not contacted with the candidate compounds. If there is an improved VSMC differentiation of iPSCs contacted with a specific candidate compound, relative to that of the negative control cells, the specific candidate compound is then identified as an potential agent for treating or ameliorating symptoms of CVDs.

[0006] In some embodiments of the invention, the iPSCs bearing CVD risk 9p21.3 haplotype are generated from peripheral blood mononuclear cells from subjects bearing CVD risk 9p21.3 haplotype. In some embodiments, the screening methods further include examining VSMC differentiation of positive control cells, which are iPSCs bearing no CVD risk haplotype. In some of these methods, the iPSCs bearing no CVD risk 9p21.3 haplotype are generated from PBMCs of healthy subjects. In some methods, the positive control cells are contacted with the identified specific candidate compound. In some embodiments of the invention, VSMC differentiation of the iPSCs is examined by detecting and/or quantifying production of mesodermal progenitor like cells (MP) or mature VSMCs from the iPSCs. Some of the methods further include examining one or more genetic or cellular characters to be examined in the methods can be expression of genes associated with CVD risk loci or genes involved in processes relevant to VSMC function. In some methods, improved VSMC differentiation of the iPSCs is evidenced by detecting a decreased expression of short form ANRIL isoforms. In some methods, genetic or cellular characters to be examined are cellular functions of the VSMCs, e.g., VSMC adhesion, contraction or proliferation. In some of these methods, improved VSMC differentiation of the iPSCs is evidenced by detecting an increased VSMC adhesion and/or contraction function. In some methods, improved VSMC differentiation of the iPSCs is evidenced by detecting a decreased proliferation of mesodermal progenitor like cells (MP). In various embodiments, the candidate compounds employed in the methods are a combinatorial library of compounds. In some embodiments, the candidate compounds are small inhibitory oligonucleotides, e.g., siRNAs. In some methods, the candidate compounds are a combinatorial library of small organic compounds.

[0007] In another aspect, the invention provides methods for identifying an agent for promoting VSMC differentiation and function and for treating or ameliorating symptoms of cardiovascular diseases (CVDs). These methods involve (a) contacting a plurality of candidate agents with a cell expressing one or more ANRIL isoforms, (b) quantifying expression levels of the one or more ANRIL isoforms to identify a specific agent that down- regulates expression levels of the one or more ANRIL isoforms, and (c) examining effect of the identified specific agent on iPSCs’ differentiation into vascular smooth muscle cells (VSMCs) or function of differentiated VSMCs. The specific agent is identified as an agent for treating or ameliorating symptoms of CVDs if it, by down-regulating ANRIL expression levels, can indeed improve VSMC differentiation or function. In some preferred embodiments, the candidate agents employed in these methods are small inhibitory oligonucleotides targeting the one or more ANRIL isoforms, e.g., siRANs. In some embodiments, the one or more ANRIL isoforms targeted in the methods are human ANRIL transcript variants 11 and 12.

[0008] A further understanding of the nature and advantages of the present invention may be realized by reference to the remaining portions of the specification and claims.

DESCRIPTION OF THE DRAWINGS

[0009] Figure 1 shows that reduction of ANRIL isoforms expression in iPSC- derived VSMCs with the risk locus alters the expression of genes linked to CVD pathology.

DETAILED DESCRIPTION

[0010] The 9p21.3 cardiovascular disease (CVD) risk locus encompasses the strongest common risk haplotype for coronary artery disease and is linked to aneurysms and stroke. Yet, its function remains unclear, hindering translational studies. This region lacks coding genes but contains terminal exons of the non-coding KN A ANRIL and multiple predicted enhancers. The present invention is predicated in part on the inventors’ studies to investigate CVD risk in disease-relevant cell types. As detailed herein, the inventors used genome editing to delete the entire ~60kb haplotype in induced pluripotent stem cells and differentiated them into vascular smooth muscle cells (VSMCs). Unexpectedly, presence of the risk haplotype in VSMCs led to genome-wide transcriptional changes concomitant with increased proliferation, reduced adhesion and contraction and increased expression of short ANRIL isoforms, compared to non-risk cells. In addition, it was found that loss of the risk haplotype or reduction of ANRIL isoform expression can rescue VSMC function, while addition of ANRIL isoforms to mature cells can increase the generation of less adhesive and contractile vascular smooth muscle cells types that resemble those found in CVD affected vasculature. By molecularly defining a cellular phenotypic switch influenced by the most prevalent CVD risk region, the inventors demonstrated that iPSCs carrying the risk haplotype can be powerful tools to model cardiovascular disease risk and to enable drug discovery.

[0011] In accordance with these studies, the invention provides methods to screen for therapeutic agents that are useful in treating or ameliorating symptoms of cardiovascular diseases (CVDs). These methods utilize induced pluripotent stem cells (iPSCs) bearing CVD risk 9p21.3 haplotype as described herein. Agents that are capable of enhancing differentiation of the iPSCs into vascular smooth muscle cells are identified as potential drugs for treating CVD diseases such as coronary artery disease, aneurysms and stroke. In some related embodiments, candidate agents such as small inhibitory oligonucleotides (e.g., siRNAs) can be designed and selected for ability to down-regulate expression of ANRIL isoforms. Agents thus identified can also be useful for enhancing VSMC function and for treating CVDs. A further understanding of the nature and advantages of the present invention may be realized by reference to the remaining portions of the specification and claims.

[0012] Unless otherwise indicated, the present invention can be practiced in accordance with the techniques exemplified herein and other standard procedures well known and routinely practiced in the art. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which this invention pertains. The following references provide one of skill with a general definition of many of the terms used in this invention: Singleton et al., DICTIONARY OF MICROBIOLOGY AND MOLECULAR BIOLOGY (2d ed. 1994); THE

CAMBRIDGE DICTIONARY OF SCIENCE AND TECHNOLOGY (Walker ed., 1988); and Hale & Marham, THE HARPER COLLINS DICTIONARY OF BIOLOGY (1991). In the event that there are a plurality of definitions for terms herein, those in this section prevail. Where reference is made to a URL or other such identifier or address, it understood that such identifiers can change and particular information on the internet can come and go, but equivalent information can be found by searching the internet. Reference thereto evidences the availability and public dissemination of such information.

[0013] As used herein, the singular forms "a," "an" and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to compound, comprising "an extracellular domain" includes compounds with one or a plurality of extracellular domains. The term“agent” or“test agent” includes any substance, molecule, element, compound, entity, or a combination thereof. It includes, but is not limited to, e.g., protein, polypeptide, peptide or mimetic, small organic molecule, polysaccharide, polynucleotide, and the like. It can be a natural product, a synthetic compound, or a chemical compound, or a combination of two or more substances. Unless otherwise specified, the terms“agent”,“substance”, and“compound” are used interchangeably herein. In some screening methods of the invention, the employed test agents or candidate compounds are small organic molecules.

[0014] The term "analog" or“derivative” is used herein to refer to a molecule that structurally resembles a reference molecule (e.g., a My c-inhibitor compound exemplified herein) but which has been modified in a targeted and controlled manner, by replacing a specific substituent of the reference molecule with an alternate substituent. Compared to the reference molecule, an analog would be expected, by one skilled in the art, to exhibit the same, similar, or improved utility. Synthesis and screening of analogs to identify variants of known compounds having improved traits (such as higher binding affinity for a target molecule) is an approach that is well known in pharmaceutical chemistry.

[0015] ANRIL, or“antisense noncoding RNA in the INK4 locus”, is long non- coding RNA encoded in the chromosome 9p21 region. Several long and short ANRIL isoforms have been reported. See, e.g., Chen et al., BMC Neurol 17: 214, 2017. While the exact role of ANRIL awaited further elucidation, common disease genome wide association studies (GWAS) have surprisingly identified the ANRIL gene as a genetic susceptibility locus shared associated by coronary disease, intracranial aneurysm and also type 2 diabetes. ANRIL has been shown to regulate its neighbor tumor suppressors CDKN2A/B by epigenetic mechanisms and thereby regulate cell proliferation and senescence.

[0016] The term“contacting” has its normal meaning and refers to combining two or more agents (e.g., polypeptides or small molecule compounds) or combining agents and cells. Contacting can occur in vitro, e.g., combining two or more agents or combining an agent and a cell or a cell lysate in a test tube or other container. Contacting can also occur in a cell or in situ, e.g., contacting two polypeptides in a cell by coexpression in the cell of recombinant polynucleotides encoding the two polypeptides, or in a cell lysate. Contacting can also occur inside the body of a subject, e.g., by administering to the subject an agent which then interacts with the intended target (e.g., a tissue or a cell).

