WO2020027640A1

WO2020027640A1 - Composition for inhibiting ctgf expression

Info

Publication number: WO2020027640A1
Application number: PCT/KR2019/095026
Authority: WO
Inventors: 원철희; 민달희
Original assignee: 주식회사 레모넥스
Priority date: 2018-07-31
Filing date: 2019-06-03
Publication date: 2020-02-06

Abstract

The present invention relates to a composition for inhibiting CTGF expression, the composition enabling the inhibition of the expression level of CTGF by means of RNA interference (RNAi), and the present invention relates to a composition enabling the prevention or treatment, with excellent efficiency, of various fibroplastic diseases such as hypertrophic scars and keloids.

Description

Composition for Inhibiting CTGF Expression

The present invention relates to a composition which inhibits CTGF expression with high efficiency and has excellent prophylactic or therapeutic effect of fibroproliferative disease.

Tissue remodeling is the reconstruction of existing tissue in response to physiological or pathological stress. Tissue remodeling in pathophysiology is characterized by connective tissue growth factor (CTGF), myofiber differentiation and activation, deposition of extracellular matrix (ECM) and overexpression of fibrosis. Among various signal molecules and factors, CTGF has been considered a pivotal mediator in tissue remodeling. CTGF is involved in a variety of signal transduction pathways, resulting in cell adhesion and migration, ECM remodeling and alteration of organ structure. Tissue remodeling and fibrosis are associated with numerous fibrotic disorders such as pulmonary fibrosis, liver fibrosis, kidney fibrosis, diabetic retinopathy, and skin fibrosis (keloids and hypertrophic scars).

The wound healing process in the skin is very complex and consists of overlapping steps of inflammation, cell differentiation and proliferation, tissue remodeling (including collagen production). Some cytokines and growth factors, especially TGF-β, play an important role in the early and late stages of wound healing. TGF-β mediates leukocyte migration, angiogenesis, fibroblast migration and ECM components (collagen and fibronectin) production through CTGF upregulation. Since overexpression of CTGF has been observed in hypertrophic scars and keloid patients, suppression of CTGF expression is an attractive strategy to modulate fibrosis mechanisms that can inhibit or reverse the fibrosis process.

Many antibodies or antisense oligonucleotides have been investigated to inhibit CTGF expression or to reduce excessive collagen production and fibrosis. siRNA is one of the promising candidates for CTGF inhibition. RNA interference induced in siRNA is mediated by highly specific and efficient gene silencing machinery that sequencely recognize and cleave target mRNAs. Despite its high potential as a new therapeutic agent, several limitations such as 1) rapid degradation by nucleases in biological systems, 2) maintenance of effective siRNA doses, 3) difficulty in efficient delivery across biological barriers, and There is a barrier.

To date, cationic polymers, lipid nanoparticles (LNPs), viruses, and various nanomaterials have been developed for the delivery of siRNAs. The clinical application of cationic polymers and LNPs should be prudent due to the toxicity and / or instability of the structures in vivo, and viral gene transfer poses mutagenesis in addition to low packaging capacity. Chemical modifications of siRNA backbones can increase stability and cell uptake, but still suffer from disadvantages such as high cost, labor intensive, time consuming processing, and high amounts of siRNA administration for satisfactory efficacy in target cells.

An object of the present invention is to provide a composition having high efficiency of inhibiting CTGF expression and having an excellent prophylactic or therapeutic effect of fibroproliferative diseases.

1. A composition for inhibiting CTGF gene expression, comprising: a nucleic acid molecule consisting of a sequence of SEQ ID NO: 1 and a sequence complementary to 10 nucleotides or more.

2. The composition according to the above 1, wherein the nucleic acid molecule consisting of a sequence of at least 16 nucleotides complementary to the sequence of SEQ ID NO: 1;

3. The composition of 1 above, wherein the nucleic acid molecule consisting of a sequence complementary to the entire sequence of SEQ ID NO: 1;

4. The composition of 1 above, wherein the nucleic acid molecule forms a strand of siRNA, dsRNA, PNA or miRNA.

5. In the above 4, the siRNA consisting of the sense RNA consisting of the sequence of SEQ ID NO: 1 and the antisense RNA consisting of the sequence of SEQ ID NO: 2, the strand consisting of the sequence of SEQ ID NO: 3 and dsRNA consisting of the strands complementary thereto, SEQ ID NO: 52 SiRNA consisting of a sense RNA consisting of a sequence of and an antisense RNA consisting of a sequence of SEQ ID NO: 53, a dsRNA consisting of a strand consisting of the sequence of SEQ ID NO: 54 and a complementary strand thereof, a sense RNA consisting of the sequence of SEQ ID NO: 55, and SEQ ID NO: 56 SiRNA consisting of an antisense RNA consisting of a sequence of DNA, a strand consisting of a sequence of SEQ ID NO: 57 and a dsRNA consisting of a complementary strand thereof, a siRNA consisting of a sense RNA consisting of a sequence of SEQ ID NO: 58, and an antisense RNA consisting of a sequence of SEQ ID NO: 59, A strand consisting of the strand of SEQ ID NO: 60 and a strand complementary thereto, A siRNA consisting of a sense RNA consisting of a sequence of SEQ ID NO: 61 and an antisense RNA consisting of a sequence of SEQ ID NO: 62, a dsRNA consisting of a strand consisting of the sequence of SEQ ID NO: 63 and a complementary strand thereof, a sense RNA consisting of a sequence of SEQ ID NO: 64, and SiRNA consisting of antisense RNA consisting of the sequence of SEQ ID NO: 65, dsRNA consisting of the strand of SEQ ID NO: 66 and complementary strands thereof, sense RNA consisting of the sequence of SEQ ID NO: 67, and antisense RNA consisting of the sequence of SEQ ID NO: 68 An siRNA consisting of a siRNA consisting of a strand of SEQ ID NO: 69 and a dsRNA consisting of a strand complementary thereto, a sense RNA consisting of a sequence of SEQ ID NO: 70, and an antisense RNA consisting of a sequence of SEQ ID NO: 71, a sequence of SEQ ID NO: 72 Strand and dsRNA consisting of complementary strands; Standing selected at least one composition comprising an siRNA or dsRNA.

