WO2020046217A1

WO2020046217A1 - A nucleic acid construct for inhibiting the house dust mite allergic response

Info

Publication number: WO2020046217A1
Application number: PCT/TH2018/000036
Authority: WO
Inventors: Alain Jacquet; Kiat RUXRUNGTHAM; Patrawadee PITAKPOLRAT
Original assignee: Chulalongkorn University
Priority date: 2018-08-28
Filing date: 2018-08-28
Publication date: 2020-03-05

Abstract

A polynucleotide construct that comprises an isolated polynucleotide encoding Der p 2 polypeptide, a CpG motif sequence and a leader sequence wherein the construct is pHis.LeaderDer p 2 vector.

Description

A NUCLEIC ACID CONSTRUCT FOR INHIBITING THE HOUSE DUST MITE

ALLERGIC RESPONSE

FIELD OF THE INVENTION

[oooii The present invention generally relates to a nucleic acid construct and. method that inhibits the house dust mite (HDM) allergic response, more particularly to inhibition of tire specific Ig£ responses initiated by allergen Der p 2 which is one of the most important HDM allergen.

SEQUENCE LISTING

[0002] This document incorporates by reference herein an electronic sequence listing text file, which is submitted via. CD-R in lieu of a printed paper copy. The text file is named “Sequence Listing-CHU-P004 WO_ST25.txt” is 10,725 bytes and was created on 28 August 201 8.

BACKGROUND ART

[0003] Allergies or allergic diseases are conditions that are commonly caused by hypersensitivity of the immune system to some particular allergens found in the environment. House dust mites (HDM, mainly from the Dermatophagoides species) represent one of the most important allergenic sources worldwide. Sensitizations to HDM allergens trigger various allergic symptoms such as inflammation of skin and airway mucosa leading to certain allergic diseases like allergic rhino-conjunctivitis, allergic asthma, atopic eczema and other allergic skin diseases as atopic dermatitis.

[0004] The most important HDM allergens from the Dermatophagoides pteronyssinus mite species are Der p 1 and Der p 2. Notably, more than 80% of HDM allergic patients develop specific IgE to Der p 2. The basic pathogenesis of HDM allergy Is the development of allergen-specific CD4÷ Th2 cells and particularly Th2-associated cytokines/chemokines which induce the production of allergen-specific IgE antibodies together with the recruitment of inflammatory cells (mainly eosinophils) in the airways. Hence, there is a need to design therapeutic approaches for the treatment of HDM allergic diseases in order to shift the allergic immune responses from Th2- to non-ailergic Th! - type responses capable to prevent the IgE production by B cells through at least IFN gamma production and development of blocking IgG antibodies. [00051 Allergen-specific immunotherapy (SIT) is, up to now, the unique immune- modifying therapy capable to treat specifically HDM allergy. SIT induces immunological tolerance and specific Thl responses through repeated exposure to HDM extracts containing the whole allergens from mite. However, this treatment presents some disadvantages and is sometimes risky. Indeed, SIT involves long-time treatment consisting in regular subcutaneous or sublingual administration of allergen extracts using incremental regimes (50-80 injections) taking from 2 to 5 years. Anaphylactic side-effects, due to large doses of native allergens displaying IgE reactivity, can occur in 0.1-5% of individuals.

[0006] Pulsawat et al. (2013) disclosed knowledge concerning HDM-specific DNA vaccine encoding Der p 2 and its delivery system, especially for inhibition of Der p 2- specific IgE production (Th2~type responses) and induction of Der p 2-specific IgG2a production (Thl -type responses) as well as the components of Der p 2 DNA vaccine (pHIS-Det p 2 vector). However, Pulsawat et al (2013) did not describe the part of some primate optimized CpG immimostimulatory sequences, leader sequences and the experimental data related to anti-HDM allergic activities of the Der p 2 DNA, vaccine in humans, both ex vivo or in vivo.

[0007] Kent et al. (WQ2004056391) disclosed the composition of pHIS-HIY B-based DNA vaccine candidate, based on the pHIS vector for this invention and describes primate optimized CpG immnnostimulatory sequences. Furthermore, Krieg et al. (1998) described the incorporation of CpG immunostimulatory sequences into DNA vaccine vector which can enhance Thl -like function in vivo and also disclosed the sequences of some CpG immunosiimulatory sequences.

