WO2020034256A1 - Gene for disaccharide degrading enzyme and use thereof - Google Patents

Abstract

Provided are a trehalase derived from Trichoderma reesei and the coding gene thereof. The trehalase can hydrolyze the trehalose produced during metabolism to glucose which is used by the distillery yeast to increase the ethanol production.

Description

Disaccharide degrading enzyme gene and application thereof Technical field

The invention belongs to the field of biological enzymes, and particularly relates to a disaccharide degrading enzyme gene and application thereof.

Background technique

Trehalase (EC3.2.1.28, α, α-trehalose glucohydrolase) was first discovered by Bourquelot in Aspergillus niger in 1893, and subsequent research found that trehalase is widely present in microorganisms, insects, plants and Invertebrates play an important role in glucose transport and energy storage. Trehalase is a trehalose hydrolase that can break down trehalose into two molecules of glucose. Currently, researchers have isolated trehalase from many organisms.

The catalytic residues of trehalase are distributed between the trehalase-tagged domain 1 and the C-terminus, and are not linked together as a whole but dispersed in the sequence. The distribution of these conserved domains is different in different trehalase enzymes.

The mechanism of action of glycoside hydrolase can be divided into two categories, retention catalytic mechanism and reverse catalytic mechanism. Trehalase uses reverse catalytic mechanism. In this mechanism, the active residue (aspartic acid or glutamic acid) in the enzyme molecule plays an important role, one amino acid residue serves as a nucleophilic group, and the other amino acid residue serves as a proton donor. The specific reaction mechanism is as follows: (1) the nucleophilic group (amino acid residue) attacks the water molecule, the water molecule attacks the C1 atom of the substrate to form a bridge-like connection; (2) the catalytic amino acid residue (carboxyl and base) The carboxyl group provides H ⁺ , which electrophilically attacks the O atom of the substrate C1-O to form an intermediate; (3) the C1-O bond is cleaved to form a product.

Studies have shown that except for Pichia fermentans, which use trehalose phosphorylase to break down trehalose, all fungi breaks down trehalose through trehalase, and trehalose is its sole substrate. . According to the optimal pH and regulatory characteristics, fungal trehalase can be divided into acidic (non-regulatory) and neutral (regulatory) trehalase. Neutral trehalase is an intracellular enzyme that mainly degrades endogenous trehalose, such as during spore germination, cell starvation, or when cell growth is subject to temperature changes. Acid trehalase is an extracellular enzyme that can help cells absorb foreign trehalose. All fungi need acid trehalase when they grow in a medium containing trehalose as a carbon source. In many fungi, such as Saccharomyces, Cerevisiae, Schizosaccharomyces, Pombe, and Candidautilis, and other species, these two enzymes are present, but in different subcellular, biochemical and The regulatory characteristics are different and their functions are relatively independent, but this phenomenon has not been well explained for many years.

The optimal pH of acid trehalase is about 4.5, and it shows the highest enzyme activity around pH 4.5. The acid trehalase in yeast is mainly located in the vacuole, while the acid trehalase in filamentous fungi is mainly located in the cell wall. The acid trehalase that has been studied in depth is mainly derived from Saccharomyces cerevisiae. This type of acid trehalase belongs to a vacuolar glycoprotein, which is not associated with neutral trehalase. This type of acidic trehalase is not inhibited by ATP, nor is it activated by phosphorylation and Ca ²⁺ or Mn ²⁺ . This type of acidic trehalase can be induced by trehalose and inhibited by carbon metabolites. Currently, trehalase derived from filamentous fungi is mainly acid trehalase. Filamentous fungal acid trehalase is a glycoprotein, which mainly exists in spores, hyphae, and vacuoles, and is rarely secreted into the culture medium. They show good thermal stability and are not reversibly phosphorylated. The thermophilic fungi Scytalidium thermophilum and Humicola grisea acid trehalase are activated by Ca ²⁺ or Mn ²⁺ , and ATP has a slight inhibitory effect. However, acidic trehalase derived from Dictyostelium discoideum and Chaetomium acreum is not sensitive to Ca ²⁺ , Mn ²⁺ , and ATP.