6. The composition of 5 above, further comprising a sequence of UU or dTdT at the 3 'end of the sense RNA and antisense RNA sequence.

7. The composition of 4 above, comprising at least one PNA consisting of one sequence selected from the group consisting of SEQ ID NOs: 87-99.

8. The peptide according to the above 7, wherein the peptide comprises at least one sequence selected from the group consisting of SEQ ID NOs: 101 to 113 at at least one end of the PNA; Or mPEG ₅₀₀₀ is further bound.

9. A pharmaceutical composition for the prevention or treatment of fibroproliferative diseases comprising the composition of any one of 1 to 8.

10. In the above 9, the fibrotic disease is hypertrophic scar, keloid, fibrosis, pulmonary fibrosis, idiopathic pulmonary fibrosis, liver fibrosis, kidney fibrosis, cystic fibrosis, myelofibrosis, peritoneal fibrosis, scleroderma, diabetic retinopathy , Duchenne muscular dystrophy, radiation-induced fibrosis, myocardial fibrosis, diabetic kidney disease, chronic renal failure, chronic viral hepatitis, biliary fibrosis, fatty hepatitis, alcoholic fatty hepatitis, nonalcoholic steatohepatitis, proliferative vitreoretinopathy, musculoskeletal tumor, osteosarcoma , Rhabdomyosarcoma, glioblastoma, lung cancer, ovarian cancer, esophageal cancer, colon cancer, pancreatic cancer, kidney sclerosis, sarcoidosis, glaucoma, macular degeneration, subretinal fibrosis, choroidal neovascularization, vitreoretinopathy, proliferative vitreoretinopathy, diabetes Retinopathy, keratitis, pterygium, censorship, scleroderma, uterine fibroids, systemic sclerosis, glomerulonephritis, human immunodeficiency viral kidney disease, acute respiratory distress Syndrome, chronic obstructive pulmonary disease, Raynaud, rheumatoid arthritis, multiple myositis, vascular restenosis, periodontal disease, and at least one selected from the group consisting of chijueun composition.

11. Porous silica particles carrying nucleic acid molecules that complementarily bind to at least a portion of the transcript of the CTGF gene;

The porous silica particles react with silica particles having pores less than 5 nm in diameter at 120 ° C. to 180 ° C. for 24 to 96 hours to expand the pores less than 5 nm in diameter; And calcining the pores of expanded silica particles at a temperature of 400 ° C. or higher for at least 3 hours.

The average diameter of the porous silica particles is 100 nm to 1000 nm, the BET surface area is 200m ² / g to 700m ² / g, the volume per g is 0.7ml to 2.2ml,

The porous silica particles, the ratio of the absorbance of the following formula 1 is t is 24 or more, CTGF gene expression inhibition composition:

[Equation 1]

A _t / A ₀

Wherein A ₀ is the absorbance of the porous silica particles measured by placing 5 ml of the 1 mg / ml suspension of the porous silica particles in a cylindrical permeable membrane having pores having a diameter of 50 kDa,

Outside of the permeable membrane is in contact with the permeable membrane, 15ml of the same solvent as the suspension is located, the inside and outside of the permeable membrane is stirred 60 rpm at 37 ℃ horizontal,

The pH of the suspension is 7.4,

A _t is the absorbance of the porous silica particles measured after t hours have elapsed since the measurement of A ₀ ).

12. The composition of 11 above, wherein the porous silica particles are positively charged or uncharged at neutral pH at the outer surface or inside the pore.

13. The composition of 11 above, wherein the porous silica particles have a hydrophilic or hydrophobic functional group.

14. The composition of 11 above, wherein the nucleic acid molecule is at least 10 nucleotides complementary to the sequence of SEQ ID NO: 1.

15. The composition of 11 above, wherein the nucleic acid molecule is at least 16 nucleotides complementary to the sequence of SEQ ID NO: 1.

16. The composition of 11, wherein the nucleic acid molecule consisting of a sequence complementary to the entire sequence of SEQ ID NO: 1.

17. The composition of 11 above, wherein the nucleic acid molecule forms one strand of siRNA, dsRNA, PNA or miRNA.

18. The method according to the above 17, the siRNA consisting of the sense RNA consisting of the sequence of SEQ ID NO: 1 and the antisense RNA consisting of the sequence of SEQ ID NO: 2, the strand consisting of the sequence of SEQ ID NO: 3 and dsRNA consisting of strands complementary thereto, SEQ ID NO: 52 SiRNA consisting of a sense RNA consisting of a sequence of and an antisense RNA consisting of a sequence of SEQ ID NO: 53, a dsRNA consisting of a strand consisting of the sequence of SEQ ID NO: 54 and a complementary strand thereof, a sense RNA consisting of the sequence of SEQ ID NO: 55, and SEQ ID NO: 56 SiRNA consisting of an antisense RNA consisting of a sequence of DNA, a strand consisting of a sequence of SEQ ID NO: 57 and a dsRNA consisting of a complementary strand thereof, a siRNA consisting of a sense RNA consisting of a sequence of SEQ ID NO: 58, and an antisense RNA consisting of a sequence of SEQ ID NO: 59, A strand consisting of the strand of SEQ ID NO: 60 and a strand complementary thereto , A siRNA consisting of a sense RNA consisting of a sequence of SEQ ID NO: 61 and an antisense RNA consisting of a sequence of SEQ ID NO: 62, a dsRNA consisting of a strand consisting of the sequence of SEQ ID NO: 63, and a complementary strand thereof, a sense RNA consisting of the sequence of SEQ ID NO: 64 And an siRNA consisting of an antisense RNA consisting of the sequence of SEQ ID NO: 65, a dsRNA consisting of a strand consisting of the sequence of SEQ ID NO: 66 and a strand complementary thereto, a sense RNA consisting of the sequence of SEQ ID NO: 67, and an antisense RNA consisting of the sequence of SEQ ID NO: 68 A siRNA consisting of a siRNA consisting of a strand of SEQ ID NO: 69 and a dsRNA consisting of a strand complementary thereto, a sense RNA consisting of a sequence of SEQ ID NO: 70, and an antisense RNA consisting of a sequence of SEQ ID NO: 71, a sequence of SEQ ID NO: 72 Consisting of dsRNA consisting of a strand consisting of and a strand complementary thereto; Composition comprising at least one siRNA or dsRNA selected from.

