WO2020029487A1

WO2020029487A1 - Method for improving plant drought resistance by inhibiting expression of cost1 genes

Info

Publication number: WO2020029487A1
Application number: PCT/CN2018/119255
Authority: WO
Inventors: 包岩; 宋维萌; 张洪霞
Original assignee: 鲁东大学
Priority date: 2018-08-09
Filing date: 2018-12-05
Publication date: 2020-02-13
Also published as: CN108949821B; CN108949821A

Abstract

Disclosed is a method for improving plant drought resistance by inhibiting expression of COST1 genes. The nucleotide sequence of the COST1 genes is shown as SEQ ID NO: 1, and the protein sequence coded by the COST1 genes is an amino acid sequence shown as SEQ ID NO: 2. Homologous genes of the COST1 genes comprise tomato SlCOST1 genes, rice OsCOST1 genes, poplar PtCOST1 and PtCOST2 genes, and other genes in other species having a homology degree of more than 40% with fragments in any nucleotide or protein region of COST1.

Description

Method for improving plant drought resistance by suppressing expression of COST1 gene

Technical field

The invention relates to the technical field of genetic engineering, in particular to a method for improving drought resistance of a plant by knocking out the COST1 gene or inhibiting the expression of the COST1 gene. The present invention takes priority to the Chinese invention patent with a patent number of 201810901473.7, which was filed on August 09, 2018.

Background technique

In today's environment of global warming and extreme shortage of fresh water resources, how to ensure stable food production and feed 7.5 billion people worldwide is a great challenge. It is urgent to cultivate new plant varieties with higher yield and drought resistance.

In recent years, driven by next-generation sequencing, the genome sequences of a large number of plants have been published. How to dig deep into the functions of these existing genomic sequences and find new functional genes with independent intellectual property rights has become a new challenge. How to use these genes to develop more powerful new crop varieties is imminent. Traditional genetic breeding is time consuming and long because it needs to go through multiple generations such as crosses and selfings. At the same time, it has problems such as unclear genetic background. The use of currently mature biotechnology methods, including the currently very mature RNAi interference technology, can quickly and accurately control the expression of certain genes to significantly shorten the breeding time, making it a fast and effective method for breeding new varieties.

Summary of the invention

An object of the present invention is to provide a method for improving drought resistance of a plant by knocking out the COST1 gene or suppressing the expression of the COST1 gene.

Specifically, the present invention uses gene knockout and small RNA interference technology to achieve knockout or down-regulate the expression level of an Arabidopsis DUF641 family COST1 (gene ID: AT2G45260) and its similar genes in plants by transgene to induce cell autophagy. Wait for adversity response to improve drought resistance (stomata close quickly and water loss rate decreases).

Further, the expression of the homologous gene of this gene in similar mono- and dicotyledonous plants such as rice, tomato and poplar was reduced by small RNA interference technology, and the corresponding transgenic plant exhibited a drought-resistant phenotype, so this transgenic technology was used to obtain The transgenic plants all fall within the protection scope of the present invention.

The nucleotide sequence of the COST1 gene is shown as SEQ ID NO: 1; the protein sequence encoded by the COST1 gene is shown as the amino acid sequence shown as SEQ ID No.2.

The homologous gene of the COST1 gene in tomato is the SlCOST1 gene. The nucleotide sequence of the SlCOST1 gene is shown in SEQ ID NO: 3, and the protein sequence encoded by the SlCOST1 gene is shown in SEQ ID No. 4 amino acid sequence.

The homologous gene of the COST1 gene in rice is the OsCOST1 gene. The nucleotide sequence of the OsCOST1 gene is shown in SEQ ID NO: 5, and the protein sequence encoded by the OsCOST1 gene is shown in the amino acid sequence shown in SEQ ID No.6.

