WO2020051243A1 - Lipid nanoparticles and methods of using thereof - Google Patents

Lipid nanoparticles and methods of using thereof Download PDF

Info

Publication number
WO2020051243A1
WO2020051243A1 PCT/US2019/049590 US2019049590W WO2020051243A1 WO 2020051243 A1 WO2020051243 A1 WO 2020051243A1 US 2019049590 W US2019049590 W US 2019049590W WO 2020051243 A1 WO2020051243 A1 WO 2020051243A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
mol
composition
lipid
functional nucleic
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2019/049590
Other languages
French (fr)
Inventor
Robert Lee
Xinwei CHENG
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ohio State Innovation Foundation
Original Assignee
Ohio State Innovation Foundation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ohio State Innovation Foundation filed Critical Ohio State Innovation Foundation
Publication of WO2020051243A1 publication Critical patent/WO2020051243A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/06Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/30Macromolecular organic or inorganic compounds, e.g. inorganic polyphosphates
    • A61K47/42Proteins; Polypeptides; Degradation products thereof; Derivatives thereof, e.g. albumin, gelatin or zein
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/0012Galenical forms characterised by the site of application
    • A61K9/0019Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/48Preparations in capsules, e.g. of gelatin, of chocolate
    • A61K9/50Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals
    • A61K9/51Nanocapsules; Nanoparticles
    • A61K9/5107Excipients; Inactive ingredients
    • A61K9/5176Compounds of unknown constitution, e.g. material from plants or animals
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • C12N2320/31Combination therapy
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • C12N2320/32Special delivery means, e.g. tissue-specific