19. The composition of 18 above, further comprising a sequence of UU or dTdT at the 3 'end of the sense RNA and antisense RNA sequences.

20. The composition of 17, wherein the composition comprises at least one PNA consisting of one sequence selected from the group consisting of SEQ ID NOs: 87 to 99.

21. The peptide according to the above 20, at least one end of the PNA peptide consisting of at least one sequence selected from the group consisting of SEQ ID NO: 101 to 113; Or mPEG ₅₀₀₀ is further bound.

22. A pharmaceutical composition for the prevention or treatment of fibroproliferative diseases comprising the composition of any one of 11 to 21 above.

23. The method according to the above 22, wherein the fibrotic disease is hypertrophic scar, keloid, fibrosis, pulmonary fibrosis, idiopathic pulmonary fibrosis, liver fibrosis, kidney fibrosis, cystic fibrosis, myelofibrosis, peritoneal fibrosis, scleroderma, diabetic retinopathy , Duchenne muscular dystrophy, radiation-induced fibrosis, myocardial fibrosis, diabetic kidney disease, chronic renal failure, chronic viral hepatitis, biliary fibrosis, fatty hepatitis, alcoholic fatty hepatitis, nonalcoholic steatohepatitis, proliferative vitreoretinopathy, musculoskeletal tumor, osteosarcoma , Rhabdomyosarcoma, glioblastoma, lung cancer, ovarian cancer, esophageal cancer, colon cancer, pancreatic cancer, kidney sclerosis, sarcoidosis, glaucoma, macular degeneration, subretinal fibrosis, choroidal neovascularization, vitreoretinopathy, proliferative vitreoretinopathy, diabetes Retinopathy, keratitis, pterygium, censorship, scleroderma, uterine fibroids, systemic sclerosis, glomerulonephritis, human immunodeficiency viral kidney disease, acute respiratory distress Syndrome, chronic obstructive pulmonary disease, Raynaud, rheumatoid arthritis, multiple myositis, vascular restenosis, periodontal disease, and at least one selected from the group consisting of chijueun composition.

The composition of the present invention contains a nucleic acid molecule capable of effectively inhibiting the expression of CTGF and collagen, it is possible to prevent or treat a variety of fibrotic diseases due to overexpression of CTGF or collagen.

FIG. 1 schematically illustrates the mechanism of inhibition of hypertrophic scars and keloids due to overexpression of CTGF induced by pathological pathways and the effect of inhibiting effective CTGF expression of LEM-S401.

2,3 shows A549 (FIG. 2) and HaCaT (FIG. 3) cells each treated for 6 hours with various doses of LEM-S401 (12.5, 25, 50, 100 nM) for 6 hours and CTGF expression was 12 ng. TGF-ß of / mL, CTGF mRNA expression level was compared with the control (untreated, siCTGF only, DegradaBALL only, scrambled siRNA treatment) using RT-PCR ( * P <0.05, ** P <0.01, *** P <0.005).

4 and 5 show that A549 (FIG. 4) and HaCaT (FIG. 5) cells were treated with lipoid nanoparticles (LiP nanoparticles (LNP)) carrying LEM-S401 and siCTGF, respectively, and the cells were 72 and 96 hours. And TGF-ß was treated 12 hours before harvesting ( * P <0.05, ** P <0.01, *** P <0.005).

FIG. 6 is a subcutaneous injection of LEM-S401 into mouse skin, and fluorescence images of the excised mouse skin were taken at different time points to measure skin retention time of siCTGF and DegradaBALL at the LEM-S401 injection site (1,3,5). 1) (left, Scale bar: 25mm), after the DAPI staining was taken fluorescence image of the treated skin section (right, Scale bar: 100μm).

FIG. 7 shows fluorescence images of resected skin subcutaneously injected with FITC-conjugated siCTGF unsupported in DegradaBALL at different time points (left), and after fluorescence imaging of fluorescence images of skin sections treated in the same manner. Scale bar: 100 μm.

Figures 8 to 15 show the results of subcutaneous injection of LEM-S401 (1 nmol) around the mouse skin wound on

day

0,4,8,12, Figures 8 to 10 mRNA expression of CTGF and

collagen type

1,3 Levels were measured at day 16 using RT-PCR, FIG. 11 shows images of wounded mouse skin treated with skin irregularities and softness between LEM-S401 treated group and control (buffer, DegradaBALL only, siCTGF only). 12 is a fluorescent image of skin sections treated with LEM-S401, free siCTGF, DegradaBALL only and buffer after tissue staining with antibodies that recognize CTGF and

collagen types

1,3, respectively. Secondary antibodies were treated to skin sections (Scale bar: 100 μm), and FIGS. 13 to 15 quantitatively analyze immunohistochemical data based on the image of FIG. 12 ( * P <0.05, ** P <0.01 , *** P <0.005).

