KR20220092363A - Composition for preventing or treating cancer containing lipid nanoparticles - Google Patents

Abstract

The present application relates to a composition for preventing or treating cancer containing lipid nanoparticles, and a pharmaceutical composition according to one embodiment has excellent biocompatibility, can deliver gene therapy with high efficiency to have excellent cancer prevention or treatment effects, and thus has excellent cancer prevention or treatment effects even when used in combination with anticancer drugs and/or radiation therapy.

Description

Composition for preventing or treating cancer containing lipid nanoparticles

The present application relates to a composition for preventing or treating cancer comprising lipid nanoparticles.

In the pharmaceutical formulation industry, the drug delivery system (DDS), designed to efficiently deliver the required amount of drug by reducing side effects and maximizing efficacy and effect, can create economic benefits comparable to drug development while It is a high value-added core technology with great potential for success, and its purpose is to improve the quality of patient treatment by making drug administration more efficient. The solubilization technology of poorly soluble drugs belonging to the drug absorption promotion technology, which is one of the core technologies of the drug delivery system, is considered the most reasonable method to reduce the development cost of new drug substances and to increase the added value of currently marketed drugs. In particular, the development of improved new drugs through the development of drug solubilization technology in a situation where new drug development conditions are poor as in Korea is a field that can create enormous added value at a low cost.

Gene therapy using gene drug delivery systems holds great promise for correcting genetic linkages and treating numerous diseases. In carrying out such gene therapy successfully and safely, effective gene delivery is one of the main tasks, and viral delivery has been demonstrated to be effective in gene delivery. However, several drawbacks, such as immunogenicity, limitations in the size of injected DNA, and difficulties in mass production, limit the use of viruses as gene delivery systems. Non-viral gene carriers such as cationic liposomes and polymers are beginning to gain attention as alternative means of viral systems.

The improved stability profile and ease of preparation and manipulation of polymeric carriers have prompted research into the design and synthesis of non-toxic and biodegradable polymeric carriers for effective and safe gene delivery. Poly (L-lysine), polyethyleneimine (polyethylenimine), starburst (starburst), polyamidoamine dendrimers, and cationic liposomes can spontaneously self-assemble and plasmid DNA (pDNA) through endocytosis It has been widely studied as a non-viral gene carrier because it can be compressed into structures small enough to enter cells.

Nucleic acids, such as antisense RNA and siRNA, are substances that can inhibit the expression of specific proteins in vivo, and are spotlighted as an important tool for the treatment of cancer, genetic diseases, infectious diseases, autoimmune diseases, etc. (Novina and Sharp, Nature, 430, 161-164, 2004). However, nucleic acids such as siRNA are difficult to deliver directly into cells and are easily degraded by enzymes in the blood, so many studies are being conducted to overcome them. Until now, as a method of transporting a nucleic acid into a cell, a method of transporting it mixed with positively charged lipids or polymers (referred to as lipid-DNA conjugates and polymer-DNA conjugates, respectively) is mainly used (Hirko et al., Curr. Med. Chem., 10, 1185-1193, 2003; Merdan et al., Adv. Drug. Deliv. Rev., 54, 715-758, 2002; Spagnou et al., Biochemistry, 43, 13348-13356, 2004). Lipid-DNA conjugates bind nucleic acids and deliver nucleic acids into cells, and are widely used at the cellular level, but in vivo, when injected locally, in many cases, they induce inflammation in the body (Filonand and Phillips, Biochim. Biophys. Acta, 1329). , 345-356, 1997), there is a disadvantage of accumulating in tissues such as the lung, liver, and spleen, which are mainly the primary organs of passage during intravascular injection (Ren et al., Gene Therapy, 7, 764-768, 2000).

In addition, such a non-viral carrier has a problem of low transfection efficiency. Although many efforts have been made to increase transfection efficiency, this is still far from a system that is considered stable. In addition, non-viral gene carrier carriers exhibit remarkably high cytotoxicity due to poor biocompatibility and non-biodegradability.

Under this technical background, there is a need for the development of nanoparticles having excellent anticancer effects because they can efficiently deliver an anticancer agent to a target organ or cell.

Republic of Korea Patent Publication No. 10-2020-0083804

One example is (1) a 6-membered heterocyclic amine and an alkyl-epoxide bonded ionizable lipid (ionizable lipid); phospholipids; cholesterol; And lipid-lipid nanoparticles comprising a PEG (polyethyleneglycol) conjugate, and

(2) comprising a first anticancer agent,

The first anticancer agent is an anionic drug, a nucleic acid, or a combination thereof,

To provide a pharmaceutical composition for preventing or treating cancer

Another example is to provide a pharmaceutical composition for cancer treatment for use in combination with radiation therapy comprising the pharmaceutical composition.

Another example is to provide a pharmaceutical composition for combined administration of an anticancer agent, further comprising the pharmaceutical composition and a second anticancer agent.

One aspect to achieve the above object is

(1) 6-membered heterocyclic amine and alkyl-epoxide bonded ionizable lipid (ionizable lipid); phospholipids; cholesterol; And lipid-lipid nanoparticles comprising a PEG (polyethyleneglycol) conjugate, and

(2) comprising a first anticancer agent,

The first anticancer agent provides an anionic drug, a nucleic acid, or a combination thereof, a pharmaceutical composition for preventing or treating cancer.

The lipid nanoparticles included in the pharmaceutical composition have excellent biocompatibility and can deliver anticancer agents (eg, gene therapy) with high efficiency, so they are useful in lipid nanoparticle-mediated gene therapy and imaging technology, etc. can be used

As used herein, the term 'ionizable lipid' or 'lipidoid' refers to an amine-containing lipid that can be easily protonated, for example, a lipid whose charge state changes depending on the surrounding pH. can be The ionizable lipid may be a 6-membered heterocyclic amine and an alkyl-epoxide bonded thereto. Specifically, the ionizable lipid may be a compound having properties similar to lipids produced by the reaction of a 6-membered heterocyclic amine and an alkyl-epoxide, and more specifically, a 6-membered heterocyclic amine with an alkyl-epoxide It may be a compound produced by a ring opening reaction of an epoxide by reacting.

In one example, the ionizable lipid is a 6-membered heterocyclic amine and an alkyl-epoxide 1:n (n = the number of primary amines included in the 6-membered heterocyclic amine x 2 + the number of secondary amines x It may be combined by reacting in a molar ratio of 1). According to one embodiment, 1,4-bis (3-aminopropyl) piperazine (1,4-bis (3-aminopropyl) piperazine) and 1,2-epoxydodecane are mixed in a molar ratio of 1: 4 to 700 It may be prepared by reacting for 2 to 4 days at 800 rpm and 85 to 95° C.

The ionizable lipid may be protonated (positively charged) at a pH below the pKa of the cationic lipid, and may be substantially neutral at a pH above the pKa. In one example, the lipid nanoparticles may include protonated ionizable lipids and/or ionizable lipids exhibiting neutrality.

The ionizable lipid is an ionizable compound having lipid-like properties, such that the drug is highly efficiently encapsulated in lipid nanoparticles through electrostatic interaction with a drug (eg, an anionic drug and/or nucleic acid). can play a role.

The 6-membered heterocyclic amine may have a piperazine or piperidine structure.

,

,

,

,

, 및

으로 이루어진 군으로부터 선택되는 1종 이상일 수 있다. The 6-membered heterocyclic amine may be a chain or non-chain amine including a tertiary amine, and according to one example,

,

,

,

,

, and

It may be at least one selected from the group consisting of.

In one embodiment, the 6-membered heterocyclic amine is 1,4-bis (3-aminopropyl) piperazine (1,4-bis (3-aminopropyl) piperazine), N- (3-aminopropyl) piperidine (N-(3-Aminopropyl)piperidine), (1-methyl-4-piperidinyl)methanamine ((1-Methyl-4-piperidinyl)methanamine), 2-(4-methyl-piperazin-1-yl )-Ethylamine (2-(4-Methyl-piperazin-1-yl)-ethylamine), 1-(2-aminoethyl)piperazine, and 1-(3-amino) It may be at least one selected from the group consisting of propyl) piperazine (1- (3-aminopropyl) piperazine).

Depending on the type of amine contained in the ionizable lipid, (i) the drug encapsulation rate of the lipid nanoparticles, (ii) the polydispersity index (PDI) of the lipid nanoparticles, and/or (iii) the cancer of the pharmaceutical composition The efficiency of drug delivery to tissues and/or cancer cells may be different.

When comprising an ionizable lipid comprising an amine, it may have one or more of the following characteristics:

(1) encapsulation of drugs in the lipid nanoparticles with high efficiency;

(2) the size of the prepared lipid nanoparticles is uniform (or has a low PDI value);

(3) excellent drug delivery efficiency to cancer tissues and/or cancer cells;

(4) capable of long circulation in vivo; and/or

(5) Excellent cancer prevention and/or treatment effect.

According to one embodiment, a lipid comprising an ionizable lipid comprising 1,4-bis (3-aminopropyl) piperazine (Cas Nos. 7209-38-3) When nanoparticles are included, they may have one or more of the following characteristics than when ionizable lipids including other types of amines are included:

(1) encapsulation of drugs in the lipid nanoparticles with high efficiency;

(2) the size of the prepared lipid nanoparticles is uniform (or has a low PDI value);

(3) excellent drug delivery efficiency to cancer tissues and/or cancer cells;

(4) capable of long circulation in vivo; and/or

(5) Excellent cancer prevention and/or treatment effect.

The alkyl-epoxide may have a structure as shown in Formula 1 below.

[Formula 1]

The alkyl-epoxide may have a carbon length of C6 to C14, C6 to C12, C6 to C10, C8 to C14, C8 to C12, C8 to C10, C10 to C14, C10 to C12, or C10, for example, For example, it may be 1,2-epoxydodecane of C10. By setting the carbon number of the alkyl-epoxide included in the ionizable lipid to be within the above range, a high encapsulation rate for the drug encapsulated in the lipid nanoparticles can be exhibited.

In one example, the ionizable lipid may have the general formula of Formula 2 below.

[Formula 2]

The structure of Formula 2 is an example of the structure of the ionizable lipid according to an embodiment, and the structure of the ionizable lipid may be different depending on the type of the 6-membered heterocyclic amine and/or the alkyl-epoxide.

According to one example, when an ionizable lipid including an ionizable lipid having the structure of Formula 2 is included, it may have one or more of the following characteristics than in the case of lipid nanoparticles including other types of ionizable lipids:

(1) encapsulation of drugs in the lipid nanoparticles with high efficiency;

(2) the size of the prepared lipid nanoparticles is uniform (or has a low PDI value);

(3) excellent drug delivery efficiency to cancer tissues and/or cancer cells;

(4) capable of long circulation in vivo; and/or

(5) Excellent cancer prevention and/or treatment effect.

According to an example, the lipid nanoparticles included in the pharmaceutical composition may have a pKa of 5 to 8, 5.5 to 7.5, 6 to 7, or 6.5 to 7. pKa is an acid dissociation constant, and points out what is generally used as an index|index showing the acid strength of a target substance. The pKa value of the lipid nanoparticles is important in terms of in vivo stability of the lipid nanoparticles and drug release of the lipid nanoparticles. In one example, the lipid nanoparticles exhibiting a pKa value in the above range can be safely delivered to cancer tissues and/or cancer cells in vivo, reach cancer tissues and/or cancer cells, and exhibit a positive charge after endocytosis to endo It is possible to release the encapsulated drug (the first anticancer drug) through electrostatic interaction with the anionic protein of the endosome membrane.

The phospholipid may serve to protect the core formed by the interaction of ionizable lipid and drug (first anticancer agent) in the lipid nanoparticles, and bind to the phospholipid bilayer of the target cell to form a cell membrane during intracellular delivery of the drug It can facilitate passage and endosomal escape.

As the phospholipid, any phospholipid capable of promoting the fusion of lipid nanoparticles according to an embodiment may be used without limitation, for example, dioleoylphosphatidylethanolamine (DOPE), distearoylphosphatidylcholine (DSPC) , palmitoyloleoylphosphatidylcholine (POPC), egg phosphatidylcholine (EPC), dioleoylphosphatidylcholine (dioleoylphosphatidylcholine, DOPC), dipalmitoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DOPC) ), dipalmitoylphosphatidylglycerol (DPPG), distearoylphosphatidylethanolamine (DSPE), phosphatidylethanolamine (PE), dipalmitoylphosphatidylethanolamine (dipalmitoylphosphatidylethanolamine), 1,2-diolephatidylethanolamine -sn-glycero-3-phosphoethanolamine, 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine (POPE), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2 -dioleoyl-sn-glycero-3-[phospho-L-serine] (DOPS), and 1,2-dioleoyl-sn-glycero-3-[phospho-L-serine] may be at least one selected from the group consisting of have. In one example, when including lipid nanoparticles including DOPE, it may be effective for mRNA delivery (excellent drug delivery efficiency for mRNA) as a drug, and in another example, when including lipid nanoparticles including DSPE As a drug, it may be effective for siRNA delivery (excellent drug delivery efficiency for siRNA).

The cholesterol imparts morphological rigidity to the lipid filling in the lipid nanoparticles, and may serve to improve the stability of the nanoparticles by being dispersed in the core and surface of the nanoparticles.

As used herein, "lipid-PEG (polyethyleneglycol) conjugate", "lipid-PEG", "PEG-lipid", "PEG-lipid", or "lipid-PEG" refers to a form in which a lipid and PEG are conjugated, It refers to a lipid in which a polyethylene glycol (PEG) polymer, which is a hydrophilic polymer, is bound to one end. The lipid-PEG conjugate contributes to the stability of the nanoparticles in serum in the lipid nanoparticles, and serves to prevent aggregation between nanoparticles. In addition, the lipid-PEG conjugate protects the nucleic acid from degrading enzymes during in vivo delivery of the nucleic acid, thereby enhancing the stability of the nucleic acid in the body, and increasing the half-life of the drug encapsulated in the nanoparticles.