[0017] The term CVD risk 9p21.3 haplotype or 9p21.3 risk locus refers to a genetic allele located in anon-coding region on chromosome 9 at 9p21.3. It spans 58 kb and encompasses multiple single nucleotide polymorphisms (SNPs) in tight linkage

disequilibrium The 9p21 risk allele is carried by a substantial portion of the world population and confers risk for coronary atherosclerosis independently of known risk factors such as hypertension, hypercholesterolemia and smoking. The lead SNP rsl333049 constitutes the risk haplotype ACAC together with rs7044859, rs496892 (formerly rsl292136) and rs7865618. See, e.g., McPherson et al., Science. 2007; 316: 1675-1684; and Schunkert et al., Circulation. 2008; 117: 1675-1684.

[0018] As used herein, VSMC differentiation refers to the process and related cellular or biochemical activities that are associated with derivation ofVSMCs from pluripotent stem cells (including iPSCs) or mesenchymal stem cells (multipotent stromal cells or MP cells). Vascular smooth muscle cells (VSMCs) are a highly differentiated cell type present within the medial region of arteries and arterioles. Along the differentiation process, VSMCs or precursors express proteins that are important for contractility, ion channels, and signaling molecules that allow these cells to regulate systemic blood pressure through the modulation of vascular tone. VSMCs can switch between a differentiated (also termed contractile) state and a dedifferentiated (also termed synthetic) phenotype in response to extracellular cues. Deregulation of VSMC phenotype switching contributes to the development and progression of vascular pathologies such as atherosclerosis.

[0019] The terms“subject” and "patient" are used interchangeably and refer to mammals such as human patients and non-human primates, as well as experimental animals such as rabbits, rats, and mice, and other animals. Animals include all vertebrates, e.g., mammals and non-mammals, such as dogs, cats, sheeps, cows, pigs, rabbits, chickens, and etc. Preferred subjects for practicing the therapeutic methods of the present invention are human.

[0020] The term "inhibiting" or "inhibition," in the context of tumor growth or tumor cell growth, refers to delayed appearance of primary or secondary tumors, slowed development of primary or secondary tumors, decreased occurrence of primary or secondary tumors, slowed or decreased severity of secondary effects of disease, or arrested tumor growth and regression of tumors. The term“prevent” or“prevention” refers to a complete or partial inhibition of development of primary or secondary tumors or any secondary effects of disease.

[0021] The term“treat” or“treatment” refers to arrested tumor growth, and to partial or complete regression of tumors. The term“treating” includes the administration of compounds or agents to prevent or delay the onset of the symptoms, complications, or biochemical indicia of a disease (e.g., a cancer), alleviating the symptoms or arresting or inhibiting further development of the disease, condition, or disorder. Treatment may be prophylactic (to prevent or delay the onset of the disease, or to prevent the manifestation of clinical or subclinical symptoms thereof) or therapeutic suppression or alleviation of symptoms after the manifestation of the disease.

[0022] A "variant" of a reference molecule refers to a molecule substantially similar in structure and biological activity to either the entire reference molecule, or to a fragment thereof. Thus, provided that two molecules possess a similar activity, they are considered variants as that term is used herein even if the composition or secondary, tertiary, or quaternary structure of one of the molecules is not identical to that found in the other, or if the sequence of amino acid residues is not identical.

[0023] The invention provides methods for identifying agents that can be used for treating or ameliorating symptoms of cardiovascular diseases (CVDs) or conditions, e.g., atherosclerosis. In some embodiments, the method involves testing candidate compounds for effect on VSMC differentiation from pluripotent stem cells (e.g., iPSCs) bearing a 9p2l.3 risk locus. The 9p21.3 risk locus bearing cells are examined for ability to differentiate into VSMCs. Any candidate compound that is capable of improving or restoring the stem cell’s ability to differentiate into healthy VSMCs or to maintain this state with increased frequency or stability (i.e., with normal VSMC function such as adhesion or contraction as exemplified herein) is a potential agent for treating or ameliorating symptoms of cardiovascular diseases. In some of these screening methods, 9p21.3 risk locus bearing iPSCs can be first generated in accordance with the present invention. For example, iPSCs bearing CVD risk 9p21.3 haplotype can be generated from peripheral blood mononuclear cells from subjects bearing CVD risk 9p21.3 haplotype. This can be performed in accordance with the protocols exemplified herein or methods well known in the art. Preferably, the iPSC are generated from human cells. The cells can then be contacted with candidate agents to identify compounds capable of promoting or enhancing normal VSMC differentiation (e.g., differentiation of iPSC or MP cells into functional VSMCs), as detailed below. The screening methods can additionally include examining VSMC differentiation of positive control cells, which can be iPSCs bearing no CVD risk haplotype. Similarly, the iPSCs bearing no CVD risk 9p21.3 haplotype can be generated from PBMCs of healthy subjects. Alternatively, they can be obtained via homozygous deletion of CVD risk haplotype from the genome of iPSCs. In these methods, the positive control cells can be contacted with multiple candidate compounds or just the identified compound.

[0024] To identify compounds capable of modulating (e.g., enhancing) VSMC differentiation, the iPSCs bearing CVD risk 9p21.3 haplotype cells and the control cells are contacted with candidate agents in vitro under appropriate conditions. After culturing the cells for sufficient time, VSMC differentiation of iPSCs can be examined or monitored using a number of cellular or genetic assays that are routinely practiced in the art. These typically involve detecting genetic markers or cellular characters of mature VSMCs or precursor cells of VSMCs. For example, VSMC differentiation activities of the iPSCs can be examined and quantified by assaying expression of one or more genes that are molecular markers of VSMCs. In some embodiments, VSMC differentiation of the iPSCs can be examined, e.g., by detecting and/or quantifying production of mesodermal progenitor like cells (MP) or mature VSMCs from the iPSCs. In some embodiments, VSMC differentiation of the iPSCs can be monitored by examining one or more genetic or cellular characters of VSMCs generated from the iPSCs. For example, the genetic or cellular characters to be examined can be expression of genes associated with CVD risk loci or genes involved in processes relevant to VSMC function. As exemplified herein, increased expression of short ANRIL isoforms is associated with the presence of the risk 9p21.3 haplotype. Thus, some methods of the invention are directed to identifying compounds that can improve VSMC

differentiation via reducing expression of short ANRIL isoforms. In some embodiments, the genetic or cellular characters are cellular functions of the VSMCs, e.g., VSMC adhesion, contraction or proliferation. For example, as exemplified herein, improved VSMC differentiation in the screening methods of the invention can be monitored by detecting an increased adhesion or contraction activity of the VSMC or a decreased proliferation of the precursor MP cells. Detailed procedures for the various screening methods of the invention can be based on or modified from methods well known in the art, or the exemplified methods herein.

[0025] In some other embodiments, candidate agents can be screened for ability to down-regulate expression of one or more ANRIL isoforms. As exemplified herein, siRNA mediated reduction of expression of ANRIL isoforms, e.g., short ANRIL transcript variants 11 and 12 (accession nos. NR 047541 and NR 047542, respectively), resulted in improved VSMC function. Thus, in the screening methods of the invention, candidate agents can be examined for activity to suppress or inhibit expression, or down-regulate cellular levels, of one or more of the ANRIL isoforms. The ANRIL isoforms that can be targeted in the methods of the invention can be any of the ANRIL isoforms known in the art. In some embodiments, candidate agents are small inhibitory oligonucleotides that are designed to target any of the ANRIL isoforms known in the art, e.g., human CDKN2B antisense RNA 1 (CDKN2B-AS1) transcript variants 1-14. See, e.g., Pasmant et al., Cancer Res. 67: 3963- 3969, 2007; Folkersen et al., PLoS ONE 4: e7677, 2009; and Chen et al., BMC Neurol 17: 214, 2017. In some embodiments, the target ANRIL isoform used in the methods is the short human ANRIL transcript variant 11 or 12 as exemplified herein. To identify agents that alter ANRIL expression levels, any cells that express one or more of the ANRIL isoforms can be employed. In some preferred embodiments, iPSC-derived VSMCs as exemplified herein can be used. Effect of the candidate agents on ANRIL expression or cellular level in the cells can be determined via standard techniques of molecule biology as exemplified herein.