[0008] Thomas et al. (US006Q71522) disclosed a nucleotide sequence and the deduced amino acid sequence for Der p 2. Similarly, Yoo (US7439233) also described the nucleotidic sequences encoding murine and human Der p 2 T-cell epitopes and disclosed that a DNA vaccine comprising such sequences encoding Der p 2 T-cell epitopes can impair Der p 2 -specific Th2-type responses. Nevertheless, Pulsawat et al and Yoo both were not able to disclose the part that Der p 2-specific T-ceil epitopes restricted to HLA alleles common to the global populations.

[0009] Chua et al. (W02004019978) disclosed the method of ratramuscular/intradermal DNA administration using electroporation which consists in the application of a transient o electric field at the site of injection followed by applying electric field at the site of infection. Similarly, Vasan ei al. (2011) also described the in vivo electroporation of HIV DNA vaccine i humans and disclosed that this delivery system increased the magnitude of cellular mediated immunity'.

[0010] In ligh of the discussion above, potent Thl responses induced by DNA-based vaccines encoding allergens through electroporation provides the rationale for the evaluation of the efficacy of DNA encoding Der p 2 for the treatment of HDM allergy in clinical trials. Hence, there is required a nucleic acid construct that relates to the inhibition of Der p 2-specific Th2-type responses by the Der p 2 DNA vaccine administrated by intramuscular electroporation device.

[hOTl I Any discussion of the background art throughout the specification should in no way be considered as an admission that such background art is prior art nor that such background art is widely known or forms part of the common general knowledge in the field.

SUMMARY OF THE INVENTION

[0012] According to an aspect of the present invention, there is provided a nucleic acid construct in the aim of inhibiting the Der p 2-specific immune responses. The recombinant DNA comprises a nucleic acid sequence encoding a full-length Der p 2 polypeptide (Leader sequence + mature protein), a CpG motif and is named pHis.LeaderDer p 2.

[6013] In one embodiment of the invention, the isolated polynucleotide encoding Der p 2 polypeptide is amplified by at least one pair of primers.

[0014] In one embodiment of the invention, the primer pair is selected from the group comprising of, but not limited to, SEQ ID NO. xOl and SEQ ID NO. x02; SEQ ID NO. x03 and SEQ ID NO. x04.

[0015] In one embodiment of the invention, the polynucleotide construct comprises the polynucleotide sequence, but not limited to, SEQ ID NO. x05.

[0016] In one embodiment of the invention, the polynucleotide construct comprises the polynucleotide sequence, but not limited to, SEQ ID NO. x06. [0017] In one embodiment of the invention, the polynucleotide construct also comprises the CpG motif, but not limited to, SEQ ID NO. x09.

[0018] In one embodiment of the invention, the polynucleotide construct further comprises leader sequence, but not limited to, SEQ ID NO. x07.

[0019] In one embodiment of the Invention, the Der p 2 DNA sequence is modified to produce Der p 2 protein with disrupted IgE binding epitopes.

[0020] In one embodiment of the invention, the plasmi contains multiple copies of DNA Der p 2.

[0021] In one embodiment of the invention, the Der p 2 DNA sequence is fused with DNA sequence encoding HDM allergen as Der p 1 as example (Der p 2-Der p 1).

[0022] In one embodiment of the invention, the pHIS-Der p 2 nucleic acid is used as a prophylactic vaccine to prevent the development of the HDM allergic response.

[0023] In one embodiment of the invention, the pHIS-Der p 2 nucleic acid is used in specific immunotherapy to treat the HDM allergic response.

[0024] According to another aspect of the present invention, there is provided a method for the immunomodulalion of the allergic response comprising the steps of immunizing a subject with the polynucleotide construct to a subject through applying an electric pulse to the site of administration wherein the said method is specific immunotherapy against house dust mite allergies. In one embodiment of the invention, the method comprises electrical pulse, but not limited to, amplitude of low-voltage (100-300 V), long-duration (4-50 ms) pulses, or high-voltage (400-1 ,200 V/'cm), short-duration (95-300 ps) pulses of electrode spacing for 40 s over a 400 rns interval.

[0026] In one embodiment of the invention, the method of modulating immune responses provides suppressed production of IgE antibody specifically reactive with Der p 2.

[0027] In one embodiment of the invention, the method of modulating immune responses provides suppressed production of interleukin (IL)-5 from splenocytes stimulated with Der p 2. [0028] In one embodiment of the invention, the method of modulating immune responses provides reduced eosinophil cell numbers in respiratory tract.