The homologous genes of COST1 gene in poplar are PtCOST1 gene and PtCOST2 gene. The nucleotide sequence of the PtCOST1 gene is shown in SEQ ID NO: 7, and the nucleotide sequence of the PtCOST2 gene is shown in SEQ ID ID NO: 8. The protein sequence encoded by the PtCOST1 gene is as shown in SEQ ID No. 9 and the protein sequence encoded by the PtCOST2 gene is as shown in SEQ ID No. 10.

In addition, the homologous genes of the COST1 gene protected by the present invention are not limited to those listed above, but also include genes in other species that have homology to any nucleotide or protein region fragment of COST1 of more than 40%.

The invention has the following advantages:

The invention knocks out the COST1 gene in Arabidopsis thaliana through gene knockout and small RNA interference technology, and improves the drought resistance of plants. The COST1 gene and other genes in other species that have a homology of more than 40% with any nucleotide or protein region fragment of COST1 were found to lay the foundation for breeding more drought-resistant transgenic plants. This method can be applied to plant genetic improvement.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 is an alignment of the protein sequences of Arabidopsis COST1 with three other highly homologous proteins COST2, COST3 and COST4;

In the figure, the conserved DUF641 / COST domain of the COST protein is indicated below the black line. Sequence alignment with the help of CLUSTALW software (http://www.clustal.org/clustal2/);

Figure 2 is the identification of COST1 mutants.

In the figure, (a) shows the genetic structure of COST1. The gray squares are non-coding regions, the black squares are coding regions, the triangles show the T-DNA insertion positions, and F and R indicate the positions of the primers used for PCR identification. (b) Genomic PCR showed that the T-DN insertion was homozygous for the COST1 mutant, and WT (Wild-type) indicates the wild type. LBa1 is a T-DNA insertion specific primer, and the ACT2 (ID: AT3G18780) gene is used as an internal standard. (c) Quantitative PCR showed that the COST1 gene transcription in the COST1 mutant was completely knocked out.

Figure 3 is the evolutionary analysis of the COST1 gene family and the effect of Arabidopsis gene knockout mutants on development; (a), a schematic diagram of the structure of the COST1 protein, and the numbers below indicate the amino acid positions. AT2G45260 is the ID number of the COST1 gene; the conserved COST / DUF641 domain is located from the 31st amino acid to the 159th amino acid at the nitrogen terminal (N) of the COST1 protein; the carbon terminal (C) is relatively differentiated. (b) Analysis of protein evolution of the COST1 family. The name after the underscore is the ID of the corresponding gene in each species. The circles represent the COST proteins of four Arabidopsis thaliana, and the right side of the corresponding gene ID is the Fragments Per Kilobase of Transcript and Million (FPKM) values. The four COST genes of Arabidopsis thaliana are represented by circles. (c), qPCR test results of four Arabidopsis COST genes; (d), the effect of COST1 mutants on the growth and development of Arabidopsis.

Figure 4 reveals that COST1 can be complemented by its own genomic DNA fragment.

In the figure, (a), the genomic sequence of the COST1 gene is used to complement the cost1 mutant, and WT, cost1 and two independent lines gCOST1 # 1 and gCOST # 5 are tested for drought resistance.

(b) Quantitative PCR detects the transcriptional expression of the COST1 gene in the mutant and two complementary strains.

(c) Detection of water loss rate of WT wild-type and cost1 mutants and two independent complementary lines gCOST1 # 1 and gCOST # 5.

Figure 5 is used to illustrate that inhibition of COST1 gene expression improves plant drought resistance;

(a) Drought resistance tests were performed on WT, cost1, and two RNAi transgenic lines RNAi # 1 and RNAi # 3 of the COST1 gene.

(b) Quantitative PCR detection of WT, cost1 in (a), and the transcription of the COST1 gene in two RNAi transgenic lines, RNAi # 1 and RNAi # 3.

(c) Detection of water loss rate of WT, cost1 and two RNAi transgenic lines RNAi # 1 and RNAi # 3.