[0026] The candidate agents that can be employed in the practice of the invention can be of any chemical nature. In some embodiments, the candidate agents can be small inhibitory nucleic acid molecules or oligonucleotides. These include inhibitory

polynucleotides or nucleic acid molecules that specifically recognize a target sequence (e.g., an ANRIL isoform). In various embodiments, the candidate agents can be antisense molecules, short interfering RNA (siRNA) molecules, sequence specific single-stranded RNAs which form short hairpin structures, shRNA, double stranded homologues, as well as other inhibitory polynucleotide molecules such as complementary polynucleotide sequences, ribozymes or DNAzymes. In some of these embodiments, the candidate agents are nucleic acid molecules that are complementary to a target nucleic acid (e.g., an ANRIL isoform or a loci in the 9p21.3 CVD risk haplotype). The nucleic acid can be complementary to an entire coding strand, or to only a portion thereof, e.g., all or part of the target coding region (or open reading frame). In some embodiments, the employed inhibitory polynucleotides are siRNA or shRNA which can degrade the target sequence via RNA interference (RNAi) (see, e.g., Bass et al., Nature 411:428-29, 2001). The small nucleic acid agents or agents for RNA interference (e.g., siRNA oligonucleotides or shRNA vectors) can be obtained from or readily synthesized with reagents from commercial suppliers, e.g., as exemplified in Example 6 herein. Suitable reagents for synthesizing small inhibitory nucleic acid agents can also be obtained from other vendors, e.g., Santa Cruz Biotechnology, Inc. (Santa Cruz, CA), Origene (Rockville, MD), GeneCopoeia (Rockville, MD), and Thermo Fisher

Scientific (Carlsbad, CA). Small inhibitory nucleic acid molecules suitable for the invention can also be generated via routinely practiced laboratory techniques. For example, siRNA molecules suitable for the present invention can be generated by chemical synthesis or in vitro transcription using single-stranded DNA templates. See e.g., Yu et al., Proc. Natl. Acad. Sci. USA 99:6047-52, 2002; and Elbashir et al., Nature 411:494-98, 2001.

[0027] In some embodiments, the candidate agents can be small molecule organic compounds. In some embodiments, combinatorial libraries of small molecule candidate agents can be employed to screen for therapeutic agents for CVDs. Such compound libraries are well known in the art, e.g., as described in Schultz et al., Bioorg. Med. Chem. Lett. 8:2409-2414, 1988; Weller et al., Mol Divers. 3:61-70, 1997; Fernandes et al., Curr. Opin. Chem. Biol. 2:597-603, 1998; and Sittampalam et al., Curr. Opin. Chem. Biol. 1:384-91, 1997. Candidate agents include unringed and unbranched small organic molecules, as well as other organic compounds such as aromatic compounds, heterocyclic compounds, and benzodiazepines. Candidate agents to be screened can also include polypeptides, beta-turn mimetics, polysaccharides, phospholipids, hormones, prostaglandins, steroids, purines, pyrimidines, oligomeric N-substituted glycines, oligocarbamates, saccharides, fatty acids, as well as derivatives, structural analogs or combinations thereof.

[0028] Any of the assays described herein for monitoring VSMC differentiation (e.g., assays for monitoring VSMC adhesion or contraction) can be employed in the screening methods. In addition, various biochemical and molecular biology techniques or assays well known in the art can be employed to practice the screening methods of the present invention. Such techniques are described in, e.g., Handbook of Drug Screening, Seethala et al. (eds.), Marcel Dekker (1^st ed., 2001); High Throughput Screening: Methods and Protocols (Methods in Molecular Biology, 190), Janzen (ed.), Humana Press (1^st ed., 2002); Current Protocols in Immunology, Coligan et al. (Ed.), John Wiley & Sons Inc. (2002); Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press (3^rd ed., 2001); and Brent et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc. (ringbou ed., 2003).

EXAMPLES

[0029] The following examples are offered to illustrate, but not to limit the present invention.

Example 1 Generating isogenic CVD risk haplotype deleted iPSCs

[0030] Due to the variation among iPSCs derived from different patients, the use of genome edited isogenic lines to discover the impact of gene mutations is becoming more widely adopted. To determine whether this approach would allow us to uncover the function of the non-coding human 9p21.3 CVD risk region, we generated iPSCs from CVD patients who were homozygous for the risk haplotype (RR) as well as from healthy individuals who were homozygous for the non-risk haplotype (NN). The iPSCs were produced from expanded peripheral blood mononuclear cells (PBMCs) using non-integrating episomal vectors carrying OCT3/4, SOX2, KLF4, LIN28, c-MYC and a knock-down construct against p53 (shp53) (Chou et al., Nature Publishing Group 21, 518-529, 2011). Lines that passed quality control tests for pluripotency markers and karyotyping were expanded and banked, and validated, karyotypically normal lines from each donor were selected for generation of knock-out lines.

[0031] The CVD locus comprises a ~60kb block of SNPs in linkage

disequilibrium, such that is unclear which known SNPs or additional linked mutations might ultimately influence disease risk. Accordingly, we elected to directly interrogate the function of the 9p21 risk interval by deleting the entire risk haplotype using genome editing (referred to as haplotype editing) with engineered nucleases (Carroll, Ann. Rev. Biochem. 83, 409- 439, 2014). Previous studies have shown that zinc finger nucleases could be used to generate a precisely targeted genomic deletion by inducing double strand breaks at two nearby sites of the same chromatid. This finding has now been demonstrated for other classes of targetable nucleases, such as TALENs and Cas9, though the likelihood of success, maximum deletion size and reproducibility of large-scale genomic deletions remains poorly defined. Here, we engineered two independent sets of TALENs (set A and set B), each comprising one upstream and one downstream pair, that targeted different sequences, thereby limiting the risk of reproducible off target effects.

[0032] When delivered to iPSCs, these TALENs cut their target sites efficiently based on deep sequencing. Furthermore, even without selection, we found that both sets of TALENs could readily produce homozygous and heterozygous 9p21.3 knock-outs from both patients. Loss of this locus in iPSCs did not significantly impact their growth rates or expression of pluripotency markers, such as TRA1-81 and Nanog as measured by immunostaining and other key markers of pluripotency via RNA-Seq. These results suggested that we could study the function of 9p21.3 during the development and maturation of isogenic iPSC lines into VSMCs, which has not been previously possible in human cells. Thus, we characterized the molecular and cellular consequences of 9p21.3 knock-out on a set of isogenic iPSC lines derived from individuals of each genetic background (RR and NN) produced with each of the two TALEN sets.

[0033] To assess whether loss of the 9p21.3 region impacts iPSCs, we performed RNA-Seq. These data showed that all the iPSC lines were highly similar (R² = 0.97 - 1.0); lines clustered by donor due to strong within donor correlations, but not based on presence or absence of the 9p21 region. No genes were significantly differentially expressed genes between groups and closer inspection of key markers of iPSC identity confirmed that these markers were not affected by variation or deletion of 9p21.3. These results are consistent with models in which the main effector of 9p21.3 dependent risk is not operative in iPSCs, despite the generally open chromatin state of this region (Consortium, Nature 489, 57-74, 2012). We also note that the RNA-Seq shows that expression levels of ANRIL, as well as the nearby CDKN2A and CDKN2B genes are very low in iPSCs, despite reports that their expression levels are anti-correlated in some cell types. Example 2 The impact of the 9p21.3 risk region on VSMC precursors

[0034] To address the role of the 9p21 risk region in VSMCs at different stages of differentiation, we adapted an efficient method to generate VSMCs in vitro from iPSCs (Cheung et al., Nat. Protoc. 9, 929-938, 2014). This method produces mesodermal progenitor like cells (MP, days 3-5), which then mature into VSMCs by day 17. As reported by Cheung et al., this method successfully differentiated our set of isogenic iPSC lines into cells with key features of MPs and mature VSMCs. At day 5, ~90% of the cells expressed the MP marker NKX2.5 and displayed the characteristic polygonal morphologies of this cell type. In addition, ~50% of the cells also expressed markers of mature VSMCs, such as CNN1 and TAGLN. By day 17 the majority of cells expressed markers of mature VSMCs including CNN1, TAGLN (~90%) and alpha-SMA (~80%). All iPSC lines responded similarly to this protocol independent of genotype, though we detected a very small but statistically significant decrease in alpha-SMA+ cells in NNKO cells at day 17. We further confirmed the results of the differentiation using RNA-Seq comparisons of key markers of iPSCs, MPs and VSMCs.