[0029] In one embodiment of the invention, the method of modulating immune responses provides suppressed Th-2 responses.

[0030] In one embodiment of the invention, the present method of immunomoduiation provides the suppressed production of IgGl antibody specifically reactive with Der p 2.

[0031] in one embodiment of the invention, the present method of immunomoduiation provides the enhanced Th-1 response

[0032] In one embodiment of the invention, the method of modulating immune responses provides enhanced production of IgG2a antibody specifically reactive with Der p 2.

[0033] In one embodiment of the invention, the method of modulating immune responses provides enhanced production of interferon (IFN)-gamma from splenocytes stimulated with Der p 2.

BRIEF DESCRIPTION OF THE DRAWINGS

10034] At least one example of the invention will be described with reference to the accompanying drawings, in which:

[0035] Fig, 1 is the schematic representation of the pHis.LeaderDer p 2. plasmid map, in accordance with an embodiment of the present invention;

[0036] Fig. 2 (a) illustrates a sequence of synthetic primer- Leader sense primer (SEQ ID NO. xOl ), in accordance with an embodiment of the present invention;

[0037] Fig. 2 (b) illustrates a sequence of synthetic primer- antisense primer (SEQ ID NO. x02), in accordance with an embodiment of the present invention;

[0038] Fig. 3 (a) illustrates a sequence of synthetic primer- Leader sense primer (SEQ ID NO. x03), in accordance with an embodiment of the present invention;

[0039] Fig. 3 (b) illustrates a sequence of synthetic primer- antisense primer (SEQ ID NO. x04), in accordance with an embodiment of the present invention; [0040] Fig. 4 illustrates an artificial sequence of amplified PCR product amplified from primer (SEQ ID NO. xOl) and (SEQ ID NO. x02), in accordance with an embodiment of the present invention;

[0041] Fig. 5 illustrates an artificial sequence of amplified PCR product amplified from primer (SEQ ID NO. x03) and (SEQ ID NO. x04), in accordance with an embodiment of the present invention;

[0042] Fig. 6 illustrates an artificial sequence of Leader Der p 2 nucleotide sequence in pHiS.LeaderDer p 2 (SEQ ID NO. xG7), in accordance with an embodiment of the present invention;

[0043] Fig. 7 illustrates an artificial sequence of Leader Der p 2 amino acid sequences translated from SEQ ID NO. x07, in accordance with an embodiment of the present invention;

[0044] Fig. 8 illustrates an artificial sequence of 4447 residue sequence of pHis.LeaderDer P 2 vector, in accordance with an embodiment of the present invention;

[0045] Fig. 9 illustrates a sequence of the different part of pHis original and the version, in accordance with the embodiment of present invention.

[0046] Fig. 10 il iustrates a bar diagram showing the therapeutic vaccines BAL analysis, in accordance with an embodiment of the present invention;

[0047] ft should be noted that the same numeral represents the same or similar elements throughout the drawings.

DETAILED DESCRIPTION OF THE EMBODIMENTS

|0Q48] T throughout this specification, unless the context requires otherwise, the words “comprise”,“comprises” and“comprising” wi ll be understood to imply the inclusion of a stated step or element or group of steps or elements but not the exclusion of any other step or element or group of steps or elements.

[0049] Any one of the terms;“including” or wdiieh includes” or“that includes” as used herein is also an open term that also means including at least the elernents/feature; that follow the term, but not excluding others. Ί

[0050] In an embodiment of the present invention, the main purpose of the present invention is to improve the immunogenicity of a prophylactic vaccine encoding the major house dust mite allergen Der p 2. A plasmid DNA based on pHIS vector expressing the major House Dust Mite (HDM) allergen Der p 2 is designed, in synthetic form as shown in figure 1, in which the Der p 2 sequence is a natural one The optimization of allergen expression, the DNA delivery by in vivo electroporation and the DNA dose as well as the heterologous prime/boost strategy contributes to the efficacy of Der p 2-encoded DNA vaccinations.

[0051] In an embodiment of the present invention, synthetic primer- Leader sense primer denoted by SEQ ID NO. xOl as shown in figure 2 (a) was paired with antisense primer denoted by SEQ ID NO. xQ2 as shown in figure 2 (b) and the new version of Leader sense primer denoted by SEQ ID NO. x03 as shown in figure 3 (a) was paired with the new version of antisense primer denoted by SEQ ID NO. x04 as shown in figure 3 (b ).