Neutral trehalase showed the highest enzyme activity at pH 7.0, mainly in the cytoplasm. Neutral trehalase is a strictly regulated enzyme. Saccharomyces cerevisiae and K.lactis, S.pombe, T.delbeueckii, C.utilis, Pachysolen tannophilus and other fungal neutral trehalase enzymes are all regulated by signal pathways. This signal pathway mainly regulates the reversibility of enzymes through phosphorylation Activation, glucose, nitrogen source, heat shock, chemicals and other factors can trigger the activation of these signal pathways. In vitro, the activity of neutral trehalase derived from S. cerevisiae and K. lactis can be activated by Ca ²⁺ and Mn ²⁺ , and ATP has a slight inhibitory effect on it. Their protein sequences show that the N-terminal region has two consensus-dependent cAMP protein phosphorylation sites and a putative Ca ²⁺ binding sequence.

In recent years, a great deal of research has been conducted on the physiological functions of acid trehalase and neutral trehalase. It has been reported that acid and neutral trehalase mutants of Saccharomyces cerevisiae are used to study the physiological functions of these enzymes. The results show that acid trehalase mutants can still decompose trehalose in the cytoplasm, but cannot use exogenous trehalose as a carbon source. ; In contrast, neutral trehalase mutants can grow normally on trehalose-containing media. The filamentous fungus Neurospora crassa acid trehalase deficiencies cannot use trehalase as a carbon source, but it can effectively break down trehalose in the cytoplasm as well as the wild type, and it is similarly found in Aspergillus nidulans. Foster et al. Showed that the neutral trehalase in Aspergillus nidulans, Streptococcus albicans and Magnaporthe grisea can break down trehalose in cells. According to the evidence obtained from the research on the above several yeasts and filamentous fungi, acid and neutral trehalase have unique and independent functions, breaking down extracellular and intracellular trehalose, respectively. Therefore, the coexistence of these two types of trehalase may be a common phenomenon. On the one hand, it makes it possible to accumulate and decompose trehalose in fungi, and at the same time, it can use extracellular trehalose as a carbon source.

In addition to this, the overexpression of the trehalase gene AtTRE1 in Arabidopsis can improve the ability of plants to resist drought stress, and trehalase expression is involved in abscisic acid-mediated stomatal closure. Trehalase can also degrade trehalose in insects into glucose for energy supply and adjust the trehalose content to cope with environmental changes. In addition, studies have shown that increased urinary trehalase activity in animals is associated with recurrence of nephrotic syndrome, so kidney disease can be diagnosed by measuring urinary trehalase.

The heterologous expression of trehalase is mainly expressed in the E. coli expression system, but the expressed protein is often limited to the periplasmic cavity or cytoplasm and has low activity, which may be related to the presence of rare codons in the gene and post-translational The protein needs to be modified. The encoded protein is toxic to E. coli, the encoded protein is sensitive to proteases in the E. coli system, and the structure of the encoded protein is too complicated. With the development of the times and the advancement of science and technology, most of the trehalase genes have also been successfully expressed in the silkworm baculovirus expression system, the Pichia yeast expression system, and the Saccharomyces cerevisiae expression system. Analysis of the trehalase gene and the selection of an appropriate expression system are particularly important for the efficient expression of the trehalase enzyme. In addition, genetic modification of the trehalase gene at the molecular level is also an important strategy to improve trehalase enzyme activity.

The trehalase genes reported so far are mostly from insects, plants, animals, etc. The trehalase gene from Trichoderma reesei and its expression in Pichia yeast, and the trehalase produced in the Aspergillus niger expression system is produced in alcohol. No other reports have been reported for applications in the fermentation industry.

Summary of the Invention

An object of the present invention is to provide a trehalase gene.