Definitions

  • Lung cancer is the leading cause of cancer related deaths in the United States. Approximately 150,000 Americans died from lung cancer in 2017, which accounted for nearly 25 percent of all cancer deaths. In advanced stages lung cancer readily metastasizes to other organs, which abrogate the effectiveness of surgery and conventional therapy.
  • Chemotherapeutics such as paclitaxel and cisplatin, are currently employed in treatment for lung cancer. However, these agents have serious adverse side effects and have limited efficacy. Cervical carcinoma is another aggressive cancer that affects over 500,000 women worldwide each year with nearly half of patients succumbing to this disease. Response rates are higher for combination chemotherapy over monotherapy. However, treatment is frequently associated with severe effects. Accordingly, improved compositions and methods for the treatment of cancer are needed.
  • lipid nanoparticles encapsulating a therapeutic cargo as well as pharmaceutical compositions comprising the lipid nanoparticles in combination with one or more pharmaceutically acceptable excipients.
  • the composition can comprise a sterile solution, a sterile suspension, or a lyophilized powder.
  • the lipid nanoparticles are formed from a lipid mixture that comprises a cationic lipid, a phospholipid, and a targeting conjugate.
  • the lipid mixture can further comprise one or more additional lipids, such as a neutral lipid, a polymer-lipid conjugate, or a combination thereof.
  • the lipid nanoparticle can have a zeta potential of from 0 to +40 mV.
  • the lipid nanoparticle can have a diameter of less than 300 nm (e.g., from 50 nm to 200 nm).
  • the cationic lipid can comprise from 25 mol % to 45 mol % of the lipid mixture.
  • the cationic lipid can comprise a tertiary amine-cationic lipid (e.g., a tertiary amine-cationic lipid selected from the group consisting ofN-[l-(2, 3- dioleyloyx) propyl] -N-N-N-dimethyl ammonium chloride (DODMA), l,2-dioleoyl-3- dimethylammonium-propane (DODAP), 3P-
  • a tertiary amine-cationic lipid e.g., a tertiary amine-cationic lipid selected from the group consisting
  • the cationic lipid can comprise a quaternary amine-cationic lipid (e.g., a quaternary amine-cationic lipid selected from the group consisting of l,2-dioleoyl-3-trimethylammonium-propane (DOTAP), N-[l-(2, 3-dioleyloyx) propyl]-N— N— N-trimethyl ammonium chloride (DOTMA), dimethyldioctadecylammonium bromide (DDAB), or combinations thereof).
  • DOTAP l,2-dioleoyl-3-trimethylammonium-propane
  • DOTMA N-[l-(2, 3-dioleyloyx) propyl]-N— N— N-trimethyl ammonium chloride
  • DDAB dimethyldioctadecylammonium bromide
  • the phospholipid can comprise from 30 mol % to 50 mol % of the lipid mixture.
  • the phospholipid can comprise a phosphatidylcholine (e.g., an egg phosphatidylcholine).
  • the targeting conjugate can comprise from 0.05 mol % to 5 mol % of the lipid mixture.
  • the targeting conjugate can comprise a targeting agent bound to a lipid via a polymeric linker.
  • the targeting agent can comprise a T7 peptide.
  • the targeting conjugate can be, for example, T7-PEG-CHEMS (T7- polyethylene glycol-cholesteryl hemisuccinate), T7-PEG-DSPE (T7-poly ethylene glycol- distearoyl phosphatidylethanolamine), or a combination thereof.
  • the lipid mixture further comprises a neutral lipid (e.g., cholesterol).
  • a neutral lipid e.g., cholesterol
  • the lipid mixture can comprise from 10 mol % to 30 mol % of a neutral lipid.
  • the lipid mixture further comprises a polymer-lipid conjugate.
  • the lipid mixture can comprise from 0.5 mol % to 15 mol % of a polymer-lipid conjugate.
  • the polymer-lipid conjugate can comprise l,2-distearoyl-sn- glycero-3-phosphoethanolamine-N-PEG (DSPE-PEG), dimyristoylphosphatidylethanolamine- PEG (DMPE-PEG), dipalmitoylphosphatidlyethanolamine-PEG (DPPE-PEG), 1 , 2- dimyristoyl-sn-glycerol and methoxypolyethylene glycol (DMG-PEG), or a combination thereof.
  • the lipid mixture can comprise from 30 mol % to 40 mol % cationic lipid, from 35 mol % to 45 mol % phospholipid, from 15 mol % to 25 mol % neutral lipid, from 0.05 mol % to 2 mol % targeting conjugate; and from 1 mol % to 10 mol % polymer-lipid conjugate.
  • the lipid mixture can comprise from 30 mol % to 40 mol % N-[l-(2, 3-dioleyloyx) propyl] -N-N-N-dimethyl ammonium chloride
  • the therapeutic cargo encapsulated in the lipid nanoparticles can comprise a functional nucleic acid which modulates the expression of Akt-l; and a functional nucleic acid which modulates the expression of Bcl-2.
  • the functional nucleic acid which modulates the expression of Akt-l and the functional nucleic acid which modulates the expression of Bcl-2 can be present at a molar ratio of from 5: 1 to 1 : 5. In some embodiments, the functional nucleic acid which modulates the expression of Akt-l and the functional nucleic acid which modulates the expression of Bcl-2 can be present at a molar ratio of from 1 : 1 to 5: 1 (e.g., a molar ratio of from 1 : 1 to 3: 1)
  • the functional nucleic acid which modulates the expression of Akt-l can be a plasmid DNA (pDNA), an antisense oligonucleotide (ASO), small interfering RNA (siRNA), small hairpin RNA (shRNA), microRNA (miR), anti-miRs, or a combination thereof.
  • the functional nucleic acid can be stabilized by modifications to substituent nucleic acid base units, by phosphorothioate substitution of phosphodiester linkers, and/or by 2'-0-methylation (2’-OMe) of ribose units.
  • the functional nucleic acid which modulates the expression of Akt-l can comprise an antisense oligonucleotide (ASO) targeted to a portion of a nucleic acid encoding Akt-l.
  • ASO antisense oligonucleotide
  • the functional nucleic acid can be defined by 5’-gcu GCT TGATCT CCT TG gcg-3’ (SEQ ID NO:4), wherein the lower-case letters indicate 2’-OMe modification.
  • the functional nucleic acid which modulates the expression of Bcl-2 can be a plasmid DNA (pDNA), an antisense oligonucleotide (ASO), small interfering RNA (siRNA), small hairpin RNA (shRNA), microRNA (miR), anti-miRs, or a combination thereof.
  • the functional nucleic acid can be stabilized by modifications to substituent nucleic acid base units, by phosphorothioate substitution of phosphodiester linkers, and/or by 2'-0-methylation of ribose units.
  • the functional nucleic acid which modulates the expression of Bcl-2 can comprise an antisense oligonucleotide (ASO) targeted to a portion of a nucleic acid encoding Bcl-2.
  • ASO antisense oligonucleotide
  • the functional nucleic acid can be defined by 5’- ucu CCC AGC GTG CGC cau-3’ (SEQ ID NO:2), wherein the lower-case letters indicate 2’- OMe modification.
  • the pharmaceutical composition can further comprise an additional therapeutic agent, such as an antineoplastic agent, anti-infective agent, local anesthetic, anti-allergic, antianemic, angiogenesis inhibitor, beta-adrenergic blocker, calcium channel antagonist, anti-hypertensive agent, anti-depressant, anti-convulsant, anti-bacterial, anti-fungal, anti-viral, anti-rheumatic, anthelminithic, antiparasitic agent, corticosteroid, hormone, hormone antagonist, immunomodulator, neurotransmitter antagonist, anti-diabetic agent, anti-epileptic, anti-hemmorhagic, anti-hypertonic, antiglaucoma agent, immunomodulatory cytokine, sedative, chemokine, vitamin, toxin, narcotic, imaging agent, or combination thereof.
  • the additional therapeutic agent can be encapsulated within the lipid nanoparticle, or otherwise dissolved or dispersed in the pharmaceutical composition (e.g., dissolved,
  • the methods can comprise contacting the cancer cell with a lipid nanoparticle described herein or a
  • the cancer can be, for example, brain cancer, bladder cancer, lung cancer, breast cancer, melanoma, skin cancer, epidermal carcinoma, colon and rectal cancer, non-Hodgkin lymphoma, endometrial cancer, pancreatic cancer, kidney (renal cell) cancer, prostate cancer, leukemia thyroid cancer, head and neck, ovarian cancer, hepatocellular cancer, cervical cancer, sarcomas, gastric cancers, multiple myeloma, lymphomas, and gastrointestinal cancer, and uterine cancer.
  • Figure 1 is a photograph showing the syringe pump system with dual syringes operating at a programed rate that was used to prepare the ASOs-LNPs formulations. Oligos and lipids from two syringes were combined in the Y-tubing and further mixed in the 20G blunt needle under laminar flow. This system enabled controlled LNP assembly and reproducible production of small nanoparticles.
  • Figure 2 is a plot showing the colloidal stability of ASOs-LNPs formulations with different lipid compositions. LNPs were stored at 4 °C for up to 30 days. The values represent the average of three separate measurements.
  • Figure 3 is an isobologram of RX-020l-GAP-LNPs and G3l39-GAP-LNPs in A549 cells.
  • the ICrio additive isobole is a straight line between points A and B.
  • a and B indicate the IC50 values of RX-020l-GAP-LNPs and G3l39-GAP-LNPs.
  • the solid dots represent the IC50 values of different treatment groups.
  • the dots above the straight line indicates antagonism and the dots below the additive isobole suggest synergism.
  • Figure 4 shows the uptake of the T7-FAM-ASO-LNPs, FAM-ASO-LNPs and Free FAM-ASO by A549 cells.
  • ASO was labeled green.
  • the cells were stained with DAPI (blue), wheat germ agglutinin (WGA) (red) and were analyzed by confocal microscopy. The scale bar was 25 pm.
  • Figures 5A-5B show Bcl-2 and Akt-l mRNA and protein levels expression after various treatments of ASO-LNPs in A549 and KB cells.
  • Figure 5A shows the relative Bcl-2 and Akt-l mRNA and protein expressions to b-actin in A549 cells after 1 mM ASOs-LNPs treatments.
  • Figures 6A-6B show immunohistochemical staining for the Bcl-2 (Figure 6A) and Akt- 1 (Figure 6B) in the A549 tumor sections.
  • Tumor sections from left to right, top to bottom were from mice treated with PTX + T7-Co-ASOs-LNPs (G:R 1 :2), PTX + Co- ASOs-LNPs (G:R 1 :2), PTX, and saline.
  • the scale bar is 50pm.
  • Figure 7 shows IVIS Lumina XR in vivo imaging of ASO distribution at tumor sites.
  • Athymic BALB/c mice were injected with T7-conjugated FAM-G3l39-LNPs, or FAM-G3139- LNPs, Free FAM-G3139, or saline control. The mice were imaged at l2h after injection.
  • Figures 8A-8B show tumor inhibition and survival extension by treatment with ASO- LNPs and PTX combinations.
  • Figure 8A shows tumor inhibition effects with combination treatments of PTX and ASOs-LNPs.
  • A549 tumor bearing mice were treated with PTX + T7- Co- ASOs-LNPs (G:R 1:2), or PTX + Co-ASOs-LNPs (G:R 1 :2), or PTX + G3139-GAP- LNPs, or PTX + RX-020l-GAP-LNPs, or PTX + Free ASOs (G:R 1:2), or PTX, or saline control. Tumor volumes were measured for approximately 30 days.
  • Figure 8B shows a Kaplan- Meier analysis that was utilized to monitor the median survival time of the A549 tumor bearing mice.
  • the treatment groups were PTX + T7-Co-ASOs-LNPs (G:R 1 :2), or PTX + Co-ASOs- LNPs (G:R 1 :2), or PTX + G3l39-GAP-LNPs, or PTX + RX-020l-GAP-LNPs, or PTX + Free ASOs (G:R 1:2), or Saline control.
  • Figure 9 is a schematic illustration of the therapeutic strategy employed in Example 1.
  • lipid nanoparticles encapsulating a therapeutic cargo as well as pharmaceutical compositions comprising the lipid nanoparticles in combination with one or more pharmaceutically acceptable excipients.
  • the lipid nanoparticles can be used to deliver therapeutic agents, including anti-cancer agents.
  • a liposome is a vesicle composed of one or more lipid bilayers, capable of carrying hydrophilic molecules within an aqueous core or hydrophobic molecules within its lipid bilayer(s).
  • “Lipid nanoparticles” is a general term to described lipid- based particles in the submicron range. LNs can have structural characteristics of liposomes and/or have alternative non-bilayer types of structures. Drug delivery by LNs via systemic route requires overcoming several physiological barriers. The reticuloendothelial system (RES) is responsible for clearance of LNs from the circulation. Once escaping the vasculature and reaching the target cell, LNs are typically taken up by endocytosis and must release the drug into the cytoplasm prior to degradation within acidic endosome conditions.
  • RES reticuloendothelial system
  • NAs functional nucleic acids
  • siRNA siRNA
  • oligonucleotide oligonucleotide
  • ON oligonucleotide
  • the lipid nanoparticles described herein can (1) protect the drug (e.g., a functional nucleic acid) from enzymatic degradation; (2) transverse the capillary endothelium; (3) specifically reach the target cell type without causing excessive immunoactivation or off-target cytotoxicity; (4) promote endocytosis and endosomal release; and (5) form a stable formulation with colloidal stability and long shelf-life.
  • the lipid nanoparticles may partition hydrophobic molecules within the lipid membrane and/or encapsulate water-soluble particles within the aqueous core.
  • the lipid nanoparticle can have a zeta potential of from 0 to +40 mV.
  • the lipid nanoparticle can have a diameter of less than 300 nm (e.g., from 50 nm to 200 nm).
  • the lipid nanoparticles can be formed from a lipid mixture the comprises a cationic lipid, a phospholipid, and a targeting conjugate.
  • the lipid mixture can further comprise one or more additional lipids, such as a neutral lipid, an anionic lipid, a polymer-lipid conjugate, or a combination thereof.
  • the lipid mixture can include one or more cationic lipids.
  • Cationic lipids are lipids that carry a net positive charge at any physiological pH. The positive charge can be used for association with negatively charged therapeutics such as ASOs via electrostatic interaction.
  • Suitable cationic lipids include, but are not limited to: 3b-[N— (N',N'-dimethylaminoethane)- carbamoyljcholesterol hydrochloride (DC-Chol); l,2-dioleoyl-3-trimethylammonium-propane (DOTAP); l,2-dioleoyl-3-dimethylammonium-propane (DODAP);
  • DDAB dimethyldioctadecylammonium bromide salt
  • DL-EPC dimethyldioctadecylammonium bromide salt
  • DODAC N-(l-(2,3- dioleyloxy)propyl)-N-2-(sperminecarboxamido)ethyl)-N,N-dimethylammonium trifluora
  • TRANSFECTAM from Promega
  • TRANSFECTIN from Bio-Rad Laboratories, Inc.
  • the cationic lipid can comprise a tertiary amine-cationic lipid (e.g., a tertiary amine-cationic lipid selected from the group consisting ofN-[l-(2, 3-dioleyloyx) propyl]-N-N-N-dimethyl ammonium chloride (DODMA), l,2-dioleoyl-3-dimethylammonium- propane (DODAP), 3P-
  • a tertiary amine-cationic lipid e.g., a tertiary amine-cationic lipid selected from the group consisting ofN-[l-(2, 3-dioleyloyx) propyl]-N-N-N-d
  • the cationic lipid can comprise a quaternary amine-cationic lipid (e.g., a quaternary amine-cationic lipid selected from the group consisting of l,2-dioleoyl-3-trimethylammonium- propane (DOTAP), N-[l-(2, 3-dioleyloyx) propyl]-N— N— N-trimethyl ammonium chloride (DOTMA), dimethyldioctadecylammonium bromide (DDAB), or combinations thereof).
  • DOTAP l,2-dioleoyl-3-trimethylammonium- propane
  • DOTMA N-[l-(2, 3-dioleyloyx) propyl]-N— N— N-trimethyl ammonium chloride
  • DDAB dimethyldioctadecylammonium bromide
  • the cationic lipid can comprise at least 25 mol % (e.g., at least 30 mol %, at least 35 mol %, or at least 40 mol %) of the lipid mixture. In some embodiments, the cationic lipid can comprise 45 mol % or less (e.g., 40 mol % or less, 35 mol % or less, or 30 mol % or less).
  • the cationic lipid can be present in the lipid mixture at a molar ratio ranging from any of the minimum values described above to any of the maximum values described above.
  • cationic lipid can comprise from 25 mol % to 45 mol % (e.g., from 30 mol % to 40 mol %) of the lipid mixture.
  • the lipid mixture can further include one or more phospholipids.
  • phospholipids include glycerophospholipids, such as phosphatidic acid (phosphatidate) (PA), phosphatidylethanolamine (cephalin) (PE), phosphatidylcholine (lecithin) (PC),
  • PS phosphatidylserine
  • PI phosphatidylinositol
  • PIP phosphatidylinositol phosphate
  • PIP2 phosphatidylinositol bisphosphate
  • PIP3 phosphatidylinositol trisphosphate
  • PIP3 phosphosphingolipids, such as ceramide phosphorylcholine (sphingomyelin) (SPH), ceramide phosphorylethanolamine
  • the phospholipid can comprise a phosphatidylcholine (e.g., an egg phosphatidylcholine).
  • the phospholipid can comprise at least 30 mol % (e.g., at least 35 mol %, at least 40 mol %, or at least 45 mol %) of the lipid mixture. In some embodiments, the phospholipid can comprise 50 mol % or less (e.g., 45 mol % or less, 40 mol % or less, 35 mol % or less, or 30 mol % or less).
  • the phospholipid can be present in the lipid mixture at a molar ratio ranging from any of the minimum values described above to any of the maximum values described above.
  • phospholipid can comprise from 30 mol % to 50 mol % (e.g., from 35 mol % to 45 mol %) of the lipid mixture.
  • the targeting conjugate can comprise a targeting agent bound to a lipid via a polymeric linker.
  • the addition of targeting agents to the LN can provide increased efficacy over passive targeting approaches.
  • Targeting involves incorporation of specific targeting moieties such as, but not limited to, ligands or antibodies, cell surface receptors, peptides, lipoproteins, glycoproteins, hormones, vitamins, antibodies, antibody fragments, prodrugs, and conjugates or combinations of these moieties.
  • targeting agents include folate, cRGD (e.g., cyclo(Arg-Gly-Asp-D-Phe-Cys) (RGDfC)) peptides, galactose-containing moieties, transferrin, EPPT1 peptide, low density lipoprotein, epidermal growth factors, and antibodies.
  • cRGD can refer to any derivative of or related cRGD peptide, for example, cRGDfC, cRGDfK, cRGDfE, etc.
  • the cRGD peptide is cRGDfC (cyclo(Arg- Gly-Asp-D-Phe-Cys)).
  • the targeting agent can comprise a T7 peptide.
  • the targeting conjugate can comprise a targeting agent bound to a lipid described herein via a polymeric linker.
  • the polymeric linker can comprise a hydrophilic polymer, such as polyvinyl alcohol (PVA) or a polyalkylene oxide (e.g., polyethylene glycol).
  • PVA polyvinyl alcohol
  • polyalkylene oxide e.g., polyethylene glycol
  • the molecular weight of the polymeric linker, such as PEG can be from about 100 and about 10,000 Da, from about 100 and about 5,000 Da or from about 100 to about 2,000 Da.
  • the targeting conjugate can be, for example, T7-PEG- CHEMS (T7-polyethylene glycol-cholesteryl hemisuccinate), T7-PEG-DMPE (T7- polyethylene glycol-dimyristoylphosphatidylethanolamine), T7-PEG-DPPE (T7-poly ethylene glycol- dipalmitoylphosphatidylethanolamine), T7-PEG-DSPE (T7-polyethylene glycol- distearoyl phosphatidylethanolamine), or a combination thereof.
  • T7-PEG- CHEMS T7-polyethylene glycol-cholesteryl hemisuccinate
  • T7-PEG-DMPE T7- polyethylene glycol-dimyristoylphosphatidylethanolamine
  • T7-PEG-DPPE T7-poly ethylene glycol- dipalmitoylphosphatidylethanolamine
  • T7-PEG-DSPE T7-polyethylene glycol- distearoyl
  • the targeting conjugate can comprise at least 0.05 mol % (e.g., at least 0.1 mol %, at least 0.5 mol %, at least 1 mol %, at least 2 mol %, at least 3 mol %, or at least 4 mol %) of the lipid mixture.
  • the targeting conjugate can comprise 5 mol % or less (e.g., 4 mol % or less, 3 mol % or less, 2 mol % or less, 1 mol % or less, 0.5 mol % or less, or 0.1 mol % or less).
  • the targeting conjugate can be present in the lipid mixture at a molar ratio ranging from any of the minimum values described above to any of the maximum values described above.
  • targeting conjugate can comprise from 0.05 mol % to 5 mol % (e.g., from 0.1 mol % to 1 mol %) of the lipid mixture.
  • the lipid mixture can include a neutral lipid.
  • Neutral lipids have zero net charge at physiological pH.
  • One or a combination of several neutral lipids may be included in any LN formulation disclosed herein.
  • Suitable neutral lipids include, but are not limited to:
  • sterols such as cholesterol, demosterol, sitosterol, zymosterol, diosgenin, lanostenol, stigmasterol, lathosterol, and dehydroepiandrosterone, and combinations thereof.
  • the neutral lipid can comprise at least 10 mol % (e.g., at least 15 mol %, at least 20 mol %, or at least 25 mol %) of the lipid mixture. In some embodiments, the neutral lipid can comprise 30 mol % or less (e.g., 25 mol % or less, 20 mol % or less, or 15 mol % or less).
  • the neutral lipid can be present in the lipid mixture at a molar ratio ranging from any of the minimum values described above to any of the maximum values described above.
  • neutral lipid can comprise from 10 mol % to 30 mol % (e.g., from 15 mol % to 25 mol %) of the lipid mixture.
  • the lipid mixture can further comprise an anionic lipid.
  • Anionic lipids are lipids that carry a net negative charge at physiological pH. These lipids, when combined with cationic lipids, are used to reduce the overall surface charge of LNs and introduce pH-dependent disruption of the LN bilayer structure, facilitating nucleotide release by inducing nonlamellar phases at acidic pH or induce fusion with the cellular membrane.
  • anionic lipids include, but are not limited to: fatty acids such as oleic, linoleic, and linolenic acids; cholesteryl hemisuccinate (CHEMS); l,2-di-0-tetradecyl-sn-glycero-3-phospho-(l'-rac- glycerol) (Diether PG); l,2-dimyristoyl-sn-glycero-3-phospho-(l'-rac-glycerol) (sodium salt); l,2-dimyristoyl-sn-glycero-3-phospho-L-serine (sodium salt); l-hexadecanoyl,2-(9Z,l2Z)- octadecadienoyl-sn-glycero-3-phosphate; l,2-dioleoyl-sn-glycero-3-[phospho-rac-(l-glycerol)] (CHEMS
  • the anionic lipid can comprise at least 5 mol % (e.g., at least 10 mol %, at least 15 mol %, or at least 20 mol %) of the lipid mixture. In some embodiments, the anionic lipid can comprise 25 mol % or less (e.g., 20 mol % or less, 15 mol % or less, or 10 mol % or less). The anionic lipid can be present in the lipid mixture at a molar ratio ranging from any of the minimum values described above to any of the maximum values described above. For example, anionic lipid can comprise from 5 mol % to 25 mol % (e.g., from 10 mol % to 20 mol %) of the lipid mixture.
  • the lipid mixture further comprises a polymer-lipid conjugate. Charged
  • the lipid mixture can include hydrophilic polymers such as polyethylene glycol (PEG) conjugated to a lipid anchor to discourage LN aggregation or interaction with membranes.
  • Hydrophilic polymers may be covalently bonded to lipid components (e.g., any of the lipids described herein) or conjugated using crosslinking agents to functional groups such as amines.
  • Suitable hydrophilic polymers for conjugation and hydrophilic polymer conjugates include, but are not limited to, polyvinyl alcohol (PVA) and polyalkylene oxides, such as polyethylene glycol.
  • the molecular weight of the hydrophilic polymer used can be from about 100 and about 10,000 Da, from about 100 and about 5,000 Da or from about 100 to about 2,000 Da.
  • the polymer-lipid conjugate can comprise l,2-distearoyl-sn-glycero-3- phosphoethanolamine-N-PEG (DSPE-PEG), dimyristoylphosphatidylethanolamine-PEG (DMPE-PEG), dipalmitoylphosphatidlyethanolamine-PEG (DPPE-PEG), 1, 2-dimyristoyl-sn- glycerol and methoxypolyethylene glycol (DMG-PEG), or a combination thereof.
  • DSPE-PEG dimyristoylphosphatidylethanolamine-PEG
  • DPPE-PEG dipalmitoylphosphatidlyethanolamine-PEG
  • DMG-PEG methoxypolyethylene glycol
  • the polymer-lipid conjugate can comprise at least 0.5 mol %
  • the polymer-lipid conjugate can comprise 15 mol % or less (e.g., 10 mol % or less, 5 mol % or less, or 1 mol % or less).
  • polymer-lipid conjugate can be present in the lipid mixture at a molar ratio ranging from any of the minimum values described above to any of the maximum values described above.
  • polymer-lipid conjugate can comprise from 0.5 mol % to 15 mol % (e.g., from 1 mol % to 10 mol %) of the lipid mixture.
  • the lipid mixture can comprise from 30 mol % to 40 mol % cationic lipid, from 35 mol % to 45 mol % phospholipid, from 15 mol % to 25 mol % neutral lipid, from 0.05 mol % to 2 mol % targeting conjugate; and from 1 mol % to 10 mol % polymer-lipid conjugate.
  • the lipid mixture can comprise from 30 mol % to 40 mol % N-[l-(2, 3-dioleyloyx) propyl] -N-N-N-dimethyl ammonium chloride
  • DODMA dihydroxy phosphatidylcholine
  • phosphatidylcholine from 35 mol % to 45 mol % phosphatidylcholine, from 15 mol % to 25 mol % cholesterol, from 0.05 mol % to 2 mol % T7-PEG-DSPE (T7-poly ethylene glycol-distearoyl phosphatidylethanolamine), and from 1 mol % to 10 mol % 1, 2-dimyristoyl-sn-glycerol and methoxypolyethylene glycol (DMG-PEG).
  • DMG-PEG 2-dimyristoyl-sn-glycerol and methoxypolyethylene glycol
  • the LN formulations described here may further comprise cationic polymers or conjugates of cationic polymers.
  • Cationic polymers or conjugates thereof may be used alone or in combination with lipid nanocarriers.
  • Suitable cationic polymers include, but are not limited to: polyethylenimine (PEI); pentaethylenehexamine (PEHA); spermine; spermidine; poly(L-lysine); poly(amido amine) (PAMAM) dendrimers; polypropyleneiminie dendrimers; poly(2-dimethylamino ethyl)-methacrylate (pDMAEMA); chitosan; tris(2-aminoethyl)amine and its methylated derivatives; and combinations thereof.
  • PEI polyethylenimine
  • PEHA pentaethylenehexamine
  • spermine spermine
  • spermidine poly(L-lysine)
  • PAMAM poly(amido amine) dendrimers
  • Anionic polymers may also be incorporated into the LN formulations presently disclosed as well.
  • Suitable anionic polymers include, but are not limited to: poly(propylacrybc acid) (PPAA); poly(glutamic acid) (PGA); alginates; dextrans; xanthans; derivatized polymers; and combinations thereof.