In the lipid-PEG conjugate, the PEG may be conjugated directly to the lipid or may be linked to the lipid via a linker moiety. Any linker moiety suitable for linking PEG to a lipid can be used, including, for example, ester-free linker moieties and ester-containing linker moieties. The ester-free linker moiety is an amido (-C(O)NH-), amino (-NR-), carbonyl (-C(O)-), carbamate (-NHC(O)O-) ), urea (-NHC(O)NH-), disulfide (-SS-), ether (-O-), succinyl (-(O)CCH ₂ CH ₂ C(O)-), succinamidyl ( -NHC(O)CH ₂ CH ₂ C(O)NH-), ethers, disulfides, as well as combinations thereof (eg, linkers containing both carbamate linker moieties and amido linker moieties) However, the present invention is not limited thereto. Such ester-containing linker moieties include, for example, carbonate (-OC(O)O-), succinoyl, phosphate esters (-O-(O)POH-O-), sulfonate esters, and these including, but not limited to, combinations of

In one embodiment, the average molecular weight of the lipid-PEG conjugate is 100 to 10000 Daltons, 200 to 10000 Daltons, 500 to 10000 Daltons, 1000 to 10000 Daltons, 1500 to 10000 Daltons, 2000 to 10000 Daltons, 100 to 7500 Daltons, 200 to 7500 Daltons, 500 to 7500 Daltons, 1000 to 7500 Daltons, 1500 to 7500 Daltons, 2000 to 7500 Daltons, 100 to 5000 Daltons, 200 to 5000 Daltons, 500 to 5000 Daltons, 1000 to 5000 Daltons, 1500 to 5000 Daltons, 2000 to 5000 Daltons, 100 to 3000 Daltons, 200 to 3000 Daltons, 500 to 3000 Daltons, 1000 to 3000 Daltons, 1500 to 3000 Daltons, 2000 to 3000 Daltons, 100 to 2600 Daltons, 200 to 2600 Daltons, 500 to 2600 Daltons, 1000 to 2600 Daltons, 1500-2600 Daltons, 2000-2600 Daltons, 100-2500 Daltons, 200-2500 Daltons, 500-2500 Daltons, 1000-2500 Daltons, 1500-2500 Daltons, or 2000-2500 Daltons.

The lipid in the lipid-PEG conjugate may be used without limitation as long as it is a lipid capable of binding to polyethylene glycol, and phospholipids and/or cholesterol, which are other components of the lipid nanoparticles, may also be used. Specifically, the lipid in the lipid-PEG conjugate is ceramide (ceramide) (ceramide), dimyristoylglycerol (DMG), succinoyl-diacylglycerol (s-DAG), distearoylphosphatidylcholine , DSPC), distearoylphosphatidylethanolamine (DSPE), or cholesterol.

In one embodiment, the lipid-PEG conjugate is PEG bound to dialkyloxypropyl (PEG-DAA), PEG bound to diacylglycerol (PEG-DAG), PEG bound to phospholipids such as phosphatidylethanolamine (PEG- PE), PEG conjugated to ceramide (PEG-CER, or ceramide-PEG conjugate), PEG conjugated to cholesterol or derivatives thereof, PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC , PEG-DSPE, and mixtures thereof, for example, C16-PEG2000 ceramide, DMG-PEG 2000, 14:0 PEG2000 PE.

According to an example, when the lipid nanoparticles including the ceramide-PEG conjugate are included, the lipid nanoparticles including other types of lipid-PEG conjugates may have one or more of the following characteristics than when the lipid nanoparticles are included:

(1) encapsulation of drugs in the lipid nanoparticles with high efficiency;

(2) the size of the prepared lipid nanoparticles is uniform (or has a low PDI value);

(3) excellent drug delivery efficiency to cancer tissues and/or cancer cells;

(4) capable of long circulation in vivo; and/or

(5) Excellent cancer prevention and/or treatment effect.

PEG in the lipid-PEG conjugate is a hydrophilic polymer and has the ability to inhibit the adsorption of plasma proteins, thereby increasing the circulation time of lipid nanoparticles in the body and preventing aggregation between nanoparticles. In addition, the lipid-PEG conjugate may exhibit a stealth function in vivo to prevent degradation of nanoparticles.

The PEG may be a functional group bound to a side not bound to a lipid (functionalized PEG). In this case, the functional group that can be used is at least one selected from the group consisting of succinyl, carboxylic acid, maleimide, amine, biotin, cyanur, and folate. can

According to one embodiment, the lipid-PEG conjugate is 0.1 to 20 mol%, 0.25 to 20 mol%, 0.5 to 20 mol%, 1 to 20 mol%, 1.5 to 20 mol%, 2 to 20 mol%, 2.5 to 20 mol%, 3-20 mol%, 0.1-15 mol%, 0.25-15 mol%, 0.5-15 mol%, 1-15 mol%, 1.5-15 mol%, 2-15 mol%, 2.5-15 mol% , 3 to 15 mol%, 0.1 to 12.5 mol%, 0.25 to 12.5 mol%, 0.5 to 12.5 mol%, 1 to 12.5 mol%, 1.5 to 12.5 mol%, 2 to 12.5 mol%, 2.5 to 12.5 mol%, 3 to 12.5 mol%, 0.1 to 10 mol%, 0.25 to 10 mol%, 0.5 to 10 mol%, 1 to 10 mol%, 1.5 to 10 mol%, 2 to 10 mol%, 2.5 to 10 mol%, 3 to 10 mol%, 0.1 to 7.5 mol%, 0.25 to 7.5 mol%, 0.5 to 7.5 mol%, 1 to 7.5 mol%, 1.5 to 7.5 mol%, 2 to 7.5 mol%, 2.5 to 7.5 mol%, 3 to 7.5 mol% , 0.1-5 mol%, 0.25-5 mol%, 0.5-5 mol%, 1-5 mol%, 1.5-5 mol%, 2-5 mol%, 2.5-5 mol%, or 3-5 mol% It may be included in the lipid nanoparticles.

According to an embodiment, the drug delivery effect or cancer prevention and/or treatment effect of the lipid nanoparticles into cancer tissues and/or cancer cells may depend on the content of the lipid-PEG conjugate included in the lipid nanoparticles.

For example, 0.1-20 mol%, 0.25-20 mol%, 0.5-20 mol%, 1-20 mol%, 1.5-20 mol%, 2-20 mol%, 2.5-20 mol% of the lipid-PEG conjugate , 3 to 20 mol%, 0.1 to 15 mol%, 0.25 to 15 mol%, 0.5 to 15 mol%, 1 to 15 mol%, 1.5 to 15 mol%, 2 to 15 mol%, 2.5 to 15 mol%, 3 to 15 mol%, 0.1 to 12.5 mol%, 0.25 to 12.5 mol%, 0.5 to 12.5 mol%, 1 to 12.5 mol%, 1.5 to 12.5 mol%, 2 to 12.5 mol%, 2.5 to 12.5 mol%, 3 to 12.5 mol%, 0.1-10 mol%, 0.25-10 mol%, 0.5-10 mol%, 1-10 mol%, 1.5-10 mol%, 2-10 mol%, 2.5-10 mol%, 3-10 mol% , 0.1 to 7.5 mol%, 0.25 to 7.5 mol%, 0.5 to 7.5 mol%, 1 to 7.5 mol%, 1.5 to 7.5 mol%, 2 to 7.5 mol%, 2.5 to 7.5 mol%, 3 to 7.5 mol%, 0.1 to 5 mol%, 0.25 to 5 mol%, 0.5 to 5 mol%, 1 to 5 mol%, 1.5 to 5 mol%, 2 to 5 mol%, 2.5 to 5 mol%, or 3 to 5 mol% The lipid nanoparticles may have one or more of the following characteristics than the lipid nanoparticles comprising a lipid-PEG conjugate in an amount outside the above range:

(1) encapsulating the first anticancer agent with high efficiency;

(2) the size of the produced particles is uniform (or has a low PDI value);

(3) excellent drug delivery efficiency to cancer tissues and/or cancer cells;

(4) capable of long circulation in vivo; and/or

(5) Excellent cancer prevention and/or treatment effect.

According to an example, the cholesterol is 10 to 60 mol%, 20 to 60 mol%, 30 to 60 mol%, 34.5 to 60 mol%, 35 to 60 mol%, 39.5 to 60 mol%, 40 to 60 mol%, 43-60 mol%, 44-60 mol%, 10-55 mol%, 20-55 mol%, 30-55 mol%, 34.5-55 mol%, 35-55 mol%, 39.5-55 mol%, 40- 55 mol%, 43-55 mol%, 44-55 mol%, 10-52.5 mol%, 20-52.5 mol%, 30-52.5 mol%, 34.5-52.5 mol%, 35-52.5 mol%, 39.5-52.5 mol% %, 40-52.5 mol%, 43-52.5 mol%, 44-52.5 mol%, 10-51 mol%, 20-51 mol%, 30-51 mol%, 34.5-51 mol%, 35-51 mol%, 39.5 to 51 mol%, 40 to 51 mol%, 43 to 51 mol%, 44 to 51 mol%, 10 to 50 mol%, 20 to 50 mol%, 30 to 50 mol%, 34.5 to 50 mol%, 35 to 50 mol%, 39.5-50 mol%, 40-50 mol%, 43-50 mol%, 44-50 mol%, 10-45 mol%, 20-45 mol%, 30-45 mol%, 34.5-45 mol% %, 35 to 45 mol%, 39.5 to 45 mol%, 40 to 45 mol% , 43-45 mol%, 44-45 mol%, 10-44.25 mol%, 20-44.25 mol%, 30-44.25 mol%, 34.5-44.25 mol%, 35-44.25 mol%, 39.5-44.25 mol%, 40 to 44.25 mol%, 43 to 44.25 mol%, 44 to 44.25 mol%, 10 to 44 mol%, 20 to 44 mol%, 30 to 44 mol%, 34.5 to 44 mol%, 35 to 44 mol%, 39.5 to 44 mol%, 40-44 mol%, 43-44 mol%, 44-44 mol%, 10-43 mol%, 20-43 mol%, 30-43 mol%, 34.5-43 mol%, 35-43 mol% , 39.5 to 43 mol%, or 40 to 43 mol% may be included in the lipid nanoparticles.

According to an example, the sum of the lipid-PEG conjugate and the cholesterol is 40 to 60 mol%, 40 to 55 mol%, 40 to 53.5 mol%, 40 to 50 mol%, 40 to 47.5 mol%, 40 to 45 mol% %, 40 to 44,5 mol%, 42 to 60 mol%, 42 to 55 mol%, 42 to 53.5 mol%, 42 to 50 mol%, 42 to 47.5 mol%, 42 to 45 mol%, 42 to 44, 5 mol%, 44-60 mol%, 44-55 mol%, 44-53.5 mol%, 44-50 mol%, 44-47.5 mol%, 44-45 mol%, 44-44.5 mol%, 44.5-60 mol %, 44.5 to 55 mol%, 44.5 to 53.5 mol%, 44.5 to 50 mol%, 44.5 to 47.5 mol%, or 44.5 to 45 mol% may be included in the lipid nanoparticles.

According to an example, the ionizable lipid is 10 to 60 mol%, 10 to 55 mol%, 10 to 50 mol%, 10 to 45 mol%, 10 to 42.5 mol%, 10 to 40 mol%, 10 to 35 mol% %, 10-30 mol%, 10-26.5 mol%, 10-25 mol%, 10-20 mol%, 15-60 mol%, 15-55 mol%, 15-50 mol%, 15-45 mol%, 15 to 42.5 mol%, 15 to 40 mol%, 15 to 35 mol%, 15 to 30 mol%, 15 to 26.5 mol%, 15 to 25 mol%, 15 to 20 mol%, 20 to 60 mol%, 20 to 55 mol%, 20-50 mol%, 20-45 mol%, 20-42.5 mol%, 20-40 mol%, 20-35 mol%, 20-30 mol%, 20-26.5 mol%, 20-25 mol% %, 25-60 mol%, 25-55 mol%, 25-50 mol%, 25-45 mol%, 25-42.5 mol%, 25-40 mol%, 25-35 mol%, 25-30 mol%, 25 to 26.5 mol%, 26.5 to 60 mol%, 26.5 to 55 mol%, 26.5 to 50 mol%, 26.5 to 45 mol%, 26.5 to 42.5 mol%, 26.5 to 40 mol%, 26.5 to 35 mol%, 26.5 to 30 mol%, 30-60 mol%, 30-55 mol%, 30-50 mol%, 30-45 mol%, 30-42.5 mol%, 30-40 mol%, 30-35 mol%, 35-60 mol %, 35 to 55 mol%, 35 to 50 mol%, 35 to 45 mol%, 35 to 42.5 mol%, 35 to 40 mol%, 40 to 60 mol%, 40 to 55 mol%, 40 to 50 mol%, 40 to 45 mol%, 40 to 42.5 mol%, 42.5 to 60 mol%, 42.5 to 55 mol%, 42.5 to 50 mol%, or 42.5 to 45 mol% may be included in the lipid nanoparticles.

According to an example, the phospholipid is 5 to 30 mol%, 5 to 25 mol%, 5 to 20 mol%, 5 to 15 mol%, 5 to 13 mol%, 5 to 10 mol%, 10 to 30 mol%, 10-25 mol%, 10-20 mol%, 10-15 mol%, 10-13 mol%, 15-30 mol%, 15-25 mol%, 15-20 mol%, 20-30 mol%, or 20 to 25 mol% may be included in the lipid nanoparticles.

In the present specification, "mol% (mol%, mole percent)" is expressed as a percentage by dividing the number of moles of a specific component by the sum of moles of all components and then multiplying by 100.

(Equation 1)

mol% = (number of moles of a specific component) / (sum of moles of all components) x 100

The lipid nanoparticles are ionizable lipid: phospholipid: cholesterol: lipid-PEG conjugate in a molar ratio of 20 to 50: 10 to 30: 10 to 60: 0.25 to 10, 20 to 50: 10 to 30: 20 to 60: 0.25 to A molar ratio of 10, 20 to 50: 10 to 30: 30 to 60: A molar ratio of 0.5 to 5, 25 to 45: 10 to 25: 40 to 50: A molar ratio of 0.5 to 3, 25 to 45: 10 to 20: 40 to 55: 0.5 to 3 molar ratio, 25 to 45: 10 to 20: 40 to 55: 1.0 to 1.5 molar ratio, 40 to 45: 10 to 15: 40 to 45: 0.5 to 3.0 molar ratio, 40 to 45: 10 to 15: 40 to 45: a molar ratio of 0.5 to 3, 40 to 45: 10 to 15: 40 to 45: a molar ratio of 1 to 1.5, 25 to 30: 17 to 22; 50 to 55: a molar ratio of 0.5 to 3.0, 25 to 30: 17 to 22; 50 to 55: a molar ratio of 1.0 to 2.5, 25 to 30: 17 to 22; 50 to 55: may be included in a molar ratio of 1.5 to 2.5. Among the components included in the lipid nanoparticles, while maintaining the sum of the moles of the lipid-PEG conjugate and cholesterol constant, the moles of cholesterol are decreased as much as the number of moles of the lipid-PEG conjugate is increased, thereby maintaining the molar ratio of the components. can

In this specification, the molar ratio means the mole ratio.

The lipid nanoparticles may include 20 to 50 parts by weight of an ionizable lipid, 10 to 30 parts by weight of a phospholipid, 30 to 60 parts by weight of cholesterol, and 0.1 to 5 parts by weight of a lipid-PEG conjugate.

In the present specification, "part by weight" means a weight ratio in which each component is included.