[0052] In another embodiment of the present invention, PCR product were amplified from both the primer sets: Primer set 1 comprising SEQ ID No. 1 and SEQ ID No. 2, providing amplified PCR product denoted by SEQ ID NO. x05 as shown in figure 4 and Primer set 2 comprising SEQ ID No. 3 and SEQ ID No. 4, providing another: amplified PCR product denoted by SEQ ID NO. x06 as shown in figure 5.

[0053] Still further, in an embodiment of the present invention, the amplified PCR products were cut with the restriction enzymes and Leader Der p 2 nucleotide sequence in pHIS. Leader Der p 2 denoted by SEQ ID NO. x07 is prepared as shown in figure 6.

[0054] Furthermore, in an embodiment of the present invention, the Leader Der p 2 amino acid sequence is translated from SEQ ID NO:7 as CpG motif denoted by SEQ ID NO. x09, as shown in figure 8.

[0055] Still, in an embodiment of the present invention, 4447 residue sequence of pHis.LeaderDp2 vector is represented by SEQ ID NO. x09, as shown in figure 8.

[0056] Moreover, in an embodiment of the present invention, the different part of pHis original and version of the present invention is represented by SEQ ID NO. x lO, as shown in figure 9. [0057] In another embodiment of the present invention, the pHiS Leader Der p 2 construction is used as a prophylactic vaccine and as a therapeutic treatment. Additionally modified Der p 2 DNA sequence either through point mutations or truncations produces hypoallergenic Der p 2 i.e. Der p 2 protein with disrupte IgE binding epitopes. Also, the Der p 2 DNA sequence can be fused with any other DNA sequence encoding another HDM allergen as Der p 1 as example (Der p 2 -Der p 1).

[0058] In yet another embodiment of the present invention, Leader Der p 2 amino acid sequence was translated from SEQ ID NO:7 as illustrated in figure 7. Figure 9 illustrates the sequence with various parts of pHis original and the version from the present invention.

[0059] According to an embodiment of the present invention, the recombinant plasmid DNA is administered in mice by in-vivo intramuscular electroporation. Using this method of delivery, the Der p 2 protein expression is increased. Further, the plasmid contains multiple copies of DNA Der p 2, but not limited to, 1 copy 2 copies or 3 copies. Moreover, prophylactic vaccinations prevented the development of HDM allergy in mice. The invention is described below by the way of examples with reference to the following experimental procedures and results.

Materials and methods:

Plasmid constructions and preparation

[006(1] The full length Der p 2.0101 (leader + mature sequence) cDNA was amplified from the recombinant P. pastoris expression vector pPIC9K~mature Der p 2 by PCR using the following primers:

Leader sense primer-

5’-ATCGGCTAGCCTCGAGGCCACCATGTACAAAATTTTGTGTCTTTC

ATTGTTGGTCGCAGCCGTTGCTCGIGATCAAGTCGATGTCAAAGAT-3^' and antisense primer-

5’-CTATGCGGCCGCG AATTCTTAATCGCGGATTTTAGC ATGAGTAGC-3’ .

The amplified PCR product was digested respectively with Nhei-Noti, Nhel-EcoRI or XhoI-EcoRI for the cloning into the mammalian expression vectors pCMV/Kan/(NC I, NΪT1, USA), pcDNA3.1 + (Invitrogen, Carlsbad, USA) and pHIS-MCS respectively. The pH!S vector contained a kanamycm-seiection, a CMV promoter, the bovine growth hormone polyA signal, a synthetic intron placed immediately prior to multiple cloning site and 64 primate-optimized CpG immuno stimulatory sequences. The presence and identity of the full length Der p 2 cDNA was confirmed by DNA sequencing. All plasmid DNA constructs were produced and purified under endotoxin free environment.

EXAMPLE

Is vitro transient transfection assays

[0061] HEK 293 cells line were cultured onto 6 well plates (and with coversllp for immunofluorescence assay) in Dulbecco’s modified Eagle's medium (DMEM) supplied with 10% fetal bovine serum (FBS) at a density of I xlO⁶ cells/weli. At a 90% confluency, the purified plasmid DNA (4 pg of each DNA) were diluted in 250 mE of serum free DMEM medium, gently mixed and incubated with 250 mE of a diluted solution of Lipofectamine^{I M} 2000, 10 mΐ, of Lipofectamine ^{1 M} 2000 diluted in 240 mE of Opti-MEM I. The lipopiexes were then added into each well containing cells and 2 ml, medium, then plates were gently mixed and incubated at 37°C in a CO2 incubator for 48 hr.