  • LN preparation is suitable to synthesize the LNs of the present disclosure, including methods known in the art. For example, ethanol dilution, freeze-thaw, thin film hydration, sonication, extrusion, high pressure homogenization, detergent dialysis, microfluidization, tangential flow diafiltration, sterile filtration, and/or lyophilization may be utilized. Additionally, several methods may be employed to decrease the size of the LNs. For example, homogenization may be conducted on any devices suitable for lipid homogenization such as an Avestin Emulsiflex C5. Homogenized LNs may be recycled back into circulation for extended homogenization.
  • Extrusion may be conducted on a Lipex Biomembrane extruder using a polycarbonate membrane of appropriate pore size (0.05 to 0.2 pm). Multiple particle size reduction cycles may be conducted to minimize size variation within the sample and achieve a desired size.
  • the resultant LNs may then be passed through a Sepharose CL4B to remove excess reagents or processed by tangential flow diafiltration.
  • LNs Physical characterization of the LNs can be carried through many methods. Dynamic light scattering (DLS) or atomic force microscopy (AFM) can be used to determine the average diameter and its standard deviation. Ideally, LNs should fall under 200 nm in diameter. Zeta potential measurement via zeta potentiometer is useful in determining the relative stability of particles. Both dynamic light scattering analysis and zeta potential analysis may be conducted with diluted samples in deionized water or appropriate buffer solution. Cryogenic transmission electron microscopy (Cryo-TEM) and scanning electron microscopy (SEM) may be used to determine the detailed morphology of LNs.
  • DLS Dynamic light scattering
  • AFM atomic force microscopy
  • Zeta potential measurement via zeta potentiometer is useful in determining the relative stability of particles. Both dynamic light scattering analysis and zeta potential analysis may be conducted with diluted samples in deionized water or appropriate buffer solution.
  • LNs described herein are stable under refrigeration for several months. LNs requiring extended periods of time between synthesis and administration may be lyophilized using standard procedures. A cryoprotectant such as 10% sucrose may be added to the LN suspension prior to freezing to maintain the integrity of the formulation. Freeze drying loaded LN formulations is recommended for long term stability.
  • the therapeutic cargo encapsulated in the lipid nanoparticles can comprise a functional nucleic acid which modulates the expression of Akt-l; and a functional nucleic acid which modulates the expression of Bcl-2.
  • Functional nucleic acids are nucleic acid molecules that have a specific function, such as binding a target molecule or catalyzing a specific reaction.
  • Functional nucleic acid molecules can be divided into the following categories, which are not meant to be
  • functional nucleic acids include antisense molecules, aptamers, ribozymes, triplex forming molecules, and external guide sequences.
  • the functional nucleic acid molecules can act as effectors, inhibitors, modulators, and stimulators of a specific activity possessed by a target molecule, or the functional nucleic acid molecules can possess a de novo activity independent of any other molecules.
  • Functional nucleic acid molecules can interact with any macromolecule, such as DNA, RNA, polypeptides, or carbohydrate chains.
  • functional nucleic acids can interact with the mRNA of any of the disclosed nucleic acids or the genomic DNA of any of the disclosed nucleic acids, or they can interact with the polypeptide encoded by any of the disclosed nucleic acids.
  • Often functional nucleic acids are designed to interact with other nucleic acids based on sequence homology between the target molecule and the functional nucleic acid molecule.
  • the specific recognition between the functional nucleic acid molecule and the target molecule is not based on sequence homology between the functional nucleic acid molecule and the target molecule, but rather is based on the formation of tertiary structure that allows specific recognition to take place.
  • Antisense molecules are designed to interact with a target nucleic acid molecule through either canonical or non-canonical base pairing.
  • the interaction of the antisense molecule and the target molecule is designed to promote the destruction of the target molecule through, for example, RNaseH mediated RNA-DNA hybrid degradation.
  • the antisense molecule is designed to interrupt a processing function that normally would take place on the target molecule, such as transcription or replication.
  • Antisense molecules can be designed based on the sequence of the target molecule. Numerous methods for optimization of antisense efficiency by finding the most accessible regions of the target molecule
  • antisense molecules bind the target molecule with a dissociation constant (k d )less than or equal to 10 6 , 10 8 , 10 10 , or 10 12 .
  • k d dissociation constant
  • the functional nucleic acid can be a plasmid DNA (pDNA), an antisense oligonucleotide (ASO), small interfering RNA (siRNA), small hairpin RNA
  • pDNA plasmid DNA
  • ASO antisense oligonucleotide
  • siRNA small interfering RNA
  • siRNA small RNA
  • miR microRNA
  • anti-miRs or a combination thereof.
  • Akt-l (also known as PKB alpha and RAC-PK alpha) is a member of the AKT/PKB family of serine/threonine kinases and has been shown to be involved in a diverse set of signaling pathways. Akt-l, like other members of the AKT/PKB family is located in the cytosol of unstimulated cells and translocates to the cell membrane following stimulation. Akt- 1 translocation can be activated by several ligands including platelet derived growth factor, epidermal growth factor, basic fibroblast growth factor, cellular stress such as heat shock and hyperosmolarity as well as insulin (Bos, Trends Biochem.
  • Akt-l has been shown to mediate several functions within the cell including apoptosis, the metabolic effects of insulin, induction of differentiation and/or proliferation, protein synthesis and stress responses (Alessi and Cohen, Curr. Opin. Genet. Dev., 1998, 8, 55-62; Downward, Curr. Opin. Cell Biol., 1998, 10, 262-267).
  • Akt-l was cloned independently in 1991 by three groups (Bellacosa et al, Science, 1991, 254, 274-277; Coffer and Woodgett, Eur. J. Biochem., 1991, 201, 475-481 ; Jones et al, Cell Regul, 1991, 2, 1001-1009) but its association with primary human gastric carcinoma was recognized as early as 1987 (Staal, Proc. Natl. Acad. Sci. U S A, 1987, 84, 5034-5037). Akt-l has also been shown to be overexpressed in 3% of breast cancers (Bellacosa et al, Int. J.
  • Akt-l has been proposed to be a gene involved in chromosomal rearrangement at chromosome band l4q32. This locus is known to undergo rearrangement in human T-cell malignancies such as prolymphocytic leukemias, and mixed lineage childhood leukemias (Staal et al, Genomics, 1988, 2, 96-98). Akt-l also plays a role in the prevention of "programmed cell death" or apoptosis.
  • Akt-l provides a survival signal to cells protecting them from a number of agents including UV radiation (Dudek et al., Science, 1997, 275, 661-665), withdrawal of IGF 1 from neuronal cells, detachment from the extracellular matrix, stress and heat shock (Alessi and Cohen, Curr. Opin. Genet. Dev., 1998, 8, 55-62).
  • the functional nucleic acid which modulates the expression of Akt-l can be a plasmid DNA (pDNA), an antisense oligonucleotide (ASO), small interfering RNA (siRNA), small hairpin RNA (shRNA), microRNA (miR), anti-miRs, or a combination thereof.
  • the functional nucleic acid can be stabilized by modifications to substituent nucleic acid base units, by phosphorothioate substitution of phosphodiester linkers, and/or by 2'-0-methylation of ribose units.
  • the functional nucleic acid which modulates the expression of Akt-l can comprise an antisense oligonucleotide (ASO) targeted to a portion of a nucleic acid encoding Akt- 1.
  • the functional nucleic acid is an ASO targeted to a portion of a nucleic acid encoding Akt-l, and which modulates the expression of Akt-l.
  • oligonucleotide compounds are designed to specifically hybridize with one or more nucleic acids encoding Akt-l.
  • ASOs are disclosed in U.S. Pat. No. 7,122,527, the contents of which are hereby incorporated by reference in their entirety.
  • Akt-l gene which is a 20-mer phosphorothioate antisense oligonucleotide, is targeted to a site in the coding region of the Akt-l gene having the following sequence: 5' cgccaaggagatcatgcagc 3' at site 1,478 of Akt-l gene (SEQ ID NO: 13).
  • the sequence for the backbone of RX-0201 is complementary to this site.
  • RX-0194 is targeted to a site on the Akt-l gene having the following sequence: 5' agtggactggtgggggctgg 3' at site 1,271 of Akt-l gene (SEQ ID NO: 14).
  • the sequence for the backbone of RX-0194 is complementary to this site.
  • Oligomers comprising either 5 or 10 nucleotide upstream and downstream from the sequence where the 20-mer of RX-0194 was derived showed a measurable inhibition of Akt-l mRNA expression.
  • the truncated versions of RX-0194 and RX-0201 also showed an inhibition of cancer cell proliferation.
  • RX-0627 comprising 5' cgtggagagatcatctgagg 3' (SEQ ID NO: 17) hybridizable to the site beginning at position 2473 of Akt-l gene, having the following sequence: 5'
  • RX-0628 comprising 5' tcgaaaggtcaagtgctac 3' (SEQ ID NO: 19) hybridizable to the site beginning at position 2493 of Akt-l gene, having the following sequence: 5'
  • RX-0632 comprising 5' tggtgcagcggcagcggcag 3' (SEQ ID NO:2l) hybridizable to the site beginning at position 2603 of Akt-l gene, having the following sequence: 5'
  • RX-0638 comprising 5' ggcgcgagcgcgggcctagc 3' (SEQ ID NO:23) hybridizable to the site beginning at position site 170 of Akt-l gene, having the following sequence: 5' gctaggcccgcgctcgcgcc 3' (SEQ ID NO:24).
  • the functional nucleic acid can be defined by 5’-gcu GCT TGATCT CCT TG gcg-3’ (SEQ ID NO:4), wherein the lower-case letters indicate 2’-OMe modification.
  • Bcl-2 has been linked to a wide variety of diseases such as hematologic malignancies, both leukemias and lymphomas, including follicular and nonfollicular lymphomas, chronic lymphocytic leukemia, and plasma cell dyscrasias (Campos et al, Blood, 84:595, 1994); solid tumors like those associated with breast, prostate and colon cancer; and immune disorders.
  • diseases such as hematologic malignancies, both leukemias and lymphomas, including follicular and nonfollicular lymphomas, chronic lymphocytic leukemia, and plasma cell dyscrasias (Campos et al, Blood, 84:595, 1994); solid tumors like those associated with breast, prostate and colon cancer; and immune disorders.
  • Follicular non-Hodgkin Lymphoma FL
  • FL is the most common lymphoid malignancy in Europe and the United States. Typically it is an indolent, low grade disease consisting of an accumulation of small, resting B
  • Bcl-2 tumorigenic potential is related to its capacity of interfering with physiological death responses, thereby enhancing the longevity of the cell (Nunez et. al, J. Immunol., 144:3602, 1990).
  • the Bcl-2 protein blocks apoptotic stimuli such as growth factor deprivation, radiation, heat-shock, virus, and most of the chemotherapeutic agents
  • Bcl-2-related proteins This includes Bax, Bcl-XL, Bcl-Xs, Bad, Bak, Mcl-l, A-l, and several open reading frames in DNA viruses (Oltvai et. al, Cell, 74:609, 1993; Boise et. al, Cell, 74:597, 1993; Yang et.
  • Bcl-2 Membership in the Bcl-2 family of proteins is principally defined by homology within the BH1 and BH2 domains, which help regulate dimerization between the members (Sato et. al, Proc. Natl Acad. Sci. USA, 91 :9238, 1994).
  • Bax which shares 21% amino-acid identity with Bcl-2, can bind to Bcl-2 protein and neutralize its ability to block cell death.
  • the ratio of Bcl-2 to Bax is thought to determine the cells susceptibility to death following an apoptotic stimulus (Oltvai et. al, 1993; Yin et. al, Nature, 369: 321, 1994).
  • the functional nucleic acid which modulates the expression of Bcl-2 can be a plasmid DNA (pDNA), an antisense oligonucleotide (ASO), small interfering RNA (siRNA), small hairpin RNA (shRNA), microRNA (miR), anti-miRs, or a combination thereof.
  • the functional nucleic acid can be stabilized by modifications to substituent nucleic acid base units, by phosphorothioate substitution of phosphodiester linkers, and/or by 2'-0-methylation of ribose units.
  • the functional nucleic acid which modulates the expression of Bcl-2 can comprise an antisense oligonucleotide (ASO) targeted to a portion of a nucleic acid encoding Bcl-2.
  • ASO antisense oligonucleotide
  • Examples of such ASOs are known in the art, and include those described in U.S. Patent Nos. 5,734,033, 7,022,831, 6,001,992, 7,285,288, each of which is incorporated herein by reference in its entirety.
  • the functional nucleic acid can be defined by 5’-ucu CCC AGC GTG CGC cau-3’ (SEQ ID NO:2), wherein the lower-case letters indicate 2’-OMe modification.
  • the functional nucleic acid which modulates the expression of Akt-l and the functional nucleic acid which modulates the expression of Bel -2 can be present at a molar ratio of from 5: 1 to 1:5.
  • the functional nucleic acid which modulates the expression of Akt-l and the functional nucleic acid which modulates the expression of Bcl-2 can be present at a molar ratio of from 1: 1 to 5: 1 (e.g., a molar ratio of from 1 : 1 to 3: 1)
  • the therapeutic cargo can further comprise an additional therapeutic agent, such as an antineoplastic agent, anti-infective agent, local anesthetic, anti allergic, antianemic, angiogenesis inhibitor, beta-adrenergic blocker, calcium channel antagonist, anti-hypertensive agent, anti-depressant, anti-convulsant, anti-bacterial, anti-fungal, anti-viral, anti-rheumatic, anthelminithic, antiparasitic agent, corticosteroid, hormone, hormone antagonist, immunomodulator, neurotransmitter antagonist, anti-diabetic agent, anti-epileptic, anti-hemmorhagic, anti-hypertonic, antiglaucoma agent, immunomodulatory cytokine, sedative, chemokine, vitamin, toxin, narcotic, imaging agent, or combination thereof.
  • additional therapeutic agents can be encapsulated within the lipid nanoparticle, or otherwise dissolved or dispersed in the pharmaceutical composition (e.g., dissolved or dispersed in
  • the lipid nanoparticles disclosed herein may be designed to favor characteristics such as increased interaction with nucleic acids, increased serum stability, lower RES-mediated uptake, targeted delivery, or pH sensitive release within the endosome. Because of the varied nature of LN formulations, any one of the several methods provided herein may be applied to achieve a particular therapeutic aim. Cationic lipids, anionic lipids, PEG-lipids, neutral lipids, fusogenic lipids, cationic polymers, anionic polymers, polymer conjugates, peptides, targeting moieties, and combinations thereof may be applied to meet specific aims.
  • lipid nanoparticles described herein can be used as platforms for therapeutic delivery of oligonucleotide (ON) therapeutics, such as cDNA, siRNA, shRNA, miRNA, anti- miR, and antisense oligonucleotides (ASO).
  • ON oligonucleotide
  • ASO antisense oligonucleotides
  • These therapeutics could be used to manage a wide variety of diseases such as various types of cancers, leukemias, viral infections, and other diseases.
  • the particular disease treatable according to the invention depends, of course, upon the therapeutic agent incorporated into the LN of the invention.
  • the LNs described herein are particularly suitable for encapsulation of nucleic acids, for example antisense oligonucleotides.
  • Nucleic acids, and in particular antisense nucleotides are especially useful for the treatment of tumors and cancers.
  • tumors and cancers treatable according to the invention include, for example Brain cancer, bladder cancer, lung cancer, breast cancer, melanoma, skin cancer, epidermal carcinoma, colon and rectal cancer, non-Hodgkin lymphoma, endometrial cancer, pancreatic cancer, kidney (renal cell) cancer, prostate cancer, leukemia thyroid cancer, head and neck, ovarian cancer, hepatocellular cancer, cervical cancer, sarcomas, gastric cancers, multiple myeloma, lymphomas, and gastrointestinal cancer, and uterine cancer.
  • Specific examples include epidermal carcinoma, pancreatic cancer and breast cancer.
  • Targeting moieties such as cRGD peptides, folate, transferrin (Tf), antibodies low density lipoprotein (LDL), and epidermal growth factors can greatly enhance activity by enabling targeted drug delivery.
  • Multi-targeted systems are another possibility and may be applied further to specify a particular target cell subtype.
  • the LNs described herein may be administered by the following methods: peroral, parenteral, intravenous, intramuscular, subcutaneous, intraperitoneal, transdermal, intratumoral, intraarterial, systemic, or convection- enhanced delivery.
  • the LNs are delivered intravenously, intramuscularly, subcutaneously, or intratumorally. Subsequent dosing with different or similar LNs may occur using alternative routes of administration.
  • compositions of the present disclosure comprise an effective amount of a lipid nanoparticle formulation disclosed herein, and/or additional agents, dissolved or dispersed in a pharmaceutically acceptable carrier.
  • pharmaceutically acceptable refers to molecular entities and compositions that produce no adverse, allergic or other untoward reaction when administered to an animal, such as, for example, a human.
  • the preparation of a pharmaceutical composition that contains at least one compound or additional active ingredient will be known to those of skill in the art in light of the present disclosure, as exemplified by Remington's Pharmaceutical Sciences, 2003, incorporated herein by reference.
  • preparations should meet sterility, pyrogenicity, general safety and purity standards as required by FDA Office of Biological Standards.
  • compositions disclosed herein may comprise different types of carriers depending on whether it is to be administered in solid, liquid or aerosol form, and whether it need to be sterile for such routes of administration as injection.
  • Compositions disclosed herein can be administered intravenously, intradermally, transdermally, intrathecally, intraarterially, intraperitoneally, intranasally, intravaginally, intrarectally, topically, intramuscularly, subcutaneously, mucosally, in utero, orally, topically, locally, via inhalation (e.g., aerosol inhalation), by injection, by infusion, by continuous infusion, by localized perfusion bathing target cells directly, via a catheter, via a lavage, in creams, in lipid compositions (e.g., liposomes), or by other method or any combination of the forgoing as would be known to one of ordinary skill in the art (see, for example, Remington's Pharmaceutical Sciences, 2003, incorporated herein by reference).
  • the actual dosage amount of a composition disclosed herein administered to an animal or human patient can be determined by physical and physiological factors such as body weight, severity of condition, the type of disease being treated, previous or concurrent therapeutic interventions, idiopathy of the patient and on the route of administration. Depending upon the dosage and the route of administration, the number of administrations of a preferred dosage and/or an effective amount may vary according to the response of the subject. The practitioner responsible for administration will, in any event, determine the concentration of active ingredient(s) in a composition and appropriate dose(s) for the individual subject.
  • compositions may comprise, for example, at least about 0.1% of an active compound.
  • an active compound may comprise between about 2% to about 75% of the weight of the unit, or between about 25% to about 60%, for example, and any range derivable therein.
  • the amount of active compound(s) in each therapeutically useful composition may be prepared is such a way that a suitable dosage will be obtained in any given unit dose of the compound. Factors such as solubility, bioavailability, biological half-life, route of administration, product shelf life, as well as other pharmacological considerations will be contemplated by one skilled in the art of preparing such pharmaceutical formulations, and as such, a variety of dosages and treatment regimens may be desirable.
  • a dose may also comprise from about 1
  • microgram/kg/body weight about 5 microgram/kg/body weight, about 10 microgram/kg/body weight, about 50 microgram/kg/body weight, about 100 microgram/kg/body weight, about 200 microgram/kg/body weight, about 350 microgram/kg/body weight, about 500
  • microgram/kg/body weight about 1 milligram/kg/body weight, about 5 milligram/kg/body weight, about 10 milligram/kg/body weight, about 50 milligram/kg/body weight, about 100 milligram/kg/body weight, about 200 milligram/kg/body weight, about 350 milligram/kg/body weight, about 500 milligram/kg/body weight, to about 1000 mg/kg/body weight or more per administration, and any range derivable therein.
  • a range of about 5 mg/kg/body weight to about 100 mg/kg/body weight, about 5 microgram/kg/body weight to about 500 milligram/kg/body weight, etc. can be administered, based on the numbers described above.
  • a composition herein and/or additional agents is formulated to be administered via an alimentary route.
  • Alimentary routes include all possible routes of administration in which the composition is in direct contact with the alimentary tract.
  • compositions disclosed herein may be administered orally, buccally, rectally, or sublingually.
  • these compositions may be formulated with an inert diluent or with an assimilable edible carrier.
  • a composition described herein may be administered via a parenteral route.
  • parenteral includes routes that bypass the alimentary tract.
  • the pharmaceutical compositions disclosed herein may be administered, for example but not limited to, intravenously, intradermally, intramuscularly, intraarterially, intrathecally, subcutaneous, or intraperitoneally (U.S. Pat. Nos. 6,753,514, 6,613,308, 5,466,468, 5,543,158; 5,641,515; and 5,399,363 are each specifically incorporated herein by reference in their entirety).
  • compositions disclosed herein as free bases or pharmacologically acceptable salts may be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose.
  • Dispersions may also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.
  • compositions suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions (U.S. Pat. No. 5,466,468, specifically incorporated herein by reference in its entirety).
  • the form must be sterile and must be fluid to the extent that easy injectability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi.
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (i.e., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and/or vegetable oils.
  • polyol i.e., glycerol, propylene glycol, and liquid polyethylene glycol, and the like
  • suitable mixtures thereof and/or vegetable oils.
  • Proper fluidity may be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
  • the prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like.
  • isotonic agents for example, sugars or sodium chloride.
  • Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption such as, for example, aluminum monostearate or gelatin.
  • aqueous solutions For parenteral administration in an aqueous solution, for example, the solution should be suitably buffered if necessary and the liquid diluent first rendered isotonic with sufficient saline or glucose.
  • aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous, and intraperitoneal administration.
  • sterile aqueous media that can be employed will be known to those of skill in the art in light of the present disclosure.
  • one dosage may be dissolved in 1 ml of isotonic NaCl solution and either added to 1000 ml of hypodermoclysis fluid or injected at the proposed site of infusion, (see for example,“Remington's Pharmaceutical Sciences” l5th Edition, pages 1035-1038 and 1570-1580).
  • Some variation in dosage will necessarily occur depending on the condition of the subject being treated.
  • the person responsible for administration will, in any event, determine the appropriate dose for the individual subject.
  • preparations should meet sterility, pyrogenicity, general safety, and purity standards as required by FDA Office of Biologies standards.
  • Sterile injectable solutions are prepared by incorporating the compositions in the required amount in the appropriate solvent with various other ingredients enumerated above, as required, followed by filtered sterilization.
  • dispersions are prepared by
  • a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above.
  • some methods of preparation are vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
  • a powdered composition is combined with a liquid carrier such as, e.g., water or a saline solution, with or without a stabilizing agent.
  • compositions may be formulated for administration via various miscellaneous routes, for example, topical (i.e., transdermal) administration, mucosal administration (intranasal, vaginal, etc.) and/or via inhalation.
  • topical i.e., transdermal
  • mucosal administration intranasal, vaginal, etc.
  • inhalation via inhalation.
  • compositions for topical administration may include the compositions formulated for a medicated application such as an ointment, paste, cream or powder.