[0035] During the differentiation of iPSC-derived mesodermal progenitors (MP) into VSMCs when we re-plate the cells at equal density, we observe no impact of the risk haplotype on overall production of VSMCs or their expression of various markers of cell identity. However, at days 3 and 5 of the differentiation RR WT MPs exhibited a marked increase in proliferation compared to NN cells as measured by cell counting and FACS based DNA content analyses. Knocking out the risk region in RR cells restored their proliferation to that of NN WT MPs, while deleting the non-risk region in NN cells had no effect.

[0036] To evaluate the global impact of the 9p21.3 CVD locus we performed an extensive set of RNA-Seq experiments, at each stage of the differentiation timecourse for 14 different iPSC lines in 3-5 independent experiments. Experiments were designed to ensure that multiple lines from each genotype were profiled in at least three independent biologic experiments over the course of more than a year to ensure that our results were consistent and reproducible in different lines at different passages . On day 3 of VSMC differentiation, we observed that deleting the 9p21.3 region in NN cells had almost no impact on global gene expression, with only three genes differentially expressed at an adjusted p value <0.05. Of these genes, two are the neighboring CDKN2B and CDKN2A genes and the third is NNAT, which has been reported to be imprinted and frequently misregulated in iPSCs. This result suggests that the non-risk haplotype only influences neighboring genes.

[0037] However, in RR MP cells, deleting the 9p21.3 region had a far greater impact resulting in differential expression of 113 genes, including CDKN2b and other genes located throughout the genome. These genes are involved in developmental processes relevant to mesodermal progenitors based on their significant enrichment in gene ontologies (GO) including developmental process, system development, ectoderm development, and cell-cell adhesion. Principal component analyses (PCA) and clustering based on the whole transcriptome show that, as in the iPSCs, MP cells primarily cluster based on the donor, but suggest a trend in which the RR KO cells begin to resemble the NN and NN KO cells. The 1785 genes that are differentially expressed between the RR cells and the three other groups are enriched in GO categories including embryo development, muscle development and cell adhesion. These results suggest a model in which the CVD risk locus regulates cellular development by modifying transcription of gene regulatory networks that are distal to the 9p21 region.

Example 3 The 9D21.3 risk region affects global gene expression in VSMCs

[0038] Next, we wished to examine the consequence of the 9p21.3 CVD haplotype in cells similar to mature VSMCs. In our differentiation protocol the majority of cells express markers of mature VSMCs at day 17. RNA-Seq analyses of day 17 VSMCs uncovered an even stronger effect of the RR haplotype than we observed in the precursors. The number of differentially expressed genes (filtered for expression of >100 counts in at least one sample for clarity) was small in the NN vs. NN KO VSMCs comparison (87 genes) compared to the 3268 genes that were differentially expressed in the RR KO lines compared to their isogenic lines with an intact locus. Principal component analyses also show that at this time point the genetic influence of the donor has been masked by this large shift in cellular phenotype such that the RR cells cluster separately from the other three groups (RR KO, NN and NN KO). The functional significance of these transcriptional changes is suggested by examining the enriched gene ontologies. These include terms predicted by previous studies and our data in the MPs such as cell cycle, DNA replication and repair. However we also find evidence that these genes are involved in processes relevant to VSMC function including GO terms for cell adhesion, muscle development and muscle contraction. Importantly, these differentially expressed genes are distributed across all chromosomes with no enrichment in the 9p21 region, indicating that the predominant role of the risk haplotype in these cells is to affect genes distal to this locus.

[0039] An alternative to gene ontology annotation is to identify genes related to disease using genetic studies. A recent large scale meta-analysis⁷ identified 73 independent loci associated with CVD. We find that 27/73 of the genes associated with these risk loci are dysregulated in VSMCs in the context of RR haplotype, which is a statistically significant enrichment based on the binomial distribution (p<0.01). Together, these expression analyses indicate that the RR version of the 9p21.3 risk region has a much more significant impact on VSMCs than the NN haplotype, and provide evidence that the impacted genes are involved in pathways known to influence cardiovascular disease risk and affect VSMC function.

Example 4 VSMC function selectively perturbed bv the CVD risk haplotvpe

[0040] Guided by the RNA-Seq analyses, we examined VSMC adhesion, contraction and proliferation in the set of haplotype-edited lines. As predicted, mature RR VSMCs proliferated more quickly than NN VSMCs, while deleting the haplotype restored normal proliferation, paralleling studies using primary VSMCs. Next we measured VSMC adhesion using Traction Force Microscopy (TFM), which quantifies the ability of cells to displace fluorescent beads embedded in a hydrogel, a metric of adhesive force. TFM showed that all cells maintained polarized traction forces but RR VSMCs exerted markedly lower traction forces than the three other genotypes. In a parallel set of assays we quantified adhesion strength using a spinning disc assay in which cells are exposed to a range of stress forces depending on their radial position. Adhesion strength, which we define as the stress where 50% of the population remains adherent, i.e. TSO, again varied based on the presence of the RR haplotype; RR cells exhibited weaker adhesion than NN cells with or without the deletion. In both cases, deleting the RR locus restored normal function.

[0041] In addition to single cell functional assays, we measured collective VSMC behavior in a collagen gel-based contraction assay over an eight-day time course. Again, the RR WT lines were outliers, exhibiting reduced contraction compared to the NN WT and NN KO lines. Deleting the risk haplotype restored contraction of the RR lines to that of NN lines. To further confirm the results of this assay we employed pharmacologic agents that stimulate or block contraction (Bradykinin or Cytochalasin D, respectively). These studies show that while RR WT cells do not contract Ihe gel to a degree similar to NN, NN KO or RR KO cells, their contraction can be stimulated with Bradykinin, indicating that they possess but do not use their contractile capabilities in the presence of the risk interval.

Conversely depolymerization of the cytoskeleton with Cytochalasin D significantly reduced contraction for all VSMCs.

[0042] By constructing and analyzing two large sets of isogenic haplotype edited iPSC lines we have uncovered an unexpected additive gain of function role for the 9p21 CVD risk haplotype that appears to cause dysregulation of key aspects of mature VSMC function. To assess whether these results also apply to cells derived from other individuals carrying the 9p21.3 risk haplotype, we generated iPSCs from five additional RR and NN individuals with intact 9p21.3 loci. We also produced RR KO cells from one of these donors, bringing the total number of genetically distinct donors to seven (4 independent RR individuals and 3 NN). Using these new lines, we performed VSMC differentiations and tested the cells using the TFM and spinning disk adhesion assays. These results confirmed the results of our isogenic study in that presence of the risk haplotype correlates with reduced cellular adhesion in unaltered VSMCs. We also confirmed that deletion of the risk haplotype is sufficient to restore adhesive function to VSMCs from a second risk individual.

[0043] In parallel with the functional assays, we performed RT-qPCR analysis of six cell adhesion genes that we identified as significantly differentially expressed in RR vs. NN VSMCs based on our RNA-Seq analyses of the isogenic lines. These patterns of differential gene expression were consistent in the five new donor-derived iPSCs, with five meeting statistical significance and one (R0B02) exhibiting a trend that was not statistically significant. Given the known heterogeneity in the behaviors of non-isogenic iPSCs, and known donor specific-effects on gene expression, we believe these results support a strong and consistent role for risk haplotype status in governing the attributes of in vitro derived VSMCs.

Example 5 Extent and function of hanlotype dependent ANRTL isoform expression

[0044] Though lacking known coding genes, the 9p21 risk interval is rich in enhancer sequences and also contains the terminal exons of ihe ANRIL long noncoding (CDKN2B-AS) RNA transcript Previous studies have uncovered extensive ANRTL alternative isoform usage, including circular isoforms. Differences between these studies suggest that ANRIL isoform usage can vary based on the cell type and/or the donor genetic background. Our isogenic lines and RNA-Seq datasets provide a unique resource to assess ANRIL isoform expression levels in haplotype edited cell types derived from the same individual, which enables us to clearly establish the influence of 9p21.3 genotype on ANRIL expression in a particular cell type or lineage.