The lipid nanoparticles may comprise 20 to 50% by weight of an ionizable lipid, 10 to 30% by weight of a phospholipid, 40 to 60% by weight of a cholesterol, and 1.5 to 3% by weight of a lipid-PEG conjugate, based on the total weight of the nanoparticles. . Specifically, the lipid nanoparticles include 25 to 50% by weight of ionizable lipids, 10 to 20% by weight of phospholipids, 35 to 55% by weight of cholesterol, and 0.5 to 5.0% by weight of lipid-PEG conjugates, based on the total weight of the nanoparticles. can do.

A pharmaceutical composition comprising lipid nanoparticles comprising ionizable lipids, cholesterol, phospholipids, and/or lipid-PEG conjugates in the above ranges (molar ratios, midranges, and/or weight % ranges) outside of the above ranges ionizable lipids, (i) the stability of the lipid nanoparticles than when including lipid nanoparticles comprising cholesterol, phospholipids, and/or lipid-PEG conjugates; (ii) the encapsulation rate of the anticancer agent; (iii) anticancer agent delivery efficiency to cancer tissues and/or cancer cells; (iv) effect of long circulation in vivo; and/or (iv) cancer prevention and/or treatment effects may be excellent.

In the present specification, the "targeting" and "localization" of the lipid nanoparticles to cancer tissues and/or cancer cells may be internalization in tissues or cells, and may also penetrate the nuclear membrane. It could mean internalizing it inside the nucleus.

The pharmaceutical composition may be one in which a first anticancer agent (for example, an anionic drug and/or a physiologically active material such as a nucleic acid) is encapsulated inside the lipid nanoparticles, and the first anticancer agent is stable and high efficiency of the lipid It is encapsulated in nanoparticles and may exhibit an excellent cancer prevention and/or treatment effect by the pharmaceutical composition according to an embodiment.

In one example, the weight ratio of the ionizable lipid and the first anticancer agent (eg, anionic drug, nucleic acid, or a combination thereof) contained in the lipid nanoparticles is 1 to 20: 1, 1 to 15: 1, 1 to It may be 10:1, 5 to 20:1, 5 to 15:1, 5 to 10:1, 7.5 to 20:1, 7.5 to 15:1, or 7.5 to 10:1.

The composition according to an embodiment comprises (1) ionizable lipids in a weight ratio within the above range; and (2) a first anticancer agent (eg, anionic drug, nucleic acid, or a combination thereof), when (i) a first anticancer agent inside the lipid nanoparticle (eg, anionic drug, nucleic acid, or a combination thereof) ) of the encapsulation rate; (ii) efficiency of delivery of anticancer agents to cancer tissues and/or cancer cells; (iii) the effect of long circulation in the body; and/or (iv) a cancer preventive and/or therapeutic effect in a weight ratio outside the above range: (1) an ionizable lipid; and (2) a composition comprising lipid nanoparticles comprising the first anticancer agent (which may be superior to).

The lipid nanoparticles encapsulated with the first anticancer agent have an average diameter of 20 nm to 200 nm, 20 to 180 nm, 20 nm to 170 nm, 20 nm to 150 nm, 20 nm to 120 nm, 20 nm to 100 nm, 20 nm to facilitate introduction into cancer tissues and/or cancer cells. to 90 nm, 30 nm to 200 nm, 30 to 180 nm, 30 nm to 170 nm, 30 nm to 150 nm, 30 nm to 120 nm, 30 nm to 100 nm, 30 nm to 90 nm, 40 nm to 200 nm, 40 to 180 nm, 40 nm to 170 nm, 40 nm to 150 nm, 40 nm to 120 nm , 40nm to 100nm, 40nm to 90nm, 50nm to 200nm, 50 to 180nm, 50nm to 170nm, 50nm to 150nm, 50nm to 120nm, 50nm to 100nm, 50nm to 90nm, 60nm to 200nm, 60 to 180nm, 60nm to 170nm, 60nm to 150 nm, 60 nm to 120 nm, 60 nm to 100 nm, 60 nm to 90 nm, 70 nm to 200 nm, 70 to 180 nm, 70 nm to 170 nm, 70 nm to 150 nm, 70 nm to 120 nm, 70 nm to 100 nm, 70 nm to 90 nm, 80 nm to 200 nm, 80 to 180 nm , 80 nm to 170 nm, 80 nm to 150 nm, 80 nm to 120 nm, 80 nm to 100 nm, 80 nm to 90 nm, 90 nm to 200 nm, 90 to 180 nm, 90 nm to 170 nm, 90 nm to 150 nm, 90 nm to 120 nm, or 90 nm to 100 nm. Nanoparticles having a diameter within the above range can remain in the blood for a long time, so that the chance of reaching a target tumor tissue can be increased. Lipid nanoparticles having a diameter size in the above range may exhibit EPR (Enhanced Permeability and Retention; permeation increase and retention effect) effect. The EPR effect means that molecules having a specific size tend to accumulate in tumor tissues rather than normal tissues. Lipid nanoparticles having a diameter size within the above range are excreted by the kidneys less than lipid nanoparticles having a diameter size outside the above range, and immune cell activity is not induced, so that delivery to cancer cells and/or cancer tissues is effectively achieved. can

In one example, the composition comprising lipid nanoparticles having a diameter within the range is higher than the composition comprising lipid nanoparticles having a diameter exceeding the upper limit of the range (i) cancer tissue and/or cancer cell delivery efficiency ; (ii) increase the permeation and retention effect (EPR effect) into cancer tissues and/or cancer cells; And/or (iii) cancer prevention and/or treatment effect is excellent. Lipid nanoparticles according to an embodiment are 5 to 8, 5.5 to 7.5, 6 to 7, or a first anticancer agent (for example, a nucleic acid and an anion) Sex drugs (eg, proteins))), etc., can easily form a complex with the drug through electrostatic interaction, so that the drug can be encapsulated with high efficiency, and the first anticancer agent (eg, nucleic acid) It can be usefully used as a composition for preventing and/or treating cancer, including.

As used herein, "encapsulation" refers to encapsulating a delivery material to be efficiently encapsulated into the body, and the first anticancer agent (drug) encapsulation rate (encapsulation efficiency) is the total drug used for manufacturing. With respect to the content, it means the content of the first anticancer agent (drug) encapsulated in the lipid nanoparticles.

In the composition according to an example, the encapsulation rate of the first anticancer agent is 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 91% or more, 92% or more, 94% or more, 80% or more. 99% or less, 80% or more to 97% or less, 80% or more to 95% or less, 85% or more to 95% or less, 87% or more to 95% or less, 90% or more to 95% or less, 91% or more to 95% or less, 91% or more and 94% or less, 91% or more and 95% or less, 92% or more and 99% or less, 92% or more and 97% or less, or 92% or more and 95% or less.

According to an example, the encapsulation rate can be calculated by a commonly used method, for example, the first anticancer agent (drug) encapsulation rate is Triton-X treatment in the lipid nanoparticles according to an example, Triton-X is treated and Triton-X is not treated to measure the fluorescence intensity of a specific wavelength bandwidth (for example, exitation: 480 ~ 490nm, emission: 520 ~ 530nm), in Equation 2 below may have been calculated by

(Equation 2)

Drug encapsulation rate (%) = (Fluorescence intensity (fluorescence intensity) of lipid nanoparticles treated with Triton-X- Fluorescence intensity (fluorescence intensity) of lipid nanoparticles not treated with Triton-X)/(Triton-X treatment Fluorescence intensity (fluorescence intensity) of lipid nanoparticles) X 100

The first anticancer agent may be an anionic drug, a nucleic acid, or a combination thereof that exhibits an effect of treating and/or preventing cancer.

The nucleic acid is small interfering ribonucleic acid (siRNA), ribosomal ribonucleic acid (rRNA), ribonucleic acid (RNA), deoxyribonucleic acid (DNA), complementary deoxyribonucleic acid (cDNA), aptamer (aptamer), messenger ribonucleic acid (mRNA), It may be one or more selected from the group consisting of transport ribonucleic acid (tRNA), antisense oligonucleotide, shRNA, miRNA, ribozyme, PNA, DNAzyme, and sgRNA for gene editing, but is not limited thereto.

As used herein, the term "siRNA" refers to double-stranded RNA (duplex RNA) capable of inducing RNA interference (RNAi) phenomenon through specific mRNA cleavage, or single-stranded single-stranded RNA having a double-stranded form inside single-stranded RNA. refers to RNA. It is composed of a sense RNA strand having a sequence homologous to the mRNA of a target gene and an antisense RNA strand having a sequence complementary thereto. Since siRNA can inhibit the expression of a target gene, it is provided as an efficient gene knock-down method or as a method of gene therapy. Bonding between double strands is achieved through hydrogen bonding between nucleotides, and not all nucleotides within the double strands need to be complementary and completely bonded.

The length of the siRNA is about 15 to 60, specifically about 15 to 50, about 15 to 40, about 15 to 30, about 15 to 25, about 16 to 25, about 19 to 25, about 20 to 25, or about 20 to 23 nucleotides. The siRNA length means the number of nucleotides on one side of the double-stranded RNA, that is, the number of base pairs, and in the case of single-stranded RNA, it means the length of the double-stranded inside of the single-stranded RNA. In addition, siRNA may be composed of nucleotides introduced with various functional groups for the purpose of increasing blood stability or weakening an immune response.

As used herein, an "antisense oligonucleotide" may be modified at one or more bases, sugars or backbone positions to enhance efficacy (De Mesmaeker et al., Curr Opin Struct Biol., 5(3): 343-55, 1995). The oligonucleotide backbone can be modified with phosphorothioates, phosphotriesters, methyl phosphonates, short chain alkyls, cycloalkyls, short chain heteroatoms, heterocyclic intersaccharide linkages, and the like. Antisense oligonucleotides may also include one or more substituted sugar moieties. Antisense oligonucleotides may include modified bases. Modified bases include hypoxanthine, 6-methyladenine, 5-me pyrimidine (particularly 5-methylcytosine), 5-hydroxymethylcytosine (HMC), glycosyl HMC, gentobiosyl HMC, 2-aminoadenine, 2-thiouracil, 2-thiothymine, 5-bromouracil, 5-hydroxymethyluracil, 8-azaguanine, 7-deazaguanine, N6 (6-aminohexyl) adenine, 2,6-diaminopurine etc.

As used herein, "single-stranded deoxyribonucleic acid (ssDNA)" refers to a single-stranded oligonucleotide that selectively binds to a specific target DNA and induces an antigene effect.

As used herein, "aptamer" refers to an oligonucleotide (generally, 20 to 80 nt DNA or RNA) that binds to a specific target. Preferably, in the present invention, "aptamer" means an oligonucleotide aptamer (eg, DNA or RNA aptamer).

As used herein, “mRNA” refers to a synthetic mRNA capable of expressing a gene (in vitro transcribed mRNA).

As used herein, "shRNA" refers to nucleotides composed of 50 to 70 single strands, and in vivo forms a stem-loop structure. A long RNA of 19 to 29 nucleotides is complementary to both sides of a loop region of 5 to 10 nucleotides to form a double-stranded stem.

As used herein, "miRNA (microRNA)" refers to a single-stranded RNA molecule that regulates gene expression and consists of a full length of 21 to 23 nucleotides. miRNA is an oligonucleotide that is not expressed in cells and has a short stem-loop structure. miRNA has full or partial homology with one or two or more mRNA (messenger RNA), and suppresses target gene expression through complementary binding to the mRNA.

In the present specification, "ribozyme" is a type of RNA and is an RNA having the same function as an enzyme that recognizes the base sequence of a specific RNA and cuts it by itself. A ribozyme is a complementary nucleotide sequence of a target messenger RNA strand and consists of a region that binds with specificity and a region that cuts the target RNA.

As used herein, "DNAzyme" is a single-stranded DNA molecule having enzymatic activity, and a DNAzyme (10-23 DNAzyme) consisting of 10 to 23 nucleotides cuts an RNA strand at a specific position under physiologically similar conditions. 10-23 DNAzyme does not base pair and cleaves between any exposed purines and pyrimidines. 10-23 DNA enzyme (DNAzyme) consists of 15 conserved nucleotide sequences (eg, 5'-GGCTAGCTACAACGA-3') of the enzyme's active site (catalytic domain) and the RNA substrate to the left and right of the active site of the above-mentioned enzyme. It consists of an RNA substrate binding domain consisting of 7 to 8 DNA sequences to be recognized.

As used herein, "PNA (Peptide nucleic acid)" refers to a molecule having both nucleic acid and protein properties, and capable of complementary binding to DNA or RNA. PNA was first reported in 1999 as a DNA-like DNA in which nucleobases are linked by peptide bonds (Nielsen PE, Egholm M, Berg RH, Buchardt O, "Sequence-selective recognition of DNA by strand displacement with a thymine- substituted polyamide", Science 1991, Vol. 254: pp1497-1500]). PNA is not found in nature and is artificially synthesized by chemical methods. PNA causes a hybridization reaction with a natural nucleic acid of a complementary base sequence to form a double strand. PNA/DNA duplexes are more stable than DNA/DNA duplexes, and PNA/RNA duplexes are more stable than DNA/RNA duplexes for the same length. As the basic backbone of a peptide, N-(2-aminoethyl)glycine is repeatedly linked by an amide bond. is neutral with The four nucleotides present in PNA have almost the same spatial size and distance between the nucleotides as in the case of natural nucleic acids. PNA is not only chemically more stable than natural nucleic acids, but also biologically stable because it is not degraded by nucleases or proteases.

As used herein, "sgRNA" refers to a complex single RNA molecule of crispr RNA (crRNA) and tracer (tracrRNA) as an oligonucleotide (generally, an RNA molecule) that binds to a specific DNA target. An RNA molecule that is used to recognize a specific DNA sequence together with Cas9 nuclease in the CRISPR system and enables selective gene cleavage. It contains a 20-nt sequence that can be complementary to DNA and has a total length of 100 nt .

As used herein, the term "gene editing protein" refers to Cas9, spCas9, cjCas9, casX, CasY and Cpf1, and refers to a protein that recognizes a target DNA base sequence together with sgRNA to cause DNA cleavage.

The composition for drug delivery according to an embodiment may include Cas9 mRNA at a high encapsulation rate. The previously known composition for delivery of Cas9 mRNA has a limitation in using it as a composition for delivery of Cas9 mRNA, including Cas9 mRNA at a low ratio. On the other hand, the lipid nanoparticles according to an embodiment may contain Cas9 mRNA with a high encapsulation rate, specifically, an encapsulation rate of 70% or more, and thus may be usefully utilized for gene editing therapy.