  • Ointments include all oleaginous, adsorption, emulsion and water-soluble based compositions for topical application, while creams and lotions are those compositions that include an emulsion base only.
  • Topically administered medications may contain a penetration enhancer to facilitate adsorption of the active ingredients through the skin.
  • Suitable penetration enhancers include glycerin, alcohols, alkyl methyl sulfoxides, pyrrolidones and luarocapram.
  • Possible bases for compositions for topical application include polyethylene glycol, lanolin, cold cream and petrolatum as well as any other suitable absorption, emulsion or water-soluble ointment base.
  • Topical preparations may also include emulsifiers, gelling agents, and antimicrobial preservatives as necessary to preserve the composition and provide for a homogenous mixture.
  • Transdermal administration of the compositions may also comprise the use of a“patch.”
  • the patch may supply one or more compositions at a predetermined rate and in a continuous manner over a fixed period of time.
  • the compositions may be delivered by eye drops, intranasal sprays, inhalation, and/or other aerosol delivery vehicles.
  • Methods for delivering compositions directly to the lungs via nasal aerosol sprays has been described in U.S. Pat. Nos. 5,756,353 and 5,804,212 (each specifically incorporated herein by reference in their entirety).
  • the delivery of drugs using intranasal microparticle resins (Takenaga et al, 1998) and lysophosphatidyl-glycerol compounds (U.S. Pat. No. 5,725,871, specifically incorporated herein by reference in its entirety) are also well-known in the pharmaceutical arts and could be employed to deliver the compositions described herein.
  • transmucosal drug delivery in the form of a polytetrafluoroetheylene support matrix is described in U.S. Pat. No.
  • compositions disclosed herein may be delivered via an aerosol.
  • aerosol refers to a colloidal system of finely divided solid or liquid particles dispersed in a liquefied or pressurized gas propellant.
  • the typical aerosol for inhalation consists of a suspension of active ingredients in liquid propellant or a mixture of liquid propellant and a suitable solvent.
  • Suitable propellants include hydrocarbons and hydrocarbon ethers.
  • Suitable containers will vary according to the pressure requirements of the propellant.
  • Administration of the aerosol will vary according to subject's age, weight and the severity and response of the symptoms.
  • Example 1 T7 Peptide-conjugated Lipid Nanoparticles for Dual-modulation of Bcl-2 and Akt-1 in Lung and Cervical Carcinomas
  • Bcl-2 and Akt-l have been associated with human cancer.
  • G3139 and RX-0201, targeting Bcl-2 and Akt-l, respectively, are antisense oligonucleotides (ASOs) that have shown limited efficacy in clinical trials.
  • ASOs antisense oligonucleotides
  • LNPs tumor cell-targeting lipid nanoparticles
  • A“gapmer” design strategy was applied to ASOs with the addition of 2’-0- methyl modifications on the nucleotides at 5’ and 3’ ends of the ASOs.
  • a dual-channel syringe pump system was developed for the synthesis of the ASOs-LNPs.
  • ASO-LNPs composed of DODMA, egg PC, cholesterol, T7-PEG-DSPE, and PEG-DMG at a molar ratio of
  • the ASOs-LNPs exhibited excellent colloidal stability and high ASO encapsulation efficiency with relatively small mean particle sizes and moderately positive zeta potentials.
  • Transferrin receptor-targeting T7-conjugated LNPs showed enhanced cellular uptake compared to non-targeted LNPs.
  • both T7-conjugated Co- ASO-LNPs and non-T7-conjugated Co-ASO-LNPs at a molar ratio of (G3139-GAP to RX-0201-GAP at 1:2) showed efficient downregulation of both Bcl-2 and Akt-l in both A549 and KB cells.
  • T7-conjugated co-loaded ASOs-LNPs produced superior anti- tumor activity, prolonged the overall survival time, and demonstrated tumor targeting activity in an A549 xenograft model.
  • Lung cancer is the leading cause of cancer related deaths in the United States.
  • Chemotherapeutics such as paclitaxel and cisplatin, are currently employed in treatment for lung cancer. However, these agents have serious adverse side effects and have limited efficacy.
  • Cervical carcinoma is another aggressive cancer that affects over 500,000 women worldwide each year with nearly half of patients succumbing to this disease. Response rates are higher for combination chemotherapy over monotherapy. However, treatment is frequently associated with severe effects.
  • Antisense oligonucleotides are able to selectively modulate expression of target genes by preventing mRNA translation into protein and have shown promising efficacy in preclinical studies.
  • Expression of B cell lymphoma 2 (Bcl-2) family members has been found to be correlated to survival in most mammalian cells and to drug resistance in cancer cells.
  • Akt-l is a member of the Akt/PKB family that has been implicated in several cancer-related pathways. Moreover, Akt-l has been shown to negatively regulate programmed cell death.
  • ASOs face challenges such as nuclease degradation, low target binding affinity, low membrane permeability, off-target effects, etc.
  • a gapmer-based design strategy was implemented based on Bcl-2 and Akt-l ASOs by adding 2’-0-methyl modifications (2’-0-Me) to the ends of the oligonucleotides while retaining the full sequence modification with phosphorothioate (PS) linkages.
  • PS phosphorothioate
  • This design can increase protection of the ASOs against nucleases and to enhance RNaseH based target degradation.
  • the dual target modulation provides a synergistic effect.
  • lipid nanoparticles LNPs
  • LNPs lipid nanoparticles
  • T7 peptide which has high affinity for the transferrin receptor, was conjugated to LNPs for tumor cell targeting.
  • Dual modulation of Bcl-2 and Akt-l targets was achieved by co-loading of the two ASOs in T7-LNPs and targeted delivery to tumor cells.
  • DODMA l,2-Dioleyloxy-3-dimethylaminopropane
  • DOPE l,2-dioleoyl-sn-glycero-3- phosphoethanolamine
  • cholesterol cholesterol
  • egg L-a-phosphatidylcholine 95%)
  • egg PC egg L-a-phosphatidylcholine
  • PEG-DSPE (MW 3,400) were purchased from Avanti Polar Lipids (Alabaster, AL). 1,2- Dimyristoyl-rac-glycero-3-methylpolyoxy ethylene (PEG-DMG) was obtained from Fisher Scientific (Grand Island, NY). Slide-A-LyzerTM Dialysis Cassettes with MWCO 3.5k and Pierce Rapid Gold BCA Protein Assay Kit were purchased from ThermoFisher Scientific (Waltham, MA). RPMI-1640 medium, trypsin-EDTA (0.05%), and penicillin-streptomycin were obtained from Gibco (Gaithersburg, MD).
  • Tris-HCl Precast Gels Tris- Glycine-SDS running buffer, and Tris-Glycine transfer buffer were from BioRad (Hercules, CA).
  • Paclitaxel (PTX) was purchased from Sigma-Aldrich (St. Louis, MO). ASOs
  • G3139 gapmer (G3139-GAP) was custom-synthesized by Alpha DNA (Quebec, Canada).
  • the sequence of fully phosphorothioated original G3139 is 5’-TCT CCC AGC GTG CGC CAT-3’ (SEQ ID NO: l).
  • the G3139-GAP design had 2’-0-Me modifications on both ends of the oligonucleotide with a sequence of 5’-ucu CCC AGC GTG CGC cau-3’ (SEQ ID NO: 2; lower case here indicates 2’-OMe modification).
  • RX-0201 was obtained from Rexahn Pharmaceuticals (Rockville, MD). RX-0201 is fully phosphorothioate substituted and has the sequence of 5’-GCT GCA TGA TCT CCT TGG CG-3’ (SEQ ID NO:3), which targets Akt-l. The 2’-OMe modifications were then applied for the gapmer.
  • RX-0201 gapmer (RX0201-GAP) had a sequence of 5’-gcu GCT TGA TCT CCT TG gcg-3’ (SEQ ID NO:4) and was purchased from Alpha DNA (Quebec, Canada).
  • Fluorescent oligonucleotides FAM-G3139 and FAM-RX-0201 were purchased from Integrated DNA Technologies (Coralville, IA).
  • T7-peptide is composed of 7 amino acids (HAIYPRH; SEQ ID NO:5) and targets the transferrin receptor, which is expressed on the surface of most tumor cells.
  • a cysteine was added to the N terminus of the T7 peptide (Cys-HARYPRH, SEQ ID NO:6) to facilitate peptide conjugation with Mal-PEG-DSPE.
  • the modified T7 peptide was custom synthesized by Genscript (Piscataway, NJ).
  • the thiol group (-SH) in Cys-T7 peptide was coupled to the maleimide-functionalized Mal-PEG-DSPE using a procedure similar to a previously described method. See, for example, Wang, Z., et al. Enhanced Anti-Ischemic Stroke of ZL006 by T7-Conjugated PEGylated Liposomes Drug Delivery System. Sci. Rep. 2015, 5, and Kuang, Y., et al. T7 Peptide-Functionalized Nanoparticles Utilizing RNA Interference for Glioma Dual Targeting. Int. J. Pharm. 2013, 454 (1), 11-20, both of which are hereby incorporated by reference.
  • the Co-ASOs-LNPs consisted of several lipid components including DODMA, egg PC, cholesterol, T7-PEG-DSPE, and PEG-DMG.
  • TEAA triethylamine acetate
  • a dual-channel syringe pump with two syringes attached to a bifurcated Y-connector was utilized to synthesize the final product ( Figure 1).
  • a 20G blunt needle was attached to the end of the tubing connector to facilitate component mixing.
  • a post-insertion method was used to incorporate T7- PEG-DSPE into the LNPs. Briefly, T7-PEG-DSPE was dissolved and incubated with Co- ASOs-LNPs for 1 h at 37 °C at the T7-PEG-DSPE to total lipid ratio of 0.5: 100.
  • the mean particle size of Co-ASOs-LNPs was determined on a NICOMP370 Particle
  • ASO encapsulation efficiency was measured using previously described methods. See, for example, Weecharangsan, W., et al. Efficient Delivery of Antisense
  • Human lung epithelial cancer cells A549 and human cervical cancer KB cell lines were acquired from ATCC (Manassas, VA). The cells were cultured in RPMI 1640 media with the addition of 10% fetal bovine serum (FBS), 100 U/ml penicillin, and lOOug/ml streptomycin. The cells were grown in a tissue culture incubator at 37 °C and 5% CC concentration.
  • the ASO-to-ASO and ASO-to-PTX drug combination ratios were optimized by determining cytotoxicity in A549 cells. Briefly, cells were seeded in 96-well plates and treated with ASO combinations the next day. Treatment groups included Co-ASOs-LNPs with various ASO molar ratios: (G3139-GAP (G) to RX-0201-GAP (R) (G:R ratio) of 1 : 1, 1:2, and 2: 1), G3139-GAP, RX-0201-GAP, free Co-ASOs at a G:R ratio of 1 : 1 with an ASO concentration of 0.5 mM, scrambled ASO, and empty vesicles.
  • the cells were further incubated with PTX at a series of concentrations (0 to 10mM) at 37 °C for 4h. After incubation, the treatment medium was replaced with fresh medium and the cells were incubated for another 72h. Then, 20pL CellTiter 96® AQueous One Solution Cell Proliferation Assay Solution (MTS) from Promega (Madison, WI) was added to each well and the plate was incubated at 37 °C for 4h.
  • MTS CellTiter 96® AQueous One Solution Cell Proliferation Assay Solution
  • Cpso and CR, 50 were concentrations of G3139-GAP and RX-0201-GAP used in combination to achieve 50% growth inhibition, respectively.
  • I CVI.G and IC5o,R were the single ASO (G3139-GAP or Rx-020l-GAP) 50% inhibition concentrations.
  • a Cl that is less than, equal to, or more than unity suggests a synergistic, additive, and antagonistic effect
  • the isobologram was plotted using IC50 values of the A549 cells.
  • a straight line between intercepts A and B on the G3139-GAP and RX-0201-GAP axes indicates isobole of 50% inhibition effect.
  • FAM-ASO-LNPs were evaluated for uptake efficiency in A549 cells. Briefly, A549 cells were seeded on coverslips at a density of 4* 10 4 cells per well in l2-well plates and cultured overnight. The cells were incubated with T7-conjugated FAM-ASO-LNPs, FAM- ASO-LNPs, free FAM-ASO, or saline control for 4 h, which was replaced with fresh medium and the cells were incubated for another 48h at 37 °C. Then, the cells were fixed in 4% paraformaldehyde and washed with PBS three times.
  • the cells were then stained with DAPI and wheat germ agglutinin labeled with Alexa 594 from ThermoFisher Scientific (Waltham, MA) for 10 min each. This was followed by washing with PBS. The coverslips were taken out from the l2-well plates and mounted on glass slides. The slides were then examined on an Olympus FV 1000 Filter Confocal Microscope System (Tokyo, Japan).
  • RNA extraction was performed following manufacturer’s instructions from Qiagen (Valencia, CA). Briefly, A549 and KB cells were harvested after 48 h incubation with Co- ASOs-LNPs. RLT buffer was added to each well, followed by several seconds of shaking to lyse the cells and the wells were further washed with 70% ethanol. The cell lysate was placed on a shaker from Daigger Scientific (Vernon Hills, IL) for 5 min to ensure homogeneity. Next, the cell lysate was pipetted into a QIAvac 96 manifold followed by several washing steps. The RNA was obtained by RNAse-free water elution.
  • Bcl-2 and Akt-l mRNA expression levels were measured by real-time quantitative reverse transcriptase polymerase chain reaction (qRT-PCR). Briefly, cDNA was synthesized by employing a first-strand cDNA synthesis kit from Invitrogen (Carlsbad, CA). The mRNA was combined with lOmM dNTP and 50pl/mL random hexamer primer and heated to 65°C for 10 min and cooled down to 4 °C for 5 min on a thermal cycler from Applied Biosystems (Foster City, CA).
  • the resulting first-strand cDNA was further amplified with the addition of 40 U/pL RNaseOUT, 0.1M DTT, 10 c RT buffer, 200 U/pL Superscript III RT, and 25mM MgCh.
  • the amplification included three stages. The mixture was first heated to 48°C for 60 min and then to 95°C for 5 min and was cooled down to 4°C for the last 5 min. The number of cycles were 30 cycles.
  • the primers and probes from Thermo Fisher Scientific were: Bcl-2 forward primer, CCCTGTGGATGACTGAGTACCTG (SEQ ID NO: 7), bcl-2 reverse primer, CCAGCCTCCGTTATCCTGG (SEQ ID NO: 8), Akt-l forward primer, CTGGACAAGGACGGGCACA (SEQ ID NO:9), Akt-l reverse primer, GGT GGGCT GAGCTT CTTCTCGT A (SEQ ID NO: 10), GAPDH forward primer
  • TAGCCCAGGATGCCCTTTAGT SEQ ID NO: 12
  • the expression levels of the Bcl-2 and Akt-l were normalized based on GAPDH and calculated utilizing StepOne v2.3 Software.
  • the membrane was further incubated with monoclonal rabbit anti-human Bcl-2 from BioRad (Hercules, CA) or Akt (pan) (C67E7) Rabbit mAh purchased from Cell Signaling Technology (Boston, MA) or polyclonal anti-human b-actin from Santa Cruz (Cambridge, MA) and stored at 4 °C overnight.
  • the membrane was washed several times before incubation with secondary antibodies: horseradish peroxidase-conjugated sheep anti-rabbit or sheep anti-mouse from Santa Cruz (Cambridge, MA). After 1 h incubation, the membrane was exposed on an imager from Konica Minolta Healthcare (Wayne, NJ). The densities of the bands were analyzed by ImageJ software (Bethesda, MD).
  • A549 cells were cultured in large scale and embedded into the right flank of athymic BALB/c mice (20-25g) obtained from Hunan Si-Lai- Ke Laboratory Animal Co., Ltd (Hunan, China).
  • 10 7 A549 cells were injected subcutaneously into 4-week-old nude mice. After the size of the tumors reached ⁇ 200mm 3 , the mice were sacrificed, and the tumors were cut into 2mm 3 fragments and stored in sterile saline. Next, 70 mice were inoculated with these tumor blocks and let tumors subcutaneously.
  • mice When tumor volumes reached - 150 mm 3 , the mice were divided into eight groups and were given the first treatment. Seven treatment groups were included in this study: PTX (lmg/kg), PTX (lmg/kg) combined with free ASO combination at G-to-R of 1:2 (5mg/kg), PTX (lmg/kg) combined with G3l39-GAP-LNPs (5mg/kg), PTX (lmg/kg) combined with RX-020l-GAP-LNPs (5mg/kg), PTX (lmg/kg) combined with Co-ASOs-LNPs at G-to-R of 1 :2 (5mg/kg), PTX (lmg/kg) combined with T7-conjugated Co-ASOs-LNPs at G- to-R of 1:2 (5mg/kg), and saline control.
  • the treatment schedule used was twice per week for 3 weeks given through tail vein injection. Tumor sizes were measured by caliper every 2 days
  • Luminescence images were acquired utilizing an in vivo imaging system (IVIS Lumina XR in vivo imaging system, PerkinElmer) equipped with a cooled, slow-scan CCD camera and driven by Living Image software (PerkinElmer, USA). Based on the characteristics of the FAM fluorescent tag, 495 nm excitation and 520 nm emission filters were selected. Images were obtained using a biofluorescence in vivo imaging (BFI) system, with fluorescent acquisition time of 3.5 s and the fluorescent signal was then overlaid onto a picture of each mouse.
  • IVIS Lumina XR in vivo imaging system PerkinElmer
  • Immunohistochemical staining was used to determine the Akt-l and Bcl-2 expression levels in tumors.
  • Tumor samples were harvested and fixed with 10% formaldehyde overnight.
  • the fixed tumors were immersed in paraffin and sliced into 5pm thick sections.
  • the sections were further deparaffinized and dehydrated in a gradient of ethanol.
  • the slices were further incubated with horseradish peroxidase-conjugated anti-goat secondary antibody from Santa Cruz Biotechnology (Santa Cruz, CA) for 1 h at room temperature. Hematoxylin was used to counterstain the tissue slices, which were imaged by digital camera mounted on an optical microscope.
  • Results were presented as mean ⁇ standard deviation (SD) unless otherwise indicated. Group differences were determined by one-way analysis of variance (ANOVA) followed by Fisher’s LSD post hoc. Kaplan-Meier plot was utilized to evaluate the length of survival. Log- rank test was used to analyze differences between treatment groups p values of 0.01 and 0.05 were selected as cutoffs for“highly significant” and“significant” differences, respectively. GraphPad Prism was the software used to perform all the statistical analyses.
  • the average particle size of empty LNPs was 90.9 ⁇ 5.2 nm.
  • mean particle sizes were increased to 125.7 ⁇ 7.1 nm and 139.4 ⁇
  • ASOs-LNPs and T7-ASOs-LNPs were relatively narrow with polydispersity indexes (PDI) of 0.08 ⁇ 0.03 and 0.10 ⁇ 0.04, respectively.
  • PDI polydispersity indexes
  • the zeta potential of Co-ASOs-LNPs and T7-ASOs-LNPs were 8.49 ⁇ 3.24 and 10.03 ⁇ 2.64 mV, respectively (Table 1).
  • T7-PEG-DSPE was synthesized as described above. A standard curve was plotted in the range of 0.5-l0mg/mL using T7 peptide based on the BCA assay. The calculated T7 peptide concentration in synthesized T7-PEG-DSPE is 1.65 mg/mL.
  • Encapsulation efficiencies for single ASO were 88.2 ⁇ 4.65% and 88.5 ⁇ 3.34%, respectively.
  • the addition of a pegylating agents can improve the colloidal stability of LNPs.
  • the stability of T7-ASOs-LNPs, Co-ASOs-LNPs, the single ASO-LNPs were compared with and without a pegylating agent for three weeks ( Figure 2).
  • PTX combined with T7-conjugated Co-ASOs-LNPs at a molar ratio of G3139-GAP (G) to RX-0201-GAP (R) (G:R) of 1 :2 showed the lowest tumor cell viability compared to other treatment groups.
  • the viability differences between the T7-conjugated Co-ASOs-LNPs and other treatment groups were statistically significant at both 10 and 100 nM concentrations.
  • the IC50 value was 0.62mM, which was lower than those of single ASO encapsulated LNPs (0.83 mM for G3l39-GAP-LNPs and 0.77 mM for RX-020l-GAP-LNPs).
  • the ICso values of Co-ASOs-LNPs at G:R ratios of 1 :2, 1: 1, 2: 1 were 0.75 mM, 0.81 mM, and 0.88 mM, respectively.
  • the combination indexes of T7 -conjugated Co-ASOs-LNPs and Co-ASOs-LNPs at G:R ratios of 1 :2, 1 : 1, 2: 1 were 0.76, 0.93, 1.01, 1.03, respectively.
  • the non-T7-conjugated LNP with G:R ratio of 1:2 produced synergistic effects based on the combination index obtained ( Figure 3).
  • T7-conjugated FAM- ASO-LNPs were determined by confocal microscopy.
  • T7-conjugated FAM- ASO-LNPs showed stronger fluorescent intensity in A549 cells compared to non-T7-conjugated groups. This indicates that the T7 ligand facilitated the internalization of the LNPs into the A549 cells.
  • fluorescence in the cells treated with non-T7-conjugated LNPs and free ASO groups was barely observed, which suggested that in the absence of T7 ligand on the surface of the nanoparticles, LNPs were not efficiently taken up by the cells (Figure 4).
  • mRNA-level downregulation effects of Akt-l by T7-conjugated Co-ASOs-LNPs were 78.2% ⁇ 6.7% and 73.4% ⁇ 6.9% compared to the non-treated groups in A549 and KB cells, respectively.
  • T7-conjugated Co-ASOs-LNPs (G:R 1 :2) treated cells had an average Bcl-2 protein decrease of 81%, which was 1.3-fold, 2-fold and 8.3-fold lower than the non-T7 groups, single ASO-LNPs, and free oligo, respectively.
  • the average Akt-l protein level of the T7-conjugated Co-ASOs-LNPs (G:R 1 :2) treated group was 82%, which was 2.2- fold, 2.4-fold and 4.5-fold lower compared to the non-T7 groups, single ASO-LNPs, and free oligo ( Figures 5 A and 5B).
  • An A549 xenograft mouse model was used to evaluate ASO-PTX combination therapy.
  • Treatment was started when tumors reached 150 mm 3 .
  • average tumors volumes had reached 763, 516, 514, 288, 268, 267, 174 mm 3 for saline, PTX , PTX + Free ASOs (G:R 1:2), PTX + RX-020l-GAP-LNPs, PTX + G3l39-GAP-LNPs, PTX + Co-ASOs-LNPs G:R 1 :2, and PTX + T7-conjugated Co-ASOs-LNPs (G:R 1:2), respectively (Figure 8A). Significant differences were found between PTX + T7-conjugated Co-ASOs- LNPs and other treatment groups.
  • the median survival days of the saline group was 27, 35.5 for PTX and PTX + free ASOs (G:R 1:2), 37.5 for PTX + RX-0201- GAP -LNPs, 41 PTX + G3l39-GAP-LNPs, 42 for PTX + Co-ASOs-LNPs (G:R 1 :2), and 60 for PTX + T7-conjugated Co-ASOs-LNPs (G:R 1 :2) ( Figure 8B). Analyzed by a log-rank test, the T7-conjugated Co-ASOs-LNPs (G:R 1 :2) showed much longer survival time compared to mice in other treatment groups (Table 2). Table 2. Results Log-Rank Test of the Survival Curve.
  • a b c d p values were generated relatively to aaline, PTX, PTX + G3139-GAP -LNPs, PTX + RX- 020l-GAP-LNPs, and PTX + Co-ASOs-LNPs, respectively. Significant difference was shown when a p value was less than 0.05.
  • ASOs have been developed to target genes that are frequently involved in the progression of tumor.
  • Bcl-2 and Akt-l are targets reported to be related to tumor cell proliferation, anti-apoptosis pathways, and tumor homeostasis.
  • ASOs with 2’-0-Me or 2’- MOE modifications have been shown to exhibited enhanced exonuclease resistance and to have much greater mRNA binding affinity and hybridization stability.
  • ASOs retain their ability to activate RNaseH.
  • Prexigebersen a liposomal formulation of Grb2 ASO designed to treat acute myeloid leukemia, has entered phase II clinical trial.
  • Custirsen (OGX-Ol l) a second generation ASO, has entered phase 3 trial at the end of 2017.
  • a combination of chemically modified ASOs was incorporated into the LNPs aiming at dual targets of Bcl-2 and Akt-l.
  • a small peptide T7 was attached to the surface of the nanoparticles to achieve high selectivity through transferrin receptor targeting.
  • T7-conjugated Co- ASOs LNPs were shown to have the lowest IC50 value, which indicates that T7 ligand on the surface of the nanoparticles facilitated the internalization of LNPs into the cancer cells.
  • the combination of ASOs without T7 ligand also showed a synergistic effects compared to the single ASO. Increased uptake efficiency was achieved in the T7-conjugated LNPs, which correlated with the results obtained from the cell viability study.
  • T7-LNP Co-ASOs at G:R of 1 :2 had the highest anti-tumor activity and prolonged the overall survival time.
  • the IVIS images showed that the T7-LNP group had the highest fluorescence at the tumor sites which indicated that the T7-conjugated ASO-LNPs preferentially accumulated at the tumor site after administration in vivo.
  • Body weights of all the treatment groups remained similar, which suggests low toxicity resulting from treatment.
  • the Co-ASOs-LNPs at G:R 1:2 were shown to exhibit optimal stability and therapeutic efficacy both in vitro and in vivo.
  • T7 targeting ligand attached to the surface the uptake efficiency for the LNPs increased compared to non-conjugated LNPs both in vitro and in vivo.
  • the T7-conjugated Co-ASOs-LNPs at G:R of 1:2 showed overall greater anti tumor activity, longer survival time, and more effective target modulation activities than other formulations and warrants further evaluation.
  • a syringe pump system has been developed that enables precisely controlled synthesis of LNPs that may facilitate their future preclinical development
  • compositions and methods of the appended claims are not limited in scope by the specific compositions and methods described herein, which are intended as illustrations of a few aspects of the claims. Any compositions and methods that are functionally equivalent are intended to fall within the scope of the claims. Various modifications of the compositions and methods in addition to those shown and described herein are intended to fall within the scope of the appended claims. Further, while only certain representative compositions and method steps disclosed herein are specifically described, other combinations of the compositions and method steps also are intended to fall within the scope of the appended claims, even if not specifically recited. Thus, a combination of steps, elements, components, or constituents may be explicitly mentioned herein or less, however, other combinations of steps, elements, components, and constituents are included, even though not explicitly stated.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Epidemiology (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Zoology (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Botany (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Inorganic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Dermatology (AREA)
  • Optics & Photonics (AREA)
  • Nanotechnology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicinal Preparation (AREA)