Another object of the present invention is to provide a trehalase enzyme whose amino acid sequence is shown in SEQ ID NO. 2. The trehalase enzyme has the purpose of decomposing trehalose.

Yet another object of the present invention is to provide the application of the above-mentioned trehalase in fermentation to produce alcohol.

The technical scheme adopted by the present invention is:

A trehalase whose amino acid sequence is shown in SEQ ID NO.2.

A trehalase gene whose nucleotide sequence can encode the amino acid sequence shown in SEQ ID NO.2.

Preferably, the nucleotide sequence of the trehalase gene is as shown in SEQ ID NO.1.

A recombinant vector containing the trehalase gene described above.

A recombinant cell containing the trehalase gene described above.

Preferably, the cell contains the above-mentioned recombinant vector.

Application of the trehalase enzyme or the trehalase gene according to any one of the above to fermentative production of alcohol.

A method for preparing trehalase by fermentation, comprising the steps of: using a recombinant expression vector containing the trehalase gene according to any of the above, transforming the recombinant expression vector into a host cell to obtain a recombinant strain; fermenting the recombinant strain to induce Expression and secretion of trehalase.

Preferably, the vector in the recombinant expression vector is selected from a yeast expression vector, a Bacillus subtilis expression vector, and a mold expression vector.

Application of the trehalase or trehalase gene according to any one of the above to the production of alcohol by fermentation.

A method for producing alcohol by fermentation includes the steps of adding the above-mentioned trehalase to a fermentation raw material.

Preferably, the pH during the fermentation does not exceed 7.0; more preferably does not exceed 6.0; and most preferably does not exceed 5.0.

Preferably, the amount of the trehalase is 5-20 U per gram of fermentation raw material; more preferably 8-12 U.

Preferably, the fermentation raw material is selected from at least one of corn flour, starch residue, sugar cane honey, and potato.

The beneficial effects of the present invention are:

(1) A novel acidic trehalase gene is cloned in the present invention. The gene can produce trehalase and can degrade trehalose to glucose.

(2) The present invention has discovered a new acidic trehalase TH3155, which is composed of 1056 amino acids, and its amino acid sequence is shown in SEQ ID NO: 2.

(3) Adding a certain amount of the trehalase of the present invention during the fermentation to produce alcohol can hydrolyze the trehalose produced in the metabolic process to glucose for utilization by the alcohol yeast, increase the alcohol production, and also reduce the seaweed in the alcohol fermentation wastewater Residual sugar reduces the cost of treating alcohol fermentation wastewater. The trehalase of the present invention has high yields in Pichia yeast and Aspergillus niger, which can greatly save costs, and more importantly, it has a good application effect and a significant increase in alcohol content. ).

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 Enzyme activity of trehalase TH3155 at different temperatures;

Figure 2 Relative enzyme activity of trehalase TH3155 at different pH.

detailed description

The present invention will be further described below with reference to specific embodiments.

The following implementation methods are for better explaining the present invention and should not be construed as limiting the purpose of the present invention. The reagents and biological materials can be obtained from commercial sources unless otherwise specified.

Example 1 Cloning of a trehalase gene TH3155

I. Experimental materials and reagents:

1.Strains and vectors

E. coli Topl0, Pichia yeast X33, Aspergillus niger 319 strain, plasmid pPICzαA, plasmid PBC-gla3, and Zeocin antibiotics were purchased from Invitrogen.

2.Gene

The strain Trichoderma reereesei was purchased from Guangdong Microbial Strain Collection Center, and a trehalase gene TH3155 was amplified from the genome of the strain.

3. Enzymes and reagents

Super-fidelity 2 × Master Mix PCR polymerase was purchased from NEB Company; universai DNA Purification Kit, TIANprep Mini Plasmid Kit, and restriction enzyme were purchased from Shanghai Shengong Company.

4.Media

The E. coli medium was LB medium (1% peptone, 0.5% yeast extract, 1% NaCl, pH 7.0). For LB + Amp medium, ampicillin was added to the LB medium at a final concentration of 100 ug / mL. LB + Zeo medium Add Zeocin to the LB medium at a final concentration of 25ug / mL.