Detection of Der p 2 expression by immwaobloting

[0062] The Der p 2 secretion was assayed using supernatants from transfected cells. The culture media from transfected cells were loaded onto a 12% SDS PAGE polyacrylamide gel. The different protein bands were then transferred onto a nitrocellulose membrane using a semi-dry transfer apparatus. The membrane was saturated with 5% skim milk and incubated with anti-Der p 2 mouse polyclonal antibodies at 1 ;2000 dilution for 1 hr. The membrane was washed with phosphate buffer saiine-Tween (PBST) (PBS, 0.5% Tween 20) and then incubated for 1 hr with horseradish peroxidase (HRP) conjugated anti-mouse IgG (dilution 1 :5000). The immuno reactive bands were detected using the chemiluminescent HRP substrate and followed by X-ray film exposition.

Detection of intracellular Der p 2 expression by immunofluorescence

[0063] HEK 293 -transfected cells on coversllp were fixed by acetone at -~20°C for 10 min. Fixed cells were incubated with anti-Der p 2 mouse polyclonal antibodies at 1 :5000 dilution at 37°C for 1 hr and washed with PBS. Cells were subsequently stained for 1 hr with rabbit-anti mouse IgG-FITC (dilution 1 :20) and washed with PBS. Cells were stained with Evans blue for 10 min and then washed with water. Cells were observed under fluorescence microscope.

[0064] Plasmid DNA vaccinations were performed by in vivo electroporation. The intramuscular DNA injection into one tibialis anterior muscle was directly followed by the stimulation of the site of injection with an electrical pulse that had an amplitude of 250 V per cm of electrode spacing for 40 ms over a 400 ms interval. To evaluate the immunogenicity of the different plasmids encoding Der p 2, groups of 6 Balb/C mice were immunized 3 times at 2-week intervals with 20 pg of the DNA vaccines. Two weeks after the last vaccination, animals were sacrificed to collect serum as well as the spleen. In the vaccination prophylactic effect experiment, animals were immunized three times by 2 or 20 pg pHis-Der p 2 or pCMV/Kan-Der p 2.

[QQ65] In another embodiment of the present invention, such homologous prime/boost regimen was also compared with two in vivo electroporation’s only followed or not by one injection of 5 pg unadjuvanted recombinant Der p 2. As a control, group of mice was immunized with saline alone. Two weeks after the last vaccination, animals were first bled from the retro-orbital venous plexus to collect serum and then sensitized at weekly intervals for 3 weeks with 5 pg recombinant Der p 2 formulated with alum (ratio allergen/adjuvant 1/100, intraperitoneai injection). To induce airway inflammation, mice were challenged 10 days after the last sensitization by intranasal administrations of crude D. pteronyssinus extract for 4 consecutive days. The amount of Der p 2 was estimated up to 5 pg/mL by western blotting. Three days post-last challenge, the mice were sacrificed to collect serum, bronchoalveolar lavage fluid (BALF) as well as the spleen.

Measurement of Der p 2-speeifk IgE, IgGl and IgG2a

[0066] The presence of anti -Der p 2 IgE, IgGl and IgG2a antibodies in the individual sera was detected by Enzyme-linked immune sorbent assay (ELISA). Immunoplates were coated with recDer p 2 (500 ng/well), for 16 hr at 4°C. Plates were washed five times with TBS-Tween (50 mm Tris-HCl pH 7.5, 150 mm NaCl, 0.1% Tween 80) and saturated for 1 hr at 37°C with 150 \xL of the same buffer supplemented with 1% BSA. For the detection of specific IgE, individual sera were applied at 1/8 dilution whereas serial dilutions of sera (40-125,000) were performed for the arsti-Der p 2 IgGl and IgG2a assays. In both cases, sera were diluted in saturation buffer and were incubated for 1 hi· at

37°C. Plates were washed five times with TBS-Tween buffer and antigen-bound antibodies were detected following incubation with rat biotinylated anti-mouse IgE, IgGl or IgG2a (BD dilution 1/1000 for each antibody) and HRP-conjugated streptavidin (BD, dilution 1/1000). The enzymatic activit was measured using the TMB substrate. OD450 nm was measured. The ELISA specific IgGl or IgG2a titers were identified as the reciprocal of the dilution giving a signal corresponding to 50% of the maximal OD₄50n_m value

Cytokines assay

[0067] To assess the cytokine production of proliferative T cells, splenocytes (4 < 105/well in triplicate) were stimulated with 20 pg/mL recDer p 2 in RPMI 1680 medium and culture supernatants were collected after 72 hr. The levels of IFNg and IL-5 in the supernatants were measured in ELISA assays.