Abstract

Disclosed are lipid nanoparticles, pharmaceutical compositions comprising the lipid nanoparticles, and methods of using thereof (e.g., for the treatment of cancer). In some examples, the lipid nanoparticles can comprise a therapeutic cargo encapsulated in the lipid nanoparticles that comprises a functional nucleic acid which modulates the expression of Akt-1 (e.g., an antisense oligonucleotide targeted to a portion of a nucleic acid encoding Akt-1) and a functional nucleic acid which modulates the expression of Bcl-2 (e.g., an antisense oligonucleotide targeted to a portion of a nucleic acid encoding Bcl-2).

Description

Lipid Nanoparticles and Methods of Using Thereof
CROSS-REFERENCE TO RELATED APPLICATIONS
This application claims benefit of U.S. Provisional Application No. 62/726,637, filed September 4, 2018, which is hereby incorporated herein by reference in its entirety.
BACKGROUND
Cancer remains a leading cause of death. Lung cancer is the leading cause of cancer related deaths in the United States. Approximately 150,000 Americans died from lung cancer in 2017, which accounted for nearly 25 percent of all cancer deaths. In advanced stages lung cancer readily metastasizes to other organs, which abrogate the effectiveness of surgery and conventional therapy. Chemotherapeutics, such as paclitaxel and cisplatin, are currently employed in treatment for lung cancer. However, these agents have serious adverse side effects and have limited efficacy. Cervical carcinoma is another aggressive cancer that affects over 500,000 women worldwide each year with nearly half of patients succumbing to this disease. Response rates are higher for combination chemotherapy over monotherapy. However, treatment is frequently associated with severe effects. Accordingly, improved compositions and methods for the treatment of cancer are needed.
SUMMARY
Disclosed herein are lipid nanoparticles encapsulating a therapeutic cargo as well as pharmaceutical compositions comprising the lipid nanoparticles in combination with one or more pharmaceutically acceptable excipients. In some embodiments, the composition can comprise a sterile solution, a sterile suspension, or a lyophilized powder.
The lipid nanoparticles are formed from a lipid mixture that comprises a cationic lipid, a phospholipid, and a targeting conjugate. In some embodiments, the lipid mixture can further comprise one or more additional lipids, such as a neutral lipid, a polymer-lipid conjugate, or a combination thereof. In some embodiments, the lipid nanoparticle can have a zeta potential of from 0 to +40 mV. In some embodiments, the lipid nanoparticle can have a diameter of less than 300 nm (e.g., from 50 nm to 200 nm).
In some embodiments, the cationic lipid can comprise from 25 mol % to 45 mol % of the lipid mixture. In some examples, the cationic lipid can comprise a tertiary amine-cationic lipid (e.g., a tertiary amine-cationic lipid selected from the group consisting ofN-[l-(2, 3- dioleyloyx) propyl] -N-N-N-dimethyl ammonium chloride (DODMA), l,2-dioleoyl-3- dimethylammonium-propane (DODAP), 3P-|N-(N'.N'-dimethylaminoethane)- carbamoyl]cholesterol hydrochloride (DC-CHOL), N,N-dimethylhexadecylamine (DMHDA), and combinations thereof). In some examples, the cationic lipid can comprise a quaternary amine-cationic lipid (e.g., a quaternary amine-cationic lipid selected from the group consisting of l,2-dioleoyl-3-trimethylammonium-propane (DOTAP), N-[l-(2, 3-dioleyloyx) propyl]-N— N— N-trimethyl ammonium chloride (DOTMA), dimethyldioctadecylammonium bromide (DDAB), or combinations thereof).
In some embodiments, the phospholipid can comprise from 30 mol % to 50 mol % of the lipid mixture. In some examples, the phospholipid can comprise a phosphatidylcholine (e.g., an egg phosphatidylcholine).
In some embodiments, the targeting conjugate can comprise from 0.05 mol % to 5 mol % of the lipid mixture. The targeting conjugate can comprise a targeting agent bound to a lipid via a polymeric linker. In some examples, the targeting agent can comprise a T7 peptide. In some examples, the targeting conjugate can be, for example, T7-PEG-CHEMS (T7- polyethylene glycol-cholesteryl hemisuccinate), T7-PEG-DSPE (T7-poly ethylene glycol- distearoyl phosphatidylethanolamine), or a combination thereof.
In some cases, the lipid mixture further comprises a neutral lipid (e.g., cholesterol). For example, the lipid mixture can comprise from 10 mol % to 30 mol % of a neutral lipid.
In some cases, the lipid mixture further comprises a polymer-lipid conjugate. For example, the lipid mixture can comprise from 0.5 mol % to 15 mol % of a polymer-lipid conjugate. In some examples, the polymer-lipid conjugate can comprise l,2-distearoyl-sn- glycero-3-phosphoethanolamine-N-PEG (DSPE-PEG), dimyristoylphosphatidylethanolamine- PEG (DMPE-PEG), dipalmitoylphosphatidlyethanolamine-PEG (DPPE-PEG), 1 , 2- dimyristoyl-sn-glycerol and methoxypolyethylene glycol (DMG-PEG), or a combination thereof.
In certain embodiments, the lipid mixture can comprise from 30 mol % to 40 mol % cationic lipid, from 35 mol % to 45 mol % phospholipid, from 15 mol % to 25 mol % neutral lipid, from 0.05 mol % to 2 mol % targeting conjugate; and from 1 mol % to 10 mol % polymer-lipid conjugate. In certain embodiments, the lipid mixture can comprise from 30 mol % to 40 mol % N-[l-(2, 3-dioleyloyx) propyl] -N-N-N-dimethyl ammonium chloride
(DODMA), from 35 mol % to 45 mol % phosphatidylcholine, from 15 mol % to 25 mol % cholesterol, from 0.05 mol % to 2 mol % T7-PEG-DSPE (T7-poly ethylene glycol-distearoyl phosphatidylethanolamine), and from 1 mol % to 10 mol % 1, 2-dimyristoyl-sn-glycerol and methoxypolyethylene glycol (DMG-PEG). The therapeutic cargo encapsulated in the lipid nanoparticles can comprise a functional nucleic acid which modulates the expression of Akt-l; and a functional nucleic acid which modulates the expression of Bcl-2. The functional nucleic acid which modulates the expression of Akt-l and the functional nucleic acid which modulates the expression of Bcl-2 can be present at a molar ratio of from 5: 1 to 1 : 5. In some embodiments, the functional nucleic acid which modulates the expression of Akt-l and the functional nucleic acid which modulates the expression of Bcl-2 can be present at a molar ratio of from 1 : 1 to 5: 1 (e.g., a molar ratio of from 1 : 1 to 3: 1)
The functional nucleic acid which modulates the expression of Akt-l can be a plasmid DNA (pDNA), an antisense oligonucleotide (ASO), small interfering RNA (siRNA), small hairpin RNA (shRNA), microRNA (miR), anti-miRs, or a combination thereof. In some cases, the functional nucleic acid can be stabilized by modifications to substituent nucleic acid base units, by phosphorothioate substitution of phosphodiester linkers, and/or by 2'-0-methylation (2’-OMe) of ribose units. In certain embodiments, the functional nucleic acid which modulates the expression of Akt-l can comprise an antisense oligonucleotide (ASO) targeted to a portion of a nucleic acid encoding Akt-l. For example, the functional nucleic acid can be defined by 5’-gcu GCT TGATCT CCT TG gcg-3’ (SEQ ID NO:4), wherein the lower-case letters indicate 2’-OMe modification.
The functional nucleic acid which modulates the expression of Bcl-2 can be a plasmid DNA (pDNA), an antisense oligonucleotide (ASO), small interfering RNA (siRNA), small hairpin RNA (shRNA), microRNA (miR), anti-miRs, or a combination thereof. In some cases, the functional nucleic acid can be stabilized by modifications to substituent nucleic acid base units, by phosphorothioate substitution of phosphodiester linkers, and/or by 2'-0-methylation of ribose units. In certain embodiments, the functional nucleic acid which modulates the expression of Bcl-2 can comprise an antisense oligonucleotide (ASO) targeted to a portion of a nucleic acid encoding Bcl-2. For example, the functional nucleic acid can be defined by 5’- ucu CCC AGC GTG CGC cau-3’ (SEQ ID NO:2), wherein the lower-case letters indicate 2’- OMe modification.
In some embodiments, the pharmaceutical composition can further comprise an additional therapeutic agent, such as an antineoplastic agent, anti-infective agent, local anesthetic, anti-allergic, antianemic, angiogenesis inhibitor, beta-adrenergic blocker, calcium channel antagonist, anti-hypertensive agent, anti-depressant, anti-convulsant, anti-bacterial, anti-fungal, anti-viral, anti-rheumatic, anthelminithic, antiparasitic agent, corticosteroid, hormone, hormone antagonist, immunomodulator, neurotransmitter antagonist, anti-diabetic agent, anti-epileptic, anti-hemmorhagic, anti-hypertonic, antiglaucoma agent, immunomodulatory cytokine, sedative, chemokine, vitamin, toxin, narcotic, imaging agent, or combination thereof. The additional therapeutic agent can be encapsulated within the lipid nanoparticle, or otherwise dissolved or dispersed in the pharmaceutical composition (e.g., dissolved or dispersed within a carrier for the lipid nanoparticles).
Also provided are methods of inducing cytotoxicity in a cancer cell. The methods can comprise contacting the cancer cell with a lipid nanoparticle described herein or a
pharmaceutical composition described herein.
Also provided are methods of treating a cancer in a subject that comprise administering to the subject a therapeutically effective amount of a lipid nanoparticle described herein, or a pharmaceutical composition described herein. The cancer can be, for example, brain cancer, bladder cancer, lung cancer, breast cancer, melanoma, skin cancer, epidermal carcinoma, colon and rectal cancer, non-Hodgkin lymphoma, endometrial cancer, pancreatic cancer, kidney (renal cell) cancer, prostate cancer, leukemia thyroid cancer, head and neck, ovarian cancer, hepatocellular cancer, cervical cancer, sarcomas, gastric cancers, multiple myeloma, lymphomas, and gastrointestinal cancer, and uterine cancer.
DESCRIPTION OF DRAWINGS
Figure 1 is a photograph showing the syringe pump system with dual syringes operating at a programed rate that was used to prepare the ASOs-LNPs formulations. Oligos and lipids from two syringes were combined in the Y-tubing and further mixed in the 20G blunt needle under laminar flow. This system enabled controlled LNP assembly and reproducible production of small nanoparticles.
Figure 2 is a plot showing the colloidal stability of ASOs-LNPs formulations with different lipid compositions. LNPs were stored at 4 °C for up to 30 days. The values represent the average of three separate measurements.
Figure 3 is an isobologram of RX-020l-GAP-LNPs and G3l39-GAP-LNPs in A549 cells. The ICrio additive isobole is a straight line between points A and B. A and B indicate the IC50 values of RX-020l-GAP-LNPs and G3l39-GAP-LNPs. The solid dots represent the IC50 values of different treatment groups. The dots above the straight line indicates antagonism and the dots below the additive isobole suggest synergism.
Figure 4 shows the uptake of the T7-FAM-ASO-LNPs, FAM-ASO-LNPs and Free FAM-ASO by A549 cells. ASO was labeled green. The cells were stained with DAPI (blue), wheat germ agglutinin (WGA) (red) and were analyzed by confocal microscopy. The scale bar was 25 pm. Figures 5A-5B show Bcl-2 and Akt-l mRNA and protein levels expression after various treatments of ASO-LNPs in A549 and KB cells. Figure 5A shows the relative Bcl-2 and Akt-l mRNA and protein expressions to b-actin in A549 cells after 1 mM ASOs-LNPs treatments. Results are presented as mean ± SD, n=3 Figure 5B shows the relative Bcl-2 and Akt-l mRNA and protein expressions to b-actin in KB cells after 1 mM ASOs-LNPs treatments. Results are presented as mean ± SD, n=3.
Figures 6A-6B show immunohistochemical staining for the Bcl-2 (Figure 6A) and Akt- 1 (Figure 6B) in the A549 tumor sections. Tumor sections from left to right, top to bottom were from mice treated with PTX + T7-Co-ASOs-LNPs (G:R 1 :2), PTX + Co- ASOs-LNPs (G:R 1 :2), PTX, and saline. The scale bar is 50pm.
Figure 7 shows IVIS Lumina XR in vivo imaging of ASO distribution at tumor sites. Athymic BALB/c mice were injected with T7-conjugated FAM-G3l39-LNPs, or FAM-G3139- LNPs, Free FAM-G3139, or saline control. The mice were imaged at l2h after injection.
Figures 8A-8B show tumor inhibition and survival extension by treatment with ASO- LNPs and PTX combinations. Figure 8A shows tumor inhibition effects with combination treatments of PTX and ASOs-LNPs. A549 tumor bearing mice were treated with PTX + T7- Co- ASOs-LNPs (G:R 1:2), or PTX + Co-ASOs-LNPs (G:R 1 :2), or PTX + G3139-GAP- LNPs, or PTX + RX-020l-GAP-LNPs, or PTX + Free ASOs (G:R 1:2), or PTX, or saline control. Tumor volumes were measured for approximately 30 days. Figure 8B shows a Kaplan- Meier analysis that was utilized to monitor the median survival time of the A549 tumor bearing mice. The treatment groups were PTX + T7-Co-ASOs-LNPs (G:R 1 :2), or PTX + Co-ASOs- LNPs (G:R 1 :2), or PTX + G3l39-GAP-LNPs, or PTX + RX-020l-GAP-LNPs, or PTX + Free ASOs (G:R 1:2), or Saline control.
Figure 9 is a schematic illustration of the therapeutic strategy employed in Example 1.
DETAILED DESCRIPTION
Disclosed herein are lipid nanoparticles encapsulating a therapeutic cargo as well as pharmaceutical compositions comprising the lipid nanoparticles in combination with one or more pharmaceutically acceptable excipients. The lipid nanoparticles can be used to deliver therapeutic agents, including anti-cancer agents.
Lipid Nanoparticles
A liposome is a vesicle composed of one or more lipid bilayers, capable of carrying hydrophilic molecules within an aqueous core or hydrophobic molecules within its lipid bilayer(s). As used herein,“Lipid nanoparticles” (LNs) is a general term to described lipid- based particles in the submicron range. LNs can have structural characteristics of liposomes and/or have alternative non-bilayer types of structures. Drug delivery by LNs via systemic route requires overcoming several physiological barriers. The reticuloendothelial system (RES) is responsible for clearance of LNs from the circulation. Once escaping the vasculature and reaching the target cell, LNs are typically taken up by endocytosis and must release the drug into the cytoplasm prior to degradation within acidic endosome conditions.
In particular, the delivery of such functional nucleic acids (NAs), including siRNA and other therapeutic oligonucleotides is a major technical challenge that has limited their potential for clinical translation. The development of efficient delivery vehicles is a key to clinical translation of oligonucleotide (ON) therapeutics. The lipid nanoparticles described herein can (1) protect the drug (e.g., a functional nucleic acid) from enzymatic degradation; (2) transverse the capillary endothelium; (3) specifically reach the target cell type without causing excessive immunoactivation or off-target cytotoxicity; (4) promote endocytosis and endosomal release; and (5) form a stable formulation with colloidal stability and long shelf-life.
The lipid nanoparticles may partition hydrophobic molecules within the lipid membrane and/or encapsulate water-soluble particles within the aqueous core. In some embodiments, the lipid nanoparticle can have a zeta potential of from 0 to +40 mV. In some embodiments, the lipid nanoparticle can have a diameter of less than 300 nm (e.g., from 50 nm to 200 nm).
The lipid nanoparticles can be formed from a lipid mixture the comprises a cationic lipid, a phospholipid, and a targeting conjugate. In some embodiments, the lipid mixture can further comprise one or more additional lipids, such as a neutral lipid, an anionic lipid, a polymer-lipid conjugate, or a combination thereof.
The lipid mixture can include one or more cationic lipids. Cationic lipids are lipids that carry a net positive charge at any physiological pH. The positive charge can be used for association with negatively charged therapeutics such as ASOs via electrostatic interaction.
Suitable cationic lipids include, but are not limited to: 3b-[N— (N',N'-dimethylaminoethane)- carbamoyljcholesterol hydrochloride (DC-Chol); l,2-dioleoyl-3-trimethylammonium-propane (DOTAP); l,2-dioleoyl-3-dimethylammonium-propane (DODAP);
dimethyldioctadecylammonium bromide salt (DDAB); l,2-dilauroyl-sn-glycero-3- ethylphosphocholine chloride (DL-EPC); N-[l-(2,3-dioleyloyx) propyl]-N— N— N-trimethyl ammonium chloride (DOTMA); N-[l-(2,3-dioleyloyx) propyl]-N— N— N-dimethyl ammonium chloride (DODMA); l,2-dilauroyl-sn-glycero-3-ethylphosphocholine chloride (DOTMA); N,N-dioctadecyl-N,N-dimethylammonium chloride (DODAC); N-(l-(2,3- dioleyloxy)propyl)-N-2-(sperminecarboxamido)ethyl)-N,N-dimethylammonium trifluoracetate (DOSPA); l,2-dimyristyloxypropyl-3-dimethylhydroxyethyl ammonium bromide (DMRIE); dioctadecylamidoglycylspermine (DOGS); neutral lipids conjugated to cationic modifying groups; and combinations thereof. In addition, a number of cationic lipids in commercially available preparations could be used, such as LIPOFECTIN (from GIBCO/BRL),
LIPOFECTAMINE (from GIBCO/MRL), siPORT NEOFX (from Applied Biosystems),
TRANSFECTAM (from Promega), and TRANSFECTIN (from Bio-Rad Laboratories, Inc.).
In some examples, the cationic lipid can comprise a tertiary amine-cationic lipid (e.g., a tertiary amine-cationic lipid selected from the group consisting ofN-[l-(2, 3-dioleyloyx) propyl]-N-N-N-dimethyl ammonium chloride (DODMA), l,2-dioleoyl-3-dimethylammonium- propane (DODAP), 3P-|N-(N'.N'-dimethylaminoethane)-carbamoyl | cholesterol hydrochloride (DC-CHOL), N,N-dimethylhexadecylamine (DMHDA), and combinations thereof). In some examples, the cationic lipid can comprise a quaternary amine-cationic lipid (e.g., a quaternary amine-cationic lipid selected from the group consisting of l,2-dioleoyl-3-trimethylammonium- propane (DOTAP), N-[l-(2, 3-dioleyloyx) propyl]-N— N— N-trimethyl ammonium chloride (DOTMA), dimethyldioctadecylammonium bromide (DDAB), or combinations thereof).
In some embodiments, the cationic lipid can comprise at least 25 mol % (e.g., at least 30 mol %, at least 35 mol %, or at least 40 mol %) of the lipid mixture. In some embodiments, the cationic lipid can comprise 45 mol % or less (e.g., 40 mol % or less, 35 mol % or less, or 30 mol % or less).
The cationic lipid can be present in the lipid mixture at a molar ratio ranging from any of the minimum values described above to any of the maximum values described above. For example, cationic lipid can comprise from 25 mol % to 45 mol % (e.g., from 30 mol % to 40 mol %) of the lipid mixture.
The lipid mixture can further include one or more phospholipids. Examples of phospholipids include glycerophospholipids, such as phosphatidic acid (phosphatidate) (PA), phosphatidylethanolamine (cephalin) (PE), phosphatidylcholine (lecithin) (PC),
phosphatidylserine (PS), and phosphoinositides (e.g., phosphatidylinositol (PI),
phosphatidylinositol phosphate (PIP), phosphatidylinositol bisphosphate (PIP2), and phosphatidylinositol trisphosphate (PIP3)), and phosphosphingolipids, such as ceramide phosphorylcholine (sphingomyelin) (SPH), ceramide phosphorylethanolamine
(sphingomyelin) (Cer-PE), and ceramide phosphoryllipid. In certain examples, the phospholipid can comprise a phosphatidylcholine (e.g., an egg phosphatidylcholine).
In some embodiments, the phospholipid can comprise at least 30 mol % (e.g., at least 35 mol %, at least 40 mol %, or at least 45 mol %) of the lipid mixture. In some embodiments, the phospholipid can comprise 50 mol % or less (e.g., 45 mol % or less, 40 mol % or less, 35 mol % or less, or 30 mol % or less).
The phospholipid can be present in the lipid mixture at a molar ratio ranging from any of the minimum values described above to any of the maximum values described above. For example, phospholipid can comprise from 30 mol % to 50 mol % (e.g., from 35 mol % to 45 mol %) of the lipid mixture.
The targeting conjugate can comprise a targeting agent bound to a lipid via a polymeric linker. The addition of targeting agents to the LN can provide increased efficacy over passive targeting approaches. Targeting involves incorporation of specific targeting moieties such as, but not limited to, ligands or antibodies, cell surface receptors, peptides, lipoproteins, glycoproteins, hormones, vitamins, antibodies, antibody fragments, prodrugs, and conjugates or combinations of these moieties. Some non-limiting examples of targeting agents include folate, cRGD (e.g., cyclo(Arg-Gly-Asp-D-Phe-Cys) (RGDfC)) peptides, galactose-containing moieties, transferrin, EPPT1 peptide, low density lipoprotein, epidermal growth factors, and antibodies. cRGD can refer to any derivative of or related cRGD peptide, for example, cRGDfC, cRGDfK, cRGDfE, etc. In embodiments, the cRGD peptide is cRGDfC (cyclo(Arg- Gly-Asp-D-Phe-Cys)). In some examples, the targeting agent can comprise a T7 peptide.
In certain embodiments, the targeting conjugate can comprise a targeting agent bound to a lipid described herein via a polymeric linker. The polymeric linker can comprise a hydrophilic polymer, such as polyvinyl alcohol (PVA) or a polyalkylene oxide (e.g., polyethylene glycol). The molecular weight of the polymeric linker, such as PEG, can be from about 100 and about 10,000 Da, from about 100 and about 5,000 Da or from about 100 to about 2,000 Da. In some examples, the targeting conjugate can be, for example, T7-PEG- CHEMS (T7-polyethylene glycol-cholesteryl hemisuccinate), T7-PEG-DMPE (T7- polyethylene glycol-dimyristoylphosphatidylethanolamine), T7-PEG-DPPE (T7-poly ethylene glycol- dipalmitoylphosphatidylethanolamine), T7-PEG-DSPE (T7-polyethylene glycol- distearoyl phosphatidylethanolamine), or a combination thereof.
In some embodiments, the targeting conjugate can comprise at least 0.05 mol % (e.g., at least 0.1 mol %, at least 0.5 mol %, at least 1 mol %, at least 2 mol %, at least 3 mol %, or at least 4 mol %) of the lipid mixture. In some embodiments, the targeting conjugate can comprise 5 mol % or less (e.g., 4 mol % or less, 3 mol % or less, 2 mol % or less, 1 mol % or less, 0.5 mol % or less, or 0.1 mol % or less).
The targeting conjugate can be present in the lipid mixture at a molar ratio ranging from any of the minimum values described above to any of the maximum values described above. For example, targeting conjugate can comprise from 0.05 mol % to 5 mol % (e.g., from 0.1 mol % to 1 mol %) of the lipid mixture.
The lipid mixture can include a neutral lipid. Neutral lipids have zero net charge at physiological pH. One or a combination of several neutral lipids may be included in any LN formulation disclosed herein. Suitable neutral lipids include, but are not limited to:
cerebrosides, prostaglandins, cephalin, diacylglycerols, glycosylated diacylglycerols, prenols, lysosomal PLA2 substrates, N-acylglycines, sterols such as cholesterol, demosterol, sitosterol, zymosterol, diosgenin, lanostenol, stigmasterol, lathosterol, and dehydroepiandrosterone, and combinations thereof.
In some embodiments, the neutral lipid can comprise at least 10 mol % (e.g., at least 15 mol %, at least 20 mol %, or at least 25 mol %) of the lipid mixture. In some embodiments, the neutral lipid can comprise 30 mol % or less (e.g., 25 mol % or less, 20 mol % or less, or 15 mol % or less).
The neutral lipid can be present in the lipid mixture at a molar ratio ranging from any of the minimum values described above to any of the maximum values described above. For example, neutral lipid can comprise from 10 mol % to 30 mol % (e.g., from 15 mol % to 25 mol %) of the lipid mixture.
The lipid mixture can further comprise an anionic lipid. Anionic lipids are lipids that carry a net negative charge at physiological pH. These lipids, when combined with cationic lipids, are used to reduce the overall surface charge of LNs and introduce pH-dependent disruption of the LN bilayer structure, facilitating nucleotide release by inducing nonlamellar phases at acidic pH or induce fusion with the cellular membrane. Examples of suitable anionic lipids include, but are not limited to: fatty acids such as oleic, linoleic, and linolenic acids; cholesteryl hemisuccinate (CHEMS); l,2-di-0-tetradecyl-sn-glycero-3-phospho-(l'-rac- glycerol) (Diether PG); l,2-dimyristoyl-sn-glycero-3-phospho-(l'-rac-glycerol) (sodium salt); l,2-dimyristoyl-sn-glycero-3-phospho-L-serine (sodium salt); l-hexadecanoyl,2-(9Z,l2Z)- octadecadienoyl-sn-glycero-3-phosphate; l,2-dioleoyl-sn-glycero-3-[phospho-rac-(l-glycerol)] (DOPG); dioleoylphosphatidic acid (DOPA); and l,2-dioleoyl-sn-glycero-3-phospho-L-serine (DOPS); anionic modifying groups conjugated to neutral lipids; and combinations thereof.
In some embodiments, the anionic lipid can comprise at least 5 mol % (e.g., at least 10 mol %, at least 15 mol %, or at least 20 mol %) of the lipid mixture. In some embodiments, the anionic lipid can comprise 25 mol % or less (e.g., 20 mol % or less, 15 mol % or less, or 10 mol % or less). The anionic lipid can be present in the lipid mixture at a molar ratio ranging from any of the minimum values described above to any of the maximum values described above. For example, anionic lipid can comprise from 5 mol % to 25 mol % (e.g., from 10 mol % to 20 mol %) of the lipid mixture.
In some cases, the lipid mixture further comprises a polymer-lipid conjugate. Charged
LNs are advantageous for transfection, but off-target effects such as cytotoxicity and RES- mediated uptake may occur. To attenuate cytotoxicity and/or RES-mediated uptake, the lipid mixture can include hydrophilic polymers such as polyethylene glycol (PEG) conjugated to a lipid anchor to discourage LN aggregation or interaction with membranes. Hydrophilic polymers may be covalently bonded to lipid components (e.g., any of the lipids described herein) or conjugated using crosslinking agents to functional groups such as amines. Suitable hydrophilic polymers for conjugation and hydrophilic polymer conjugates include, but are not limited to, polyvinyl alcohol (PVA) and polyalkylene oxides, such as polyethylene glycol. The molecular weight of the hydrophilic polymer used, such as PEG, can be from about 100 and about 10,000 Da, from about 100 and about 5,000 Da or from about 100 to about 2,000 Da. In some examples, the polymer-lipid conjugate can comprise l,2-distearoyl-sn-glycero-3- phosphoethanolamine-N-PEG (DSPE-PEG), dimyristoylphosphatidylethanolamine-PEG (DMPE-PEG), dipalmitoylphosphatidlyethanolamine-PEG (DPPE-PEG), 1, 2-dimyristoyl-sn- glycerol and methoxypolyethylene glycol (DMG-PEG), or a combination thereof.
In some embodiments, the polymer-lipid conjugate can comprise at least 0.5 mol %
(e.g., at least 1 mol %, at least 5 mol %, or at least 10 mol %) of the lipid mixture. In some embodiments, the polymer-lipid conjugate can comprise 15 mol % or less (e.g., 10 mol % or less, 5 mol % or less, or 1 mol % or less).
The polymer-lipid conjugate can be present in the lipid mixture at a molar ratio ranging from any of the minimum values described above to any of the maximum values described above. For example, polymer-lipid conjugate can comprise from 0.5 mol % to 15 mol % (e.g., from 1 mol % to 10 mol %) of the lipid mixture.
In certain embodiments, the lipid mixture can comprise from 30 mol % to 40 mol % cationic lipid, from 35 mol % to 45 mol % phospholipid, from 15 mol % to 25 mol % neutral lipid, from 0.05 mol % to 2 mol % targeting conjugate; and from 1 mol % to 10 mol % polymer-lipid conjugate. In certain embodiments, the lipid mixture can comprise from 30 mol % to 40 mol % N-[l-(2, 3-dioleyloyx) propyl] -N-N-N-dimethyl ammonium chloride
(DODMA), from 35 mol % to 45 mol % phosphatidylcholine, from 15 mol % to 25 mol % cholesterol, from 0.05 mol % to 2 mol % T7-PEG-DSPE (T7-poly ethylene glycol-distearoyl phosphatidylethanolamine), and from 1 mol % to 10 mol % 1, 2-dimyristoyl-sn-glycerol and methoxypolyethylene glycol (DMG-PEG).
If desired, the LN formulations described here may further comprise cationic polymers or conjugates of cationic polymers. Cationic polymers or conjugates thereof may be used alone or in combination with lipid nanocarriers. Suitable cationic polymers include, but are not limited to: polyethylenimine (PEI); pentaethylenehexamine (PEHA); spermine; spermidine; poly(L-lysine); poly(amido amine) (PAMAM) dendrimers; polypropyleneiminie dendrimers; poly(2-dimethylamino ethyl)-methacrylate (pDMAEMA); chitosan; tris(2-aminoethyl)amine and its methylated derivatives; and combinations thereof. Anionic polymers may also be incorporated into the LN formulations presently disclosed as well. Suitable anionic polymers include, but are not limited to: poly(propylacrybc acid) (PPAA); poly(glutamic acid) (PGA); alginates; dextrans; xanthans; derivatized polymers; and combinations thereof.
Various methods of LN preparation are suitable to synthesize the LNs of the present disclosure, including methods known in the art. For example, ethanol dilution, freeze-thaw, thin film hydration, sonication, extrusion, high pressure homogenization, detergent dialysis, microfluidization, tangential flow diafiltration, sterile filtration, and/or lyophilization may be utilized. Additionally, several methods may be employed to decrease the size of the LNs. For example, homogenization may be conducted on any devices suitable for lipid homogenization such as an Avestin Emulsiflex C5. Homogenized LNs may be recycled back into circulation for extended homogenization. Extrusion may be conducted on a Lipex Biomembrane extruder using a polycarbonate membrane of appropriate pore size (0.05 to 0.2 pm). Multiple particle size reduction cycles may be conducted to minimize size variation within the sample and achieve a desired size. The resultant LNs may then be passed through a Sepharose CL4B to remove excess reagents or processed by tangential flow diafiltration.
Physical characterization of the LNs can be carried through many methods. Dynamic light scattering (DLS) or atomic force microscopy (AFM) can be used to determine the average diameter and its standard deviation. Ideally, LNs should fall under 200 nm in diameter. Zeta potential measurement via zeta potentiometer is useful in determining the relative stability of particles. Both dynamic light scattering analysis and zeta potential analysis may be conducted with diluted samples in deionized water or appropriate buffer solution. Cryogenic transmission electron microscopy (Cryo-TEM) and scanning electron microscopy (SEM) may be used to determine the detailed morphology of LNs.
The LNs described herein are stable under refrigeration for several months. LNs requiring extended periods of time between synthesis and administration may be lyophilized using standard procedures. A cryoprotectant such as 10% sucrose may be added to the LN suspension prior to freezing to maintain the integrity of the formulation. Freeze drying loaded LN formulations is recommended for long term stability.
Therapeutic Cargo
The therapeutic cargo encapsulated in the lipid nanoparticles can comprise a functional nucleic acid which modulates the expression of Akt-l; and a functional nucleic acid which modulates the expression of Bcl-2.