The yeast medium was YPD medium (1% yeast extract, 2% peptone, 2% glucose). The yeast screening medium was YPD + Zeo medium (YPD + Zeo medium was YPD medium and Zeocin was added to a final concentration of 100 μg / mL).

Experimental methods and results

1.Cloning of Trichoderma treesei trehalase gene TH3155

Using the Trichoderma reereesei genome as a template, design three pairs of primers (TH3155-F1 ～ F3, TH3155-R1 ～ R3), amplify 3 fragments by PCR, fuse the 3 fragments by fusion PCR method, and then use the fusion product as a template. Using TH3155-F1 and TH3155-R3 as primers, an EcoRI digestion site was introduced at the 5 'end and a Not I digestion site was introduced at the 3' end. The full-length TH3155 of the trehalase gene was amplified by PCR. DNA fragment, the target fragment is recovered, and the primer sequence is as follows:

TH3155-F1: CGTA GAATTC ACAACACTCGTTGACCGCGTCACCAAGT (SEQ ID NO: 3);

TH3155-R1: GCGTCGACGTGGTTTGCATATTCATCAGGATCGGTCATGTTGGTCAGTGTC (SEQ ID NO: 4);

TH3155-F2: GACACTGACCAACATGACCGATCCTGATGAATATGCAAACCACGTCGACGC (SEQ ID NO: 5);

TH3155-R2: CCGTCGGGCGATTGCTTGTTGGCATAGTAGTCGAGGTCGTTGAGAGCAT (SEQ ID NO: 6);

TH3155-F3: ATGCTCTCAACGACCTCGACTACTATGCCAACAAGCAATCGCCCGACGG (SEQ ID NO: 7);

TH3155-R3: ACGT GCGGCCGC TTACAAACGCCGACGCATAAAGCTCCTCGGAT (SEQ ID NO: 8).

2. Sequence determination of trehalase gene TH3155

The recovered DNA target fragment was ligated with the vector pPICzαA, and the ligated product was transformed into E. coli Top10 competent cells. Recombinant transformants were selected in a plate containing Zeocin, and a part of the transformants was selected for cultivation. The plasmid was extracted for dual enzymes. Digestion verification, the two linear fragments obtained by double digestion were 3.2 kb and 3.3 kb, respectively, and the transformants obtained by single digestion were about 6.5 kb and sent to sequencing.

3. Nucleotide sequence analysis and amino acid sequence analysis of trehalase gene TH3155

The sequencing results were analyzed using the vector analysis software Vector NTI. The trehalase gene TH3155 has the base sequence described in SEQ ID NO: 1 in the sequence listing. Specifically, the trehalase gene TH3155 is composed of 3,171 bases, and contains the entire open reading frame (ORF) of the trehalase gene TH3155. The trehalase gene TH3155 encodes a protein containing 1056 amino acids, and the theoretical molecular weight of the protein is predicted to be 114.5KDa.

Example 2 Pichia pastoris expression vector and host containing trehalase gene TH3155

Expression of trehalase gene TH3155 in Pichia pastoris: pPICzαA-TH3155 recombinant expression vector was digested into a linearized DNA fragment with a Pme I restriction enzyme, and the DNA fragment was purified, and the linear pPICzαA-TH3155 DNA was transformed by an electric transformation method. Fragmented into the expression host Pichia pastoris X33 competent cells, spread on YPD + Zeocin plate, invert culture at 30 ° C for 3-4 days, pick single colonies into 2ml liquid YPD medium, and culture at 30 ° C, 200rpm for 24 hours Incubate with 1% methanol for 24 hours, collect the fermentation broth, centrifuge, and take the supernatant as the crude enzyme solution.