Figure 16 shows the toxicity in A549 and HaCaT cells with increasing concentrations of DegradaBALL was measured by CCK-8 analysis.

FIG. 17 shows the results of treatment of A549 and HaCaT cells with 2 ng / mL of TGF-ß for 24 hours. Cells were obtained at different time points, and CTGF expression levels were analyzed by RT-PCR.

18 to 24 show the results of subcutaneous injection of LEM-S401 into the wound site 10, 14, 18 and 22 days after wound formation, and FIGS. 18 to 20 show mRNA expression levels of CTGF and

collagen type

1,3 at the injection site. Measured by RT-PCR, FIG. 21 is a fluorescence image of CTGF and

collagen types

1,3 of the obtained mouse skin was measured by immunohistochemistry (Scale bar: 100 μm), and FIGS. 22 to 24 are immune tissues. Chemical data were quantified ( * P <0.05, ** P <0.01, *** P <0.005).

Fig. 25 shows comparison results of detection of fluorescent images in the body when siRNA was injected subcutaneously with DDV (porous silica particles, DegradaBALL) and when mouse was injected subcutaneously with unsupported free-siRNA.

26,27 show siRNA (# 1) consisting of a sense RNA consisting of a sequence of SEQ ID NO: 1 and an antisense RNA consisting of a sequence of SEQ ID NO: 2; SiRNA (# 2) consisting of a sense RNA consisting of a sequence of SEQ ID NO: 4 and an antisense RNA consisting of a sequence of SEQ ID NO: 5; SiRNA (# 3) consisting of sense RNA consisting of the sequence of SEQ ID NO: 7 and antisense RNA consisting of the sequence of SEQ ID NO: 8 confirmed the inhibitory ability of CTGF expression levels in A549 and HaCaT cells. FIG. 26 shows TGF- 12 hours after siRNA treatment. β was treated, and FIG. 27 was treated with siRNA 24 hours after TGF-ß treatment.

28 is a micrograph of porous silica particles according to one embodiment of the present invention.

29 is a micrograph of porous silica particles according to one embodiment of the present invention.

30 is a micrograph of the small pore particles in the manufacturing process of the porous silica particles according to an embodiment of the present invention.

Figure 31 is a micrograph of the small pore particles according to an embodiment of the present invention.

32 is a micrograph of the pore diameter of the porous silica particles according to one embodiment of the present invention.

DDV (Degradable Delivery Vehicle) is the particle of the embodiment, the number in parenthesis means the diameter of the particle, the number of subscripts means the pore diameter. For example, DDV 200 ₁₀ refers to a particle of an embodiment having a particle diameter of 200 nm and a pore diameter of 10 nm.

Figure 33 is a micrograph to confirm the biodegradability of the porous silica particles according to an embodiment of the present invention.

34 is a tube with a cylindrical permeable membrane according to one example.

35 is a result of decreasing absorbance over time of porous silica particles according to an embodiment of the present invention.

36 is a result of decreasing the absorbance for each particle diameter over time of the porous silica particles according to an embodiment of the present invention.

37 is a result of decreasing absorbance for each pore diameter of porous silica particles according to an embodiment of the present invention over time.

38 is a result of decreasing the absorbance for each pH of the environment over time of the porous silica particles according to an embodiment of the present invention.

39 is a result of the decrease in absorbance over time of the porous silica particles according to one embodiment of the present invention.

40 is a tube confirming siRNA or dsRNA release according to one example.

Figure 41 is the degree of release over time of the siRNA supported on the porous silica particles according to an embodiment of the present invention.

In the detailed description of the present invention, one intends to define a specific meaning of a term, which is to be taken as a meaning understood by those skilled in the art, and is not intended to be limited to the specific meaning defined below.

"siRNA" refers to a nucleic acid molecule capable of mediating RNA interference or gene silencing. siRNA is provided as an efficient gene knockdown method or gene therapy method because it can inhibit the expression of the target gene. The siRNA® molecule may have a double-stranded structure in which the sense strand (corresponding sequence corresponding to the mRNA sequence of the target gene) and the antisense strand (sequence complementary to the mRNA sequence of the target gene) are positioned opposite to each other. In addition, siRNA® molecules may have a single chain structure with self-complementary sense and antisense strands. siRNAs are not limited to the complete pairing of double-stranded RNA portions paired with RNA, but paired by mismatches (the corresponding bases are not complementary), bulges (there are no bases corresponding to one chain), and the like. May be included. The siRNA® terminal structure can be either blunt or cohesive, as long as the expression of the target gene can be suppressed by RNAi (RNA interference) effects. The cohesive end structure can be both a 3'-end protrusion structure and a 5'-end protrusion structure. In addition, siRNA molecules may have a form in which a short nucleotide sequence (eg, about 5-15 nt) is inserted between self-complementary sense and antisense strands, in which case the siRNA molecules formed by expression of the nucleotide sequence are intramolecular hybridization. As a result, the hairpin structure is formed, and as a whole, the stem-and-loop structure is formed. This stem-and-loop structure is processed in vitro or in vivo to produce active “siRNA” molecules that can mediate RNAi.

"dsRNA" is a precursor molecule of siRNA, meets the RISC complex containing the target cell's DICER enzyme (Ribonuclease III) and is cleaved into siRNA, in which RNAi occurs. dsRNA has a sequence that is several nucleotides longer than siRNA, and the double stranded strand of the sense strand (corresponding to the target gene) and the antisense strand (sequence complementary to the mRNA sequence of the target gene) It may have a structure forming a.