Functional nucleic acids are nucleic acid molecules that have a specific function, such as binding a target molecule or catalyzing a specific reaction. Functional nucleic acid molecules can be divided into the following categories, which are not meant to be
limiting. For example, functional nucleic acids include antisense molecules, aptamers, ribozymes, triplex forming molecules, and external guide sequences. The functional nucleic acid molecules can act as effectors, inhibitors, modulators, and stimulators of a specific activity possessed by a target molecule, or the functional nucleic acid molecules can possess a de novo activity independent of any other molecules.
Functional nucleic acid molecules can interact with any macromolecule, such as DNA, RNA, polypeptides, or carbohydrate chains. Thus, functional nucleic acids can interact with the mRNA of any of the disclosed nucleic acids or the genomic DNA of any of the disclosed nucleic acids, or they can interact with the polypeptide encoded by any of the disclosed nucleic acids. Often functional nucleic acids are designed to interact with other nucleic acids based on sequence homology between the target molecule and the functional nucleic acid molecule. In other situations, the specific recognition between the functional nucleic acid molecule and the target molecule is not based on sequence homology between the functional nucleic acid molecule and the target molecule, but rather is based on the formation of tertiary structure that allows specific recognition to take place.
Antisense molecules are designed to interact with a target nucleic acid molecule through either canonical or non-canonical base pairing. The interaction of the antisense molecule and the target molecule is designed to promote the destruction of the target molecule through, for example, RNaseH mediated RNA-DNA hybrid degradation. Alternatively, the antisense molecule is designed to interrupt a processing function that normally would take place on the target molecule, such as transcription or replication. Antisense molecules can be designed based on the sequence of the target molecule. Numerous methods for optimization of antisense efficiency by finding the most accessible regions of the target molecule
exist. Exemplary methods would be in vitro selection experiments and DNA modification studies using DMS and DEPC. It is preferred that antisense molecules bind the target molecule with a dissociation constant (kd)less than or equal to 10 6, 10 8, 10 10, or 10 12. A representative sample of methods and techniques which aid in the design and use of antisense molecules can be found in the following non-limiting list of United States patents: 5,135,917, 5,294,533,
5,627,158, 5,641,754, 5,691,317, 5,780,607, 5,786,138, 5,849,903, 5,856,103, 5,919,772, 5,955,590, 5,990,088, 5,994,320, 5,998,602, 6,005,095, 6,007,995, 6,013,522, 6,017,898, 6,018,042, 6,025,198, 6,033,910, 6,040,296, 6,046,004, 6,046,319, and 6,057,437.
In certain embodiments, the functional nucleic acid can be a plasmid DNA (pDNA), an antisense oligonucleotide (ASO), small interfering RNA (siRNA), small hairpin RNA
(shRNA), microRNA (miR), anti-miRs, or a combination thereof.
Akt-l (also known as PKB alpha and RAC-PK alpha) is a member of the AKT/PKB family of serine/threonine kinases and has been shown to be involved in a diverse set of signaling pathways. Akt-l, like other members of the AKT/PKB family is located in the cytosol of unstimulated cells and translocates to the cell membrane following stimulation. Akt- 1 translocation can be activated by several ligands including platelet derived growth factor, epidermal growth factor, basic fibroblast growth factor, cellular stress such as heat shock and hyperosmolarity as well as insulin (Bos, Trends Biochem. Sci., 1995, 20, 441-442) and other studies have shown that this activation is through PI3 kinase which is wortmannin sensitive (Franke et al, Science, 1997, 275, 665-668). Once localized to the plasma membrane, Akt-l has been shown to mediate several functions within the cell including apoptosis, the metabolic effects of insulin, induction of differentiation and/or proliferation, protein synthesis and stress responses (Alessi and Cohen, Curr. Opin. Genet. Dev., 1998, 8, 55-62; Downward, Curr. Opin. Cell Biol., 1998, 10, 262-267).
Akt-l was cloned independently in 1991 by three groups (Bellacosa et al, Science, 1991, 254, 274-277; Coffer and Woodgett, Eur. J. Biochem., 1991, 201, 475-481 ; Jones et al, Cell Regul, 1991, 2, 1001-1009) but its association with primary human gastric carcinoma was recognized as early as 1987 (Staal, Proc. Natl. Acad. Sci. U S A, 1987, 84, 5034-5037). Akt-l has also been shown to be overexpressed in 3% of breast cancers (Bellacosa et al, Int. J.
Cancer, 1995, 64, 280-285).
Akt-l has been proposed to be a gene involved in chromosomal rearrangement at chromosome band l4q32. This locus is known to undergo rearrangement in human T-cell malignancies such as prolymphocytic leukemias, and mixed lineage childhood leukemias (Staal et al, Genomics, 1988, 2, 96-98). Akt-l also plays a role in the prevention of "programmed cell death" or apoptosis. It has been demonstrated that Akt-l provides a survival signal to cells protecting them from a number of agents including UV radiation (Dudek et al., Science, 1997, 275, 661-665), withdrawal of IGF 1 from neuronal cells, detachment from the extracellular matrix, stress and heat shock (Alessi and Cohen, Curr. Opin. Genet. Dev., 1998, 8, 55-62). These findings may explain the overexpression of Akt-l seen in cancer cells which allows preferential survival of the carcinoma by avoiding the normal progression to apoptosis.
The functional nucleic acid which modulates the expression of Akt-l can be a plasmid DNA (pDNA), an antisense oligonucleotide (ASO), small interfering RNA (siRNA), small hairpin RNA (shRNA), microRNA (miR), anti-miRs, or a combination thereof. In some cases, the functional nucleic acid can be stabilized by modifications to substituent nucleic acid base units, by phosphorothioate substitution of phosphodiester linkers, and/or by 2'-0-methylation of ribose units. In certain embodiments, the functional nucleic acid which modulates the expression of Akt-l can comprise an antisense oligonucleotide (ASO) targeted to a portion of a nucleic acid encoding Akt- 1.
In some embodiments, the functional nucleic acid is an ASO targeted to a portion of a nucleic acid encoding Akt-l, and which modulates the expression of Akt-l. The
oligonucleotide compounds are designed to specifically hybridize with one or more nucleic acids encoding Akt-l. Such ASOs are disclosed in U.S. Pat. No. 7,122,527, the contents of which are hereby incorporated by reference in their entirety. One exemplary ASO, RX-0201
(Archexin®) which is a 20-mer phosphorothioate antisense oligonucleotide, is targeted to a site in the coding region of the Akt-l gene having the following sequence: 5' cgccaaggagatcatgcagc 3' at site 1,478 of Akt-l gene (SEQ ID NO: 13). The sequence for the backbone of RX-0201 is complementary to this site.
Another ASO, RX-0194, is targeted to a site on the Akt-l gene having the following sequence: 5' agtggactggtgggggctgg 3' at site 1,271 of Akt-l gene (SEQ ID NO: 14). The sequence for the backbone of RX-0194 is complementary to this site. Oligomers comprising either 5 or 10 nucleotide upstream and downstream from the sequence where the 20-mer of RX-0194 was derived showed a measurable inhibition of Akt-l mRNA expression. The truncated versions of RX-0194 and RX-0201 also showed an inhibition of cancer cell proliferation. In addition to the above 2 ASOs, five additional antisense oligonucleotide compounds which do wn-regul ate Akt-l mRNA expression and cause cytotoxic effects on cancer cell lines include: RX-0616, comprising 5' agatagctggtgacagacag 3' (SEQ ID NO: 15) hybridizable to the site beginning at position 2101 of Akt-l gene, having the following sequence: 5'
ctgtctgtcaccagctatct 3' (SEQ ID NO: 16);
RX-0627, comprising 5' cgtggagagatcatctgagg 3' (SEQ ID NO: 17) hybridizable to the site beginning at position 2473 of Akt-l gene, having the following sequence: 5'
cctcagatgatctctccacg 3' (SEQ ID NO: 18);
RX-0628, comprising 5' tcgaaaaggtcaagtgctac 3' (SEQ ID NO: 19) hybridizable to the site beginning at position 2493 of Akt-l gene, having the following sequence: 5'
gtagcacttgaccttttcga 3' (SEQ ID NO:20);
RX-0632, comprising 5' tggtgcagcggcagcggcag 3' (SEQ ID NO:2l) hybridizable to the site beginning at position 2603 of Akt-l gene, having the following sequence: 5'
ctgccgctgccgctgcacca 3' (SEQ ID NO:22); and
RX-0638, comprising 5' ggcgcgagcgcgggcctagc 3' (SEQ ID NO:23) hybridizable to the site beginning at position site 170 of Akt-l gene, having the following sequence: 5' gctaggcccgcgctcgcgcc 3' (SEQ ID NO:24).
In one example, the functional nucleic acid can be defined by 5’-gcu GCT TGATCT CCT TG gcg-3’ (SEQ ID NO:4), wherein the lower-case letters indicate 2’-OMe modification.
Bcl-2 has been linked to a wide variety of diseases such as hematologic malignancies, both leukemias and lymphomas, including follicular and nonfollicular lymphomas, chronic lymphocytic leukemia, and plasma cell dyscrasias (Campos et al, Blood, 84:595, 1994); solid tumors like those associated with breast, prostate and colon cancer; and immune disorders. One particular Bcl-2-related disease is Follicular non-Hodgkin Lymphoma (FL). FL is the most common lymphoid malignancy in Europe and the United States. Typically it is an indolent, low grade disease consisting of an accumulation of small, resting B cells. Although the response to chemotherapy is initially good, relapses are inevitable with the transformation to a more aggressive histological type and the development of drug resistance (Aisenberg, J. Clin.
Oncol., 13:2656, 1995; Johnson et. al, J. Clin. Oncol., 13: 140, 1995). In over 90% of FL patients, a t(l4; 18) translocation is found, which results in the juxtaposition of the bcl-2 gene from chromosome l8q2l with the immunoglobulin heavy chain gene locus on chromosome l4q323 (Tsujimoto et. al, Science, 229: 1390, 1985; Graninger et. al, J. Clin. Invest., 80: 1512,
1987). As a consequence, the bcl-2 gene is under the influence of immunoglobulin heavy chain enhancer, and the Bcl-2 protein is overexpressed (Bakhshi et. al, Cell, 41 :899, 1985; Tsujimoto et. al, Oncogene, 2:3, 1987). Bcl-2 tumorigenic potential is related to its capacity of interfering with physiological death responses, thereby enhancing the longevity of the cell (Nunez et. al, J. Immunol., 144:3602, 1990). The Bcl-2 protein blocks apoptotic stimuli such as growth factor deprivation, radiation, heat-shock, virus, and most of the chemotherapeutic agents
(Reed , Hematol. Oncol. Clin. North Am., 9:451, 1995; Hockenbery et. al, Nature, 348:334, 1990). In bcl-2-Ig-transgenic mice, a polyclonal follicular lymphoproliferation consisting of an expansion of mature B lymphocytes is initially observed (McDonnell et. al, Cell, 57:79, 1989). Subsequently, a monoclonal high grade large immunoblastic type lymphomas develop with 50% of them presenting rearrangement of C-MYC. This suggests that a second genetic alteration is necessary for the development and progression of malignant lymphoma
(McDonnell and Korsmeyer, Nature, 349:254, 1991).
Recently, an expanding family of Bcl-2-related proteins has been identified. This includes Bax, Bcl-XL, Bcl-Xs, Bad, Bak, Mcl-l, A-l, and several open reading frames in DNA viruses (Oltvai et. al, Cell, 74:609, 1993; Boise et. al, Cell, 74:597, 1993; Yang et.
al, Cell, 80:285, 1995; Chittenden et. al , Nature, 374:733, 1995; Kiefer et. al , Nature, 374: 736, 1995; Kozopas et. al Proc. Natl Acad. Sci. USA, 90:3516, 1993; Lin et. al, J.
Immunol., 151 : 1979, 1993; Pearson et. al, Virology, 160: 151, 1987; Neilan et. al, J.
Virol., 67:4391, 1993). Membership in the Bcl-2 family of proteins is principally defined by homology within the BH1 and BH2 domains, which help regulate dimerization between the members (Sato et. al, Proc. Natl Acad. Sci. USA, 91 :9238, 1994). Bax, which shares 21% amino-acid identity with Bcl-2, can bind to Bcl-2 protein and neutralize its ability to block cell death. Thus, the ratio of Bcl-2 to Bax is thought to determine the cells susceptibility to death following an apoptotic stimulus (Oltvai et. al, 1993; Yin et. al, Nature, 369: 321, 1994).
The functional nucleic acid which modulates the expression of Bcl-2 can be a plasmid DNA (pDNA), an antisense oligonucleotide (ASO), small interfering RNA (siRNA), small hairpin RNA (shRNA), microRNA (miR), anti-miRs, or a combination thereof. In some cases, the functional nucleic acid can be stabilized by modifications to substituent nucleic acid base units, by phosphorothioate substitution of phosphodiester linkers, and/or by 2'-0-methylation of ribose units. In certain embodiments, the functional nucleic acid which modulates the expression of Bcl-2 can comprise an antisense oligonucleotide (ASO) targeted to a portion of a nucleic acid encoding Bcl-2. Examples of such ASOs are known in the art, and include those described in U.S. Patent Nos. 5,734,033, 7,022,831, 6,001,992, 7,285,288, each of which is incorporated herein by reference in its entirety.
In one example, the functional nucleic acid can be defined by 5’-ucu CCC AGC GTG CGC cau-3’ (SEQ ID NO:2), wherein the lower-case letters indicate 2’-OMe modification. The functional nucleic acid which modulates the expression of Akt-l and the functional nucleic acid which modulates the expression of Bel -2 can be present at a molar ratio of from 5: 1 to 1:5. In some embodiments, the functional nucleic acid which modulates the expression of Akt-l and the functional nucleic acid which modulates the expression of Bcl-2 can be present at a molar ratio of from 1: 1 to 5: 1 (e.g., a molar ratio of from 1 : 1 to 3: 1)
In some embodiments, the therapeutic cargo can further comprise an additional therapeutic agent, such as an antineoplastic agent, anti-infective agent, local anesthetic, anti allergic, antianemic, angiogenesis inhibitor, beta-adrenergic blocker, calcium channel antagonist, anti-hypertensive agent, anti-depressant, anti-convulsant, anti-bacterial, anti-fungal, anti-viral, anti-rheumatic, anthelminithic, antiparasitic agent, corticosteroid, hormone, hormone antagonist, immunomodulator, neurotransmitter antagonist, anti-diabetic agent, anti-epileptic, anti-hemmorhagic, anti-hypertonic, antiglaucoma agent, immunomodulatory cytokine, sedative, chemokine, vitamin, toxin, narcotic, imaging agent, or combination thereof. These additional therapeutic agents can be encapsulated within the lipid nanoparticle, or otherwise dissolved or dispersed in the pharmaceutical composition (e.g., dissolved or dispersed within a carrier for the lipid nanoparticles).
Applications
Depending on the application, the lipid nanoparticles disclosed herein may be designed to favor characteristics such as increased interaction with nucleic acids, increased serum stability, lower RES-mediated uptake, targeted delivery, or pH sensitive release within the endosome. Because of the varied nature of LN formulations, any one of the several methods provided herein may be applied to achieve a particular therapeutic aim. Cationic lipids, anionic lipids, PEG-lipids, neutral lipids, fusogenic lipids, cationic polymers, anionic polymers, polymer conjugates, peptides, targeting moieties, and combinations thereof may be applied to meet specific aims.
The lipid nanoparticles described herein can be used as platforms for therapeutic delivery of oligonucleotide (ON) therapeutics, such as cDNA, siRNA, shRNA, miRNA, anti- miR, and antisense oligonucleotides (ASO). These therapeutics could be used to manage a wide variety of diseases such as various types of cancers, leukemias, viral infections, and other diseases. The particular disease treatable according to the invention depends, of course, upon the therapeutic agent incorporated into the LN of the invention. The LNs described herein are particularly suitable for encapsulation of nucleic acids, for example antisense oligonucleotides. Nucleic acids, and in particular antisense nucleotides are especially useful for the treatment of tumors and cancers. Examples of tumors and cancers treatable according to the invention include, for example Brain cancer, bladder cancer, lung cancer, breast cancer, melanoma, skin cancer, epidermal carcinoma, colon and rectal cancer, non-Hodgkin lymphoma, endometrial cancer, pancreatic cancer, kidney (renal cell) cancer, prostate cancer, leukemia thyroid cancer, head and neck, ovarian cancer, hepatocellular cancer, cervical cancer, sarcomas, gastric cancers, multiple myeloma, lymphomas, and gastrointestinal cancer, and uterine cancer.
Specific examples include epidermal carcinoma, pancreatic cancer and breast cancer.
A number of tumors overexpress receptors on their cell surface. Targeting moieties such as cRGD peptides, folate, transferrin (Tf), antibodies low density lipoprotein (LDL), and epidermal growth factors can greatly enhance activity by enabling targeted drug delivery. Multi-targeted systems are another possibility and may be applied further to specify a particular target cell subtype.
Implementation of embodiments of the LN formulations described herein alone or in combination with one another synergizes with current paradigms of lipid nanoparticle design.
Depending on the therapeutic application, the LNs described herein may be administered by the following methods: peroral, parenteral, intravenous, intramuscular, subcutaneous, intraperitoneal, transdermal, intratumoral, intraarterial, systemic, or convection- enhanced delivery. In particular embodiments, the LNs are delivered intravenously, intramuscularly, subcutaneously, or intratumorally. Subsequent dosing with different or similar LNs may occur using alternative routes of administration.
Pharmaceutical compositions of the present disclosure comprise an effective amount of a lipid nanoparticle formulation disclosed herein, and/or additional agents, dissolved or dispersed in a pharmaceutically acceptable carrier. The phrases“pharmaceutical” or “pharmacologically acceptable” refers to molecular entities and compositions that produce no adverse, allergic or other untoward reaction when administered to an animal, such as, for example, a human. The preparation of a pharmaceutical composition that contains at least one compound or additional active ingredient will be known to those of skill in the art in light of the present disclosure, as exemplified by Remington's Pharmaceutical Sciences, 2003, incorporated herein by reference. Moreover, for animal (e.g., human) administration, it will be understood that preparations should meet sterility, pyrogenicity, general safety and purity standards as required by FDA Office of Biological Standards.
A composition disclosed herein may comprise different types of carriers depending on whether it is to be administered in solid, liquid or aerosol form, and whether it need to be sterile for such routes of administration as injection. Compositions disclosed herein can be administered intravenously, intradermally, transdermally, intrathecally, intraarterially, intraperitoneally, intranasally, intravaginally, intrarectally, topically, intramuscularly, subcutaneously, mucosally, in utero, orally, topically, locally, via inhalation (e.g., aerosol inhalation), by injection, by infusion, by continuous infusion, by localized perfusion bathing target cells directly, via a catheter, via a lavage, in creams, in lipid compositions (e.g., liposomes), or by other method or any combination of the forgoing as would be known to one of ordinary skill in the art (see, for example, Remington's Pharmaceutical Sciences, 2003, incorporated herein by reference).
The actual dosage amount of a composition disclosed herein administered to an animal or human patient can be determined by physical and physiological factors such as body weight, severity of condition, the type of disease being treated, previous or concurrent therapeutic interventions, idiopathy of the patient and on the route of administration. Depending upon the dosage and the route of administration, the number of administrations of a preferred dosage and/or an effective amount may vary according to the response of the subject. The practitioner responsible for administration will, in any event, determine the concentration of active ingredient(s) in a composition and appropriate dose(s) for the individual subject.
In certain embodiments, pharmaceutical compositions may comprise, for example, at least about 0.1% of an active compound. In other embodiments, an active compound may comprise between about 2% to about 75% of the weight of the unit, or between about 25% to about 60%, for example, and any range derivable therein. Naturally, the amount of active compound(s) in each therapeutically useful composition may be prepared is such a way that a suitable dosage will be obtained in any given unit dose of the compound. Factors such as solubility, bioavailability, biological half-life, route of administration, product shelf life, as well as other pharmacological considerations will be contemplated by one skilled in the art of preparing such pharmaceutical formulations, and as such, a variety of dosages and treatment regimens may be desirable.
In other non-limiting examples, a dose may also comprise from about 1
microgram/kg/body weight, about 5 microgram/kg/body weight, about 10 microgram/kg/body weight, about 50 microgram/kg/body weight, about 100 microgram/kg/body weight, about 200 microgram/kg/body weight, about 350 microgram/kg/body weight, about 500
microgram/kg/body weight, about 1 milligram/kg/body weight, about 5 milligram/kg/body weight, about 10 milligram/kg/body weight, about 50 milligram/kg/body weight, about 100 milligram/kg/body weight, about 200 milligram/kg/body weight, about 350 milligram/kg/body weight, about 500 milligram/kg/body weight, to about 1000 mg/kg/body weight or more per administration, and any range derivable therein. In non-limiting examples of a derivable range from the numbers listed herein, a range of about 5 mg/kg/body weight to about 100 mg/kg/body weight, about 5 microgram/kg/body weight to about 500 milligram/kg/body weight, etc., can be administered, based on the numbers described above.
In certain embodiments, a composition herein and/or additional agents is formulated to be administered via an alimentary route. Alimentary routes include all possible routes of administration in which the composition is in direct contact with the alimentary tract.
Specifically, the pharmaceutical compositions disclosed herein may be administered orally, buccally, rectally, or sublingually. As such, these compositions may be formulated with an inert diluent or with an assimilable edible carrier.
In further embodiments, a composition described herein may be administered via a parenteral route. As used herein, the term“parenteral” includes routes that bypass the alimentary tract. Specifically, the pharmaceutical compositions disclosed herein may be administered, for example but not limited to, intravenously, intradermally, intramuscularly, intraarterially, intrathecally, subcutaneous, or intraperitoneally (U.S. Pat. Nos. 6,753,514, 6,613,308, 5,466,468, 5,543,158; 5,641,515; and 5,399,363 are each specifically incorporated herein by reference in their entirety).
Solutions of the compositions disclosed herein as free bases or pharmacologically acceptable salts may be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions may also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. The
pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions (U.S. Pat. No. 5,466,468, specifically incorporated herein by reference in its entirety). In all cases the form must be sterile and must be fluid to the extent that easy injectability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (i.e., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and/or vegetable oils. Proper fluidity may be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption such as, for example, aluminum monostearate or gelatin.
For parenteral administration in an aqueous solution, for example, the solution should be suitably buffered if necessary and the liquid diluent first rendered isotonic with sufficient saline or glucose. These particular aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous, and intraperitoneal administration. In this connection, sterile aqueous media that can be employed will be known to those of skill in the art in light of the present disclosure. For example, one dosage may be dissolved in 1 ml of isotonic NaCl solution and either added to 1000 ml of hypodermoclysis fluid or injected at the proposed site of infusion, (see for example,“Remington's Pharmaceutical Sciences” l5th Edition, pages 1035-1038 and 1570-1580). Some variation in dosage will necessarily occur depending on the condition of the subject being treated. The person responsible for administration will, in any event, determine the appropriate dose for the individual subject. Moreover, for human administration, preparations should meet sterility, pyrogenicity, general safety, and purity standards as required by FDA Office of Biologies standards.
Sterile injectable solutions are prepared by incorporating the compositions in the required amount in the appropriate solvent with various other ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by
incorporating the various sterilized compositions into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, some methods of preparation are vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof. A powdered composition is combined with a liquid carrier such as, e.g., water or a saline solution, with or without a stabilizing agent.
In other embodiments, the compositions may be formulated for administration via various miscellaneous routes, for example, topical (i.e., transdermal) administration, mucosal administration (intranasal, vaginal, etc.) and/or via inhalation.
Pharmaceutical compositions for topical administration may include the compositions formulated for a medicated application such as an ointment, paste, cream or powder.
Ointments include all oleaginous, adsorption, emulsion and water-soluble based compositions for topical application, while creams and lotions are those compositions that include an emulsion base only. Topically administered medications may contain a penetration enhancer to facilitate adsorption of the active ingredients through the skin. Suitable penetration enhancers include glycerin, alcohols, alkyl methyl sulfoxides, pyrrolidones and luarocapram. Possible bases for compositions for topical application include polyethylene glycol, lanolin, cold cream and petrolatum as well as any other suitable absorption, emulsion or water-soluble ointment base. Topical preparations may also include emulsifiers, gelling agents, and antimicrobial preservatives as necessary to preserve the composition and provide for a homogenous mixture. Transdermal administration of the compositions may also comprise the use of a“patch.” For example, the patch may supply one or more compositions at a predetermined rate and in a continuous manner over a fixed period of time.
In certain embodiments, the compositions may be delivered by eye drops, intranasal sprays, inhalation, and/or other aerosol delivery vehicles. Methods for delivering compositions directly to the lungs via nasal aerosol sprays has been described in U.S. Pat. Nos. 5,756,353 and 5,804,212 (each specifically incorporated herein by reference in their entirety). Likewise, the delivery of drugs using intranasal microparticle resins (Takenaga et al, 1998) and lysophosphatidyl-glycerol compounds (U.S. Pat. No. 5,725,871, specifically incorporated herein by reference in its entirety) are also well-known in the pharmaceutical arts and could be employed to deliver the compositions described herein. Likewise, transmucosal drug delivery in the form of a polytetrafluoroetheylene support matrix is described in U.S. Pat. No.
5,780,045 (specifically incorporated herein by reference in its entirety), and could be employed to deliver the compositions described herein.
It is further envisioned the compositions disclosed herein may be delivered via an aerosol. The term aerosol refers to a colloidal system of finely divided solid or liquid particles dispersed in a liquefied or pressurized gas propellant. The typical aerosol for inhalation consists of a suspension of active ingredients in liquid propellant or a mixture of liquid propellant and a suitable solvent. Suitable propellants include hydrocarbons and hydrocarbon ethers. Suitable containers will vary according to the pressure requirements of the propellant. Administration of the aerosol will vary according to subject's age, weight and the severity and response of the symptoms.
By way of non-limiting illustration, examples of certain embodiments of the present disclosure are given below. EXAMPLES
Example 1: T7 Peptide-conjugated Lipid Nanoparticles for Dual-modulation of Bcl-2 and Akt-1 in Lung and Cervical Carcinomas
Overview
Purpose: The expression of Bcl-2 and Akt-l have been associated with human cancer. G3139 and RX-0201, targeting Bcl-2 and Akt-l, respectively, are antisense oligonucleotides (ASOs) that have shown limited efficacy in clinical trials. Herein, a combination of newly designed ASOs based on these agents are described and delivered by tumor cell-targeting lipid nanoparticles (LNPs).
Method: A“gapmer” design strategy was applied to ASOs with the addition of 2’-0- methyl modifications on the nucleotides at 5’ and 3’ ends of the ASOs. A dual-channel syringe pump system was developed for the synthesis of the ASOs-LNPs. ASO-LNPs composed of DODMA, egg PC, cholesterol, T7-PEG-DSPE, and PEG-DMG at a molar ratio of
35:39.5:20:0.5:5 and carrying ASO or ASO combinations were synthesized and evaluated in both KB and A549 cancer cells and in an A549 murine xenograft model to determine their antitumor effects and biological activities.
Result: The ASOs-LNPs exhibited excellent colloidal stability and high ASO encapsulation efficiency with relatively small mean particle sizes and moderately positive zeta potentials. Transferrin receptor-targeting T7-conjugated LNPs showed enhanced cellular uptake compared to non-targeted LNPs. In addition, both T7-conjugated Co- ASO-LNPs and non-T7-conjugated Co-ASO-LNPs at a molar ratio of (G3139-GAP to RX-0201-GAP at 1:2) showed efficient downregulation of both Bcl-2 and Akt-l in both A549 and KB cells.
Furthermore, T7-conjugated co-loaded ASOs-LNPs (Co- ASOs-LNPs) produced superior anti- tumor activity, prolonged the overall survival time, and demonstrated tumor targeting activity in an A549 xenograft model.
Introduction
Lung cancer is the leading cause of cancer related deaths in the United States.
Approximately 150,000 Americans died from lung cancer in 2017, which accounted for nearly 25 percent of all cancer deaths. In advanced stages lung cancer readily metastasizes to other organs, which abrogate the effectiveness of surgery and conventional therapy.
Chemotherapeutics, such as paclitaxel and cisplatin, are currently employed in treatment for lung cancer. However, these agents have serious adverse side effects and have limited efficacy.