The anionic drug may be anionic biopolymer-drug conjugates such as various peptides having an anion, protein drugs, protein-nucleic acid constructs or hyaluronic acid-peptide conjugates, hyaluronic acid-protein conjugates, and the like. Non-limiting examples of the protein drug include gene editing proteins such as Cas 9 and cpf1, which are gene editing scissors, as well as apoptosis inducers (eg, cytocrome C, caspase 3/7/8/9, etc.) and various intracellular proteins. (eg, a transcription factor) and the like.

The pharmaceutical composition for preventing or treating cancer according to an embodiment may include lipid nanoparticles in which anionic drugs and/or nucleic acids are encapsulated.

The cancer may be cancer caused by infection with human papilloma virus (HPV). For example, the cancer caused by the HPV infection may include, but is not limited to, cervical cancer, vaginal cancer, vulvar cancer, anal cancer, penile cancer, tonsil cancer, pharyngeal cancer, laryngeal cancer, head and neck cancer, and adenocarcinoma of the lung. may be selected from the group.

The cancer includes cervical cancer, endometrial cancer, vaginal cancer, vulva cancer, anal cancer, penis cancer, tonsil cancer, pharynx cancer, Larynx cancer, head and neck cancer, squamous cell head and neck cancer, lung adenocarcinoma, non-small cell lung cancer, squamous cell carcinoma of the lung, lung cancer, stomach cancer, sarcoma, lymphoma, Hodgkin's lymphoma, chronic or acute leukemia, thymus Cancer, epithelial cancer, salivary gland cancer, liver cancer, stomach cancer, thyroid cancer, parathyroid cancer, ovarian cancer, breast cancer, prostate cancer, esophageal cancer, pancreatic cancer, glioma, multiple myeloma, renal cell carcinoma, bladder cancer, choriocarcinoma, colon cancer, oral cancer, skin cancer, melanoma It may be selected from the group consisting of tumors, bone cancer, rectal cancer, small intestine cancer, endocrine adenocarcinoma, adrenal cancer, soft tissue sarcoma, urethral cancer, spinal cord tumor, brainstem glioma, and pituitary adenoma.

The pharmaceutical composition may be administered by various routes including parenteral administration to mammals including humans, and parenteral administration may be applied intravenously, subcutaneously, intraperitoneally or locally, and the dosage may vary depending on the patient's condition. and body weight, disease severity, drug form, administration route and time, but may be appropriately selected by those skilled in the art.

When formulating the pharmaceutical composition according to an example, it is prepared using a diluent or excipient such as a filler, an extender, a binder, a wetting agent, a disintegrant, and a surfactant usually used.

Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspension solutions, emulsions, lyophilized formulations, suppositories, and the like.

Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. As the base of the suppository, witepsol, macrogol, tween 61, cacao butter, laurin, glycerol, gelatin, and the like can be used.

The pharmaceutical composition according to an embodiment is administered in a pharmaceutically effective amount. In the present invention, "pharmaceutically effective amount" means an amount sufficient to treat a disease at a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level is the type, severity, and drug activity of the patient. , can be determined according to factors including sensitivity to drug, administration time, administration route and excretion rate, duration of treatment, concurrent drugs, and other factors well known in the medical field. The pharmaceutical composition according to an embodiment may be administered as an individual therapeutic agent or may be administered in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered single or multiple. In consideration of all of the above factors, it is important to administer an amount that can obtain the maximum effect with a minimum amount without side effects, which can be easily determined by those skilled in the art.

Specifically, the effective amount of the compound according to the present invention may vary depending on the age, sex, and weight of the patient, and may be administered daily or every other day, or divided into 1 to 3 times a day. However, since it may increase or decrease depending on the route of administration, the severity of obesity, sex, weight, age, etc., the dosage is not intended to limit the scope of the present invention in any way.

According to one embodiment, the pharmaceutical composition is 0.1 to 100 mg/kg, 0.1 to 50 mg/kg, 1 to 10 mg/kg based on the concentration of the drug (anionic drug, nucleic acid, or a combination thereof) included in the pharmaceutical composition. kg, or at a dose of 1 to 5 mg/kg.

Another aspect is a pharmaceutical composition for cancer treatment for use in combination with radiation therapy, comprising the pharmaceutical composition; a pharmaceutical composition for enhancing radiation sensitivity; Alternatively, a pharmaceutical composition for cancer treatment in combination with radiation therapy may be provided. The pharmaceutical composition may further increase the effect of cancer treatment by improving the damage sensitivity of cancer cells to radiation during the treatment of cancer, and/or suppress the resistance of cancer cells to radiation to easily induce apoptosis of cancer cells by radiation It can be used as a composition or formulation that can be treated to do so, and a composition comprising the pharmaceutical composition can be used in combination with radiation therapy.

In the present specification, the enhancement of radiation sensitivity means enhancing the sensitivity of cells to radiation in disease treatment using radiation. Through this, the radiation treatment efficiency can be increased, and in particular, when the treatment is performed concurrently during cancer treatment, the radiation sensitivity of cancer cells is enhanced, thereby making it possible to produce a killing effect and an inhibitory effect on the proliferation of cancer cells.

A pharmaceutical composition for cancer treatment (or a composition for enhancing radiation sensitivity, a pharmaceutical composition for cancer treatment in combination with radiation therapy) for use in combination with radiation therapy according to an embodiment is a first anticancer agent, HPV type 16 (HPV16) or HPV type 18 (HPV18) ) E6 and/or E7 proteins of the virus; phosphomevalonate kinase (PMVK) protein; or an inhibitor of expression or activity of a combination thereof. The PMVK expression inhibitor, E6, and / or E7 expression inhibitor is an antisense nucleotide complementary to the mRNA of PMVK, E6, and / or E7 gene, small interfering RNA (siRNA), and short hairpin RNA ( short hairpin RNA; shRNA) may be selected from the group consisting of. wherein said inhibitor of PMVK activity and/or said inhibitor of E6 and/or E7 activity of HPV16 (or HPV type 18) virus is a peptide that specifically binds to PMVK, E6, and/or E7 protein of HPV16 (or HPV type 18) virus. , peptide mimetics, and aptamers may be selected from the group consisting of.

In one embodiment, the pharmaceutical composition may be administered in combination with radiation when treating cancer. The "irradiation" refers to a local treatment method that damages the DNA of malignant cells. Normal cells have a greater capacity to repair this damage than tumor cells. Irradiation refers to a treatment using such a difference, and includes a method of treatment using radiation in a conventional sense. Radiation irradiation can be divided into radical (red) radiation therapy, adjuvant radiation therapy, and palliative radiation therapy depending on the purpose of treatment. Curative (red) radiation therapy refers to radiation therapy for the purpose of cure when the tumor is relatively limited to a local area and there is no distant metastasis. Adjuvant radiation therapy refers to radiation therapy performed for the purpose of preventing local recurrence after surgical operation. By combining radiation therapy, it is possible not only to reduce recurrence, but also to reduce the scope of surgery to maintain function. Palliative radiation therapy is radiation therapy performed for the purpose of alleviating symptoms caused by cancer.

Radiation is a treatment that uses high-energy radiation to kill cancer cells, but since it affects not only cancer cells but also normal tissues around them, side effects may occur due to treatment. Examples include skin changes, hair loss, nausea and vomiting, diarrhea, mucositis/esophagitis, dry mouth, and changes in reproductive function.

A pharmaceutical composition for cancer treatment for use in combination with radiation therapy according to an embodiment; a pharmaceutical composition for enhancing radiation sensitivity; Alternatively, the pharmaceutical composition for cancer treatment in combination with radiation therapy may reduce these side effects by reducing the required amount of radiation. In addition, radiation sensitivity can be increased not only in cancer cells that are sensitive to radiation, but also in cancer cells that are resistant to radiation.

Cancer for use in combination with radiation therapy comprising lipid nanoparticles comprising ionizable lipids, cholesterol, phospholipids, and/or lipid-PEG conjugates in ranges (molar ratio, midsection, and/or weight percent ranges) as described above. Pharmaceutical composition for treatment (or composition for enhancing radiation sensitivity, pharmaceutical composition for cancer treatment in combination with radiation therapy) includes lipid nanoparticles comprising ionizable lipids, cholesterol, phospholipids, and/or lipid-PEG conjugates outside the above range By increasing the sensitivity of cancer cells, tumor cells, and cancer tissues to radiation, the cancer cell death and cancer treatment effects may be excellent.

In one example, according to an example, 1,4-bis(3-aminopropyl)piperazine (1,4-bis(3-aminopropyl), and/or lipid nanoparticles comprising a ceramide-PEG conjugate. In the case of other types of lipid-PEG conjugates, the sensitivity of cancer cells, tumor cells, and cancer tissues to radiation is increased, compared to the case of including lipid nanoparticles comprising a lipid-PEG conjugate, and thus cancer cell death and cancer treatment effects may be excellent.

Another aspect is a pharmaceutical composition for combined administration of an anticancer agent, further comprising the pharmaceutical composition and a second anticancer agent; Or it may provide a pharmaceutical composition for enhancing anti-cancer treatment. The pharmaceutical composition is as described above.

The second anticancer agent is gosipol, nitrogen mustard, imatinib, oxaliplatin, rituximab, erlotinib, neratinib, lapatinib, gefitinib, vandetanib, nirotinib, semasanib, bosutinib, axitinib , cediranib, restaurtinib, trastuzumab, gefitinib, bortezomib, sunitinib, carboplatin, bevacizumab, cisplatin, cetuximab, viscumalbum, asparaginase, tretinoin, hydroxycarba amide, dasatinib, estramustine, gemtuzumab ozogamicin, ibritumomab tuccetan, heptaplatin, methylaminolevulinic acid, amsacrine, alemtuzumab, procarbazine, alprostadil, holmium nitrate Chitosan, gemcitabine, doxyfluridine, pemetrexed, tegafur, capecitabine, gimeracin, oteracil, azacitidine, methotrexate, uracil, cytarabine, fluorouracil, fludagabine, enocy Tabine, flutamide, decitabine, mercaptopurine, thioguanine, cladribine, carmopher, raltitrexed, docetaxel, paclitaxel, irinotecan, belotecan, topotecan, vinorelbine, etoposide, vincristine, vin Blastin, teniposide, doxorubicin, idarubicin, epirubicin, mitoxantrone, mitomycin, bleromycin, daunorubicin, dactinomycin, pyrarubicin, aclarubicin, pepromycin, temsi Rolimus, temozolomide, busulfan, ifosfamide, cyclophosphamide, melparan, altretmine, dacarbazine, thiotepa, nimustine, chlorambucil, mitolactol, leucovorin, tretonin, X mestan, aminoglutethimide, anagrelide, nabelbine, fadrazole, tamoxifen, toremifene, testolactone, anastrozole, letrozole, vorozole, bicalutamide, lomustine, and carmustine It may be at least one selected from the group consisting of.

In one embodiment, the second anticancer agent may not be encapsulated inside the lipid nanoparticles included in the pharmaceutical composition.

Another aspect is chemotherapy or radiation therapy for cancer, comprising co-administering the pharmaceutical composition when performing chemotherapy or radiation therapy for the treatment of cancer (eg, cancer caused by HPV infection). It is possible to provide a method for enhancing the sensitivity to

In the case of "combination administration", in the case of chemotherapy, the step of administering the pharmaceutical composition several hours before, (eg, 4 hours) before chemotherapy may be performed first. In addition, in the case of radiation therapy, the pharmaceutical composition may be administered 1 day after irradiation, several times over 2 days (eg 2 to 4 times).

Another aspect provides a method for preventing or treating cancer comprising administering the pharmaceutical composition to a patient. Cancer is the same as described above.

The method for preventing or treating cancer according to an embodiment may further include the step of identifying (selecting) a patient in need of prevention and/or treatment of cancer before the administering step. In one embodiment, the patient has received radiation and/or chemotherapy; patients receiving radiation and/or chemotherapy; and/or a patient scheduled to receive radiation therapy and/or chemotherapy.

The subject subject to which the treatment method is applied means, but is not limited to, mammals including mice, livestock, etc. including humans that have or can develop cancer. A pharmaceutical composition comprising lipid nanoparticles comprising ionizable lipids, cholesterol, phospholipids, and/or lipid-PEG conjugates (or radiation treatment and / or a pharmaceutical composition for concurrent administration of an anticancer agent) to the subject, the subject can be efficiently treated.

As used herein, "administration" means introducing the pharmaceutical composition to a subject by any suitable method, and the route of administration is oral or parenteral (eg, intravenous, subcutaneous, intraperitoneal or topical application).

The prevention or treatment method may include administering the pharmaceutical composition (or a pharmaceutical composition for combined administration of radiotherapy and/or anticancer agent) in a pharmaceutically effective amount. A suitable total daily amount may be determined by treatment within the scope of correct medical judgment, and may be administered once or divided into several doses. However, a specific therapeutically effective amount for a particular patient depends on the specific composition, age, weight, general health, sex and diet, administration time of the patient, including the type and extent of the response to be achieved, and whether other agents are used as the case may be. , administration route and secretion rate of the composition, treatment period, various factors including drugs used together or concurrently with a specific composition, and similar factors well known in the pharmaceutical field can be applied differently.

Another aspect includes administering the pharmaceutical composition to an animal (eg, an animal other than a human); And it relates to a treatment method for cancer comprising the step of irradiating radiation.

In the case of irradiating radiation after administration of the pharmaceutical composition, the radiation treatment effect, furthermore, the cancer treatment effect can be significantly enhanced according to the synergistic effect.

The animal to be treated may be any mammal including humans, livestock, and pets, but is not limited thereto.

For the radiation, any radiation method used for conventional radiation treatment of cancer or a radiation method for cancer to be developed later may be applied.

Another aspect may provide a composition for killing cancer cells comprising the lipid nanoparticles and the first anticancer agent. Another aspect may provide a method for killing cancer cells comprising the step of encapsulating the first anticancer agent in the lipid nanoparticles. Cancer cells that can be killed by the composition according to an embodiment may refer to the aforementioned cancer cells.

The pharmaceutical composition according to an embodiment has excellent biocompatibility, can deliver gene therapy with high efficiency, and thus has excellent cancer prevention or treatment effect, and excellent cancer prevention or treatment effect even when combined with other anticancer agents and/or radiation therapy do.