(d) Quantitative PCR detection of stress-related genes in WT and cost1 before and after drought treatment.

FIG. 6 is a comparison of drought resistance of three RNAi independent transgene-inhibited expression lines against the COST1 homologous gene SlCOST1 (ID: Solyc01g091120) in tomato with non-transgenic control lines.

FIG. 7 is a comparison of drought resistance of two RNAi independent transgene-inhibited expression lines against the COST1 homologous gene OsCOST1 (ID: Os10g23220) in rice and non-transgenic control lines.

Figure 8 shows the drought resistance of three RNAi independent transgene-inhibited expression lines compared with non-transgenic control lines, while simultaneously inhibiting the expression of two homologous genes, Ct1 in poplar, PtCOST1 (Potri.014G067600) and PtCOST2 (Potri.002G145900) .

detailed description

The following examples are used to illustrate the present invention, but not to limit the scope of the present invention.

The scientific terms involved in the present invention are as follows:

* "Target gene" refers to the model plant Arabidopsis COST1 and its series of homologous genes.

* "Similar gene" means any DNA fragment (gene fragment) that has more than 40% homology with any region in the coding sequence of the "target gene", or any DNA fragment (gene fragment), which encodes the same amino acid sequence Any region in the amino acid sequence encoded by the "target gene" has a homology rate of more than 40%. A "similar gene" can be cloned from the genome of any organism, or it can be artificially synthesized or amplified in vitro by PCR.

* "Gene fragment" means any DNA fragment having a homology rate of more than 40% with any domain region in the DNA sequence of the "target gene" or "similar gene" with a length of 300 base pairs (bp) or more, or For any DNA fragment encoding more than 100 amino acids, the encoded amino acid sequence is more than 40% homologous with any region in the amino acid sequence encoded by the "target gene" or "similar gene". The gene fragment can be cloned from the genome of any organism, or it can be artificially synthesized or amplified in vitro by PCR.

* "Recipient plant" means mono- and dicotyledonous plants such as rice, tomato and poplar.

* "Transgenic" refers to the introduction of an exogenous double-stranded deoxyribonucleotide (DNA) fragment of a plant individual by any method, which can be isolated outside the chromosome or integrated into the genome of the recipient plant chromosome; The reproductive process is passed on to the offspring, or not. Foreign genes can be cloned from the genome of any organism, or they can be artificially synthesized or amplified in vitro by PCR.

Example 1

Screening and acquisition of COST1 gene

A new Arabidopsis DUF641 family gene COST1 (Constitutively Stressed1) was screened by reverse genetics using a variety of bioinformatics methods such as transcriptomics, genomics, and proteomics. The nucleotide sequence of the gene was as follows: The sequence is shown in SEQ ID ID NO.1, and its protein sequence is shown in SEQ ID NO.2; the protein sequence alignment shows that in addition to COST1, there are three other proteins COST2, COST3 and COST4 in C. (figure 1).

2. Homology analysis of COST1 gene and functional verification of COST1

The T-DNA insertion plant SALK_064001 of COST1 was ordered from the Arabidopsis mutant library of ABRC (Arabidopsis Biological Research Center, www.arabidopsis.org). The T-DNA insertion position of this mutant is inside the first and only exon and is homozygous (Figure 2a, b). Arabidopsis planting and mutant identification methods refer to the methods described in the literature in parentheses (Bao et al., 2014).

Real-time quantitative PCR identification showed that the expression of this gene in the homozygous COST1 mutant was completely knocked out (Figure 2c).

Analysis of its protein structure revealed that the DUF641 / COST domain is located at the N (nitrogen) end of the protein and is highly conserved (Figure 3a).