Cervical carcinoma is another aggressive cancer that affects over 500,000 women worldwide each year with nearly half of patients succumbing to this disease. Response rates are higher for combination chemotherapy over monotherapy. However, treatment is frequently associated with severe effects.
Antisense oligonucleotides (ASOs) are able to selectively modulate expression of target genes by preventing mRNA translation into protein and have shown promising efficacy in preclinical studies. Expression of B cell lymphoma 2 (Bcl-2) family members has been found to be correlated to survival in most mammalian cells and to drug resistance in cancer cells. Akt-l is a member of the Akt/PKB family that has been implicated in several cancer-related pathways. Moreover, Akt-l has been shown to negatively regulate programmed cell death.
In vivo, ASOs face challenges such as nuclease degradation, low target binding affinity, low membrane permeability, off-target effects, etc. In this example, a gapmer-based design strategy was implemented based on Bcl-2 and Akt-l ASOs by adding 2’-0-methyl modifications (2’-0-Me) to the ends of the oligonucleotides while retaining the full sequence modification with phosphorothioate (PS) linkages. This design can increase protection of the ASOs against nucleases and to enhance RNaseH based target degradation. Moreover, the dual target modulation provides a synergistic effect. In terms of delivery system, lipid nanoparticles (LNPs) can increase ASO stability and overall systematic circulation time. In this example, T7 peptide, which has high affinity for the transferrin receptor, was conjugated to LNPs for tumor cell targeting. Dual modulation of Bcl-2 and Akt-l targets was achieved by co-loading of the two ASOs in T7-LNPs and targeted delivery to tumor cells.
Experimental
Materials
l,2-Dioleyloxy-3-dimethylaminopropane (DODMA), l,2-dioleoyl-sn-glycero-3- phosphoethanolamine (DOPE), cholesterol, egg L-a-phosphatidylcholine (95%) (egg PC), and 1,2 distearoyl-sn-glycero-3-phosphoethanolamine-N-[maleimide (polyethylene glycol)] (Mal-
PEG-DSPE) (MW 3,400) were purchased from Avanti Polar Lipids (Alabaster, AL). 1,2- Dimyristoyl-rac-glycero-3-methylpolyoxy ethylene (PEG-DMG) was obtained from Fisher Scientific (Grand Island, NY). Slide-A-Lyzer™ Dialysis Cassettes with MWCO 3.5k and Pierce Rapid Gold BCA Protein Assay Kit were purchased from ThermoFisher Scientific (Waltham, MA). RPMI-1640 medium, trypsin-EDTA (0.05%), and penicillin-streptomycin were obtained from Gibco (Gaithersburg, MD). Ready Gel® Tris-HCl Precast Gels, Tris- Glycine-SDS running buffer, and Tris-Glycine transfer buffer were from BioRad (Hercules, CA). Paclitaxel (PTX) was purchased from Sigma-Aldrich (St. Louis, MO). ASOs
G3139 gapmer (G3139-GAP) was custom-synthesized by Alpha DNA (Quebec, Canada). The sequence of fully phosphorothioated original G3139 is 5’-TCT CCC AGC GTG CGC CAT-3’ (SEQ ID NO: l). The G3139-GAP design had 2’-0-Me modifications on both ends of the oligonucleotide with a sequence of 5’-ucu CCC AGC GTG CGC cau-3’ (SEQ ID NO: 2; lower case here indicates 2’-OMe modification).
RX-0201 was obtained from Rexahn Pharmaceuticals (Rockville, MD). RX-0201 is fully phosphorothioate substituted and has the sequence of 5’-GCT GCA TGA TCT CCT TGG CG-3’ (SEQ ID NO:3), which targets Akt-l. The 2’-OMe modifications were then applied for the gapmer. RX-0201 gapmer (RX0201-GAP) had a sequence of 5’-gcu GCT TGA TCT CCT TG gcg-3’ (SEQ ID NO:4) and was purchased from Alpha DNA (Quebec, Canada).
Fluorescent oligonucleotides FAM-G3139 and FAM-RX-0201 were purchased from Integrated DNA Technologies (Coralville, IA).
T7 Peptide
T7-peptide is composed of 7 amino acids (HAIYPRH; SEQ ID NO:5) and targets the transferrin receptor, which is expressed on the surface of most tumor cells. A cysteine was added to the N terminus of the T7 peptide (Cys-HARYPRH, SEQ ID NO:6) to facilitate peptide conjugation with Mal-PEG-DSPE. The modified T7 peptide was custom synthesized by Genscript (Piscataway, NJ).
Synthesis of T7-PEG-DSPE
The thiol group (-SH) in Cys-T7 peptide was coupled to the maleimide-functionalized Mal-PEG-DSPE using a procedure similar to a previously described method. See, for example, Wang, Z., et al. Enhanced Anti-Ischemic Stroke of ZL006 by T7-Conjugated PEGylated Liposomes Drug Delivery System. Sci. Rep. 2015, 5, and Kuang, Y., et al. T7 Peptide-Functionalized Nanoparticles Utilizing RNA Interference for Glioma Dual Targeting. Int. J. Pharm. 2013, 454 (1), 11-20, both of which are hereby incorporated by reference.
Briefly, Mal-PEG-DSPE (76 mg, 22 pmol) was added to 1 mL DMF. Cys-T7 peptide (20 mg, 20 pmol) was dissolved in 9 mL lx Phosphate-Buffered Saline (PBS, pH 7.4). The mixture was stirred overnight at room temperature. The product T7-PEG-DSPE was purified by dialysis (membrane MWCO 3,500) against deionized water. BCA protein assay was used to determine the peptide concentration of T7 peptide and that of T7-PEG-DSPE
Preparation of co-loaded ASOs in lipid nanoparticles (Co-ASOs-LNPs)
The Co-ASOs-LNPs consisted of several lipid components including DODMA, egg PC, cholesterol, T7-PEG-DSPE, and PEG-DMG. A modified pump-based ethanol dilution method was used in the preparation of the LNPs. Briefly, the DODMA, egg PC, cholesterol, PEG-DMG were dissolved in 100% ethanol at molar ratio of 35:39.5:20:5. The resulting solution was diluted in an acid buffer (40 mM triethylamine acetate (TEAA) pH=4.5, solution A). The ASOs (solution B) with various molar ratios of ASOs (G3139-GAP, RX-0201-GAP, and G3139-GAP to RX-020l-GAP=l : l, 1:2, 2: 1) were dissolved in an equal volume of 20% sucrose in RNase-free water. A dual-channel syringe pump with two syringes attached to a bifurcated Y-connector was utilized to synthesize the final product (Figure 1). A 20G blunt needle was attached to the end of the tubing connector to facilitate component mixing.
Subsequently, the LNPs were dialyzed against HEPES buffered saline (HBS, pH=7.4) overnight using a Slide-A-Lyzer cassette to remove ethanol and free ASOs and were filtered through a 0.22 pm filter for sterilization. A post-insertion method was used to incorporate T7- PEG-DSPE into the LNPs. Briefly, T7-PEG-DSPE was dissolved and incubated with Co- ASOs-LNPs for 1 h at 37 °C at the T7-PEG-DSPE to total lipid ratio of 0.5: 100.
Particle Size and Zeta Potential
The mean particle size of Co-ASOs-LNPs was determined on a NICOMP370 Particle
Sizer from Particle Sizing Systems (Santa Barbara, CA) under volume weighting mode utilizing dynamic light scattering (DLS). The zeta potential of the Co-ASOs-LNPs was measured on a Malvern Zetasizer Nano Z (Worcestershire, UK).
Encapsulation Efficiency
ASO encapsulation efficiency was measured using previously described methods. See, for example, Weecharangsan, W., et al. Efficient Delivery of Antisense
Oligodeoxyribonucleotide G3139 by Human Serum Albumin-Coated Liposomes. Mol. Pharm. 2009, 6 (6), 1848-1855, and Yang, X., et al. Transferrin Receptor-Targeted Lipid
Nanoparticles for Delivery of an Antisense Oligodeoxyribonucleotide against Bcl-2. Mol. Pharm. 2009, 6 (1), 221-230, both of which are hereby incorporated by reference. FAM- labeled ASOs were included in the LNPs. A centrifugal filtration unit (MWCO 10,000 Da) from Millipore (Bedford, MA) was utilized to separate LNPs and unbound ASOs. The ASO concentration was calculated based on a standard curve of the ASO concentration vs fluorescence intensity. The fluorescent intensity was measured by fluorometry utilizing excitation at 495nm and emission at 520nm. The amount of free ASOs was determined by the fluorescence in the filtrates.
Encapsulation Efficiency
Figure imgf000027_0001
Cell Culture
Human lung epithelial cancer cells A549 and human cervical cancer KB cell lines were acquired from ATCC (Manassas, VA). The cells were cultured in RPMI 1640 media with the addition of 10% fetal bovine serum (FBS), 100 U/ml penicillin, and lOOug/ml streptomycin. The cells were grown in a tissue culture incubator at 37 °C and 5% CC concentration.
Combination Ratio Optimization
The ASO-to-ASO and ASO-to-PTX drug combination ratios were optimized by determining cytotoxicity in A549 cells. Briefly, cells were seeded in 96-well plates and treated with ASO combinations the next day. Treatment groups included Co-ASOs-LNPs with various ASO molar ratios: (G3139-GAP (G) to RX-0201-GAP (R) (G:R ratio) of 1 : 1, 1:2, and 2: 1), G3139-GAP, RX-0201-GAP, free Co-ASOs at a G:R ratio of 1 : 1 with an ASO concentration of 0.5 mM, scrambled ASO, and empty vesicles. The cells were further incubated with PTX at a series of concentrations (0 to 10mM) at 37 °C for 4h. After incubation, the treatment medium was replaced with fresh medium and the cells were incubated for another 72h. Then, 20pL CellTiter 96® AQueous One Solution Cell Proliferation Assay Solution (MTS) from Promega (Madison, WI) was added to each well and the plate was incubated at 37 °C for 4h.
Subsequently, absorbance at 490nm was measured on a SpectraMax M5 plate reader from Molecular Devices (Sunnyvale, CA).
Assessment of ASOs combination through isobologram
The IC50 values of the different ASO combinations above were obtained using software from GraphPad (La Jolla, CA). Concentrations of G3139-GAP and RX-0201-GAP in each combination group were calculated based on the molar ratios of each ASO in the combination to achieve 50% cellular growth inhibition. Combination indexes (Cl) were calculated using the formula below
_,T CG,50 CR,50
CI= - IC50.G - IC 50, R
where Cpso and CR, 50 were concentrations of G3139-GAP and RX-0201-GAP used in combination to achieve 50% growth inhibition, respectively. I CVI.G and IC5o,Rwere the single ASO (G3139-GAP or Rx-020l-GAP) 50% inhibition concentrations. A Cl that is less than, equal to, or more than unity suggests a synergistic, additive, and antagonistic effect,
respectively.
The isobologram was plotted using IC50 values of the A549 cells. A straight line between intercepts A and B on the G3139-GAP and RX-0201-GAP axes indicates isobole of 50% inhibition effect. Cellular Uptake of ASOs-LNPs
FAM-ASO-LNPs were evaluated for uptake efficiency in A549 cells. Briefly, A549 cells were seeded on coverslips at a density of 4* 104 cells per well in l2-well plates and cultured overnight. The cells were incubated with T7-conjugated FAM-ASO-LNPs, FAM- ASO-LNPs, free FAM-ASO, or saline control for 4 h, which was replaced with fresh medium and the cells were incubated for another 48h at 37 °C. Then, the cells were fixed in 4% paraformaldehyde and washed with PBS three times. The cells were then stained with DAPI and wheat germ agglutinin labeled with Alexa 594 from ThermoFisher Scientific (Waltham, MA) for 10 min each. This was followed by washing with PBS. The coverslips were taken out from the l2-well plates and mounted on glass slides. The slides were then examined on an Olympus FV 1000 Filter Confocal Microscope System (Tokyo, Japan).
RNA Extraction
RNA extraction was performed following manufacturer’s instructions from Qiagen (Valencia, CA). Briefly, A549 and KB cells were harvested after 48 h incubation with Co- ASOs-LNPs. RLT buffer was added to each well, followed by several seconds of shaking to lyse the cells and the wells were further washed with 70% ethanol. The cell lysate was placed on a shaker from Daigger Scientific (Vernon Hills, IL) for 5 min to ensure homogeneity. Next, the cell lysate was pipetted into a QIAvac 96 manifold followed by several washing steps. The RNA was obtained by RNAse-free water elution.
Quantification of Bcl-2 and Akt-1 mRNA expression by Real Time qRT-
PCR
Bcl-2 and Akt-l mRNA expression levels were measured by real-time quantitative reverse transcriptase polymerase chain reaction (qRT-PCR). Briefly, cDNA was synthesized by employing a first-strand cDNA synthesis kit from Invitrogen (Carlsbad, CA). The mRNA was combined with lOmM dNTP and 50pl/mL random hexamer primer and heated to 65°C for 10 min and cooled down to 4 °C for 5 min on a thermal cycler from Applied Biosystems (Foster City, CA). The resulting first-strand cDNA was further amplified with the addition of 40 U/pL RNaseOUT, 0.1M DTT, 10c RT buffer, 200 U/pL Superscript III RT, and 25mM MgCh. The amplification included three stages. The mixture was first heated to 48°C for 60 min and then to 95°C for 5 min and was cooled down to 4°C for the last 5 min. The number of cycles were 30 cycles. The primers and probes from Thermo Fisher Scientific (Waltham, MA) were: Bcl-2 forward primer, CCCTGTGGATGACTGAGTACCTG (SEQ ID NO: 7), bcl-2 reverse primer, CCAGCCTCCGTTATCCTGG (SEQ ID NO: 8), Akt-l forward primer, CTGGACAAGGACGGGCACA (SEQ ID NO:9), Akt-l reverse primer, GGT GGGCT GAGCTT CTTCTCGT A (SEQ ID NO: 10), GAPDH forward primer
CCCCCAATGTATCCGTTGTG (SEQ ID NO: 11), and GAPDH reverse primer,
TAGCCCAGGATGCCCTTTAGT (SEQ ID NO: 12). The expression levels of the Bcl-2 and Akt-l were normalized based on GAPDH and calculated utilizing StepOne v2.3 Software.
Protein Extraction
A549 and KB cells were incubated with Co-ASOs-LNPs for 48 h and harvested by adding 0.05% trypsin-EDTA to each well. The cells were further washed with ice-cold PBS (pH=7.4) and lysed with IX lysis buffer containing a protease inhibitor cocktail from
CalBiochem (San Diego, CA). The resultant whole cell lysate was chilled on ice for 5 min and centrifuged at 12,000 rpm at 4 °C for 8 min. The supernatant was collected and its protein concentration was measured by Bradford Protein Assay from BioRad (Hercules, CA).
Quantification of the Bcl-2 and Akt-l Protein expressions
ASO target protein expression in cells with different treatments were analyzed by Western blot. Briefly, extracted proteins were placed in the sample buffer and loaded onto a 4%-20% Tris-HCl-polyacrylamide Precast Gel from Bio-Rad (Hercules, CA). The protein in the precast gel was transferred to a precut nitrocellulose membrane from Bio-Rad (Hercules, CA) and incubated with Tris-Buffered saline (l50mM NaCl, 20mM Tris-HCl, pH=7.4) with 10% non-fat milk for 2 h. Subsequently, the membrane was further incubated with monoclonal rabbit anti-human Bcl-2 from BioRad (Hercules, CA) or Akt (pan) (C67E7) Rabbit mAh purchased from Cell Signaling Technology (Boston, MA) or polyclonal anti-human b-actin from Santa Cruz (Cambridge, MA) and stored at 4 °C overnight. The membrane was washed several times before incubation with secondary antibodies: horseradish peroxidase-conjugated sheep anti-rabbit or sheep anti-mouse from Santa Cruz (Cambridge, MA). After 1 h incubation, the membrane was exposed on an imager from Konica Minolta Healthcare (Wayne, NJ). The densities of the bands were analyzed by ImageJ software (Bethesda, MD).
In Vivo anti- tumor activity in a Xenograft Tumor Model
Animal dosing and handling protocols were approved by the Laboratory Animal Care and Use Committee of Hainan Medical University based on the guidelines from Chinese Associations of Laboratory Animal Science. First, A549 cells were cultured in large scale and embedded into the right flank of athymic BALB/c mice (20-25g) obtained from Hunan Si-Lai- Ke Laboratory Animal Co., Ltd (Hunan, China). For implantation, 107 A549 cells were injected subcutaneously into 4-week-old nude mice. After the size of the tumors reached ~200mm3, the mice were sacrificed, and the tumors were cut into 2mm3 fragments and stored in sterile saline. Next, 70 mice were inoculated with these tumor blocks and let tumors subcutaneously. When tumor volumes reached - 150 mm3, the mice were divided into eight groups and were given the first treatment. Seven treatment groups were included in this study: PTX (lmg/kg), PTX (lmg/kg) combined with free ASO combination at G-to-R of 1:2 (5mg/kg), PTX (lmg/kg) combined with G3l39-GAP-LNPs (5mg/kg), PTX (lmg/kg) combined with RX-020l-GAP-LNPs (5mg/kg), PTX (lmg/kg) combined with Co-ASOs-LNPs at G-to-R of 1 :2 (5mg/kg), PTX (lmg/kg) combined with T7-conjugated Co-ASOs-LNPs at G- to-R of 1:2 (5mg/kg), and saline control. The treatment schedule used was twice per week for 3 weeks given through tail vein injection. Tumor sizes were measured by caliper every 2 days and calculation based on the formula V = (W(2) c L)/2.
In vivo bioluminescence imaging
In order to track the bio-distribution of T7-FAM-G3l39-LNPs and free FAM-G3139, non-invasive bioluminescence imaging was performed 12 h post-injection in live mice. Mice were imaged with the injection of free FAM-G3139, non-conjugated FAM-G3139 LNPs, and T7-conjugated FAM-G3139 LNPs. The animals were anaesthetized with a 4% air-isoflurane blend and maintained with a 2% air-isoflurane mixture through a nose cone. Luminescence images were acquired utilizing an in vivo imaging system (IVIS Lumina XR in vivo imaging system, PerkinElmer) equipped with a cooled, slow-scan CCD camera and driven by Living Image software (PerkinElmer, USA). Based on the characteristics of the FAM fluorescent tag, 495 nm excitation and 520 nm emission filters were selected. Images were obtained using a biofluorescence in vivo imaging (BFI) system, with fluorescent acquisition time of 3.5 s and the fluorescent signal was then overlaid onto a picture of each mouse.
Immunohistochemical evaluation of Akt-1 and Bcl-2 expression in A549 tumor
Immunohistochemical staining was used to determine the Akt-l and Bcl-2 expression levels in tumors. Tumor samples were harvested and fixed with 10% formaldehyde overnight. The fixed tumors were immersed in paraffin and sliced into 5pm thick sections. The sections were further deparaffinized and dehydrated in a gradient of ethanol. Antigen was retrieved by a microwave method in Tris-EDTA buffer (pH=9.0) and sections were blocked with 5% goat serum for 1 h at room temperature. Subsequently, the slices were incubated with primary antibody against Akt-l from Cell Signaling Technology (Boston, MA) or Bcl-2 from BioRad (Hercules, CA) overnight at 4 °C. After several steps of washing, the slices were further incubated with horseradish peroxidase-conjugated anti-goat secondary antibody from Santa Cruz Biotechnology (Santa Cruz, CA) for 1 h at room temperature. Hematoxylin was used to counterstain the tissue slices, which were imaged by digital camera mounted on an optical microscope.
Statistical Analysis
Results were presented as mean ± standard deviation (SD) unless otherwise indicated. Group differences were determined by one-way analysis of variance (ANOVA) followed by Fisher’s LSD post hoc. Kaplan-Meier plot was utilized to evaluate the length of survival. Log- rank test was used to analyze differences between treatment groups p values of 0.01 and 0.05 were selected as cutoffs for“highly significant” and“significant” differences, respectively. GraphPad Prism was the software used to perform all the statistical analyses.
Results
Particle Size and Surface Charge
The average particle size of empty LNPs was 90.9 ± 5.2 nm. With the addition of co- ASOs or T7-ASOs-LNPs, mean particle sizes were increased to 125.7 ± 7.1 nm and 139.4 ±
7.6 nm, respectively. The size distributions of ASOs-LNPs and T7-ASOs-LNPs were relatively narrow with polydispersity indexes (PDI) of 0.08 ± 0.03 and 0.10 ± 0.04, respectively. The zeta potential of Co-ASOs-LNPs and T7-ASOs-LNPs were 8.49 ± 3.24 and 10.03 ± 2.64 mV, respectively (Table 1).
Table 1. Characteristics of LNP Formulations. Data is presented as mean ± standard
Figure imgf000032_0001
T7-PEG-DSPE Synthesis
T7-PEG-DSPE was synthesized as described above. A standard curve was plotted in the range of 0.5-l0mg/mL using T7 peptide based on the BCA assay. The calculated T7 peptide concentration in synthesized T7-PEG-DSPE is 1.65 mg/mL.
ASOs Encapsulation Efficiency and Nanoparticles Colloidal Stability
Encapsulation efficiencies for single ASO were 88.2 ± 4.65% and 88.5 ± 3.34%, respectively. The addition of a pegylating agents can improve the colloidal stability of LNPs. The stability of T7-ASOs-LNPs, Co-ASOs-LNPs, the single ASO-LNPs were compared with and without a pegylating agent for three weeks (Figure 2). Tumor Cell Viability and Combination indexes (CIs)
PTX combined with T7-conjugated Co-ASOs-LNPs at a molar ratio of G3139-GAP (G) to RX-0201-GAP (R) (G:R) of 1 :2 showed the lowest tumor cell viability compared to other treatment groups. The viability differences between the T7-conjugated Co-ASOs-LNPs and other treatment groups were statistically significant at both 10 and 100 nM concentrations. The IC50 value was 0.62mM, which was lower than those of single ASO encapsulated LNPs (0.83 mM for G3l39-GAP-LNPs and 0.77 mM for RX-020l-GAP-LNPs). The ICso values of Co-ASOs-LNPs at G:R ratios of 1 :2, 1: 1, 2: 1 were 0.75 mM, 0.81 mM, and 0.88 mM, respectively. The combination indexes of T7 -conjugated Co-ASOs-LNPs and Co-ASOs-LNPs at G:R ratios of 1 :2, 1 : 1, 2: 1 were 0.76, 0.93, 1.01, 1.03, respectively. The non-T7-conjugated LNP with G:R ratio of 1:2 produced synergistic effects based on the combination index obtained (Figure 3).
Internalization of T7-conjugated ASO-LNPs into A549 Cells
Cellular uptake of T7-conjugated FAM- ASO-LNPs was determined by confocal microscopy. T7-conjugated FAM- ASO-LNPs showed stronger fluorescent intensity in A549 cells compared to non-T7-conjugated groups. This indicates that the T7 ligand facilitated the internalization of the LNPs into the A549 cells. In contrast, fluorescence in the cells treated with non-T7-conjugated LNPs and free ASO groups was barely observed, which suggested that in the absence of T7 ligand on the surface of the nanoparticles, LNPs were not efficiently taken up by the cells (Figure 4).
Downregulation of Akt-1 and Bcl-2 targets by T7-conjugated Co-ASOs-
LNPs
A549 and KB cancer cells treated with T7-conjugated Co-ASOs-LNPs with an ASO G:R ratio of 1:2, non-T7 -conjugated Co-ASOs-LNPs with a G:R ratio of 1:2, G3139-GAP- LNPs, RX-0201-GAP-LNPS, free Co-ASOs at a G:R ratio of 1 :2, and scrambled ASO were analyzed by both real time qRT-PCR and Western blot. mRNA-level downregulation effects of Akt-l by T7-conjugated Co-ASOs-LNPs (with G:R ratio of 1:2) were 78.2% ± 6.7% and 73.4% ± 6.9% compared to the non-treated groups in A549 and KB cells, respectively.
Statistically significant differences were found between the T7-conjugated Co-ASOs-LNPs and other treatment groups. Similar downregulation activities were found in the target Bcl-2 in both A549 and KB cells. Interestingly, the T7-conjugated Co-ASOs-LNPs (with G:R ratio of 1:2) exerted the strongest Bcl-2 mRNA-level downregulation activities (72.5% ± 5.3% and 71.4% ± 7.8%) compared to other treatment groups in A549 and KB cells, respectively. As shown in the Western blot analysis, T7-conjugated Co-ASOs-LNPs (G:R 1 :2) treated cells had an average Bcl-2 protein decrease of 81%, which was 1.3-fold, 2-fold and 8.3-fold lower than the non-T7 groups, single ASO-LNPs, and free oligo, respectively. The average Akt-l protein level of the T7-conjugated Co-ASOs-LNPs (G:R 1 :2) treated group was 82%, which was 2.2- fold, 2.4-fold and 4.5-fold lower compared to the non-T7 groups, single ASO-LNPs, and free oligo (Figures 5 A and 5B). Similar Bcl-2 and Akt-l downregulation effects were found in the immunohistochemical staining micrographs of xenograft tumors treated with T7-conjugated Co-ASOs-LNPs (G:R 1:2), which indicated that T7-LNPs also was active in vivo (Figures 6A and 6B).
In Vivo Combination Therapy of LNPs with PTX
An A549 xenograft mouse model was used to evaluate ASO-PTX combination therapy.
Treatment was started when tumors reached 150 mm3. At 30 days after the first treatment, average tumors volumes had reached 763, 516, 514, 288, 268, 267, 174 mm3 for saline, PTX , PTX + Free ASOs (G:R 1:2), PTX + RX-020l-GAP-LNPs, PTX + G3l39-GAP-LNPs, PTX + Co-ASOs-LNPs G:R 1 :2, and PTX + T7-conjugated Co-ASOs-LNPs (G:R 1:2), respectively (Figure 8A). Significant differences were found between PTX + T7-conjugated Co-ASOs- LNPs and other treatment groups. Moderate body weight changes were observed during treatment, which suggested low toxicity generated by the treatments. Lower Bcl-2 and Akt-l expressions were found in the tumor sections of T7-conjugated Co-ASOs-LNPs (G:R 1:2) treated group, which indicates that T7-conjugated Co-ASOs-LNPs efficiently reduced both Bcl-2 and Akt-l protein expression in vivo. In addition, more than 10-fold increased bioluminescence signal was found in the fluorescence-labeled T7-conjugated Co-ASOs-LNPs treated group relative to other treatment groups, which suggests that T7-conjugated Co-ASOs- LNPs were directed to the tumor sites in vivo (Figure 7). The median survival days of the saline group was 27, 35.5 for PTX and PTX + free ASOs (G:R 1:2), 37.5 for PTX + RX-0201- GAP -LNPs, 41 PTX + G3l39-GAP-LNPs, 42 for PTX + Co-ASOs-LNPs (G:R 1 :2), and 60 for PTX + T7-conjugated Co-ASOs-LNPs (G:R 1 :2) (Figure 8B). Analyzed by a log-rank test, the T7-conjugated Co-ASOs-LNPs (G:R 1 :2) showed much longer survival time compared to mice in other treatment groups (Table 2). Table 2. Results Log-Rank Test of the Survival Curve.
Groups Log-rsn P value
Figure imgf000035_0001
ab c d p values were generated relatively to aaline, PTX, PTX + G3139-GAP -LNPs, PTX + RX- 020l-GAP-LNPs, and PTX + Co-ASOs-LNPs, respectively. Significant difference was shown when a p value was less than 0.05.
Discussion
Many ASOs have been developed to target genes that are frequently involved in the progression of tumor. Bcl-2 and Akt-l are targets reported to be related to tumor cell proliferation, anti-apoptosis pathways, and tumor homeostasis. ASOs with 2’-0-Me or 2’- MOE modifications have been shown to exhibited enhanced exonuclease resistance and to have much greater mRNA binding affinity and hybridization stability. Moreover, with the central portion containing only phosphorothioate modification, ASOs retain their ability to activate RNaseH. Recently, Prexigebersen, a liposomal formulation of Grb2 ASO designed to treat acute myeloid leukemia, has entered phase II clinical trial. Custirsen (OGX-Ol l), a second generation ASO, has entered phase 3 trial at the end of 2017.
In this example, a combination of chemically modified ASOs was incorporated into the LNPs aiming at dual targets of Bcl-2 and Akt-l. A small peptide T7 was attached to the surface of the nanoparticles to achieve high selectivity through transferrin receptor targeting. T7-conjugated Co- ASOs LNPs were shown to have the lowest IC50 value, which indicates that T7 ligand on the surface of the nanoparticles facilitated the internalization of LNPs into the cancer cells. Interestingly, the combination of ASOs without T7 ligand also showed a synergistic effects compared to the single ASO. Increased uptake efficiency was achieved in the T7-conjugated LNPs, which correlated with the results obtained from the cell viability study. qRT-PCR and Western blot analyses showed that greater downregulation effects were observed on the T7-conjugated Co-ASOs-LNPs with the ASO combination (G:R 1:2), which suggested that the combinations of ASOs at certain ratios can exert an unexpected synergistic effect. The dual syringes pump system used for LNP synthesis has similar characteristics as a microfluidic system. It is possible to program in a constant flow rate and a fixed mixing mechanism, which results in reproducible LNP characteristics. The microbore Y-tubing and the attached needle elements (which has a calculated Reynold number of - 200) suggest that fluid streams follow laminar flow and diffusion-based interlayer mixing. This in turn resulted in the production under controlled conditions of homogenous nanoparticles with relatively small particle size and narrow size distribution. The process is easily scaled up by maintaining the flowrates at the Y-tubing, thereby, fixing the mixing mechanism. This process is similar to microfluidic systems in the mechanism of component mixing and programmability, but has advantages of having lower complexity and being potentially easier to scale up in terms of production volume.
As shown in the A549 xenograft mice model, T7-LNP Co-ASOs at G:R of 1 :2 had the highest anti-tumor activity and prolonged the overall survival time. Interestingly, the IVIS images showed that the T7-LNP group had the highest fluorescence at the tumor sites which indicated that the T7-conjugated ASO-LNPs preferentially accumulated at the tumor site after administration in vivo. Body weights of all the treatment groups remained similar, which suggests low toxicity resulting from treatment.
Conclusion
The Co-ASOs-LNPs at G:R 1:2 were shown to exhibit optimal stability and therapeutic efficacy both in vitro and in vivo. In addition, with T7 targeting ligand attached to the surface, the uptake efficiency for the LNPs increased compared to non-conjugated LNPs both in vitro and in vivo. The T7-conjugated Co-ASOs-LNPs at G:R of 1:2 showed overall greater anti tumor activity, longer survival time, and more effective target modulation activities than other formulations and warrants further evaluation. In addition, a syringe pump system has been developed that enables precisely controlled synthesis of LNPs that may facilitate their future preclinical development
The compositions and methods of the appended claims are not limited in scope by the specific compositions and methods described herein, which are intended as illustrations of a few aspects of the claims. Any compositions and methods that are functionally equivalent are intended to fall within the scope of the claims. Various modifications of the compositions and methods in addition to those shown and described herein are intended to fall within the scope of the appended claims. Further, while only certain representative compositions and method steps disclosed herein are specifically described, other combinations of the compositions and method steps also are intended to fall within the scope of the appended claims, even if not specifically recited. Thus, a combination of steps, elements, components, or constituents may be explicitly mentioned herein or less, however, other combinations of steps, elements, components, and constituents are included, even though not explicitly stated.
The term“comprising” and variations thereof as used herein is used synonymously with the term“including” and variations thereof and are open, non-limiting terms. Although the terms“comprising” and“including” have been used herein to describe various embodiments, the terms“consisting essentially of’ and“consisting of’ can be used in place of “comprising” and“including” to provide for more specific embodiments of the invention and are also disclosed. Other than where noted, all numbers expressing geometries, dimensions, and so forth used in the specification and claims are to be understood at the very least, and not as an attempt to limit the application of the doctrine of equivalents to the scope of the claims, to be construed in light of the number of significant digits and ordinary rounding approaches.
Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of skill in the art to which the disclosed invention belongs. Publications cited herein and the materials for which they are cited are specifically incorporated by reference.