[0045] Because our RNA-Seq data suggested that ANRIL expression highest in the day 17 VSMCs, we examined ANRIL isoform expression in this data set. Using STAR aligner to identify reads that map across every potential ANRIL exon-exon junction we identified a set of predicted ANRIL isoforms for each group of VSMCs. These alignments show that ANRIL isoform usage differs between the RR and NN lines. Specifically, in RR cells we observed enhanced use of an alternative terminating exon that results in production of short ANRIL isoforms, while no splicing to exon 13 was detected in NN cells. In contrast, both NN and RR VSMCs exhibited splicing to the alternative terminal exon 19, which is found in long ANRIL isoforms). We used RACE to confirm the precise structure of the short isoforms, providing additional evidence that these isoforms correspond to previously described isoforms 11 and 12. The longer isoforms we found resemble previously described isoforms 2 and 3, with some changes in splicing of exons 10 and 12. We were unable to detect any of the previously described circular ANRIL isoforms, using RNA-seq alignments, bioinformatics methods to detect circular RNAs (see Methods) or RT-PCR based assays (data not shown).

[0046] To assess the relative expression levels of the ANRIL isoforms throughout the differentiation of iPSCs to VSMCs we performed quantitative RT-PCR using exon spanning primers designed to detect the long isoforms (exons 18-19) or short (and long) isoforms (exons 5-6 and 6-7). As expected, long isoform expression is absent in KO VSMCs due to deletion of these exons. In NN and RR cells expression of long ANRIL isoforms expression is very low in iPSCs but increases throughout VSMC differentiation and is similar in RR and NN cell lines. In contrast, exons also found in the short isoforms (exons 5-6 or 6-7) were significantly upregulated in RR VSMCs, and restored to NN levels in the RR KO cells. We also confirmed these results in the larger set of iPSCs derived from additional donors.

[0047] Together these RNA-Seq and qRT-PCR ANRIL expression studies support a model in which presence of the risk haplotype leads to increased expression of short ANRIL isoforms in RR cells relative to NN cells when they are differentiated into VSMCs in vitro. To determine whether these short ANRIL isoforms might contribute to functional differences in RR VSMCs, we cloned isoforms 11 and 12 into inducible lentiviral expression vectors and expressed them during VSMC differentiation of NN KO IPSCs. Misexpression of the short ANRIL isoforms induced morphologic changes in mature NN VSMCs, inducing them to closely resemble the RR cells. Quantitative RT-PCR analyses of genes involved in adhesion and contraction showed that many genes previously identified as differentially expressed can be regulated by short ANRIL expression, although some genes were unchanged, consistent with a role for other regions of the risk locus in regulating phenotypic changes in VSMCs.

[0048] Finally, to determine whether short ANRIL expression is sufficient to alter cell function, we performed single cell adhesion assays. Strikingly, we show that over time, misexpression of short ANRIL is sufficient to reduce the adhesive strength of the NN KO cells. Together these transcriptomic and functional analyses provide strong evidence that the ~60kb CVD risk locus defined in human GWAS studies acts in an additive gain of function manner to broadly influence gene expression and alter key functional properties of VSMCs including adhesion/contraction and proliferation. These findings suggest a model in which presence of the risk haplotype represses the generation and maintenance of the mature VSMC state, partly through the production of increased levels of the short ANRIL isoforms we define here.

Example 6 Reduction of ANRIL isoform expressions rescue VSMC function

[0049] We tested and validated siRNAs (sequences 57, 45 or the mixture) that reduce the expression of ANRIL isoforms, including short ones, by targeting particular exons found in all isoforms (sequence 57 targets exon 5, while sequence 45 targets exon 6).

[0050] Specifically, 9p21.3 Risk VSMCs were harvested at D12 of the differentiation process and prepared for transfection. 2.7x10⁵ cells were transfected with lOul of siPORT NeoFX transfection reagent and 60nM of total siRNA, according to the manufacturer (Applied Biosystem). Cells were assayed for knock down at day 17 of differentiation. siRNA used are CDKN2B-AS1 Silencer Select Pre-designed siRNA

(Ambion), cat. No. 4392420, IDs: n272157 and n509345. We have evidences that our Risk VSMCs express short ANRIL transcript variants 11 and 12 (NR_047541, NR 047542). Both ANRIL isoforms contain exons 5-6-7, therefore, we assume the knock down experiment alters the expression of both. However, our quantitative PCR assay cannot distinguish between the two isoforms level.

[0051] As shown in Figure 1, the siRNA molecules significantly reduce the expression of ANRIL isoforms containing exons 5-6 (57) or 6-7 (57, 45), but not the very long isoforms containing exons 18-19. These treatments result in increased expression of adhesion molecules related to adhesion and contraction of vascular smooth muscle cells and of CD36.

Example 7 Experimental Procedures

[0052] This Example describes some materials and experimental procedures exemplified herein.

[0053] Peripheral blood mononuclear cell isolation and culture: Study participants were enrolled and informed consent obtained under study IRB- 11-5676 approved by the Scripps Institutional Review Board. PBMC isolation from blood in Heparin vacutainers was performed using Ficoll-Paque™Premium (GE Healthcare, cat #17-5442- 03). Blood was diluted with 10 ml IX PBS, layered over the top of 20 ml Ficoll and then centrifuged at 750xg for 35 min with the acceleration at its lowest setting. The white interphase (huffy coat) between the plasma and Ficoll fractions was transferred into 35 ml IX PBS and centrifuged for 10 min at 350 xg. The cells were then resuspended in 10 ml IX PBS and centrifuged for 10 min at 250 xg. Cells were resuspended in 10% DMSO in heat- inactivated FBS (Life Technologies, cat # 10082139), frozen at -80C and then transferred to liquid nitrogen for long-term storage.

[0054] PBMC reprogramming to iPSCs: iPSCs were generated from 2 individuals

(59 years old, male, RR for 9p21.3; 86 years old, male, NN for 9p21.3) via Yamanaka episomal-based reprogramming of peripheral blood mononuclear cells (PBMCs). The methods used were optimized from previously described protocols (Chou et al., 2011). To summarize the optimizations made, isolated and cryopreserved PBMCs were thawed and cultured for 12-14 days in Mononuclear Cell (MNC) complete medium (MNC basal medium (IMDM (Gibco Cat#21056023), Hams F12 (Gibco Cat#31765035), Glutamax (Gibco Cat#35050-061), Chemically Defined Lipid Concentrate (Gibco Cat# 11905031), ITS-X (Gibco Cat#51500-056), 1-Thioglycerol (Sigma, 435uM), Bovine Serum Albumin (Sigma Cat#A9418, 0.5%w/v), and Ascorbic acid (Sigma Cat#A8960, 50ug/mL)) supplemented with rhEPO (R&D 2U/mL), hSCF (R&D 50ng/mL), rhlGFl (R&D 40ng/mL), hIL3 (R&D 10ng/mL), Dexamethasone (Sigma Cat#D2915 luM), and Holo-transferrin (R&D

50ug/mL)). Cell count was performed at feeding on Days 2, 5, 8, and 11, with cells seeded at 2.5x10^® cells/mL for days 2-5, and 1.5x10⁶ cells/mL on days 8 and 11. After 14 days of expansion 2x10⁶ cells were transfected (AmaxaNucleofector Technology) with plasmids containing the reprogramming transcription factors (pCXLE-hOCT3/4-shp53; pCXLE-hSK; pCXLE-hUL), 2ug each plasmid. Human CD34+ cells nucleofector kit (Cat#VPA-1003) was used with program U-008 on an Amaxa Nucleofector II device. Cells were allowed to rest in MNC complete medium for 2 days, then plated on inactivated MEF feeders (3x10⁴ cells/cm²) in MNC basal medium supplemented with 10% FBS, and transitioned to mTeSRl medium (Stemcell Tech Cat#05850) over the next 3 days. Cultures were fed with fresh mTeSRl on days 7, 9, and daily thereafter. From Days 10-20, 50% fresh mTeSR was supplemented with 50% fibroblast conditioned mTeSR (inactivated human foreskin fibroblasts (EMD Millipore Cat#SCC057)). Medium was supplemented with the small molecule enhancer of reprogramming sodium butyrate (0.25mM) as nascent colonies became visible with timing varying on a patient-by-patient basis, typically around Day 13. Colonies were allowed to develop until approximately 22 days post-transfection and then picked to feeder-free conditions on Matrigel (Coming Cat#354277), at which time sodium butyrate supplementation was stopped.