"PNA" is a synthetic polymer that has a structure similar to DNA or RNA, but unlike DNA or RNA, and is designed to have no charge, and has a strong binding force, wherein the DNA and RNA are deoxyribose or ribose sugar backbones ( backbones, respectively, while the backbone of the PNA has a structure in which repeating N- (2-aminoethyl) -glycine ((N- (2-aminoethyl) -glycine) units are linked by peptide bonds. A pyrimidine base is linked to the backbone with methylene (-CH _2- ) and carbonyl groups (-C = O-), and similarly to peptides, the N-terminus and C-terminus Have

"Nucleic acid" is meant to include any PNA, DNA or RNA, eg, chromosomes, mitochondria, viruses and / or bacterial nucleic acids present in tissue samples. One or both strands of a double-stranded nucleic acid molecule and any fragment or portion of an intact nucleic acid molecule.

"Gene" means any nucleic acid sequence or portion thereof that has a functional role in protein coding or transcription or in the regulation of other gene expression. The gene may consist of any nucleic acid encoding a functional protein or only a portion of a nucleic acid encoding or expressing a protein. Nucleic acid sequences can include gene abnormalities in exons, introns, initiation or termination regions, promoter sequences, other regulatory sequences, or unique sequences adjacent to genes.

The term "gene expression" generally refers to a cellular process in which a biologically active polypeptide is produced from a DNA sequence and exhibits biological activity in a cell. In that sense, gene expression includes not only transcriptional and translational processes, but also post-transcriptional and posttranslational processes that can affect the biological activity of a gene or gene product. The processes include, but are not limited to, RNA synthesis, processing and transport, as well as post-translational modifications of the polypeptide synthesis, transport and polypeptide. In the case of genes that do not encode protein products, such as siRNA genes, the term "gene expression" refers to the process by which precursor siRNAs are produced from a gene. Typically, this process is referred to as transcription, although unlike transcription induced by RNA polymerase II for a protein coding gene, the transcription product of the siRNA gene is not translated to produce a protein. Nevertheless, generation of mature siRNA from siRNA genes is encompassed by the term "gene expression" as that term is used herein.

The term "target gene" refers to a gene that is targeted for regulation using the methods and compositions of the subject matter disclosed herein. Therefore, the target gene comprises a nucleic acid sequence whose expression level is down regulated by siRNA at the mRNA or polypeptide level. Similarly, the term "target RNA" or "target mRNA" refers to a transcript of a target gene to which siRNA binds to induce regulation of expression of the target gene.

The term "transcription" refers to a cellular process that involves the interaction of an RNA polymerase with a gene that drives expression as RNA of structural information present in the coding sequence of the gene.

The expression “down-regulation” refers to the expression of specific genes in mRNA or the expression of proteins in activated cells by intracellular transcription or translation in activated cells compared to normal tissue cells. Means reduced.

"Treatment" means an approach to obtain beneficial or desirable clinical results. For the purposes of the present invention, beneficial or desirable clinical outcomes include, but are not limited to, alleviation of symptoms, reduction of disease range, stabilization of disease state (ie, not worsening), delay or slowing of disease progression, disease state Improvement or temporary mitigation and alleviation (partially or wholly), detectable or not detected. "Treatment" may also mean increasing survival compared to expected survival when untreated. Treatment refers to both therapeutic treatment and prophylactic or preventive measures. Such treatments include not only the disorders to be prevented but also the treatments required for already occurring disorders.

"Prevention" means any action that inhibits or delays the development of a related disease. It will be apparent to those skilled in the art that the compositions herein can prevent the initial symptoms, or related diseases, if administered before they appear.

Hereinafter, the present invention will be described in detail.

The present invention provides a composition for inhibiting CTGF gene expression comprising; a nucleic acid molecule consisting of a sequence of SEQ ID NO: 1 and a sequence complementary to 10 nucleotides or more.

Complementarity with the sequence of SEQ ID NO: 1, consecutively or discontinuously, at least 10 nucleotides (nt), at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, Or at least 17 nucleotides or all 18 nucleotides.

The nucleic acid molecule may be one strand of siRNA, dsRNA, PNA or miRNA, in which case the siRNA, dsRNA, PNA or miRNA is expressed in the CTGF gene by RNAi (RNA interference). It may be to suppress the, and more specifically, in the mRNA sequence which is a transcript of the CTGF gene, it may be to complementarily bind to at least a portion of the region consisting of the sequence of SEQ ID NO: 1 to inhibit the expression of the CTGF gene.

When the nucleic acid molecule forms a strand of siRNA, dsRNA, PNA or miRNA, the sequence conforms to the conditions to be considered in the design of the siRNA, dsRNA, PNA or miRNA at the level of those skilled in the art. It is obvious that it is designed in this case, in this case, it may be designed to avoid the degradation of RNAi efficiency caused by the hairpin shape (crosspin), cross-shaped (hairpin shape) so as not to have a palindrome sequence. Specifically, for example, siRNA or dsRNA of the present invention may be designed not to include the sequence of SEQ ID NO: 100 (5'-AACUUGAACU-3 '), for example, PNA of the present invention, both ends of the CNA It may be designed to avoid having a complementary relationship with each and G, it can be designed to have a stable RNAi efficiency by maintaining the entire length of the nucleic acid molecule more than the appropriate length.

The total sequence length of the nucleic acid molecule is 10 to 30, 11 to 29, 12 to 28, 13 to 27, 14 to 26, 15 to 25, 16 to 24, 16 to 23, 16 to 22, 16 to 21 or 16 to It may be 20 nucleotides in length, but is not necessarily limited thereto, but preferably 16 to 16 in order to maintain the efficiency of RNAi by maintaining an appropriate length or more, but to maintain the efficiency in vivo by maintaining the appropriate length or less. It may be 20 nucleotides in length.