Claims

WHAT IS CLAIMED IS:
1. A pharmaceutical composition comprising lipid nanoparticles encapsulating a therapeutic cargo,
wherein lipid nanoparticles are formed from a lipid mixture comprising a cationic lipid, a phospholipid, and a targeting conjugate; and
wherein the therapeutic cargo comprises (i) a functional nucleic acid which modulates the expression of Akt-l; and (ii) a functional nucleic acid which modulates the expression of Bel -
2
2. The composition of claim 1 , wherein the cationic lipid comprises from 25 mol % to 45 mol % of the lipid mixture.
3. The composition of any of claims 1-2, wherein the cationic lipid comprises a tertiary amine-cationic lipid.
4. The composition of claim 3, wherein the tertiary amine-cationic lipid is selected from the group consisting of N-[l-(2, 3-dioleyloyx) propyl] -N— N— N-dimethyl ammonium chloride (DODMA), l,2-dioleoyl-3-dimethylammonium-propane (DODAP), 3b-[N— (N',N'- dimethylaminoethane)-carbamoyl]cholesterol hydrochloride (DC-CHOL), N,N- dimethylhexadecylamine (DMHDA), and combinations thereof.
5. The composition of claim 4, wherein the tertiary amine-cationic lipid comprises N-[l- (2, 3-dioleyloyx) propyl]-N— N— N-dimethyl ammonium chloride (DODMA).
6. The composition of any of claims 1-5, wherein the cationic lipid comprises a quaternary amine-cationic lipid.
7. The composition of claim 6, wherein the quaternary amine-cationic lipid is selected from the group consisting of l,2-dioleoyl-3-trimethylammonium-propane (DOTAP), N-[l-(2, 3-dioleyloyx) propyl]-N— N— N-trimethyl ammonium chloride (DOTMA),
dimethyldioctadecylammonium bromide (DDAB), or combinations thereof.
8. The composition of any of claims 1-7, wherein the phospholipid comprises from 30 mol % to 50 mol % of the lipid mixture.
9. The composition of any of claims 1-8, wherein the phospholipid comprises a phosphatidylcholine.
10. The composition of any of claims 1-9, wherein the targeting conjugate comprises from 0.05 mol % to 5 mol % of the lipid mixture.
11. The composition of any of claims 1-10, wherein the targeting conjugate comprises a targeting agent bound to a lipid via a polymeric linker.
12. The composition of claim 11, wherein the targeting agent comprises a T7 peptide.
13. The composition of claim 12, wherein the targeting conjugate is selected from the group consisting of T7-PEG-CHEMS (T7 -poly ethylene glycol-cholesteryl hemisuccinate), T7- PEG-DSPE (T7-poly ethylene glycol-distearoyl phosphatidylethanolamine), or a combination thereof.
14. The composition of any of claims 1-13, wherein the lipid mixture further comprises a neutral lipid.
15. The composition of claim 14, wherein the neutral lipid comprises from 10 mol % to 30 mol % of the lipid mixture.
16. The composition of any of claims 14-15, wherein the neutral lipid comprises cholesterol.
17. The composition of any of claims 1-16, wherein the lipid mixture further comprises a polymer-lipid conjugate.
18. The composition of claim 17, wherein the polymer-lipid conjugate comprises from 0.5 mol % to 15 mol % of the lipid mixture.
19. The composition of any of claims 17-18, wherein the polymer-lipid conjugate is selected from the group consisting of l,2-distearoyl-sn-glycero-3-phosphoethanolamine-N- PEG (DSPE-PEG), dimyristoylphosphatidylethanolamine-PEG (DMPE-PEG),
dipalmitoylphosphatidlyethanolamine-PEG (DPPE-PEG), 1, 2-dimyristoyl-sn-glycerol and methoxypolyethylene glycol (DMG-PEG), and combinations thereof.
20. The composition of any of claims 1-19, wherein the lipid mixture comprises
from 30 mol % to 40 mol % cationic lipid;
from 35 mol % to 45 mol % phospholipid;
from 15 mol % to 25 mol % neutral lipid;
from 0.05 mol % to 2 mol % targeting conjugate; and
from 1 mol % to 10 mol % polymer-lipid conjugate.
21. The composition of claim 20, wherein the lipid mixture comprises
from 30 mol % to 40 mol % N-[l-(2, 3-dioleyloyx) propyl]-N— N— N-dimethyl ammonium chloride (DODMA);
from 35 mol % to 45 mol % phosphatidylcholine;
from 15 mol % to 25 mol % cholesterol;
from 0.05 mol % to 2 mol % T7-PEG-DSPE (T7-polyethylene glycol-distearoyl phosphatidylethanolamine); and
from 1 mol % to 10 mol % 1, 2-dimyristoyl-sn-glycerol and methoxypolyethylene glycol (DMG-PEG).
22. The composition of any of claims 1-21, wherein the lipid nanoparticle has a zeta potential of from 0 to +40 mV.
23. The composition of any of claims 1-22, wherein the lipid nanoparticle has a diameter of less than 300 nm.
24. The composition of any of claims 1-23, wherein the lipid nanoparticle has a diameter of from 50 nm to 200 nm.
25. The composition of any of claims 1-24, wherein the functional nucleic acid which modulates the expression of Akt-l is chosen from the group consisting of plasmid DNA (pDNA), an antisense oligonucleotide (ASO), small interfering RNA (siRNA), small hairpin RNA (shRNA), microRNA (miR), anti-miRs, or a combination thereof.
26. The composition of claim 25, wherein the functional nucleic acid is stabilized by modifications to substituent nucleic acid base units, by phosphorothioate substitution of phosphodiester linkers, and/or by 2'-0-methylation of ribose units.
27. The composition of any of claims 25-26, wherein the functional nucleic acid which modulates the expression of Akt-l comprises an antisense oligonucleotide (ASO) targeted to a portion of a nucleic acid encoding Akt-l.
28. The composition of any of claims 25-27, wherein the functional nucleic acid is defined by 5’-gcu GCT TGA TCT CCT TG gcg-3’ (SEQ ID NO:4), wherein the lower-case letters indicate 2’-OMe modification.
29. The composition of any of claims 1-28, wherein the functional nucleic acid which modulates the expression of Bcl-2 is chosen from the group consisting of plasmid DNA (pDNA), an antisense oligonucleotide (ASO), small interfering RNA (siRNA), small hairpin RNA (shRNA), microRNA (miR), anti-miRs, or a combination thereof.
30. The composition of claim 29, wherein the functional nucleic acid is stabilized by modifications to substituent nucleic acid base units, by phosphorothioate substitution of phosphodiester linkers, and/or by 2'-0-methylation of ribose units.
31. The composition of any of claims 29-30, wherein the functional nucleic acid which modulates the expression of Bcl-2 comprises an antisense oligonucleotide (ASO) targeted to a portion of a nucleic acid encoding Bcl-2.
32. The composition of any of claims 29-31, wherein the functional nucleic acid is defined by 5’-ucu CCC AGC GTG CGC cau-3’ (SEQ ID NO:2), wherein the lower-case letters indicate 2’-OMe modification.
33. The composition of any of claims 1-32, wherein the functional nucleic acid which modulates the expression of Akt-l and the functional nucleic acid which modulates the expression of Bcl-2 are present at a molar ratio of from 5: 1 to 1 :5.
34. The composition of any of claims 1-33, wherein the functional nucleic acid which modulates the expression of Akt-l and the functional nucleic acid which modulates the expression of Bcl-2 are present at a molar ratio of from 1 : 1 to 5: 1.
35. The composition of any of claims 1-34, wherein the functional nucleic acid which modulates the expression of Akt-l and the functional nucleic acid which modulates the expression of Bcl-2 are present at a molar ratio of from 1 : 1 to 3: 1.
36. The composition of any of claims 1-35, wherein the composition further comprises an additional therapeutic agent selected from: antineoplastic agents, anti-infective agents, local anesthetics, anti-allergies, antianemics, angiogenesis, inhibitors, beta-adrenergic blockers, calcium channel antagonists, anti-hypertensive agents, anti-depressants, anti-convulsants, anti bacterial, anti-fungal, anti-viral, anti-rheumatics, anthelminithics, antiparasitic agents, corticosteroids, hormones, hormone antagonists, immunomodulators, neurotransmitter antagonists, anti-diabetic agents, anti-epileptics, anti-hemmorhagics, anti-hypertonics, antiglaucoma agents, immunomodulatory cytokines, sedatives, chemokines, vitamins, toxins, narcotics, imaging agents, and combinations thereof.
37. The composition of any of claims 1-36, wherein the composition comprises a sterile solution, a sterile suspension, or a lyophilized powder.
38. A method of inducing cytotoxicity in a cancer cell comprising contacting the cancer cell with the composition of any of claims 1-37.
39. A method of treating a cancer in a subject, the method comprising administering to the subject a therapeutically effective amount of the composition of any of claims 1-37.
40. The method of claim 39, wherein the cancer is selected from the group consisting of brain cancer, bladder cancer, lung cancer, breast cancer, melanoma, skin cancer, epidermal carcinoma, colon and rectal cancer, non-Hodgkin lymphoma, endometrial cancer, pancreatic cancer, kidney (renal cell) cancer, prostate cancer, leukemia thyroid cancer, head and neck, ovarian cancer, hepatocellular cancer, cervical cancer, sarcomas, gastric cancers, multiple myeloma, lymphomas, and gastrointestinal cancer, and uterine cancer.
41. A method of inducing cytotoxicity in a cancer cell comprising contacting the cancer cell with a functional nucleic acid which modulates the expression of Akt-l and a functional nucleic acid which modulates the expression of Bcl-2.
42. The method of claim 41, wherein the functional nucleic acid which modulates the expression of Akt-l is chosen from the group consisting of plasmid DNA (pDNA), an antisense oligonucleotide (ASO), small interfering RNA (siRNA), small hairpin RNA
(shRNA), microRNA (miR), anti-miRs, or a combination thereof.
43. The method of claim 42, wherein the functional nucleic acid is stabilized by modifications to substituent nucleic acid base units, by phosphorothioate substitution of phosphodiester linkers, and/or by 2'-0-methylation of ribose units.
44. The method of any of claims 42-43, wherein the functional nucleic acid which modulates the expression of Akt-l comprises an antisense oligonucleotide (ASO) targeted to a portion of a nucleic acid encoding Akt-l.
45. The method of any of claims 42-44, wherein the functional nucleic acid is defined by 5’-gcu GCT TGATCT CCT TG gcg-3’ (SEQ ID NO:4), wherein the lower-case letters indicate 2’-OMe modification.
46. The method of any of claims 41-45, wherein the functional nucleic acid which modulates the expression of Bcl-2 is chosen from the group consisting of plasmid DNA (pDNA), an antisense oligonucleotide (ASO), small interfering RNA (siRNA), small hairpin RNA (shRNA), microRNA (miR), anti-miRs, or a combination thereof.
47. The method of claim 46, wherein the functional nucleic acid is stabilized by modifications to substituent nucleic acid base units, by phosphorothioate substitution of phosphodiester linkers, and/or by 2'-0-methylation of ribose units.
48. The method of any of claims 46-47, wherein the functional nucleic acid which modulates the expression of Bcl-2 comprises an antisense oligonucleotide (ASO) targeted to a portion of a nucleic acid encoding Bcl-2.
49. The method of any of claims 46-48, wherein the functional nucleic acid is defined by 5’-ucu CCC AGC GTG CGC cau-3’ (SEQ ID NO:2), wherein the lower-case letters indicate 2’-OMe modification.
50. The method of any of claims 41-49, wherein the functional nucleic acid which modulates the expression of Akt-l and the functional nucleic acid which modulates the expression of Bcl-2 are present at a molar ratio of from 5: 1 to 1 :5.
51. The method of any of claims 41-50, wherein the functional nucleic acid which modulates the expression of Akt-l and the functional nucleic acid which modulates the expression of Bcl-2 are present at a molar ratio of from 1 : 1 to 5 : 1.
52. The method of any of claims 41-51, wherein the functional nucleic acid which modulates the expression of Akt-l and the functional nucleic acid which modulates the expression of Bcl-2 are present at a molar ratio of from 1 : 1 to 3: 1.
PCT/US2019/049590 2018-09-04 2019-09-04 Lipid nanoparticles and methods of using thereof Ceased WO2020051243A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201862726637P 2018-09-04 2018-09-04
US62/726,637 2018-09-04

Publications (1)

Publication Number Publication Date
WO2020051243A1 true WO2020051243A1 (en) 2020-03-12

Family

ID=69723220

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2019/049590 Ceased WO2020051243A1 (en) 2018-09-04 2019-09-04 Lipid nanoparticles and methods of using thereof

Country Status (1)

Country Link
WO (1) WO2020051243A1 (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114306369A (en) * 2021-12-23 2022-04-12 北京悦康科创医药科技股份有限公司 Thiooligonucleotide injection and preparation method thereof
CN115624539A (en) * 2022-12-16 2023-01-20 首都医科大学附属北京朝阳医院 A kind of lipid nanoparticle and its preparation method and application
US11865190B2 (en) 2018-10-09 2024-01-09 The University Of British Columbia Compositions and systems comprising transfection-competent vesicles free of organic-solvents and detergents and methods related thereto
WO2024148785A1 (en) * 2023-01-10 2024-07-18 复旦大学 Method for evading preexisting anti-peg antibody in human body

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040265999A1 (en) * 2002-08-16 2004-12-30 Heejeong Yoon Use of antisense oligonucleotides to inhibit the expression of human Akt-1
WO2015075557A2 (en) * 2013-11-22 2015-05-28 Mina Alpha Limited C/ebp alpha compositions and methods of use
US20170173169A1 (en) * 2015-03-16 2017-06-22 Pdx Pharmaceuticals, Llc Cross-linked polymer modified nanoparticles

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040265999A1 (en) * 2002-08-16 2004-12-30 Heejeong Yoon Use of antisense oligonucleotides to inhibit the expression of human Akt-1
WO2015075557A2 (en) * 2013-11-22 2015-05-28 Mina Alpha Limited C/ebp alpha compositions and methods of use
US20170173169A1 (en) * 2015-03-16 2017-06-22 Pdx Pharmaceuticals, Llc Cross-linked polymer modified nanoparticles

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11865190B2 (en) 2018-10-09 2024-01-09 The University Of British Columbia Compositions and systems comprising transfection-competent vesicles free of organic-solvents and detergents and methods related thereto
US11980673B2 (en) 2018-10-09 2024-05-14 The University Of British Columbia Compositions and systems comprising transfection-competent vesicles free of organic-solvents and detergents and methods related thereto
CN114306369A (en) * 2021-12-23 2022-04-12 北京悦康科创医药科技股份有限公司 Thiooligonucleotide injection and preparation method thereof
CN114306369B (en) * 2021-12-23 2023-12-26 北京悦康科创医药科技股份有限公司 A kind of thio-oligonucleotide injection and preparation method thereof
CN115624539A (en) * 2022-12-16 2023-01-20 首都医科大学附属北京朝阳医院 A kind of lipid nanoparticle and its preparation method and application
WO2024148785A1 (en) * 2023-01-10 2024-07-18 复旦大学 Method for evading preexisting anti-peg antibody in human body

Similar Documents

Publication Publication Date Title
AU2017245294B2 (en) Lipid nanoparticle compositions for antisense oligonucleotides delivery
Kuerban et al. Doxorubicin-loaded bacterial outer-membrane vesicles exert enhanced anti-tumor efficacy in non-small-cell lung cancer
US9833416B2 (en) Oligonucleotide lipid nanoparticle compositions, methods of making and methods of using the same
Koshkaryev et al. Bleomycin in octaarginine-modified fusogenic liposomes results in improved tumor growth inhibition
US20110038941A1 (en) Lipid Nanoparticle Compositions and Methods of Making and Using the Same
KR20220092273A (en) Lipid nanoparticles comprising mannose or uses thereof
KR20220092363A (en) Composition for preventing or treating cancer containing lipid nanoparticles
US20250275921A1 (en) Composition for preventing or treating cancer, containing lipid nanoparticles
AU2020364256A1 (en) Delivery system complexes comprising a precipitate of an active agent and methods of use
KR20260065471A (en) Transdermal delivery of genetic material and composition comprising same for preventing or treating cancer
Yang Development of nanoparticle systems for therapeutic drug delivery

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19856866

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 19856866

Country of ref document: EP

Kind code of ref document: A1