Genetic evolution analysis shows that UDF641 family proteins such as COST1 are plant-specific proteins and are widely distributed in moss and other higher plants (Figure 3b). The species shown in the figure include Arabidopsis thaliana, Arabidopsis lyrata, Capsella rubella, Brassica rapa, Populus trichocarpa, Solanum lycopersicum, Medicogo truncatula, Aquilegia coerulea, Brachypodium distachyon, Oryza Sativa, Zea mays, Amborella trichopoda, Picea ababies and Physcomitrella toppatens.

The qPCR test results of four Arabidopsis COST genes showed that only COST1 was expressed, and the other three genes COST2, COST3, and COST4, which are highly homologous to the COST1 gene, were hardly expressed at the transcription level (Figure 3c). At the same time, studies on the effects of COST1 mutants on development showed that COST1 mutant plants with completely deleted COST1 genes became smaller, dwarfed, and darkened in leaf color (Figure 3d).

In order to prove that the drought-resistant phenotype of the mutant was caused by the COST1 gene knockout, we cloned the genomic fragment of the COST1 gene gCOST1 and transformed it into the background of the COST1 mutant. The specific operation is to design primers to amplify the gCOST1 full-length coding sequence to obtain a DNA fragment of about 2502bp in length, and then ligate it into the EcoRV digestion cloning vector pBlueScript II IIKS (pKS; Stratagene), identify it by enzyme digestion, and sequence correctly. The plasmid was digested with EcoRI and SalI. The digested fragments were recovered and ligated into the pcambia1300 vector. Primers gCOST1F and gCOST1R (see Table 1) used to construct the vector:

gCOST1F: CGCCGGAGAAAGTGTAAGAAAC

gCOST1R: TCATTCATGCTCTGTTTTCCTCTC

The results showed that gCOST1 # 1 and gCOST # 5, two independent transgenic lines, were able to restore the phenotype of the COST1 mutant to wild-type (WT) levels (Figure 4a). Quantitative PCR also showed that the expression of COST1 in the two complementary strains was very close to the wild-type control (Figure 4b). Around 10-year-old plants were cut out, and the weight was measured every 30 minutes. The results of the leaf water loss rate also showed that the low water loss phenotype of COST1 could be complemented by the self-genomic fragment of the stage (Figure 4c). Therefore, we concluded that the drought-resistant phenotype of the COST1 mutant was indeed caused by the COST1 gene knockout.

To further confirm the phenotype of the COST1 mutant exhibiting extreme drought resistance and low leaf loss (Figure 4c). We construct a plant RNAi interference vector. The specific method of constructing the vector is to design primers to amplify a 332 bp DNA fragment from the full-length cDNA of COST1, and then ligate it into the SmaI-digested cloning vector pBlueScript II KS (pKS; ), Enzyme digestion identification, the correct sequencing plasmid was digested with enzyme and recovered, and then ligated into pcambia1301-RNAi vector. The primers used to construct the vector are (see Table 1):

RNAi-COST1F: CGCCGGAGAAAGTGTAAGAAAC

RNAi-COST1R: TCATTCATGCTCTGTTTTCCTCTC

Agrobacterium tumefaciens-mediated transfer of RNAi vectors into Arabidopsis thaliana and two independent transgenic RNAi strains were obtained.

Water was controlled for two weeks for WT, COST1, and two RNAi lines, and the results showed that the mutant and RNAi lines were significantly resistant to drought (Figure 5a).

qPCR quantitatively detected the expression of COST1 gene in two RNAi strains. The results showed that the expression of COST1 gene in the two transgenic lines of RNAi # 1 and RNAi # 3 was reduced by about 50% and 70%, respectively (Figure 5b).

About ten rosette leaves of plants around the size were cut out, and the weight was measured every half an hour on the balance. The results showed that the dehydration rate of RNAi plants of the COST1 mutant and the two COST1 genes was reduced (Figure 5c).