Specifically, the nucleic acid molecule may be an antisense RNA (sequence of SEQ ID NO: 2) that forms a siRNA by complementarily binding with a sense RNA consisting of the sequence of SEQ ID NO: 1, a strand consisting of the sequence of SEQ ID NO: 3 It may be a strand complementary to the dsRNA to bind to, and the antisense RNA (sequence of SEQ ID NO: 53) that complementarily binds to the sense RNA consisting of the sequence of SEQ ID NO: 1 to form a siRNA, SEQ ID NO: 54 It may be a strand forming a dsRNA by binding complementarily to the strand consisting of a strand, and may be an antisense RNA (sequence of SEQ ID NO: 56) that complementarily binds to a sense RNA consisting of the sequence of SEQ ID NO: 55 to form an siRNA , Strand may form a dsRNA by complementarily binding to a strand consisting of the sequence of SEQ ID NO: 57, and complementarily with a sense RNA consisting of the sequence of SEQ ID NO: 58 Antisense RNA (sequence of SEQ ID NO: 59) combined to form a siRNA, may be a strand complementary to the strand consisting of the sequence of SEQ ID NO: 60 to form a strand forming a dsRNA, sense consisting of the sequence of SEQ ID NO: 61 It may be an antisense RNA (sequence of SEQ ID NO: 62) that binds complementarily with RNA to form an siRNA, may be a strand that binds complementarily with a strand consisting of the sequence of SEQ ID NO: 63 to form a dsRNA, SEQ ID NO: It may be an antisense RNA (SEQ ID NO: 65) that complementarily binds to a sense RNA consisting of a sequence of 64 to form an siRNA, and a strand that binds complementarily to a strand consisting of the sequence of SEQ ID NO: 66 to form a dsRNA. And antisense RNA (sequence of SEQ ID NO: 68) which complementarily binds to the sense RNA consisting of the sequence of SEQ ID NO: 67 to form an siRNA. It may be a strand consisting of dsRNA by binding complementarily to the strand consisting of a strand, and may be an antisense RNA (sequence of SEQ ID NO: 71) that complementarily binds to a sense RNA consisting of the sequence of SEQ ID NO: 70 to form an siRNA It may be a strand forming a dsRNA by binding complementary to the strand consisting of the sequence of SEQ ID NO: 72.

Specifically, the nucleic acid molecule may be a PNA consisting of one sequence selected from the group consisting of SEQ ID NOs: 87 to 99.

Specific information of the above-mentioned sequence is specifically indicated in the attached sequence list and Table 1 below.

Nucleic acid molecules of the present invention are animals including humans, for example monkeys, pigs, horses, cows, sheep, dogs, cats, mice (mice), rabbits (rabbits) and the like, preferably may be of human origin.

The nucleic acid molecule of the present invention has been modified by deletion, substitution or insertion of functional equivalents of the nucleic acid molecule constituting the same, for example, some nucleotide sequences of the nucleic acid molecule of the present invention. It is a concept that includes a variant (variants) that can function functionally the same as the nucleic acid molecule of the invention.

More specifically, when the nucleic acid molecule of the present invention forms a sense RNA or antisense RNA of siRNA, it may further include a sequence of UU or dTdT at the 3 'end of the sense RNA and antisense RNA sequence, which is a nucleic acid The siRNA or dsRNA can be given to the siRNA or the dsRNA by increasing the structural stability of the siRNA or dsRNA by increasing the resistance to the enzyme, and increasing the RNAi efficiency of the siRNA or the dsRNA through the induction of a stable RISC.

More specifically, when the nucleic acid molecule of the present invention forms a PNA, at least one peptide consisting of at least one sequence selected from the group consisting of SEQ ID NOs: 101 to 113; Or mPEG ₅₀₀₀ may be further bound, which may be for the purpose of increasing the solubility or penetration in the composition of the PNA, at the C-terminus at both ends (N-terminus or C-terminus). Bonding is more preferred in that it does not require a separate linker.

Nucleic acid molecules of the present invention may be isolated or prepared using standard molecular biology techniques, such as chemical synthesis or recombinant methods, or may be commercially available. In addition, the composition of the present invention may contain not only the nucleic acid molecule of the present invention, but also other substances capable of increasing the expression rate of the nucleic acid molecule of the present invention in cells, for example, compounds, natural products, novel proteins, and the like. .

On the other hand, the nucleic acid molecule of the present invention can be provided included in the vector for expression in the cell.

Nucleic acid molecules of the present invention can be introduced into cells using a variety of transformation techniques, such as complexes of DNA and DEAE-dextran, complexes of DNA and nuclear proteins, complexes of DNA and lipids, for this purpose nucleic acid molecules of the present invention Can be in a form contained within a carrier that allows for efficient introduction into a cell. The carrier is preferably a vector, and both viral and non-viral vectors can be used. As a viral vector, for example, lentiviruses, retroviruses, adenoviruses, adenoviruses, herpesviruses, and abipoxvirus vectors may be used. Preferably is a lentiviral vector, but is not limited thereto. Lentiviruses are a type of retrovirus that infects dividing as well as dividing cells due to the nucleophilicity of a pre-integrated complex (virus "shell") that enables active introduction into the nucleopore or the complete nuclear membrane. There are features that can be made.

In addition, the vector containing the nucleic acid molecule of the present invention preferably further comprises a selection marker. The "selection marker" is intended to facilitate selection of cells into which the nucleic acid molecule of the present invention has been introduced. The selectable markers that can be used in the vector are not particularly limited as long as they are genes capable of easily detecting or measuring the introduction of the vector, but typically, drug resistance, nutritional requirements, resistance to cytotoxic agents, or surface proteins. Markers that confer a selectable phenotype, such as expression, for example GFP (green fluorescent protein), puromycin, neomycin (Neo), hygromycin (Hyg), histidinol dihydro Genase (histidinol dehydrogenase gene: hisD) and guanine phosphosribosyltransferase (Gpt), and the like, and preferably GFP (green fluorescent protein) and puromycin markers can be used.