1a shows an exemplary structure of a lipid nanoparticle according to an example, and FIG. 1b shows an image observed by cryo-TEM of a nanoparticle according to an example.
2 shows ¹ H NMR (room temperature, 400 MHz) results of 246-C10 in CDCl ₃ .
3a (241-C10 LNP to 243-C10 LNP) and FIG. 3b (244-C10 LNP to 246-C10 LNP) show the results of measuring the fluorescence intensity of each lipid nanoparticle in a solution having a pH of 4.1 to 9.6. indicates
4A and 4B are results showing the intracellular gene transfer efficiency of each nanoparticle. Specifically, Figure 4a shows the luminescence intensity measured by lysing the cells after transforming the LNP containing the luciferase-encoding mRNA (luc mRNA) into HeLa cells, and Figure 4b shows the luminescence intensity measured by the encapsulation of siRNA according to an example. The results of measuring luciferase expression after LNP transformation into Hela-Luc cancer cells are shown.
5A to 5C are results showing the gene transfer efficiency of nanoparticles in mice. Specifically, FIG. 5a shows the results of confirming the biodistribution in cancer tissues, liver and kidney by IVIS 48 hours after the fluorescence-attached siGFP was encapsulated with LNP and injected into a mouse model, and FIG. 5b is lipid containing siLuc. Nanoparticles are administered to Hela-Luc xenograft mouse model and the result of measuring the increase or decrease in luciferase expression with a bioluminescence device is shown.
Figure 5c is a bioluminescence chart showing the increase and decrease of luciferase expression according to the injection method after administration of lipid nanoparticles containing siLuc to a Hela-Luc xenograft mouse model.
6A shows the apoptosis effect of nanoparticles containing siRNA in a head and neck squamous cell carcinoma cell line and a cervical cancer cell line.
6B shows the increase or decrease in the expression of mRNA genes by nanoparticles containing siRNA in a head and neck squamous cell carcinoma cell line and a cervical cancer cell line.
Figure 6c shows the increase or decrease in the expression of proteins by nanoparticles containing siRNA in a head and neck squamous cell carcinoma cell line and cervical cancer cell line.
Figure 7a shows the apoptosis effect of nanoparticles containing siRNA in a pancreatic cancer cell line, a lung cancer cell line, a breast cancer cell line, and a cervical cancer cell line.
Figure 7b shows the increase or decrease of mRNA gene expression by nanoparticles containing siRNA in a pancreatic cancer cell line, a lung cancer cell line, a breast cancer cell line, and a cervical cancer cell line.
Figure 7c shows the increase or decrease of protein expression by nanoparticles containing siRNA in a pancreatic cancer cell line, a lung cancer cell line, a breast cancer cell line, and a cervical cancer cell line.
7D shows apoptosis by nanoparticles and radiation containing siRNA in a pancreatic cancer cell line, a lung cancer cell line, and a cervical cancer cell line.
Figure 7e shows the increase or decrease of protein expression by nanoparticles and radiation containing siRNA in a pancreatic cancer cell line, a lung cancer cell line, and a cervical cancer cell line.
7f shows siRNA delivery and mRNA gene expression increase or decrease by nanoparticles containing siRNA against radiation in a pancreatic cancer cell line transplantation mouse model.
7G shows siRNA delivery and mRNA gene expression increase or decrease by nanoparticles containing siRNA against radiation in a lung cancer cell line transplantation mouse model.

The present invention will be described in more detail with reference to the following examples, but the scope of the rights is not limited to the following examples.

Example 1. Preparation of ionizable lipids

Example 1-1. Preparation of ionizable lipids

The amine compounds of Table 1 and 1,2-epoxidodecane (hereinafter, C10) (Sigma-Aldrich, USA) containing a 6-membered heterocyclic tertiary amine were mixed with 1:n (n = primary amine x 2 +2) An ionizable lipid was synthesized by reacting in a molar ratio of primary amine x 1).

Specifically, in a 5 ml vial, each of the 241 to 246 amines in Table 1 and the epoxide (C10) were added together with a magnetic bar in a molar ratio of 1:n (n = primary amine x 2 + secondary amine x 1) with a stirrer at 750 rpm, 90° C. for 3 days. Afterwards, with WELUX fine silica column (Intertec, Korea) After purification, the molecular weight of each ionizable lipid produced by the above reaction was calculated and stored at a concentration of 100 mg/ml using ethanol. Ionizable lipids prepared using 241 amines and C10 are named '241-C10', and ionizable lipids prepared using other types of amines are also named as 'Amine names used (241 to 246)-C10' did

Example 1-2. Identification of ionizable lipids produced

In order to confirm the ionizable lipid prepared in Example 1-1, ¹ H NMR was performed. Specifically, 5 μg of the ionizable lipid (246-C10) synthesized in Example 1-1 was diluted in 0.5 ml of CDCl ₃ (sigma, USA) to prepare a concentration of 100 mmole. Thereafter, 0.5 ml each was put into a 400 MHz NMR tube, the top was sealed, and then sealed with parafilm to obtain NMR spectra using Agilent 400 MHZ FT-NMR (Agilent, USA), and the results are shown in FIG. 2 . As shown in FIG. 2 , it was found that the signal representing each functional group of 246-C10 was saturated.

In addition, to confirm the ionizable lipids (241-C10 to 246-C10) prepared in Example 1-1, MS analysis was performed. Specifically, MS analysis was performed by diluting ionizable lipids in ethanol to a concentration of 0.5 ppm or less. The instrument used for the analysis was 6230 LC/MS from Agilent Technologies (Palo Alto, USA), and Agilent Technologies' Zorbax SB-C18 (100 mm × 2.1 mm i.d., 3.5 μm) was used for the separation tube, and 0.1% of the mobile phase was used. Two solvents of distilled water (A) and acetonitrile (B) containing formic acid were gradient eluted. The solvent gradient of the mobile phase was maintained for 4 minutes until the ratio of the organic solvent acetonitrile (B) was initially increased from 30% to 80% until 2 minutes, and then the ratio of the organic solvent was lowered to 30% again and stabilized. The flow rate of the mobile phase was 300 μl/min, and the injection volume of the analyzer was 2 μl. The results of MS analysis are shown in Table 2 below. As shown in Table 2, it was confirmed that the measured m/z ratio of the ionizable lipid and the calculated m/z ratio were almost identical.

Chemical formula Calculated
m/z ratio Observed
m/z ratio 241-C10 C ₃₂ H ₆₆ N ₂ O ₂ 510.87864 511.5201 242-C10 C ₃₁ H ₆₄ N ₂ O ₂ 496.85206 497.5043 243-C10 C ₃₁ H ₆₅ N ₃ O ₂ 511.8667 513.5186 244-C10 C ₄₂ H ₈₇ N ₃ O ₃ 682.15848 682.6821 245-C10 C ₄₃ H ₈₉ N ₃ O ₃ 696.18506 696.7045 246-C10 C ₅₈ H ₁₂₀ N ₄ O ₄ 937.5978 937.9383

From the above results, it was confirmed that the ionizable lipids were well made in Example 1-1.

Example 2. Preparation of lipid nanoparticles

Example 2-1. Lipid Nanoparticle Preparation

Ionizable lipids (241-C10 to 246-C10) prepared in Example 1-1, cholesterol (Cholesterol powder, BioReagent, suitable for cell culture, ≥99%, sigma, Korea), phospholipids (DSPC) (Avanti, USA), and a lipid-PEG conjugate (C16-PEG2000 ceramide) (C16 PEG2000 Ceramide, Avanti, USA) were dissolved in ethanol in a molar ratio of 42.5:13:43:1.5.

Ethanol and acetate buffer in which ionizable lipids, cholesterol, phospholipids, and lipid-PEG were dissolved were mixed at a volume ratio of 1:3 through a microfluidic mixing device (Benchtop Nanoassemblr; PNI, Canada) at a flow rate of 12 ml/min, Lipid nanoparticles (LNPs) were prepared.

Example 2-2. Preparation of nucleic acid-encapsulated lipid nanoparticles

Ionizable lipids (241-C10 to 246-C10), cholesterol (Cholesterol powder, BioReagent, suitable for cell culture, ≥99%, sigma, Korea), phospholipids (DSPC or DOPE) prepared in Example 1-1 ( 18:0 PC (DSPC), 18:1 (Δ9-Cis) PE (DOPE), Avanti, USA), and lipid-PEG conjugate (C16-PEG2000 ceramide) (C16 PEG2000 Ceramid, Avanti, USA) in ethanol dissolved. Dilute 30 μg of RNA therapeutic mRNA (luciferase mRNA; SEQ ID NO: 1) in 0.75 ml of sodium citrate, or 30 μg of siRNA (siLUC, siGFP, Anti-HPV16 E6/E7 siRNA, Anti-PMVK siRNA, etc.) with 50 mM acetic acid The aqueous phase was prepared by dilution in 0.75 mL of sodium. mRNA and siRNA were synthesized and used by Bioneer (Korea).

An organic phase (ethanol) in which ionizable lipids, cholesterol, phospholipids, and a lipid-PEG conjugate (hereinafter, lipid-PEG) are dissolved and an aqueous phase (sodium acetate or sodium citrate) in which an RNA therapeutic agent (nucleic acid) is dissolved at 12 ml/min By mixing through a microfluidic mixing device (Benchtop Nanoassemblr; PNI, Canada) at a flow rate of (i) In order to prepare mRNA-encapsulated lipid nanoparticles, ionizable lipid: phospholipid (DOPE): cholesterol: lipid-PEG (C16-PEG2000 ceramide) 26.5: 20: 52.5 to 51: 1.0 to 2.5 (molar ratio of It was dissolved in ethanol at a molar ratio of cholesterol and lipid-PEG content so that the total sum was 100), and the organic and aqueous phases were mixed so that the weight ratio of mRNA (luciferase mRNA; SEQ ID NO: 1): ionizable lipid was 1:10. to prepare lipid nanoparticles. (ii) ionizable lipid: phospholipid (DSPC): cholesterol: lipid-PEG (C16-PEG2000 ceramide) to prepare siRNA-encapsulated lipid nanoparticles 42.5: 13: 34.5 to 44.25: 0.25 to 10.0 (total molar ratio It was dissolved in ethanol at a molar ratio of cholesterol and lipid-PEG content so that the sum was 100), and siRNA (siLUC, siGFP, Anti-HPV16 E6/E7 siRNA, Anti-PMVK siRNA, etc.): ionizable lipid was 1:7.5 A lipid nanoparticle (LNP) was prepared by mixing an organic phase and an aqueous phase so as to have a weight ratio of . The sequences of the siRNAs used are shown in Table 3 below. Bases indicated by lowercase letters in Table 3 were transformed into 2'-O-Methyl.

Base sequence (5'->3') SEQ ID NO: siLuc sense AAcGcuGGGcGuuAAucAAdTdT SEQ ID NO: 2 antisense UUGAUuAACGCCcAGCGUUdTdT SEQ ID NO: 3 Cy5.5 labeled siGFP sense ACAUGAAGCAGCACGACUUdTdT SEQ ID NO: 4 antisense AAGUCGUGCUGCUUCAUGUdTdT SEQ ID NO: 5 Anti-HPV16 E6/E7 siRNA sense GACCGGUCGAUGUAUGUCUUG SEQ ID NO: 6 antisense AGACAuACAuCGACCGGuCCA SEQ ID NO: 7 Anti-PMVK siRNA sense UGGACGAUGCUGAGUCAGAdTdT SEQ ID NO: 14 antisense UCUGACUCAGCAUCGUCCAdTdT SEQ ID NO: 15

The prepared LNP was dialyzed against PBS for 16 hours using a 10,000 MWCO dialysis cassette to remove ethanol and adjust the pH of the lipid nanoparticles to the body pH.

Lipid nanoparticles containing ionizable lipid '241-C10' were named '241-C10 LNP', and lipid nanoparticles prepared using ionizable lipids containing different types of amines (nucleic acid-encapsulated lipid nanoparticles particles) were named 'contained amine names (241 to 246)-C10 LNP'.

Example 2-3. Observation of nucleic acid-encapsulated lipid nanoparticles

Lipid nanoparticles encapsulated with siLuc (SEQ ID NO: 5) were prepared as in Example 2-2 using a ceramide-PEG conjugate (C16-PEG2000 ceramide). Load 60ug of the prepared lipid nanoparticles (contains 1.5 mol% of ceramide-PEG conjugate) on 200 mesh carbon lacey film Cu-grid based on siRNA concentration, immerse in ethane liquefied with vitrobot (about -170 degrees or less) and plunge freeze After preparation, it was observed with Cryo-TEM (Tecnai F20, FEI), and the results are shown in FIG. 1B. As shown in FIG. 1b , spherical particles with a size of 100 nm or less were observed.

Example 3. pKa of lipid nanoparticles

In this example, the pKa of each lipid nanoparticle (LNP) formulated in Example 2-1 was calculated through an in vitro TNS assay. Anionic TNS interacts with positively charged ionizable lipids to become lipophilic, and as the pH value approaches the pKa value of each LNP, the lipophilicity of the TNS decreases and more water molecules quench TNS fluorescence ( quenching), lipid nanoparticles having a pKa of 6.0 to 7.0 have excellent in vivo drug delivery efficiency, and lipid nanoparticles showing an “s-shaped curve” in a graph showing fluorescence according to pH It means that the interaction is easy, and can easily escape the endosomes during acidification.

Specifically, the pH of a solution containing 20mM sodium phosphate, 25mM citrate, 20mM ammonium acetate, and 150mM NaCl was adjusted from pH 4.1 to pH 9.6 using 0.1N NaOH and/or 0.1N HCl in 0.5 steps to obtain various pH values. A solution of the unit was prepared. 100 μl of a solution having each pH (pH with an interval of 0.5 from pH 4.1 to pH 9.6) was added to a black 96 well plate, and a TNS stock solution of 300 μM was used to obtain a final concentration of 6 μM. Each was added to a solution having a pH. 241-C10 LNP to 246-C10 LNP were added to the mixed solution to a final concentration of 20 uM. The fluorescence intensity was measured by excitation at 325 nm and emission at 435 nm through the Tecan instrument, and the fluorescence intensity for each lipid nanoparticle is shown in FIGS. 3A and 3B, and the pKa for each lipid nanoparticle reached half of the maximum fluorescence. It was calculated as the pH value and is shown in Table 4 below. As shown in FIG. 3b , it was found that 244-C10 LNP to 246-C10 LNP exhibited a fluorescence titration s-shaped curve through nonlinear regression.

Lipid nanoparticles pKa 241-C10 LNP 7.7 242-C10 LNP 8.7 243-C10 LNP 8.2 244-C10 LNP 6.8 245-C10 LNP 6.9 246-C10 LNP 7

As can be seen in Table 3, it was confirmed that the lipid nanoparticles according to an example exhibited excellent in vivo safety and drug release in the pKa range of 6.0 to 7.0.

In the case of the nucleic acid-encapsulated LNP prepared as in Example 2-2, the same pattern was shown depending on the type of ionizable lipid included (the type of amine included in the ionizable lipid).