Ten-day-old WT seedlings were dehydrated for 6 hours, and the expression of the internal standard genes was detected by qPCR. The COST1 mutant and its corresponding wild-type material were treated (drought) and not treated, and the results showed that compared with WT, in untreated COST1 mutants, the expression of a large number of stress-related genes had been significantly increased by qPCR detection. This indicates that COST1 is a constitutive stress-responsive mutant. Compared with drought-treated WT, the expression of stress-responsive genes increased more in the drought-treated COST1 mutant background, that is, the representative stress-responsive genes in the qPCR verification part were more significantly up-regulated in COST1 (Figure 5d) . Corresponding genes tested for stress include RD29A, ABI2, ABI5, PP2C, RD22, COR15A, KIN1, COR414-TM1 and LTP3.

3. Identification of homologous gene expression that inhibits the COST1 gene and identification of drought resistance in other species

In order to more extensively verify the value of the COST1 gene in other species. We found homologous genes of Arabidopsis COST1 gene in other species through protein homology alignment (Figure 4b). The plants selected for further study were monocotyledonous rice, dicotyledonous tomato and tree poplar. By constructing genetically transformed pCAMBIA series vectors (see Appendix 9 for primers used to construct the vectors), RNAi interference technology was used to suppress the expression of the corresponding homologous genes; and these transgenic plants were further tested for drought resistance.

First, we used tomato SlCOST1 (ID: Solyc01g091120, SEQ ID NO: 3) gene specific primers RNAi-SlCOST1F and RNAi-SlCOST1R to amplify a 316bp DNA fragment. Three independent tomato RNAi lines L1, L19 and L2 were obtained by constructing a genetic transformation vector and transforming tomato callus. Three weeks of wild-type (WT) and three independent transgenic lines L19, L1, and L2 were treated with water for two weeks, and representative photographs were taken and displayed. Drought experiments on three independent RNAi transgenic lines showed that the drought resistance of the transgenic plants after the tomato COST1 homologous gene was downregulated significantly (Figure 6). The genetic transformation method of tomato refers to the method described in the literature in parentheses (Zhang et al., 2001).

Second, we used the COST1 homologous gene OsCOST1 (ID: Os10g23220, SEQ ID NO: 5) gene specific primers RNAi-OsCOST1F and RNAi-OsCOST1R in rice to amplify a 391bp DNA fragment. Three independent rice RNAi lines were obtained by constructing genetically transformed pCAMBIA series vectors (see Table 1 for primer sequences used to construct the vector) and transforming the rice callus. A representative photo was taken and displayed on a 4-week-old wild type (WT) and two independent transgenic lines, RNAi-OsCOST1-2 and RNAi-OsCOST1-11, treated with 20% PEG for 2 weeks. Drought experiments on two independent RNAi transgenic lines of rice showed that the drought resistance of plants after down-regulation of the rice COST1 homologous gene was significantly improved (Figure 7). Genetic transformation of rice follows the method described in the literature in parentheses (Toki et al., 2006).

Again, we used the COST1 homologous genes PtCOST1 (Potri.014G067600, SEQ ID NO: 7) and PtCOST2 (Potri. 002G145900, SEQ ID NO: 8) in the poplar tree as gene specific primers RNAi-PtCOST1F and RNAi-PtCOST1F, RNAi-PtCOST2F and RNAi -PtCOST2R amplified a 128bp and 299bp DNA fragment, respectively. Three independent poplar RNAi lines were obtained by constructing genetically transformed pCAMBIA series vectors (see Table 1 for primers used to construct the vector) and transforming the poplar callus. Six-week-old wild-type (WT) and three independent RNAi-independent transgenic lines RNAi-PtCOST1, 2-1, RNAi-PtCOST1, 2-5, and RNAi-PtCOST1, 2-9 were representatively photographed after three weeks of drought treatment A photo of sex. Drought testing of the three RNAi transgenic lines of poplar showed that the three RNAi independent transgenic lines obtained by simultaneously knocking out two homologous genes of COST1, PtCOST1 and PtCOST2 in poplar, were more drought-resistant (Figure 8). The genetic transformation of poplars follows the method described in the literature in parentheses (Wang et al., 2011).