The present invention provides a pharmaceutical composition for the prevention or treatment of fibroproliferative diseases comprising the composition described above.

The pharmaceutical composition of the present invention has a prophylactic or therapeutic effect of fibrotic disease, which may be an effect achieved by inhibiting the expression of the CTGF gene of the nucleic acid molecule of the present invention.

Examples of fibrotic diseases, which are diseases to be prevented or treated for the pharmaceutical composition of the present invention, include hypertrophic scars, keloids, fibrosis, pulmonary fibrosis, idiopathic pulmonary fibrosis, liver fibrosis, kidney fibrosis, cystic fibrosis, myelofibrosis, and post-peritoneal Fibrosis, scleroderma, diabetic retinopathy, Duken's muscular dystrophy, radiation-induced fibrosis, myocardial fibrosis, diabetic kidney disease, chronic renal failure, chronic viral hepatitis, biliary fibrosis, fatty hepatitis, alcoholic fatty hepatitis, nonalcoholic steatohepatitis, proliferation Vitreoretinopathy, Musculoskeletal Tumor, Osteosarcoma, Rhabdomyosarcoma, Glioblastoma, Lung Cancer, Ovarian Cancer, Esophageal Cancer, Colon Cancer, Pancreatic Cancer, Renal Sclerosis, Sarcoidosis, Glaucoma, Macular Degeneration, Subretinal Fibrosis, Choroidal Angiogenesis, Vitreoretinal Disease, proliferative vitreoretinopathy, diabetic retinopathy, keratitis, pterygium, censorship, scleroderma, uterine fibroids, systemic sclerosis, glomerulonephritis, human face Deficiency viral renal disease, acute respiratory distress syndrome, chronic obstructive pulmonary disease, Raynaud's disease, rheumatoid arthritis, polymyositis, vascular stenosis, periodontitis and periodontal gingiva may be at least one disease selected from, but not necessarily limited to, CTGF Or it is not particularly limited as long as it corresponds to a disease caused by overexpression such as collagen.

The pharmaceutical composition of the present invention may further comprise a pharmaceutically acceptable carrier, and may be formulated with the carrier. As used herein, the term "pharmaceutically acceptable carrier" refers to a carrier or diluent that does not stimulate the organism and does not inhibit the biological activity and properties of the administered compound. Acceptable pharmaceutical carriers in compositions formulated in liquid solutions are sterile and biocompatible, which include saline, sterile water, Ringer's solution, buffered saline, albumin injectable solutions, dextrose solution, maltodextrin solution, glycerol, ethanol and One or more of these components may be mixed and used, and other conventional additives such as antioxidants, buffers and bacteriostatic agents may be added as necessary. Diluents, dispersants, surfactants, binders and lubricants may also be added in addition to formulate into injectable formulations, pills, capsules, granules or tablets such as aqueous solutions, suspensions, emulsions and the like.

The pharmaceutical composition of the present invention is applicable to any formulation containing the nucleic acid molecule of the present invention as an active ingredient, and can be prepared in oral or parenteral formulations. Pharmaceutical formulations of the present invention may be oral, rectal, nasal, topical (including the cheek and sublingual), subcutaneous, vaginal or parenteral (intramuscular, subcutaneous). And forms suitable for administration by inhalation or insufflation.

The pharmaceutical composition of the present invention is administered in a pharmaceutically effective amount. Effective dose levels depend on the type of disease, severity, activity of the drug, sensitivity to the drug, time of administration, route of administration and rate of release, duration of treatment, factors including concurrent medications, and other factors well known in the medical field. Can be determined. The pharmaceutical compositions of the present invention may be administered as individual therapeutic agents or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be single or multiple doses. Taking all of the above factors into consideration, it is important to administer an amount that can achieve the maximum effect with a minimum amount without side effects, which can be readily determined by one skilled in the art.

The dosage of the pharmaceutical composition of the present invention varies widely depending on the weight, age, sex, health condition, diet, time of administration, administration method, excretion rate and severity of the disease, and the appropriate dosage is, for example, Depending on the amount of drug accumulated in the patient's body and / or the specific efficacy of the nucleic acid molecules of the invention used. It can be calculated on the basis of EC50, which is generally determined to be effective in in vivo animal models and in vitro, for example from 0.01 μg to 1 g per kg of body weight, in unit periods of daily, weekly, monthly or yearly It may be administered once or several times per unit period, or may be continuously administered for a long time using an infusion pump. The number of repeated doses is determined in consideration of the time the drug stays in the body, the drug concentration in the body, and the like. Even after treatment according to the course of the disease treatment, the composition can be administered for relapse.

The pharmaceutical composition of the present invention may further contain a compound which maintains / increases the solubility and / or absorption of at least one active ingredient or the active ingredient having the same or similar function in the treatment of fibroproliferative diseases. It may also optionally further comprise chemotherapeutic agents, anti-inflammatory agents, antiviral agents and / or immunomodulators and the like.

In addition, the pharmaceutical compositions of the present invention may be formulated using methods known in the art to provide rapid, sustained or delayed release of the active ingredient after administration to a mammal. The formulations may be in the form of powders, granules, tablets, emulsions, syrups, aerosols, soft or hard gelatin capsules, sterile injectable solutions, sterile powders.

The composition of the present invention may be carried on a carrier having a nucleic acid molecule that complementarily binds to at least a portion of a transcript of a CTGF gene, and is known in the art as capable of supporting a nucleic acid molecule in a kind of the carrier. If there is no particular limitation, for example, it may be at least one selected from the group consisting of liposomes, lipofectamine, dendrimers, micelles, porous silica particles, aminoclays and hydrogels, but preferably high nucleic acid molecule loading rate, sustained release It may be porous silica particles having advantages such as property, biodegradability and the like.