Example 4. Characterization of lipid nanoparticles

Example 4-1. Particle size measurement

In this example, the size of the mRNA-encapsulated lipid nanoparticles (LNP; containing 1.5 mol% of lipid-PEG) prepared in Example 2-2 was measured. The RNA (luciferase mRNA; SEQ ID NO: 1) contained in each lipid nanoparticle prepared in Example 2-2 was diluted with PBS so that the concentration was 1 μg/ml, and Malvern Zetasizer Nano (Malvern Instruments, UK) The diameter and polydispersity index (PDI) of the LNPs were measured using dynamic light scattering (DLS) in the , and the results are shown in Table 5 below.

Lipid nanoparticles Diameter (nm) PDI 241-C10 LNP 128 0.259 242-C10 LNP 77 0.210 243-C10 LNP 56 0.225 244-C10 LNP 66 0.149 245-C10 LNP 70 0.210 246-C10 LNP 68 0.143

As can be seen in Table 5, the lipid nanoparticles according to one example exhibited a particle size that was easy to introduce into hepatocytes and excellent drug release, and 241-C10 LNP > 243-C10 LNP > 242-C10 LNP = 245- In the order of C10 LNP > 244-C10 LNP > 246-C10 LNP, it was found that the PDI value was small and the particles were uniform.

Example 4-2. Measurement of drug encapsulation rate

The encapsulation efficiency (drug encapsulation rate, %) of each LNP (containing 1.5 mol% of lipid-PEG) encapsulated with siRNA (siFVII siRNA) as a nucleic acid drug was measured by Ribogreen analysis (Quant-iT™ RiboGreen® RNA, Invitrogen). did The LNP containing the nucleic acid drug prepared in Example 2-2 was diluted with 50 μl of 1xTE buffer so that the final concentration of siRNA was 4 to 7 μg/ml in a 96-well plate. For the group not treated with Triton-X (Triton-x LNP(-)), 50 μl of 1xTE buffer was added, and for the group treated with Triton-X (Triton-X LNP(+)), 2% Triton-X buffer 50 μl was added. After incubation at 37° C. for 10 minutes, LNPs were digested with Triton-X to release encapsulated nucleic acids. Then 100 μl of Ribogreen reagent was added to each well. The fluorescence intensity (FL) of Triton LNP(-) and Triton LNP(+) was measured with wavelength bandwidth (exitation: 485nm, emission: 528nm) in Infinite® 200 PRO NanoQuant (Tecan), and drug encapsulation rate (encapsulation efficiency, %) ) was calculated as in Equation 3 below. The drug encapsulation rate (%) for each LNP is shown in Table 6 below as an average value of the results measured repeatedly twice.

(Equation 3)

Drug encapsulation rate (%)=(fluorescence of Triton LNP(+) - fluorescence of Triton LNP(-))/(fluorescence of Triton LNP(+)) X 100

Lipid nanoparticles encapsulation rate
(Encapsulation efficiency, %) 241-C10 LNP 84 242-C10 LNP 83 243-C10 LNP 91 244-C10 LNP 87 245-C10 LNP 91 246-C10 LNP 94

As can be seen in Table 6, it was confirmed that the lipid nanoparticles according to an example can encapsulate drugs with high efficiency.

Example 5. Confirmation of intracellular nucleic acid delivery using lipid nanoparticles

Example 5-1. Nucleic acid delivery effect according to the type of ionizable lipid included in LNP

One day before LNP transfection into cells according to an example, HeLa cells (Korea Cell Line Bank) were aliquoted in a white plate (96well) at 0.01x10 ⁶ cells/well in DMEM media (SH30022, Hyclone, USA). Incubated at 37° C., 0.5-3% CO ₂ conditions. LNP prepared in Example 2-2, in which mRNA (luc mRNA; SEQ ID NO: 1) encoding the luciferase gene was encapsulated (241-C10 LNP to 246-C10 LNP containing 1.5 mol% of lipid-PEG) ) was stirred with ApoE3 0.1 μg/ml and pipetting, incubated at room temperature for 10 minutes, and then treated with HeLa cells (100 ng/well based on mRNA contained in lipid nanoparticles). ApoE3 binds to the LNP surface and plays a role in allowing LNP to enter the cell through endocytosis through the LDL receptor expressed on the cell surface.

After 24 hours, 100 μl/well of Bright-Glo™ Luciferase Assay solution (promega, USA) was treated and left at room temperature for 10 minutes. intensity) was measured, and the results are shown in FIG. 4a. As shown in FIG. 4A , 244-C10 LNPs, 245-C10 LNPs, and 246-C10 LNPs with a pKa range of 6.0 to 7.0 showed strong luminescence intensity, and among them, 246-C10 LNP showed luminescence intensity. The highest, it was found that 246-C10 LNP had the highest intracellular drug delivery efficiency.

Example 5-2. Confirmation of nucleic acid delivery in cancer cells

Lipid nanoparticles were prepared in the same manner as in Example 2-2 by changing the content of lipid-PEG to 1.5 to 10.0 mol% by including C16 PEG-ceramide or PEG-DSPE in the lipid nanoparticles.

The weight ratio of ionizable lipid: siRNA contained in lipid nanoparticles was 7.5: 1, and ionizable lipid (246-C10): phospholipid (DSPC): cholesterol: lipid-PEG (C16-PEG2000 ceramide or PEG contained in LNP) The molar ratio of -DSPE was 42.5: 13: 39.5 to 43: 1.5 to 5.0 (the cholesterol and lipid-PEG content were adjusted so that the sum of the molar ratios was 100).

One day before LNP transfection into cells according to an example, HeLa cells (Korea Cell Line Bank) were aliquoted in a white plate (96well) at 0.01x10 ⁶ cells/well in DMEM media (SH30022, Hyclone, USA). Incubated at 37° C., 0.5-3% CO ₂ conditions. After 24 hours of treatment with siLuc (SEQ ID NOs: 2 and 3) encapsulated lipid nanoparticles in the HeLa-Luc cell line at an siRNA concentration of 10 nM, 100 μl/well of Bright-Glo™ Luciferase Assay solution (promega, USA) was treated for 10 After standing at room temperature for a minute, the lysed cells were measured for luminescence intensity using an Infinite M200 luminescence measuring instrument (Tecan, USA), and the results are shown in FIG. 4B. The sequence of the used siLuc (siRNA targeting the luciferase gene) is shown in Table 3 above.

As shown in FIG. 4B , the lipid nanoparticles according to one example had excellent nucleic acid delivery effect to Hela-Luc cells, which are cancer cells.

Example 5-3. Pharmacokinetic Analysis

Anti-HPV16 E6/E7 siRNA (SEQ ID NOs: 6 and 7; Table 3) encapsulated lipid with a content of lipid-PEG contained in the lipid nanoparticles of 1.5 to 5.0 mol% as in the method of Example 2-2 Nanoparticles were prepared. The weight ratio of ionizable lipid: siRNA contained in the lipid nanoparticles was 7.5: 1, and the ionizable lipid (246-C10): phospholipid (DSPC): cholesterol: lipid-PEG (C16-PEG2000 ceramide) contained in the LNP was The molar ratio was 42.5:13:39.5 to 43:1.5 to 5.0. The diameter and PDI of the lipid nanoparticles prepared above were measured in the same manner as in Example 4-1, and are shown in Table 7 below.

Lipid-PEG (mol%) Average diameter (nm) PDI 5.0 67.4 0.312 1.5 122.9 0.214

Anti-HPV16 E6/E7 siRNA-encapsulated lipid nanoparticles 2 mg/kg drug was injected into the femoral vein of Sprague-Dawley rats (7-8 weeks old, male), and then blood for 0.5 minutes to 24 hours. was collected and immediately centrifuged at 13,000 rpm and 4°C for 5 minutes, plasma was secured and stored in a -70°C deep freezer. Anti-HPV16 E6/E7 siRNA was identified in plasma using the stem-loop RT-qPCR detection method from the obtained plasma. When the real-time PCR technique was applied using the siRNA standard sample by selecting the siRNA-specific Stem-loop RT primer and probe, the result of linear analysis between the Cp values (y) for the siRNA standard sample, the slope average and the coefficient of determination R ² The stem-loop RT-qPCR detection method was performed by analyzing the regression between the siRNA standard sample and the Cp value. Table 8 shows the results of analyzing pharmacokinetic parameters using the WinNonlin program.

Naked 246C10 Lipid
(Lipid-PEG 5%) 246C10 Lipid
(Lipid-PEG 1.5%) T max (min) 1.000 1.000 30.000 C max (ng/mL) 146025.200 473280.700 289864.600 T 1/2 (min) 3.384 87.321 588.182 CL (mL/min/kg) 2.020 0.034 0.006

As shown in Table 8, LNPs encapsulated with siHPV16_E6/E7 have a higher peak blood concentration (Cmax) after drug administration, a longer drug elimination half-life (T1/2), and a longer drug clearance (CL) compared to naked siRNA. ), which is maintained for a long time in the body and the degree of drug loss is low, increasing in vivo stability.

Example 5-4. Confirmation of siRNA-LNPs migration into cancer tissue

Lipid nanoparticles (246-C10 LNPs) encapsulated with Cy5.5 labeled siGFP (SEQ ID NOs: 4 and 5; Table 3) were prepared at 5.0 mol% of the lipid-PEG contained in the lipid nanoparticles. The weight ratio of ionizable lipid: siRNA contained in the lipid nanoparticles was 7.5: 1, and the ionizable lipid (246-C10): phospholipid (DSPC): cholesterol: lipid-PEG (C16-PEG2000 ceramide) contained in the LNP was The molar ratio was 42.5:13:39.5:5.0. The diameter and PDI of the lipid nanoparticles prepared above were measured in the same manner as in Example 4-1, and are shown in Table 9 below.

Lipid-PEG (%) Average diameter (nm) PDI 5.0 30 0.142

C57BL/6 female 7-week-old 20g mice were subcutaneously inoculated with 5x10 ⁶ HeLa cells. Tumor volume and body weight of mice were monitored twice a week. Tumor size was measured using digital calipers. Tumor volume was calculated using V = 0.5 x W ² x L (V = tumor volume, W = tumor width, L = tumor length). When the tumor size reached 100mm ³ , lipid nanoparticles were injected into mice, and the biodistribution was confirmed by IVIS 48 hours after injection. Fluorescence was measured in cancer tissue, liver, and kidney, and the results are shown in FIG. 5A. As shown in FIG. 5a , it was confirmed that when the lipid nanoparticles according to an example were administered, the transition to cancer tissues was excellent.

Example 5-5. Confirmation of in vivo siRNA delivery and gene regulation in Xenograft tumor mouse model

As confirmed in Example 5-2, the in vivo drug delivery efficiency and biodistribution of 246-C10 LNP, which exhibits excellent gene expression effect (gene transfer effect) in vitro, was to be confirmed in this Example.

siLuc (SEQ ID NOs: 2 and 3; Table 3) was prepared as 246-C10 LNP (with 1.5 mol% of lipid-PEG) according to the method of Example 5-4, and each nanoparticles were dialyzed in PBS for 16 hours. Ethanol was removed. C57BL/6 Female 7-week-old mice (Orient Bio) 20 g mice were subcutaneously inoculated with 5x10 ⁶ HeLa-Luc cancer cells. Tumor volume and body weight of mice were monitored twice a week. Tumor size was measured using digital calipers. Tumor volume was calculated using V = 0.5 x W ² x L (V = tumor volume, W = tumor width, L = tumor length). When the tumor size reached 100 mm ³ , siLuc lipid nanoparticles and negative control siRNA were injected into mice, and the bioluminescence intensity was shown in FIG. 5B using IVIS (PerkinElmer, USA) equipment 48 hours after injection. As shown in FIG. 5B , it was confirmed that the group administered with the complementary siLuc lipid nanoparticles in vivo of HeLa-Luc xenograft mice had a decrease in luminescence intensity than the group administered with the negative control siRNA lipid nanoparticles. Through this, it was confirmed that the delivery and preservation power of the lipid nanoparticles according to one example were excellent.

siLuc (SEQ ID NOs: 2 and 3; Table 3) was prepared as 246-C10 LNP (with 1.5 mol% of lipid-PEG) according to the method of Example 5-4, and each nanoparticle was dialyzed in PBS for 16 hours. Ethanol was removed. A Xenograft mouse model was manufactured in the same manner as in FIG. 5B, and the bioluminescence intensity according to the injection method was measured.

siLuc After 3 hours after injecting this encapsulated lipid nanoparticle by intravenous (IV (intravenous) injection) or intratumoral (IT (intratumoral)) method, bioluminescence was checked through IVIS (PerkinElmer, USA) equipment. , the results are shown in Figure 5c. As shown in 5c, the bioluminescence according to the injection method in which the lipid nanoparticles containing siLuc was administered was indicated in a diagram, and it was confirmed that both the intravenous injection and the intratumoral injection method decreased the luminescence intensity.

Example 6. Confirmation of cancer treatment effect using Anti-HPV16 E6/E7 siRNA

Example 6-1. Preparation of lipid nanoparticles encapsulating siRNA targeting HPV16 E6/E7 gene

Similar to the method of Example 2-2, 246-C10 lipid nanoparticles (including 1.5 mol% of lipid-PEG) encapsulated with siRNA (SEQ ID NOs: 6 and 7; Table 3) targeting the E6/E7 gene of HPV16 was prepared.

Example 6-2. Measurement of cancer cell killing effect

In order to measure the apoptosis effect of cancer cells, UM-SCC-47 (Meark Cat No. SCC071) cells, a head and neck squamous carcinoma (HNSCC) cell line, and Ca Ski (ATCC Cat No. CRL-1550) cell line was transfected with the LNP containing the Anti-HPV16 E6/E7 siRNA prepared in Example 6-1.

The head and neck squamous cell carcinoma cell line, UM-SCC-47, was cultured in DMEM medium (Hyclone's Cat: SH30243.01) containing 10% fetal bovine serum and antibiotics at 37° C., 5% CO ₂ and 100% humidity. Ca Ski, a cervical cancer cell line, was cultured in RPMI (Hyclone's Cat: SH30027.01) medium containing 10% fetal bovine serum and antibiotics at 37° C., 5% CO ₂ and 100% humidity.

24 hours before transfection, 1x10 ⁵ cells were put in a 6 well plate and cultured, and then 246-C10 LNP (containing 1.5 mol% of lipid-PEG) encapsulated with Anti HPV16 E6/E7 siRNA was added to the UM-SCC in the group administered alone and in the group administered in combination. -47 was treated at a concentration of 10 to 30 nM, and Ca Ski cells were treated at a concentration of 10 to 40 nM, and in the case of cisplatin (CDDP), 1 to 5 uM in UM-SCC-47 and 1 to 5 uM in Ca Ski in the single and combined administration groups It was treated at a concentration of 5-10uM, and after binding with 1.5ug/ml of Apoe4 for 15 minutes at room temperature, it was treated in a 6-well plate. After 48 hours after transfection, the degree of trypan blue staining in the cells was checked under a phase-contrast microscope using a hemocytometer, and the cell viability was confirmed, and the results are shown in FIG. 6A.