Table 1 Primers used in the experiment

Note: * Lowercase letters indicate restriction sites and protected bases added to the primers.

Although the present invention has been described in detail with the general description and specific embodiments, some modifications or improvements can be made on the basis of the present invention, and its scope of use is not limited to the three described in this patent. This will be obvious to those skilled in the art. Therefore, these modifications or improvements made without departing from the spirit of the present invention belong to the scope of protection of the present invention.

The documents cited in the present invention are as follows:

Bao Y, Wang CT, Jiang CM, Pan J, Zhang GB, Liu H, Zhang HX (2014) The tumoror necrosis factor receptor-associated factor (TRAF) -like family protein SEVEN IN ABSENTIA 2 (SINA2) promoments ABA-dependentmanner in Arabidopsis. New Phytol. 202 (1): 174-87.

Toki, S, Hara N, Ono K, Onodera H, Tagiri A, Oka S, Tanaka H (2006). Early infection of cutellum issues with Agrobacterium allowances high-speed transformation information of plant.Plant J. 47 (6): 969-976 .

Wang HH, Wang CT, Liu H, Tang RJ, Zhang HX (2011) An efficient Agrobacterium-mediated transformation and regeneration system for leaflet explants of two eliteite aspen, hybrid, clones, Populus, ba, P. Berolinensis, David, and Populus. Cell Rep. 30: 2037-2044.

Zhang HX, Blumwald E (2001) Transgenic salt-tolerant tomato plants accumulate salt but not in fruit. Nat Biotechnol. 19: 765-768.

Claims

A method for improving drought resistance of a plant by inhibiting the expression of the COST1 gene, characterized in that the nucleotide sequence of the COST1 gene is shown in SEQ ID NO: 1.
The method for improving plant drought resistance by suppressing the expression of the COST1 gene according to claim 1, wherein the protein sequence encoded by the COST1 gene is an amino acid sequence shown in SEQ ID No. 2.
The method for improving drought resistance of a plant by inhibiting the expression of the COST1 gene according to claim 1, wherein the method is used for obtaining a transgenic plant.
The method for improving drought resistance of a plant by inhibiting the expression of the COST1 gene according to claim 1, characterized in that the plant comprises a plant containing a gene having a homology of more than 40% with a nucleotide or protein region fragment of the COST1, such as Tomato, rice and poplar.
The method for improving plant drought resistance by inhibiting the expression of the COST1 gene according to claim 4, characterized in that the homologous gene of the COST1 gene in tomato is the SlCOST1 gene, and the nucleotide sequence of the SlCOST1 gene is SEQ ID ID NO: 3 shown.
The method according to claim 5, wherein the protein sequence encoded by the SlCOST1 gene is the amino acid sequence shown in SEQ ID No.4.
The method for improving plant drought resistance by inhibiting the expression of the COST1 gene according to claim 4, characterized in that the homologous gene of the COST1 gene in rice is the OsCOST1 gene, and the nucleotide sequence of the OsCOST1 gene is as SEQ ID ID NO: 5 shown.
The method according to claim 7, characterized in that the protein sequence encoded by the OsCOST1 gene is an amino acid sequence shown in SEQ ID No. 6.
The method for improving drought resistance of a plant by inhibiting the expression of the COST1 gene according to claim 4, characterized in that the homologous genes of the COST1 gene in the poplar are the PtCOST1 gene and the PtCOST2 gene, and the nucleotide sequence of the PtCOST1 gene is SEQ ID NO: 7, the nucleotide sequence of the PtCOST2 gene is shown in SEQ ID NO: 8.
The method according to claim 9, wherein the protein sequence encoded by the PtCOST1 gene is an amino acid sequence shown in SEQ ID No. 9, and the protein sequence encoded by the PtCOST2 gene is an amino acid sequence shown in SEQ ID No. 10.