[0068] One day after the final aerosol exposure, mice were bled and killed. The lungs were immediately washed via the trachea cannula with 1 mL PBS, which was instilled and gently recovered by aspiration three times. The lavage fluid was centrifuged at 400 xg for 10 min at 4°C The cell pellet was resuspended in 300 pL Hank’s balanced salt solution (HBSS) and ceils were counted. Cytospin preparations from 50 ,uL~aliquots were stained for differential cell counts.

[0069] Because it is generally believed that optimization of antigen expression is one of the most promising approaches proposed to enhance the immunogenicity of DNA vaccine candidates, the full length (including the leader sequence) Der p 2 cDNA was cloned into three different mammalian expression vectors: pCDNA3.1+, pHIS and pCMV/Kan. Whether all the three vectors contain the same cytomegalovirus (CMV) earl promoter, pHIS not only contained a synthetic intron placed immediately prior to Der p 2 cDNA but also a primate optimized CpG 2006 motif, an irnmuno stimulatory sequence able to activate the innate immunity through TLR9 which is active in mice. For estimating expression and secretion of Der p 2 by the constructed DNA vaccine vectors, HEK cells were transfected with DNA-Lipofectamine 2000 lipoplexes and antigen expression was analyzed by western blotting and immunofluorescence. The Der p 2 level of secretion was under the limit of detection using the recombinant DNA construct. Whether Der p 2 expression could be detected in transfected cells as well as in the culture supernatant with both pHIS- and pCMV/Kan-Der p 2 DNA vaccines, much higher Der p 2 production was however observed using the pHIS-based construction. Similar results were obtaine when the transfection agent was used to transfect the cells.

[007§] Immune responses to the pHISDer p 2 DNA vaccine delivered by electroporation or conventional intramuscular injection were then assessed In Balb/C mice following three DNA administrations of 20 pg of the plasmid. The specific humoral as well cellular responses were analyzed through anti-Der p 2 IgGL IgG2a and IgE detection as well as IFNg and IL-5 from Der p 2-specific proliferative assays. fOOTlj An elevated IFNg production together with the absence of IL-5 in the T^'-eeil proliferative assays was observed regardless of the type of DNA delivery method used. The absence of specific IgE together with low specific IgGl/IgG2a ratio and high IFNg production confirmed that. DNA immunizations through electroporation induced a strong anti -Der p 2 Thl -biased response. It is to be found that in vivo DNA delivery by electroporation had a positive impact of the production of Der p 2-specific IgG but not on the Th 1 -type cytokines .

[0072] To determine whether DNA-Der p 2 can prevent the development of HDM allergy, a first experiment of prophylactic DNA vaccinations was scheduled using a Der p 2 sensitization mouse model. According to the absence of specific antibody response following pc DNA-Der p 2 electroporations, groups of 6 naive mice were immunized by three electroporations with pHiS-Der p 2 or pCMV/Kan-Der p 2 used at 2 or 20 pg/deUvery to assess the contribution of DNA dose in the efficacy of DNA vaccines against RDM allergy. As controls, unvaccinated r nice were administrated with saline alone. The pretreated animals were all subsequently sensitized with three intra-peritoneai injections of Der p 2/alum followed by four consecu live intranasal challenges using HDM extracts to provoke airway inflammation. The delivery of pHIS-Der p 2 at low dose (2 gg) induced a strong specific IgG2a response, no production of anti-Der p 2 igG2a could be measured using the same amount of pCMV/Kan-Der p 2 (P < 0.05). Both DNA constructs used at 20 qg/injection stimulated a similar specific igG2a response, which were higher than those measured from immunizations using 2 qg DNA (P < 0.05). Whatever the DNA dose or the vector used, no specific IgE could be detected. The subsequent Der p 2 sensitizations and intranasal challenges were shown to increase the specific IgG2a level (P < 0.05 compared with post-vaccination titers) to reach comparable antibody titer in any DNA-vaccinated groups (P > 0.05 compared between groups post-challenge). The unvaccinated control animals clearly developed respectively poor and strong anti-Der p 2 specific IgG2a and IgE responses. Further, 1L-5 and IFNg secretions were analyzed by Der p 2- restimulated spleen cells. Der p 2-sensitized and HDM-challenged control mice developed high IL-5 and low IFNg production respectively. High level of IFNg secretion was similarly measured in Der p 2-restimulated spleen cells from the four vaccinated animal groups (P > 0.05). Also, any of the DNA vaccination schedules impaired equivalently the IL-5 production. BAL fluids analysis as shown in figure 10 demonstrates that non-vaccinated but sensitized and challenged animals developed an important airway eosinophilia. In contrast, DNA vaccinations with low or high doses of p HIS- Der p 2 or pCMV/Kan-Der p 2 significantly as well as similarly decreased the eosinophil influx in the airways (P < 0.05). Further, it was concluded that Der p 2-encoded DNA delivered by electroporation maintained its capacity to prevent the HDM allergic response even at a very low dose.