As shown in FIG. 6a , according to an example, the cancer cell killing effect by the lipid nanoparticles encapsulated with siRNA was excellent, and the killing effect was further increased when combined with an anticancer agent (CDDP).

Example 6-3. mRNA expression measurement

In this example, to measure the drug (siRNA) delivery efficiency by the lipid nanoparticles according to an example, the mRNA expression of HPV 16 E6/E7 was measured, and the cancer prevention or treatment effect by the lipid nanoparticles according to the example was measured. To confirm, p21 mRNA expression was measured.

To measure mRNA expression, UM-SCC-47 (Meark Cat No. SCC071) cells, a head and neck squamous carcinoma (HNSCC) cell line, and Ca Ski (ATCC Cat No. CRL- 1550) was transfected with the LNP containing the Anti-HPV16 E6/E7 siRNA prepared in Example 6-1.The head and neck squamous cell line UM-SCC-47 and the cervical cancer cell line Ca Ski was cultured as in Example 6-2.

24 hours before transfection, 1x10 ⁵ cells were put in a 6 well plate and cultured, and then 246-C10 LNP (containing 1.5 mol% of lipid-PEG) encapsulated with Anti HPV16 E6/E7 siRNA was added to the UM-SCC in the group administered alone and in the group administered in combination. -47 was treated at a concentration of 10 to 30 nM, and was treated at a concentration of 10 to 40 nM in Ca Ski cells. In the case of cisplatin (CDDP), in UM-SCC-47 at a concentration of 1 to 5 uM and in Ca Ski at a concentration of 5 to 10 uM in the single administration group and in the combination administration group, after binding with Apoe4 1.5 ug/ml at room temperature for 15 minutes, 6 It was processed in a well plate.

After 48 hours after transfection, the cells were lysed and RNA was extracted using RiboEX ^TM (GeneAll, Cat no 301-001) according to the manufacturer's instructions, and HPV16 E6/E7 (Forward primer: SEQ ID NO: 8 / Reverse primer: sequence) No. 9/ Probe: UPL#63 (Roche)), P21 (Forward primer: SEQ ID NO: 10/ Reverse primer: SEQ ID NO: 11/ Probe: UPL#82 (Roche)), HPRT1 (Forward primer: SEQ ID NO: 12 / Reverse primer : SEQ ID NO: 13/Probe: Quantitative Real time-Polymerase chain Reaction (qRT-PCR) capable of confirming the mRNA expression level of UPL#73 (Roche)) was performed, and the result is shown in FIG. 6B . HPRT1 was used as a house keeping gene, and the primer sequences used are shown in Table 10 below.

primer Base sequence (5'->3') SEQ ID NO: HPV16_E6/E7 Forward CCACTGATCTCTACTGTTATGAGCAA SEQ ID NO: 8 Reverse CCAGCTGGACCATCTATTTCA SEQ ID NO: 9 P21 Forward CGAAGTCAGTTCCTTGTGGAG SEQ ID NO: 10 Reverse CATGGGTTCTGACGGACAT SEQ ID NO: 11 HPRT1 Forward TGACCTTGATTTATTTTGCATACC SEQ ID NO: 12 Reverse CGAGCAAGACGTTCAGTCCT SEQ ID NO: 13

As shown in Figure 6b, when the lipid nanoparticles encapsulated with Anti-HPV16 E6/E7 siRNA were treated, the mRNA expression of HPV16 E6/E7 was significantly reduced, and the expression of p21 mRNA, a subgene of the tumor suppressor gene p53, was significantly increased. In combination with chemotherapy (Cisplatin, CDDP), the mRNA expression of HPV16 E6/E7 and the increase of p21 mRNA expression were further increased.

Example 6-4. Protein expression measurement

In this example, p21 and p53 protein expression was measured in order to confirm the cancer prevention or treatment effect of the lipid nanoparticles according to an embodiment.

To measure the protein expression level, UM-SCC-47 (Meark Cat No. SCC071) cells, a head and neck squamous carcinoma carcinoma (HNSCC) cell line, and Ca Ski (ATCC Cat No. CRL-1550) cell line was transfected with the LNP containing the Anti-HPV16 E6/E7 siRNA prepared in Example 6-1. UM-SCC-47, a cell line for head and neck squamous cell carcinoma, and Ca Ski, a cell line for cervical cancer, were cultured as in Example 6-2.

24 hours before transfection, 1x10 ⁵ cells were placed in a 6 well plate and cultured. Then, 246-C10 LNP (containing 1.5 mol% of lipid-PEG) encapsulated with Anti HPV16 E6/E7 siRNA was added to the UM-SCC- It was treated at a concentration of 10 to 30 nM at 47, and was treated at a concentration of 10 to 40 nM in Ca Ski cells. In the case of cisplatin (CDDP), in UM-SCC-47 at a concentration of 1 to 5 uM and in Ca Ski at a concentration of 5 to 10 uM in the single administration group and in the combination administration group, after binding with Apoe4 1.5 ug/ml at room temperature for 15 minutes, 6 It was processed in a well plate.

48 hours after transfection, expression levels of p21, p53, and b-actin, a house keeping protein, were measured using a Western blot analysis method. RIPA cell lysis buffer (RIPA Cell lysis buffer: 150 mM NaCl, 10 mM Tris-HCl (Ph7.4), 5 mM EDTA, 0.1% SDS, 0.5% deoxycholate, and 1% NP-40) was added to dissolve the protein. Western blotting was performed with the same amount of protein through BCA assay that can quantify the amount. The primary antibody Anti-P21 (Santacruz Cat no. SC-817) was diluted 1:2000, and Anti-p53 (Santacruz Cat no. SC-47698) was used diluted 1:2000, and Anti-B -actin (Santacruz Cat no. SC-47778) was used diluted 1:3000. As the secondary antibody, an antibody bound to IgG-Mouse-HRP was diluted 1:5000, and the results are shown in FIG. 6c .

As shown in FIG. 6c , when lipid nanoparticles encapsulated with Anti-HPV16 E6/E7 siRNA were treated alone or in combination with an anticancer agent (CDDP), p21 and p53 protein expression was significantly increased.

Example 7. Confirmation of cancer treatment effect using PMVK siRNA

Example 7-1. Preparation of lipid nanoparticles encapsulating siRNA targeting PMVK

Similar to the method of Example 2-2, 246-C10 lipid nanoparticles (containing 1.5 mol% of lipid-PEG) encapsulated with PMVK-targeting siRNA (SEQ ID NOs: 14 and 15; Table 3) were prepared.

Example 7-2. Measurement of cancer cell killing effect

In order to measure the apoptosis effect of cancer cells, the pancreatic cancer cell line Miapaca-2 (ATCC Cat.no CL-1420), the lung cancer cell line A549 (ATCC Cat.no CCL-185), and the breast cancer cell line MCF-7 (ATCC Cat.no HTB- 22), and a cervical cancer cell line, Hela (ATCC Cat.no CCL-2) cell line, was transfected with the LNP containing the Anti-PMVK siRNA prepared in Example 7-1.

Pancreatic cancer cell line Miapaca-2 and cervical cancer cell line Hela were cultured in DMEM medium (Hyclone's Cat: SH30243.01) containing 10% fetal bovine serum and antibiotics at 37°C, 5% CO ₂ and 100% humidity. .

Lung cancer cell line A549 and breast cancer cell line MCF-7 were cultured in RPMI (Hyclone's Cat: SH30027.01) medium containing 10% fetal bovine serum and antibiotics at 37° C., 5% CO ₂ and 100% humidity conditions.

24 hours before transfection, 0.5 to 1x10 ⁵ cells were placed in a 6 well plate and cultured, and then 246-C10 LNP (containing 1.5 mol% of lipid-PEG) encapsulated with anti PMVK siRNA was administered at a concentration of 20 to 40 nM in the group administered alone and in combination. In the case of cisplatin ((CDDP) Sigma, Cat no. P4394), it was treated at a concentration of 1 to 5 uM in the single administration group and the combined administration group, and 1.5 ug/ml of Apoe4 was bound at room temperature for 15 minutes, and then treated in a 6 well plate. did After 48 hours after transfection, the degree of trypan blue staining in the cells was checked under a phase-contrast microscope using a hemocytometer, and the cell viability was confirmed, and the results are shown in FIG. 7A.

As shown in FIG. 7a , the cancer cell killing effect by siRNA was increased by the drug-encapsulated lipid nanoparticles according to an example.

Example 7-3. mRNA expression measurement

In this Example, in order to measure the drug (siRNA) delivery efficiency by the lipid nanoparticles according to an example, PMVK mRNA expression was measured in lung cancer, pancreatic cancer, breast cancer, and cervical cancer cells.

In order to measure the mRNA expression level, the pancreatic cancer cell line Miapaca-2 (ATCC Cat.no CL-1420), the lung cancer cell line A549 (ATCC Cat.no CCL-185), and the breast cancer cell line MCF-7 (ATCC Cat.no HTB- 22), and a cervical cancer cell line, Hela (ATCC Cat.no CCL-2) cell line, was transfected with the LNP containing the Anti-PMVK siRNA prepared in Example 7-1. Pancreatic cancer cell line Miapaca-2, cervical cancer cell line Hela, lung cancer cell line A549, and breast cancer cell line MCF-7 were cultured as in Example 7-2.

24 hours before transfection, 0.5 to 1 x 10 ⁵ cells were put in a 6 well plate and cultured, and then 246-C10 LNP (containing 1.5 mol% of lipid-PEG) containing anti-PMVK siRNA was administered at 20-40 nM in the group administered alone and in combination. In the case of cisplatin ((CDDP) Sigma, Cat no. P4394), it was treated at a concentration of 1 to 5 uM in the single administration group and the combined administration group, and after binding Apoe4 1.5ug/ml at room temperature for 15 minutes, 6 well plate was processed in After 48 hours after transfection, cells were lysed and RNA was extracted using RiboEX ^TM (GeneAll, Cat no 301-001) according to the manufacturer's instructions, and PMVK (Forward: SEQ ID NO: 16 /Reverse: SEQ ID NO: 17 /Probe: UPL#49 (Roche)), B-ACTIN (Forward: SEQ ID NO: 18 / Reverse: SEQ ID NO: 19 /Probe: Quantitative Real time-Polymerase chain Reaction ( qRT-PCR) was performed and the results are shown in FIG. 7b. B-ACTIN was used as a house keeping gene, and the primer sequences used are shown in Table 11 below.

primer Base sequence (5'->3') SEQ ID NO: PMVK Forward ATATCCCCAGTGCCAGTCC SEQ ID NO: 16 Reverse AACAAGGGGCTGAGAACATC SEQ ID NO: 17 B-ACTIN Forward CCAACCGCGAGAAGATGA SEQ ID NO: 18 Reverse CCAGAGGCGTACAGGGATAG SEQ ID NO: 19

As shown in FIG. 7b , when lipid nanoparticles encapsulated with PMVK siRNA were treated in cancer cells, the mRNA expression of PMVK was significantly reduced.

Example 7-4. Protein expression measurement

In this example, to measure the drug (siRNA) delivery efficiency by the lipid nanoparticles according to an example, the protein expression of PMVK was measured in lung cancer, pancreatic cancer, breast cancer, and cervical cancer cells.

In order to measure the protein expression level, the pancreatic cancer cell line Miapaca-2 (ATCC Cat.no CL-1420), the lung cancer cell line A549 (ATCC Cat.no CCL-185), and the breast cancer cell line MCF-7 (ATCC Cat.no HTB- 22), and a cervical cancer cell line Hela (ATCC Cat.no CCL-2) cell line was transfected with the LNP encapsulated in the Anti-PMVK siRNA prepared in Example 7-1. Pancreatic cancer cell line Miapaca-2, cervical cancer cell line Hela, lung cancer cell line A549, and breast cancer cell line MCF-7 were cultured as in Example 7-2.

24 hours before transfection, 0.5 to 1 x 10 ⁵ cells were put in a 6 well plate and cultured, and then 246-C10 LNP (containing 1.5 mol% of lipid-PEG) containing anti-PMVK siRNA was administered at 20-40 nM in the group administered alone and in combination. In the case of cisplatin ((CDDP) Sigma, Cat no. P4394), it was treated at a concentration of 1 to 5 uM in the single administration group and the combined administration group, and after binding Apoe4 1.5ug/ml at room temperature for 15 minutes, 6 well plate was processed in After 48 hours of transfection, PMVK expression levels were measured using a Western blot analysis method. RIPA cell lysis buffer (RIPA cell lysis buffer: 150 mM NaCl, 10 mM Tris-HCl (pH 7.4), 5 mM EDTA, 0.1% SDS, 0.5% deoxycholate and 1% NP-40) was added and lysed, and the protein was Western blotting was performed with the same amount of protein through BCA assay that can quantify the amount. The primary antibody Anti-PMVK (Atlas antibody Cat no. HPA029900) was diluted 1:2000 and used. As the secondary antibody, the IgG-Mouse-HRP-conjugated antibody was diluted 1:5000 and the results are shown in FIG. 7c.

As shown in FIG. 7c , when cancer cells were treated with anti-PMVK siRNA-encapsulated lipid nanoparticles, PMVK protein expression was significantly reduced.

Example 7-5. Measurement of survival rate by radiation sensitivity during PMVK knock-down in cancer cell lines

In this example, in order to measure the drug (siRNA) delivery efficiency by the lipid nanoparticles according to an example, the cell viability was measured when PMVK, known as a radiotherapy resistance-related factor, is knocked down in lung cancer, pancreatic cancer, and cervical cancer cells.

In order to measure the cell viability, the pancreatic cancer cell line Miapaca-2 (ATCC Cat.no CL-1420), the lung cancer cell line A549 (ATCC Cat.no CCL-185), the cervical cancer cell line Hela (ATCC Cat.no CCL-2) and In Ca Ski (ATCC Cat.no CRL-1550) cell line, 246-C10 lipid nanoparticles ( Lipid-PEG containing 1 mol%) was prepared and transfected. Pancreatic cancer cell line Miapaca-2, cervical cancer cell line Hela, Ca Ski, and lung cancer cell line A549 were cultured as in Example 7-2.

24 hours before transfection, Miapaca-2, A549, HeLa, Ca Ski cells were seeded in a 96-well plate with 0.3 × 10 ⁴ cells and cultured for 24 hours. The cultured cells were transfected with 246-C10 lipid nanoparticles (containing 1 mol% of lipid-PEG) containing the Anti-PMVK siRNA prepared in Example 7-5. In addition, 10 Gy of radiation was processed using a 6-MV photon beam linear accelerator. Cell viability was confirmed by CCK-8 assay on the second day after radiation treatment. The results are shown in Figure 7d.