[0055] Induced pluripotent stem cells culture and characterization: Induced Pluripotent Stem Cells (iPSCs) were cultured in Matrigel-coated plates (Greiner Bio-one Cat#657160) with mTeSR medium. Cells were passaged every three to four days using 0.5mM EDTA as the dissociation reagent. PBMC-derived iPSCs were characterized after approximately 8-9 passages in culture. Karyotyping analysis was performed by Infinium HumanCore BeadChip. Validation of the iPS cells was performed by immunofluorescence staining and flow cytometry. 250,000 fixed cells per sample were incubated at room temp for 30 minutes in Blocking Buffer (5% heat inactivated FBS in 1XPBS, -Ca, -Mg). SSEA4 (Stemgent, Cat#09-0003, use 1:5) and TRA 1-60 (Millipore, Cat# MAB4360, use 1:100) were added to samples individually and incubated for 30 minutes RT. Three washes were performed with 1% heat inactivated FBS in 1XPBS, -Ca, -Mg. After the final wash, the SSEA4-stained samples were resuspended in 500 ul of Wash Buffer and transferred to FACS tubes. The TRA 1-60 samples were then resuspended in Goat anti-mouse-IgM Alexa 488 (Life Technologies, Cat#A21042, use 1:200) secondary, and incubated 30 minutes RT.

Three washes were performed using the wash buffer listed above. The cells were resuspended in 500ul wash buffer and transferred to FACS tubes. The samples were read and analyzed on the LSR II. The LookOut® Mycoplasma PCR Detection Kit (Sigma, Cat. # MP0035) was used to check for Mycoplasma contamination, following the manufacturer's instructions and using JumpStart Taq DNA Polymerase (Sigma, Cat #D9307).

[0056] Genome editing, transfection, genotypying: Transcription activator-like effector nucleases (TALENs) for the 9p21 CAD risk region were designed using an archive of TALE modules as described (ref 21 179091), and cloned into a mammalian expression vector as fusions to obligate heterodimer forms of the Fold endonuclease (ref 21131970) bearing a TALE-FokI linker optimized for gene editing of endogenous loci in mammalian cells (ref 21179091). The TALENs were validated for genome editing activity at the endogenous locus in HEK293 cells by transient transfection of TALEN expression constructs followed by measurement of percentage of chromatids bearing a TALEN-induced insertion or deletion using a mismatch sensitive endonuclease assay, Surveyor/Cell (Qiu et al., BioTechniques 36: 702-707, 2004).

[0057] 5’ capped and poly-adenylated mRNA coding for these TALENs was transcribed in vitro (Ambion Cat. AM1345), cleaned up using Qiagen RNeasy (Cat. 74104), and delivered to iPS cell lines via electroporation using the Amaxa Nucleofector 2b device with Amaxa Human Stem Cell Kit 1 (Cat# VPH-5012) reagents. Cell lines were passaged using single-cell technique for two passages prior to transfection, using Accutase (Innovative Cell Tech, Inc, Cat. AT-104) to lift cells and 10mM Y-27632 dihydrochloride (ROCK inhibitor; Tocris Cat. 1254) in plating medium to protect cells. On the day of transfection, Accutase was used to produce a single-cell suspension, and 1.8-2xl0⁶ cells used in each reaction (passage 17). Reactions also contained 2.5mg mRNA for each TALEN in a given condition, and cells were transfected using the nucleofector program“A-024”. Transfected cells were allowed to recover 24-48hrs before replating as single cells at low desnily (360 cells/cm²) on Matrigel-coated plates. Individual subclones were then isolated and genotyped for editing status. Genolyping was performed by isolation of genomic DNA followed by PCR. Genomic DNA was extracted by lysis of cell pellets at 55C for ~lhr in tail lysis buffer (lOOmM Tris HC1 (from pH 8.0 stock), 5mM EDTA, 200mM sodium chloride, 0.2% SDS, 290mg/mL proteinase K (Roche Cat. 03115828001)), treatment with RNase A (Qiagen Cat. 1007885) at room temp for 15min, separation of aqueous phase by

phenol/choloform/isoamyl alcohol (Invitrogen Cat. 15593031) with 20min centrifugation at 4C and 15,000 RCF, precipitation with 3mM sodium acetate (Ambion Cat. AM9740) in 100% ethanol (Fisher Cat. BP2818), cleaning with 70% ethanol, and resuspension in TE buffer (Ambion Cat. AM9849) at 50C for ~1hr. Priming sites were located upstream and downstream of each TALEN cut-site, witii internal priming sites deleted in successful CAD- risk allelic knock-outs. Primers sequences include: GJC 344F (5’

CATACAGGTCCCTGGCACTAA 3’) (SEQ ID NO:l), GJC 345R (5’

GAGCCAACGATATCTCCAAGA 3’) (SEQ ID NO:2), GJC 346F (5’

CGAAGGGCTTCCCTGTCTA 3’) (SEQ ID NO:3), and GJC 347R (5’ GACTTTCCCCCA

CAATGAAA 3’) (SEQ ID NO:4). Genotyping PCR was performed using Herculase II polymerase (Agilent Cat. 600675) in 30uL reactions. Reaction parameters include: 40 cycles, 58C annealing, 20sec extension, lOng genomic DNA template per reaction, and primer concentration of 250nM each. This assay allowed for detection of iPS clones with heterozygous or homozygous deletion of the 9p21 CAD-risk region by generating Sanger sequencing-verified products of unique size in the presence or absence of the CAD-risk region.

[0058] Smooth Muscle Differentiation : iPSCs lines were differentiated as previously described in Cheung et al 2014 protocol. Undifferentiated cells cultured in mTeSR medium were cultured in CDM-BSA 24h before seeding. Cells were seeded in CDM-PVA medium and differentiated through the lateral mesoderm lineage. After 17 days of differentiation cells were cultured in 10% FBS containing medium (DMEM (Gibco Cat. 10566-016) supplemented with 10%FBS, Pen/strep (Gibco Cat. 15140122), Glutamax (Gibco Cat. 35050061), NEAA (Gibco Cat. 11140050)) and passaged as a primary cell culture.

[0059] RNA extraction and qPCR: Total RNA extraction from frozen or fresh cells was performed with the Trizol reagent (Invitrogen Cat.15596) and Zymo Direct-zol RNA miniprep kit according to manufacturer protocols. RNA was eluted in water and treated with Ambion DNA Free (Cat. AMI 906) according to manufacturer protocols. cDNA for quantitative PCR was produced from isolated RNA using iScript cDNA Synthesis Kit (Bio-Rad Cat. 170-8891) in 20uL reaction volumes, according to manufacturer protocol. qPCR reactions were performed in lOuL final volume in 384-well plates, using iTaq Universal SyBr Green Supermix (Bio-Rad Cat. 1725121) for detection on a Bio-Rad CFX384 Touch Real-Time PCR machine. Each reaction was performed using cDNA template equivalent to 2-8 ng of total RNA, varying based on the expression level of each transcript of interest. Analysis was performed using a standard curve. [0060] Library Preparation for RNA sequencing: cDNA synthesis: Starting material used was lOOng of RNA. Followed Nugen's protocol using Nugen’s Ovation RNA- Seq System V2 (Cat. 7102). Quality control was done using the DNA 1000 LabChip (Agilent Cat. 5065-1504). For shearing: 1 ug of cDNA in 50 ul Buffer EB (Qiagen, Cat. 1014612) was sheared using the Covaris S2 Focused Ultra-sonicator, Duty Cycle- 10%, Intensity-5, Cycle/burst-200, time 100 sec. The sheared cDNA was purified using 1.8X Agencourt ® Ampure® XP reagent (Beckman Coulter, Cat. A63882). Libraries were made using KAPA Hyper Prep kit for Illumina platform (Cat. KR0961) with Agilent's Sure Select XT2 adapters. The cycling parameters for amplification are: 98C-45s 1 cycle, 98C-15S, 60C-30S, 72C-lmin 4 cycles, 72C-lmin 1 cycle, 4C hold. Library Quality control was done using the DNA 1000 LabChip (Agilent Cat #5065-1504). Libraries were normalized to 2nM and pooled. Final concentration of the denatured library pool was lOpM for the Rapid Run Mode and 12pM for the High Output mode. Sequencing was done on Illumina's HiSeq2500 (101X9X101 cycles). Approximately 40 million 2x100bp paired end reads were generated per condition and replicate.