[0073] The heterologous prime -boost vaccinations, an immunization protocol using different types of vaccines for the delivery of the same antigen in the priming and the boost, can elicit higher immune responses than the homologous prime-boost using same type of vaccines. Consequently, three different DNA immunization regimens were compared in another set of experiments using pH!S-Der p 2 as DNA vaccine candidate: two or three electroporations (homologous prime/boost) and two electroporations combined with one intramuscular immunization with unadjuvanted recDer p 2 (heterologous prime/boost). The vaccinated animals as well as the unvaccinated control group were subsequently sensitized and challenged. Whereas comparable specific Ig.G2a antibody titers were elicited following three DNA electroporations or two DNA electroporations + one protein immunization, two DNA electroporations triggered lower production of anti-Der p 2 IgG2a (P < 0.05). Following sensitization and challenge steps, the specific IgG2a titers were increased in all the vaccinated animals but no significant difference was observed between groups (P > 0.05). Consequent!} , the allergic control group developed the highest anti-Der p 2 IgE response.

[0074] The heterologous/prime/boost regimen induced an increase in the allergen-specific [gE production compared with the homologous prime/boost and this increment was more pronounced following prophylactic vaccinations by two DNA electroporations. The results demonstrated that all regimens were capable of preventing the development of the HDM allergic response although it can be considered that the homologous prime/boost immunization regimen based on three DNA electroporations generates the highest Thl specific response.

10( 75] Vaccinations with allergen encoding DNA plasmids were shown to represent a promising approach to prevent allergy through notably the induction of strong IFNg production which prevents Th2 bias. Consequently, allergen-specific Thl memory generated by DNA encoding allergens could be sufficient to prevent allergy. The development of allergen-specific IgG response by DNA vaccinations would be greatly facilitated by the allergen secretion through the use of efficient leader sequence in plasmid constructs. Although intracellular allergen expression could reduce the risk of the priming of allergen-specific IgE response, numerous anti-allergy DNA vaccines based on DNA constructs able to secrete allergens triggered nevertheless protective Thl/Treg responses.

[0076] According to the embodiment of present invention, three expression plasmids (pcDNA 3.1, pCMV/Kan and pHIS) were used to clone the natural full-length Der p 2 cDNA, including the sequence encoding the Der p 2 leader peptide, whereas all these plasmids drive antigen expression through the same CMV promoter, the pHIS plasmid was considered as an optimized vector for DNA vaccination through the presence of a synthetic intron placed immediately prior to Der p 2 coding sequence as well as a stretch of CpG motifs. This method concluded that electroporation combined with intramuscular injection of pHIS-Der p 2 drastically enhanced the overall level of anti-Der p 2 humoral response through, more likely, a prolonged allergen expression by transfected cells and/or a more efficient cross-priming of DCs. [0677J According to the embodiment of present invention, pcDNA-Der p 2 was able to induce a production of IFNg from restimulated splenoeytes but at a lower level than observed with pCMV/Kan-Der p 2. or pHIS-Der p 2. Further, pCMV/Kan-Der p 2 and pHIS-Der p 2 generated a potent Der p 2-specific Th! -biased response characterized by high specific IgG2a response and IFNg production which prevented the development of specific Ig£ and IL-5 but also eosinophilia in a mouse model ofHDM allergy.

[0078] According to the embodiment of the present invention it was observed that the DNA dose did not influence the global Thl -biased prevention of HDM allergy. Actually, an allergen-encoding DN A vaccine delivered even at very low dose of approximately 2 pg by electroporation was able to prevent the development of HDM allergy.