Example 3 Aspergillus niger expression vector and host containing trehalase gene TH3155

Expression of trehalase gene TH3155 in Aspergillus niger: The trehalase gene TH3155 in pPICzαA-TH3155 was constructed into the Aspergillus niger expression vector PBC-gla3 with BglII restriction enzyme and PmeI restriction enzyme, and transformed into Aspergillus niger 319 strains of protoplasts. Spread on TZ ⁺ hygromycin plate, invert culture at 32 ° C for 5-6 days, pick single colonies into 20mL liquid maltodextrin medium, culture at 32 ° C, 200rpm, and select the recombinant that expresses trehalase. Aspergillus niger.

Example 4 Study on the Enzymatic Properties of Trehalase TH3155

(1) Principle

The trehalase catalyzes the hydrolysis of trehalose under certain conditions to produce reducing sugars such as glucose. 3,5-dinitrosalicylic acid is reduced to a brown-red amino complex after co-heating with the reducing sugar solution. The color depth is directly proportional to the amount of reducing sugar, so the color can be measured at a wavelength of 550nm to calculate the enzyme activity.

(2) Enzyme reaction system

Take 1ml of fermentation broth diluted by appropriate multiples and add 1ml of 2% trehalose solution dissolved in pH5.5 acetic acid-sodium acetate buffer solution. The reaction was terminated after 30 minutes at 50 ° C. The 3,5-dinitrosalicylic acid method was used. The amount of reducing sugar produced was measured.

(3) Definition of trehalase activity

Under the above conditions, the enzyme activity that produces 1umol glucose reducing power per minute is one enzyme activity unit.

(4) Reagents and solutions

Acetic acid-sodium acetate buffer solution: accurately weigh 4.92 g of anhydrous sodium acetate and dissolve it in water, add glacial acetic acid, dissolve with distilled water and make up to 1000 ml, and correct it to 5.5 with a pH meter after preparation.

DNS reagent: accurately weigh 6.3g of 3,5-dinitrosalicylic acid and put it in a beaker containing 500ml of distilled water, add 21g of sodium hydroxide and heat to 50 ° C to dissolve completely, weigh 182g of potassium sodium tartrate and put it in 300ml of water Heat and dissolve and pour into the previous solution. Add 5g of phenol, add 5g of anhydrous sodium sulfite, stir until completely dissolved. After cooling, make up to 1000ml with distilled water, filter, store in a brown bottle and use for 7 days.

2% trehalose solution: Accurately weigh 2g of trehalose, and fully dissolve to a volume of 100ml with sodium acetate buffer solution pH 5.5 (it can be stored at low temperature for 3 days).

(5) Drawing of glucose standard curve

Take 0.2%, 0.4, 0.6, 0.8, 1.0, 1.2, 1.4ml of 0.1% standard glucose solution, respectively, and add them to the graduated test tube in turn, make up to 2.0ml with distilled water, and prepare it to contain glucose 100, 200, 300, 400, 500, 600, 700 μg standards. Add 3 ml of DNS reagent, and boil in boiling water for 7 minutes (calculate when the sample is re-boiled), add 10 ml of distilled water immediately after taking out, mix well, and after cooling, measure with 550nm colorimeter in a spectrophotometer, adjust with a blank tube solution At zero, record the optical density value, draw the standard curve with the optical density as the ordinate, and the corresponding standard glucose concentration as the abscissa.

For the blank sample, replace 0.5ml standard glucose solution with 0.5ml distilled water.

(6) Specific measurement steps:

Take 1ml of the diluted enzyme solution (enzyme solution obtained from yeast fermentation in Example 2), add 3ml DNS and mix thoroughly, react at 50 ℃ for 30min, add 1ml 2% trehalose, boil in boiling water for 7 minutes, and add 10ml of distilled water after cooling. The optical density value OD _{550 was} measured in the same manner as in the standard curve.

Take 1ml of the appropriately diluted enzyme solution (enzyme solution obtained in Example 2) in a 50 ° C water bath for 8 minutes, add 1ml of a 2% trehalose solution that has been preheated to 50 ° C in a test tube, and immediately react at 50 ° C for 30 minutes. Add 3 ml of DNS reagent, boil in boiling water for 7 minutes, add 10 ml of distilled water after cooling, mix well, and determine the optical density value OD ₅₅₀ according to the same operation as in the standard curve.