[0061] ANRIL isoforms RACE amplification: We used a modified version of

SMART-seq2 protocol to generate cDNA from SMCs. 100ng of Total RNA was annealed with 0.5uM SMARTseq2-(dT)3o primer and 1U of thermostable RNAseq inhibitor

(Promega) in 10uL of RNAse-free water (Ambion) for 2 minutes at 72C and placed on ice. Premade 10uL of 2x RT master mix was added and mixed with annealed RNA on ice using Maxima H-reverse transcriptase (Thermofisher Scientific) and Thermostable RNAse- Inhibitor (Promega). The samples were placed into preheated to 42C thermocycler, and the following program run: 42C-30min; 2cycles of: 20C-5min, 42C-5min, 55C-10 min, 65C-5 min; 4C-hold. First round of PCR amplification was done by adding: 25 uL Kappa HiFi ready mix (2x), 0.8uL 50uM ISPCR primer, 4.2uL H2O. Run program as follow (Dropseq protocol): 95C-3 min; 4cycles: 98C-20sec, 65C-45sec, 72C-3min; 9 cycles:98C-20sec, 67C- 20seC, 72C-3min, 72C-5 min, 4C - hold. The library was cleaned with 1x AmpureXP beads and eluted in TE. Secondary PCR amplification was done with exons' specific primers with touchdown program: 98C - lmin; 8cycles: 98C-15sec, 68C-15sec (auto-delta -0.8 every cycle), 72C-3min; 34cycles: 98C-15sec, 60C-15sec, 72C-3min, 72C-3min, 4C hold. lOng of RACE library was used as template. Primer pairs used: Exon1_fw - Exon13_rev. The products were visualized on 1% agarose gel. The bands were cut and extracted using Zymo Gel DNA purification kit protocol with double wash with 750uL of DNA wash buffer. [0062] ANRIL-speciflc Construct, lentiviruses generation andANRIL

overexpression: Reference isoforms 11 and 12 of ANRIL were ordered via gBlocks from IDT Inc. and minimal CMV promoter and Kpnl and BsrGI digestion sites were added to the fragments by two rounds of PCR with Q5 polymerase, digested and inserted into 3^rd generation lentiviral vector with tetracycline response element and truncated HIV 3'LTR

[0063] For lentivirus generation, LentiX HEK293T cells (Clontech Inc.) at 70% confluency were transfected with 3^rd generation packaging vectors (REV, RRE and pMD 2.G) and ANRIL plasmid using calcium phosphate method. 24 hours after transfection the media was changed to DMEM 10% FBS, supplemented with sodium pyruvate and nonessential amino acids and l.lg/lOOml of lipid free BSA (Sigma Aldrich). Virus was harvested 48h after transfection, filtered through 0.45um low protein binding syringe filters (Millipore) and concentrated using LentiX concentrator (Clontech) according to the manufacturer instructions. The pellets with the virus were resuspended in CDM-PVA media. KO NN cells at D13 ofVSMC differentiation were co-infected with lentiviruses containing rtTA M2.2 and TetO ANRIL 11 or 12. After 24 hours, lOOng/ml of doxy cycline were added to the mediate induce ANRIL expression. After D17 cells were maintained in VSMCs media with doxy for 4 more days. Cells were maintained in culture without doxy for 4 passages (about 20 more days). RNA was collected at passage 1, 2 and 4.

[0064] Deep sequencing and analysis of CAD Risk region: The region was divided into three parts 25, 25, and 16kb and each of them was amplified from genomic DNA using PrimeStar GXL enzyme using the following program: 98C - lmin; Scycles: 98C- 15sec, 68C- 30sec (auto-delta -1 every cyde), 68C-15min; 34cycles: 98C- 15sec, 60C- 30sec, 68C - 15min; 72C - 3min; 4C - hold. The fragments were separated on 1% low melt agarose (Biorad) and purified by Agarase (NEB) treatment and isopropanol precipitation.

The PCR products were tagmented and amplified using NexteraXT (Illumina inc.) library preparation kit according to the manufacturers instructions. Fragments 550-600bp were selected using Bluepippin Prep (Sage Science) and sequenced with MiSeq using 2x300bp reads. The reads were aligned using Bowtie2 aligner and calls visually made using IGV.

[0065] RNA seq data analysis: Adapter sequences were removed using

Trimmomatic PE v0.32. Reads were aligned using STAR aligner v2.3.0 to the human genome (hgl9) and UCSC Genes reference transcriptome with default parameters. Read counts per gene were quantified with HTseq. To remove genes with low expression levels, raw read counts were transformed to counts per million (CPM) and averaged within groups being compared. Genes with CPM values below 10 on average were excluded from the enrichment analyses and heatmaps. For differential expression analysis, raw counts were normalized using the variance stabilizing transformation and differentially expressed genes were identified using the DEseq function implemented in the DESeq2 R package (v1.8.2). For identification of ANRIL splicing junctions, we used samtools 1.3 to pool STAR aligned reads and IGV 2.3.80 (Integrative Genomics Viewer, Thorvaldsdottir et al 2013) for visualization. A minimum of two reads must span a junction. For visualization batch effects were removed by the COMBAT function from the SVA R package (Surrogate Variable Analysis v3.18.0). The heatmaps were made using gplots. Principal component plots we generated with the rgl (Adler, 2016) and pca3d R packages. Gene Onthology analysis was performed by using Panther Classification System (version 10.0 Released 2015-05-15) and DAVID Bioinformatics Resources 6.7.

[0066] Methods for detection of circular RNA from RNA-seq datasets: The reads that were trimmed by Trimomatic as described before, were aligned using STAR aligner with parameters recommended by DCC package for paired and unpaired reads, as described on DCC's github page. The DCC package was executed without -R option to increase sensitivity. DCC @samplesheet -mtl @mate1 -mt2 @mate2 -D -an genes. gtf -Pi -F -M - A genome. fa. The output tables with counts, coordinates and annotations were merge by locus d for further analysis.

[0067] Immunocytochemistry: Cultured cells were fixed using 4%

paraformaldehyde in PBS. Fixed samples were treated with 0.5% TritonXIOO in PBS for cytoplasmic and nuclear staining. Cells were then blocked with 5% FBS in PBS for 1 hour at room temperature. Blocking solution was aspirated and replaced with primary antibody in blocking buffer and incubated approximately 2 hours at room temperature, or overnight at 4C. Primary antibody solution was then aspirated, fixed samples washed three times with PBS, secondary antibody and DAPI in blocking buffer added to the washed samples, and incubated 45min-lhr at room temperature. Three additional PBS washes were performed after secondary antibody incubation, and the samples imaged with fluorescence microscopy. In the case of phalloidin staining, the secondary antibody-treated samples were incubated for 30min with the phalloidin-Alexa conjugate (following manufacturer protocol), followed by two washes with PBS. Stained samples were imaged on a Nikon Eclipse Ti at 4x, 10x, and/or 20x magnification. Antibodies used include: Tra-1-81 (Millipore Cat. MAB4381, 1:500), TRA-1-60 (Millipore Cat. MAB4360, 1:500), Nanog (Abcam Cat. ab21624, 1:200), a-Smooth Muscle Actin (Sigma Cat. A5228, 1:1000), Phalloidin (Life Tech Cat. A12379, 1:50), Nkx2.5 (SCBT Cat. sc-14033, 1:200), Transgelin (TAGLN; Abeam Cat. abl4106, 1:500), Calponinl (CNN1; Sigma Cat. C2687, 1:20,000).

[0068] DNA content Analysis: Cells at day 5 ofVSMC differentiation were detached by using TrypLE Express (Life Technologies), spun at 200g for 5 minutes. Pellet was washed in PBS and spun again. After PBS removal 70% cold EtOH was added dropwise while vortexing. Cells were incubated for 30 minutes at 4° C, and then spun at 200g for 5 minutes at 4° C. After washing twice with PBS, pellets were resuspended in Propidium Iodide staining solution (0.1%Triton in PBS + 20ug/ml PI + 200ug/ml RNAse A). Staining was performed overnight, and FACS analysis was performed the next day.