[0079] The terms and descriptions used herein are set forth by way of illustration only and are not meant as limitations. Examples and limitations disclosed herein are intended to be not limiting in any manner, and modifications may be made without departing from the spirit of the present disclosure. Those skilled in the art will recognize that many variations are possible within the spirit and scope of the disclosure, and their equivalents, in which all terms are to be understood in their broadest possible sense unless otherwise indicated.

[Q680] Various modifications to these embodiments are apparent to those skilled in the ait from the description and the accompanying drawings. The principles associated with the various embodiments described herein may be applied to other embodiments. Therefore, the description is not intended to be limited to the embodiments shown along with the accompanying drawings but is to be providing broadest scope of consistent with the principles and the novel and inventive features disclosed or suggested herein. Accordingly, the disclosure is anticipated to hold on to all other such alternatives, modifications, and variations that fall within the scope of the present disclosure and appended claims.

Claims

1. A polynucleotide construct comprising:

a) an isolated polynucleotide encoding a Der p 2 polypeptide;

b) a CpG motif; and

c) a leader sequence;

wherein the construct is pHis.LeaderDer p 2 vector.

2. The polynucleotide construct as claimed in claim 1, wherein said isolated polynucleotide encoding Der p 2 polypeptide is amplified by at least one primer pair.

The polynucleotide construct as claimed in claim 2, wherein said primer pair is selected from the group comprising of SEQ ID NO. xOl and SEQ ID NO. x02; SEQ ID NO. x03 and SEQ ID NO. x04.

4. The isolated polynucleotide sequence as claimed in claim 1, wherein said polynucleotide sequence is SEQ ID NO. xG5.

5. The isolated polynucleotide sequence as claimed in claim 1, wherein said polynucleotide sequence is SEQ ID NO. x06.

6. The polynucleotide construct as claimed in claim 1, wherein said CpG motif is SEQ ID NO. x09.

7. The polynucleotide construct as claimed in claim 1 , wherein the leader sequence is SEQ ID NO. x07.

8. The polynucleotide construct as claimed in claim 1, wherein Der p 2 DNA sequence is modified to produce Der p 2 protein with disrupted IgE binding epitopes.

9. The polynucleotide construct as claimed in claim 1, wherein the plasmid contain multiple copies of DNA Der p 2.

10. The polynucleotide construct as claimed in claim L wherein the Der p 2 DNA sequence is fused with DNA sequence encoding HDM allergen as Der p 1 as example (Der p 2-Der p 1 ).

11. The polynucleotide construct as claimed in claim 1, wherein the pHIS-Der p 2 nucleic acid is used as a prophylactic vaccine to prevent the HDM allergic response.

12. The polynucleotide construct as claimed in claim 1 , wherein the pHIS-Der p 2 nucleic add is used in specific immunotherapy to treat the RDM allergic response.

13. A method of modulating immune responses comprising the steps of:

a) administering the polynucleotide construct to a subject;

b) applying an electric pulse to the site of administration;

wherein the said method is specific immunotherapy against house dust mites allergies.

14. A method as claimed in claim 12, wherein said electrical pulse amplitude of low- voltage (100-300 V), long-duration (4-50 ms) pulses, or high-voltage (400-1,200 V/cm), short-duration (95-300 ps) pulses of electrode spacing for 40 ms over a 400 ms interval.

15. A method as claimed in claim 12, wherein said modulating immune responses provides suppressed production oflgE antibody specifically reactive with Der p 2.

16. A method as claimed in claim 12, wherein said modulating immune responses provides suppressed production of interleukin (IL)-5 from splenocytes stimulated with Der p 2.

17 method as claimed in c!air 12, wherein said modulating immune responses provides reduced eosinophil cell numbers in respiratory tract.

18. A method as claimed in claim 12, wherein said modulating immune responses provides suppressed Th-2 responses.

19. A method as claimed in claim 12, wherein said modulating immune responses provides suppressed IgGl responses.

20. A method as claimed in claim 12, wherein said modulating immune response provides enhanced Th-1 responses.

21. A method as claimed in claim 12, wherein said modulating immune responses provides the enhanced production of IgG2a antibody specifically reactive with Der p 2.

22. A method as claimed in claim 12, wherein said modulating immune responses provides enhanced production of interferon (IFN)-gamma from spienocytes stimulated with Der p 2.