(7) Calculation of enzyme activity

Enzyme activity (u / ml) = OD × K value ÷ 30 ÷ 180 × n

In the formula:

OD ---- the difference between the optical density of the sample and the blank;

180 --- the molecular weight of glucose;

K ----- the slope of the standard curve;

30 ----- Enzyme reaction time;

n ------ Dilution times of fermentation broth.

(8) Optimum reaction temperature of trehalase TH3155

Under pH 5.5 conditions, determine the enzyme activity of trehalase TH3155 at different temperatures (30, 35, 40, 45, 50, 55, 58, 60, 65 ° C), and the enzyme activity at 50 ° C is 100% , Calculate the relative enzyme activity, its optimum temperature is 45 ℃, the maximum enzyme activity of the fermentation broth reaches 128U / ml (as shown in Figure 1).

(9) Optimum reaction pH of trehalase TH3155

At 50 ° C, determine the enzyme activity of TH3155 at different pH (3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0), and calculate the relative enzyme activity at 100% under pH 5.5. The optimal reaction pH is 3.5 (as shown in Figure 2). When the pH reaches 6.0 or higher, the relative enzyme activity of TH3155 does not exceed 60%.

Example 5 Application of trehalase TH3155 in fermentation to produce alcohol

Method: Mix corn flour with dressing water, the ratio of material to water is 1: 2.25, adjust the pH to 5.5 with 3M phosphoric acid solution, add high temperature resistant α-amylase according to the amount of 20U / g corn flour, stir and heat to Keep it at 95 ℃ for 90min; cool down to room temperature, adjust the pH to 4.3 with 3M phosphoric acid solution, add saccharifying enzyme at 100U / g corn flour, add acid protease at 100U / g corn flour, 10U / g corn flour Add trehalase TH3155, add 0.1% of the corn flour to the yeast activation solution, shake it, and place it in a thermostatically heated incubator that has been heated to 32 ° C for constant temperature fermentation. After the fermentation, the high-performance liquid chromatography combined with an organic acid analysis column was used to detect the alcohol content in the fermentation broth, and no trehalase TH3155 was added as a blank control.

Results: The experimental results showed that the alcohol content of the experimental group containing trehalase TH3155 at the end of fermentation was 113.7 g / L, the alcohol content of the blank control was 111.9 g / L, and the alcohol content of the experimental group containing trehalase TH3155 was lower than that of the blank control. The content is 1.61% higher.

Example 6 Application of trehalase TH3155 in fermentation to produce alcohol

Method: Mix corn flour with dressing water, the ratio of material to water is 1: 2.25, adjust the pH to 5.5 with 3M phosphoric acid solution, add high temperature resistant α-amylase at 20U / g corn flour, stir to 95 ° C And maintain 90min; cool to room temperature, adjust the pH to 4.3 with 3M phosphoric acid solution, add saccharifying enzyme at 100U / g corn flour, add acid protease at 100U / g corn flour, add trehalase TH3155 at corn flour, corn flour Add 0.1% of yeast activation solution and shake well, then put it into a thermostatic incubator that has been warmed to 40 ° C to perform thermostatic fermentation. After the fermentation, the high-performance liquid chromatography combined with an organic acid analysis column was used to detect the alcohol content in the fermentation broth, and trehalase was not added as a blank control.

Results: The experimental results showed that the alcohol content of the experimental group containing trehalase TH3155 at the end of fermentation was 113.5 g / L, which was higher than that of the blank control at 110.8 g / L. The alcohol content ratio of the experimental group containing trehalase TH3155 was The blank control had a higher alcohol content of 2.44%.