[0069] Cell Adhesion Strength Assay: 25 mm glass coverslips (Fisher Scientific, St. Louis, MO) were cleaned via sonication with ethanol and DI water before being incubated with 0.1% gelatin in DI H₂O (StemCell Technologies, Vancouver, CAN) for 60 minutes at room temperature. After allowing cells to attach for 24 hours at 37°C and 5%

CO₂, coverslips were then mounted on a custom-built spinning disc device in a temperature- controlled spinning buffer (37°C) containing phosphate buffered saline with 0.5 mM MgCh and 1 mM CaCl₂ (Cellgro, Manassas, VA) and 4.5 mg/mL dextrose (Fisher). Coverslips were spun for 5 min at defined angular velocities (2000, 3000, and 5000 rpm), fixed with 3.7% formaldehyde immediately after spinning, stained with 1:5000 Hoescht in DI H₂O for 15 minutes, and mounted with Fluoromount-G (Southern Biotech, Birmingham, AL). To obtain quantitative information of adhesion strength, coverslips were imaged at lOx magnification on a Nikon Ti-S microscope with motorized stage (~1000 individual images stitched together with Metamorph 7.6 software and custom macros) and cells positions from analyses performed by a custom written MATLAB script. Cell density as a function of radial position is normalized to a coverslip not subjected to shear and the center of each sheared coverslip. A sigmoidal fit is used to quantify adhesion strength, i.e. the point where 50% of cells remain attached.

[0070] Traction Force Microscopy: 12 mm glass coverslips (Fisher) were oxidized via UV/ozone exposure (BioForce Nanosciences, Ames, IA) followed by functionalization with 20 mM 3-(trimethoxysilyl)propyl methacrylate (Sigma- Aldrich, St. Louis, MO) in ethanol. A polymer solution containing 10%/0.1% acrylamideZbis-acrylamide (Fisher), 1% v/v of 10% ammonium persulfate (Fisher), and 0.1% v/v of N,N,N’,N’- Tetramethylethylenediamine (VWR International, Radnor, PA) was prepared. In addition, 2% v/v fluorescent 580/605 0.2 mm microspheres (Invitrogen, Carlsbad, CA) were added to the pre-polymer solution. 7 mL of polymerizing hydrogel solution was sandwiched between a functionalized coverslip and a dichlorodimethylsilane-treated glass slide and was allowed to polymerize for 15 minutes. 0.1% gelatin (StemCell Technologies) was coupled to the surface using N-sulphosuccinimidy l-6-(4^, -azido-2^, -nitropheny lamino) hexanoate (sulfo-SANPAH) as a protein-substrate linker. Hydrogels were incubated in 0.2 mg/ml sulfo-SANPAH (Fisher) in sterile 50 mM HEPES pH 8.5, activated with UV light (wavelength 350 nm, intensity 4 mW/cm²) for 10 minutes, washed three times in HEPES, and then incubated in 0.1% gelatin (BD Biosciences) overnight at 37°C. Following UV sterilization, cells were cultured on substrates for 48 hours at 37°C and 5% CO₂.

[0071] The microspheres underneath selected live cells were imaged with a 60x water confocal objective using a Nikon Eclipse TI-S microscope equipped with a CARV II confocal system (BD Biosciences) and motorized stage. Images were acquired on a Cool- Snap HQ camera (Photometries) controlled by Metamorph (Molecular Devices). Cells were released with 2.5% trypsin (Fisher) and the same confocal stacks acquired. Bead

displacements were determined using a particle image velocimetry script in Matlab

(MathWorks) and normalized to cell area.

[0072] Gel Contraction Assay: Cells were detached from substrates using Tryple (Thermo Fisher Scientific, Waltham, MA) as previously described and suspended in lx DMEM (Thermo) containing 10% fetal bovine serum (Gemini Bio-products, West

Sacramento, CA). 80 mL of 6x DMEM, 400 mL of 3 mg/mL type 1 rat tail collagen

(Coming Incorporated, Coming, NY), and 120 mL of cell suspension at a final concentration of 0.2 million cells/mL were placed in a 24-well plate and allowed to polymerize at 37oC and 5% C02 for one hour. To assess smooth muscle cell contractility in the presence of contractile agonist and antagonist, a final concentration of 10 nM bradykinin or 0.5 mM cytochalasinD (Sigma- Aldrich, St. Louis, MO) was added to cell suspension media. After 24 hours at 37oC and 5% C02, lmL of lx DMEM + 10% FBS was added to each well. Images of the gels were taken at each subsequent 24 hour period until 8 days in culture. The diameter of each gel was measured using ImageJ software (NIH, Bethesda, Maryland) and normalized to the initial gel diameter on day 0.

***

[0073] It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are described.

[0074] All patents, patent applications, published applications and publications, GenBank sequences, databases, ATCC deposits, websites and other published materials referred to throughout the entire disclosure herein, unless noted otherwise, are incorporated by reference in their entirety and for all purposes as if each is individually so denoted.

Claims

WE CLAIM:

1. A mefliod for identifying an agent for treating or ameliorating symptoms of cardiovascular diseases (CVDs), comprising (a) contacting a plurality of candidate compounds with induced pluripotent stem cells (iPSCs) bearing CVD risk 9p21.3 haplotype, (b) examining the compounds-contacted iPSCs’ differentiation into vascular smooth muscle cells (“VSMC differentiation”), and (c) examining VSMC differentiation of negative control cells, which are the same iPSCs not contacted with the candidate compounds; wherein an improved VSMC differentiation of iPSCs contacted with a specific candidate compound, relative to that of the negative control cells, identifies the specific candidate compound as an agent for treating or ameliorating symptoms of CVDs.

2. The method of claim 1, wherein the iPSCs bearing CVD risk 9p21.3 haplotype are generated from peripheral blood mononuclear cells from subjects bearing CVD risk 9p21.3 haplotype.

3. The method of claim 1, further comprising examining VSMC

differentiation of positive control cells, which are iPSCs bearing no CVD risk haplotype.

4. The method of claim 3, wherein the iPSCs bearing no CVD risk 9p21.3 haplotype are generated from PBMCs of healthy subjects.

5. The method of claim 3, wherein the positive control cells are contacted with the identified specific candidate compound.

6. The method of claim 1, wherein VSMC differentiation of the iPSCs is examined by detecting and/or quantifying production of mesodermal progenitor like cells (MP) or mature VSMCs from the iPSCs.

7. The method of claim 1, further comprising examining one or more genetic or cellular characters of VSMCs generated from the iPSCs.

8. The method of claim 7, wherein the genetic or cellular characters are expression of genes associated with CVD risk loci or genes involved in processes relevant to VSMC function.

9. The method of claim 8, wherein improved VSMC differentiation of the iPSCs is decreased expression of ANRIL isoforms.

10. The method of claim 7, wherein the genetic or cellular characters are cellular functions of the VSMCs.

11. The method of claim 10, wherein the cellular functions are VSMC adhesion, contraction or proliferation.

12. The method of claim 10, wherein improved VSMC differentiation of the iPSCs is increased VSMC adhesion and/or contraction.

13. The method of claim 10, wherein improved VSMC differentiation of the iPSCs is decreased proliferation of mesodermal progenitor like cells (MP).

14. The method of claim 1, wherein the candidate compounds are inhibitory nucleic acid molecules.

15. The method of claim 14, wherein the inhibitory nucleic acid molecules are antisense oligonucleotides.

16. The method of claim 1, wherein the candidate compounds are a combinatorial library of compounds.

17. The method of claim 16, wherein the candidate compounds are small organic compounds.

18. A method for identifying an agent for treating or ameliorating symptoms of cardiovascular diseases (CVDs), comprising (a) contacting a plurality of candidate compounds with a cell expressing one or more ANRIL isoforms, (b) quantifying expression levels of the one or more ANRIL isoforms to identify a specific compound that down- regulates expression levels of the one or more ANRIL isoforms, and (c) examining effect of the identified compound on iPSCs’ differentiation into vascular smooth muscle cells (VSMCs) or function of the differentiated VSMCs; wherein an improved VSMC differentiation or function identifies the specific compound as an agent for treating or ameliorating symptoms of CVDs.

19. The method of claim 18, wherein the candidate compounds are small inhibitory oligonucleotides targeting the one or more ANRIL isoforms.

20. The method of claim 18, wherein the one or more ANRIL isoforms are human ANRIL transcript variants 11 and 12.