As shown in FIG. 7D , when cancer cells were treated with anti-PMVK siRNA-encapsulated 246-C10 lipid nanoparticles and radiation, apoptosis was significantly increased.

Example 7-6. Measurement of protein expression by radiation sensitivity during knock-down by PMVK nanoparticles in cancer cell lines

In this example, in order to measure the drug (siRNA) delivery efficiency by the lipid nanoparticles according to an example, protein expression was measured when PMVK, known as a radiation therapy resistance-related factor, was knocked down in lung cancer, pancreatic cancer, and cervical cancer cells.

To measure protein expression, the pancreatic cancer cell line Miapaca-2 (ATCC Cat.no CL-1420), the lung cancer cell line A549 (ATCC Cat.no CCL-185), the cervical cancer cell line Hela (ATCC Cat.no CCL-2) and The LNP containing the Anti-PMVK siRNA prepared in Example 7-5 was transfected into Ca Ski (ATCC Cat.no CRL-1550) cell line. Pancreatic cancer cell line Miapaca-2, cervical cancer cell line Hela, Ca Ski, and lung cancer cell line A549 were cultured as in Example 7-2.

24 hours before transfection, Miapaca-2, A549, HeLa, Ca Ski cells were seeded in a 6-well plate with 1.0 × 10 ⁵ cells and cultured for 24 hours. The cultured cells were transfected with 246-C10 LNP (containing 1.0 mol% of lipid-PEG) containing the Anti-PMVK siRNA prepared in Example 7-5. In addition, 10 Gy of radiation was processed using a 6-MV photon beam linear accelerator. After the protein was extracted on the second day after radiation treatment, the expression of the protein was confirmed by performing Western blotting using the PMVK antibody. The results are shown in Figure 7e.

As shown in FIG. 7e , when cancer cells were treated with 246-C10 lipid nanoparticles encapsulated with Anti-PMVK siRNA and radiation, it was confirmed that the protein expression by PMVK siRNA was reduced.

Example 7-7. Confirmation of in vivo siRNA delivery and gene regulation by nanoparticles containing siRNA in a Xenograft tumor mouse model

In this Example, in order to measure the drug (siRNA) delivery efficiency by the lipid nanoparticles according to an example, the tumor size change was measured when PMVK, known as a radiation therapy resistance-related factor, was knocked down in lung cancer and pancreatic cancer Xenograft mouse models.

BALB/c male 5-week-old nude mouse (Orient Bio) 20g 3x10 ⁶ Miapaca-2 cancer cells (ATCC, Cat. No. CRL-1420) and 1x10 ⁶ A549 cancer cells (ATCC, Cat. No. CCL-) on the right thigh of the mouse 185) was inoculated subcutaneously. Mouse tumor volume and body weight were monitored 3 times a week. Tumor size was measured using digital calipers. Tumor volume was calculated using V = 0.5 x W ² x L (V = tumor volume, W = tumor width, L = tumor length). Similar to the method of Example 7-5, 246-C10 lipid nanoparticles (containing 1 mol% of lipid-PEG) encapsulated with siRNA (SEQ ID NOs: 14 and 15; Table 3) targeting the PMVK gene were prepared. When the tumor size reached 100mm ³ ± 20, PMVK-encapsulated 246-C10 lipid nanoparticles and Vehicle LNP were administered IV (Intravenous) in Miapaca-2 Xenograft nude mice at QD x 3 3mg/ kg and treated with 4 Gy of radiation using a 6-MV photon beam linear accelerator once a week after nanoparticle injection. The results are shown in 7f.

Similar to the method of Example 7-5, 246-C10 lipid nanoparticles (containing 1 mol% of lipid-PEG) encapsulated with siRNA (SEQ ID NOs: 14 and 15; Table 3) targeting the PMVK gene were prepared. When the tumor size reached 100mm ³ ± 20, PMVK-encapsulated LNP and Vehicle LNP were injected IV (Intravenous) in A549 Xenograft nude mice in the first week and QD x 3 in the third week at 3 mg/kg, and also After nanoparticle injection, 2 Gy of radiation was treated using a 6-MV photon beam linear accelerator once a week. The results are shown in FIG. 7G. As shown in FIGS. 7f and 7g , it was confirmed that the decrease in PMVK gene expression in a mouse model administered with 246-C10 lipid nanoparticles containing Anti-PMKV siRNA was further reduced when treated with radiation.

<110> EnhancedBio Inc. <120> Composition for preventing or treating cancer containing lipid nanoparticles <130> DPP20215265KR <150> KR 10-2020-0183898 <151> 2020-12-24 <160> 19 <170> KoPatentIn 3.0 <210> 1 <211> 1653 <212> DNA <213> Artificial Sequence <220> <223> luciferase mRNA <400> 1 auggaagacg ccaaaaacau aaagaaaggc ccggcgccau ucuauccgcu ggaagaugga 60 accgcuggag agcaacugca uaaggcuaug aagagauacg cccugguucc uggaacaauu 120 gcuuuuacag augcacauau cgagguggac aucacuuacg cugaguacuu cgaaaugucc 180 guucgguugg cagaagcuau gaaacgauau gggcugaaua caaaucacag aaucgucgua 240 ugcagugaaa acucucuuca auucuuuaug ccgguguugg gcgcguuauu uaucggaguu 300 gcaguugcgc ccgcgaacga cauuuauaau gaacgugaau ugcucaacag uaugggcauu 360 ucgcagccua ccgugguguu cguuuccaaa aagggguugc aaaaaauuuu gaacgugcaa 420 aaaaagcucc caaucaucca aaaaauuauu aucauggauu cuaaaacgga uuaccaggga 480 uuucagucga uguacacguu cgucacaucu caucuaccuc ccgguuuuaa ugaauacgau 540 uuugugccag aguccuucga uagggacaag acaauugcac ugaucaugaa cuccucugga 600 ucuacugguc ugccuaaagg ugucgcucug ccucauagaa cugccugcgu gagauucucg 660 caugccagag auccuauuuu uggcaaucaa aucauuccgg auacugcgau uuuaaguguu 720 guuccauucc aucacgguuu uggaauguuu acuacacucg gauauuugau auguggauuu 780 cgagucgucu uaauguauag auuugaagaa gagcuguuuc ugaggagccu ucaggauuac 840 aagauucaaa gugcgcugcu ggugccaacc cuauucuccu ucuucgccaa aagcacucug 900 auugacaaau acgauuuauc uaauuuacac gaaauugcuu cugguggcgc uccccucucu 960 aaggaagucg gggaagcggu ugccaagagg uuccaucugc cagguaucag gcaaggauau 1020 gggcucacug agacuacauc agcuauucug auuacacccg agggggauga uaaaccgggc 1080 gcggucggua aaguuguucc auuuuuugaa gcgaagguug uggaucugga uaccgggaaa 1140 acgcugggcg uuaaucaaag aggcgaacug ugugugagag guccuaugau uauguccggu 1200 uauguaaaca auccggaagc gaccaacgcc uugauugaca aggauggaug gcuacauucu 1260 ggagacauag cuuacuggga cgaagacgaa cacuucuuca ucguugaccg ccugaagucu 1320 cugauuaagu acaaaggcua ucagguggcu cccgcugaau uggaauccau cuugcuccaa 1380 caccccaaca ucuucgacgc aggugucgca ggucuucccg acgaugacgc cggugaacuu 1440 cccgccgccg uuguuguuuu ggagcacgga aagacgauga cggaaaaaga gaucguggau 1500 uacgucgcca gucaaguaac aaccgcgaaa aaguugcgcg gaggaguugu guuuguggac 1560 gaaguaccga aaggucuuac cggaaaacuc gacgcaagaa aaaucagaga gauccucaua 1620 aaggccaaga agggcggaaa gaucgccgug uaa 1653 <210> 2 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> siLuc_sense <220> <221> misc_feature <222> (20)..(21) <223> deoxyribonucleotides <400> 2 aacgcugggc guuaaucaat t 21 <210> 3 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> siLuc_antisense <220> <221> misc_feature <222> (20)..(21) <223> deoxyribonucleotides <400> 3 uugauuaacg cccagcguut t 21 <210> 4 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Cy5.5 labeled siGFP_sense <220> <221> misc_feature <222> (20)..(21) <223> deoxyribonucleotides <400> 4 acaugaagca gcacgacuut t 21 <210> 5 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Cy5.5 labeled siGFP_antisense <220> <221> misc_feature <222> (20)..(21) <223> deoxyribonucleotides <400> 5 aagucgugcu gcuucaugut t 21 <210> 6 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Anti-HPV16 E6/E7_sense <400> 6 gaccggucga uguaugucuu g 21 <210> 7 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Anti-HPV16 E6/E7_antisense <400> 7 agacauacau cgaccggucc a 21 <210> 8 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> HPV16 E6/E7_Forward_primer <400> 8 ccactgatct ctactgttat gagcaa 26 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> HPV16 E6/E7_Reverse_primer <400> 9 ccagctggac catctatttc a 21 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> P21_Forward_primer <400> 10 cgaagtcagt tccttgtgga g 21 <210> 11 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> P21_Reverse_primer <400> 11 catgggttct gacggacat 19 <210> 12 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> HPRT1_Forward_primer <400> 12 tgaccttgat ttattttgca tacc 24 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Anti-PMVK_sense <400> 13 cgagcaagac gttcagtcct 20 <210> 14 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Anti-PMVK_sense <220> <221> misc_feature <222> (20)..(21) <223> deoxyribonucleotides <400> 14 uggacgaugc ugagucagat t 21 <210> 15 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Anti-PMVK_antisense <220> <221> misc_feature <222> (20)..(21) <223> deoxyribonucleotides <400> 15 ucugacucag caucguccat t 21 <210> 16 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> PMVK_Forward_primer <400> 16 atatccccag tgccagtcc 19 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PMVK_Reverse_primer <400> 17 aacaaggggc tgagaacatc 20 <210> 18 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> B-ACTIN_Forward_primer <400> 18 ccaaccgcga gaagatga 18 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> B-ACTIN _Reverse_primer <400> 19 ccagaggcgt acagggatag 20

Claims (16)

(1) 1,4-bis (3-aminopropyl) piperazine (1,4-bis (3-aminopropyl) piperazine) and an alkyl-epoxide bonded ionizable lipid (ionizable lipid); phospholipids; cholesterol; And lipid-lipid nanoparticles comprising a PEG (polyethyleneglycol) conjugate, and
(2) comprising a first anticancer agent,
The first anticancer agent is an anionic drug, a nucleic acid, or a combination thereof,
A pharmaceutical composition for preventing or treating cancer. The pharmaceutical composition according to claim 1, wherein the alkyl-epoxide is 1,2-epoxydodecane. According to claim 1, wherein the phospholipid is DOPE, DSPC, POPC, EPC, DOPC, DPPC, DOPG, DPPG, DSPE, Phosphatidylethanolamine, dipalmitoylphosphatidylethanolamine, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine, POPE, POPC, DOPS , And 1,2-dioleoyl-sn-glycero-3-[phospho-L-serine] at least one selected from the group consisting of, a pharmaceutical composition. According to claim 1, wherein the lipid in the PEG conjugate is ceramide (ceramide), dimyristoylglycerol (DMG), succinoyl-diacylglycerol (succinoyl-diacylglycerol, s-DAG), distearoylphosphatidylcholine ( distearoylphosphatidylcholine, DSPC), distearoylphosphatidylethanolamine (distearoylphosphatidylethanolamine, DSPE), and at least one selected from the group consisting of cholesterol, a pharmaceutical composition. The pharmaceutical composition according to claim 1, comprising 0.25 to 10 mol% of the lipid-PEG conjugate. The pharmaceutical composition according to claim 1, wherein the lipid nanoparticles contain ionizable lipids: phospholipids: cholesterol: lipid-PEG conjugates in a molar ratio of 20 to 50: 10 to 30: 10 to 60: 0.25 to 10. The pharmaceutical composition of claim 1, wherein the lipid nanoparticles have a pKa of 6.0 to 7.0. According to claim 1, wherein the first anticancer agent is encapsulated inside the lipid nanoparticles, the pharmaceutical composition. The pharmaceutical composition according to claim 1, wherein the lipid nanoparticles have an average diameter of 30 nm to 150 nm. The pharmaceutical composition according to claim 1, wherein the anionic drug is at least one selected from the group consisting of a peptide, a protein drug, a protein-nucleic acid construct, and an anionic biopolymer-drug conjugate. According to claim 1, wherein the nucleic acid is small interfering ribonucleic acid (siRNA), ribosomal ribonucleic acid (rRNA), ribonucleic acid (RNA), deoxyribonucleic acid (DNA), complementary deoxyribonucleic acid (cDNA), aptamer (aptamer), messenger Ribonucleic acid (mRNA), transport ribonucleic acid (tRNA), antisense oligonucleotide, shRNA, miRNA, ribozyme (ribozyme), PNA, and at least one selected from the group consisting of DNAzyme, a pharmaceutical composition. The pharmaceutical composition according to claim 1, wherein the cancer is cancer caused by human papilloma virus (HPV) infection. According to claim 1, wherein the cancer is cervical cancer, endometrial cancer, vaginal cancer (vagina cancer), vulva cancer (vulvacancer), anal cancer (anal cancer), penis cancer (penis cancer), tonsil cancer (tonsil cancer), pharynx cancer, larynx cancer, head and neck cancer, squamous cell head and neck cancer, lung adenocarcinoma, non-small cell lung cancer, squamous cell carcinoma of the lung, lung cancer, stomach cancer, sarcoma, lymphoma, Hodgkin's lymphoma, Chronic or acute leukemia, thymus cancer, epithelial cancer, salivary gland cancer, liver cancer, gastric cancer, thyroid cancer, parathyroid cancer, ovarian cancer, breast cancer, prostate cancer, esophageal cancer, pancreatic cancer, glioma, multiple myeloma, renal cell carcinoma, bladder cancer, choriocarcinoma, colon cancer , oral cancer, skin cancer, melanoma, bone cancer, rectal cancer, small intestine cancer, endocrine adenocarcinoma, adrenal cancer, soft tissue sarcoma, urethral cancer, spinal cord tumor, brainstem glioma, and a pharmaceutical composition that is selected from the group consisting of pituitary adenoma. A pharmaceutical composition for cancer treatment for use in combination with radiation therapy, comprising the pharmaceutical composition according to any one of claims 1 to 13. A pharmaceutical composition for combined administration of an anticancer agent, further comprising the pharmaceutical composition according to any one of claims 1 to 13 and a second anticancer agent. The pharmaceutical composition for combined administration of an anticancer agent according to claim 15, wherein the second anticancer agent is at least one selected from the group consisting of cisplatin, paclitaxel, docetaxel, gemcitabine, doxorubicin, fluorouracil, and carboplatin.

Images