Example 7 Application of trehalase TH3155 in fermentation to produce alcohol

Method: Mix corn flour with dressing water, the ratio of material to water is 1: 2.0, adjust the pH to 5.5 with 3M phosphoric acid solution, add high temperature resistant α-amylase at 20 U / g corn flour, stir to 95 ° C And maintain 90min; cool to room temperature, adjust the pH to 4.3 with 3M phosphoric acid solution, add saccharifying enzyme at 100U / g corn flour, add acid protease at 100U / g corn flour, add trehalase TH3155 at corn flour, corn flour After adding 0.1% of yeast activation solution to shake, put it into a thermostatic incubator that has been heated to 35 ° C for constant temperature fermentation. After the fermentation, the high-performance liquid chromatography combined with an organic acid analysis column was used to detect the alcohol content in the fermentation broth, and trehalase was not added as a blank control.

Results: The experimental results showed that the alcohol content of the experimental group containing trehalase TH3155 at the end of fermentation was 121.5g / L, which was higher than that of the blank control at 118.7g / L. The alcohol content ratio of the experimental group containing trehalase TH3155 was The blank control had a higher alcohol content of 2.36%.

The above results show that adding a certain amount of the trehalase of the present invention in the alcohol fermentation process can hydrolyze the trehalose produced in the metabolic process into glucose for utilization by the alcohol yeast, increase the alcohol production, and also reduce the seaweed in the alcohol fermentation wastewater. Residual sugar reduces the cost of treating alcohol fermentation wastewater.

During the production of alcohol by fermentation, alcohol yeast is affected by stress factors such as temperature, substrate concentration, and gradually accumulated alcohol in the later period, and a certain amount of trehalose is accumulated in the metabolic process. Non-reducing sugar composed of 1-glycosidic bonds, this sugar cannot be used by alcohol yeast. Because trehalose formation and glucose utilization are in a direct competitive relationship, the increase in non-fermentative trehalose will inevitably affect the utilization of raw materials and reduce the theoretical yield of alcohol. At the same time, as the accumulated trehalose remains in the fermentation broth, it will ferment alcohol. Wastewater treatment can also have adverse effects. Therefore, a certain amount of trehalase is added in the fermentation process for alcohol production, and the trehalose produced in the metabolic process is hydrolyzed to glucose for use by the alcohol yeast, which can increase the alcohol yield. It can be seen that the trehalase of the present invention is used for fermentation to produce alcohol, etc. The industrial field has a wide range of application values, and it is of great significance to conduct in-depth research on trehalase.

The above embodiment is a preferred embodiment of the present invention, but the embodiment of the present invention is not limited by the above embodiment. Any other changes, modifications, substitutions, combinations, and modifications made without departing from the spirit and principle of the present invention, Simplified, all should be equivalent replacement methods, and all are included in the protection scope of the present invention.

Claims (10)

1. A trehalase is characterized in that its amino acid sequence is shown in SEQ ID NO.2.
2. A trehalase gene, characterized in that its nucleotide sequence can encode the amino acid sequence shown in SEQ ID NO.2.
3. The trehalase gene according to claim 2, wherein the nucleotide sequence is as shown in SEQ ID NO.1.
4. A recombinant vector comprising the trehalase gene according to claim 2 or 3.
5. A recombinant cell, comprising the trehalase gene according to claim 2 or 3.
6. Application of the trehalase according to claim 1 or the trehalase gene according to any one of claims 2 to 3 in the production of alcohol by fermentation.
7. A method for preparing trehalase by fermentation, comprising the steps of: using a recombinant expression vector containing the trehalase gene according to claim 2 or 3 to transform the recombinant expression vector into a host cell to obtain a recombinant strain; The strain is fermented to induce expression and secretion of trehalase.
8. A method for producing alcohol by fermentation, comprising the steps of: adding the trehalase according to claim 1 to a fermentation raw material; and the pH value during the fermentation process does not exceed 7.0.
9. The method according to claim 8, wherein the amount of the trehalase is 5-20 U per gram of fermentation raw material.
10. The method according to claim 8 or 9, wherein the fermentation raw material is at least one selected from the group consisting of corn flour, starch residue, sugar cane honey, and potato.

Images