The present invention provides a composition for inhibiting CTGF gene expression, comprising; porous silica particles carrying nucleic acid molecules that complementarily bind to at least a portion of the transcript of the CTGF gene. The porous silica particles are particles of silica (SiO ₂ ) material, and have a particle size of nano size.

Porous silica nanoparticles of the present invention is a porous particle, having a nano-sized pores, can carry a nucleic acid molecule that complementarily binds to at least a portion of the transcript of the CTGF gene on the surface and / or inside the pores.

Porous silica particles of the present invention are biodegradable particles, which carry a nucleic acid molecule that complementarily binds to at least a portion of the transcript of the CTGF gene, and are complemented to at least a portion of the transcript of the CTGF gene while being biodegraded in the body when administered to the body. The porous silica particles of the present invention may be slowly degraded in the body to allow sustained release of nucleic acid molecules that complementarily bind to at least a portion of the transcript of the supported CTGF gene. have. For example, t, which is the ratio of the absorbance of the following formula 1 to 1/2, is 24 or more:

[Equation 1]

A _t / A ₀

The pH of the suspension is 7.4,

Equation 1 means that the rate at which the porous silica particles are degraded in an environment similar to the body.

Absorbance A ₀ , A _t in Equation 1 may be measured by putting porous silica particles and a suspension in a cylindrical permeable membrane and putting the same suspension outside the permeable membrane, as illustrated in FIG. 34, for example.

The porous silica particles of the present invention are biodegradable, and can be slowly decomposed in suspension, 50 kDa in diameter corresponds to about 5 nm, and biodegradable porous silica particles can pass through a permeable membrane of 50 kDa in diameter, and a cylindrical permeable membrane is 60 rpm horizontal. Under stirring, the suspension can be mixed evenly and the degraded porous silica particles can come out of the permeable membrane.

The absorbance in Equation 1 may be measured, for example, under an environment in which the suspension outside the permeable membrane is replaced with a new suspension. The suspension can be one that is constantly replaced, one that can be replaced every period, and the period can be periodic or irregular. For example, within the range of 1 hour to 1 week, 1 hour interval, 2 hours interval, 3 hours interval, 6 hours interval, 12 hours interval, 24 hours interval, 2 days interval, 3 days interval, 4 days interval, 7 It may be replaced at day intervals, but is not limited thereto.

The ratio of the absorbance to 1/2 means that the absorbance is half of the initial absorbance after t hours, which means that approximately half of the porous silica particles are decomposed.

The suspension may be a buffer solution, for example, at least one selected from the group consisting of phosphate buffered saline (PBS) and simulated body fluid (SBF), and more specifically, PBS.

T of the absorbance ratio of Equation 1 of the present invention is 1/2 or more, for example, t may be 24 to 120, for example, 24 to 96, 24 to 72, 30 within the above range To 70, 40 to 70, 50 to 65 and the like, but is not limited thereto.

In the porous silica particles of the present invention, t, for example, the absorbance ratio of Equation 1 is 1/5 may be, for example, 70 to 140, for example, 80 to 140, 80 to 120, and 80 to 110 within the above range. , 70 to 140, 70 to 120, 70 to 110, and the like, but is not limited thereto.

In the porous silica particles of the present invention, t may be 130 to 220, for example, wherein the ratio of absorbance of Equation 1 is 1/20, for example, 130 to 200, 140 to 200, 140 to 180 within the above range. , 150 to 180, and the like, but is not limited thereto.

The porous silica particles of the present invention may have a measured absorbance of 0.01 or less, for example, 250 or more, for example, 300 or more, 350 or more, 400 or more, 500 or more, 1000 or more, and the upper limit thereof is 2000 days. May be, but is not limited thereto.

In the porous silica particles of the present invention, the ratio of the absorbance of Formula 1 and t have a high positive correlation. For example, the Pearson correlation coefficient may be 0.8 or more, for example, 0.9 or more and 0.95 or more. .

T in Equation 1 means how fast the porous silica particles decompose in an environment similar to the body, for example, the surface area, particle diameter, pore diameter, surface and / or inside the pores of the porous silica particles. It can be controlled by controlling the substituent, the degree of compactness of the surface, and the like.

For example, the surface area of the particles can be increased to reduce t, or the surface area can be reduced to increase t. The surface area can be adjusted by adjusting the diameter of the particles and the diameter of the pores. In addition, by placing substituents on the surface and / or within the pores, it is possible to increase t by reducing the direct exposure of porous silica particles to the environment (such as solvents). In addition, the porous silica particles carry nucleic acid molecules that complementarily bind to at least a portion of the transcript of the CTGF gene, and increase the affinity between the nucleic acid molecules that complementarily bind to at least a portion of the transcript of the CTGF gene and the porous silica particles. In this way, it is possible to increase t by reducing the direct exposure of the porous silica silica particles to the environment. In addition, the surface may be made more densely at the time of preparation of the particles to increase t. In the above, various examples of adjusting t in Equation 1 have been described, but are not limited thereto.

Porous silica particles of the present invention may be, for example, spherical particles, but is not limited thereto.

The porous silica particles of the present invention may have an average diameter of, for example, 150 nm to 1000 nm, for example, within the above range, for example, 150 nm to 800 nm, 150 nm to 500 nm, 150 nm to 400 nm, 150 nm to 300 nm, and 150 nm to 200 nm. May be, but is not limited thereto.

The porous silica particles of the present invention may have an average pore diameter of, for example, 1 nm to 100 nm, for example, within the above range, for example, 5 nm to 100 nm, 7 nm to 100 nm, 7 nm to 50 nm, 10 nm to 50 nm, 10 nm to 30 nm. , 7 nm to 30 nm, but is not limited thereto. A nucleic acid molecule having a large diameter as described above may carry a nucleic acid molecule that complementarily binds to at least a portion of a transcript of a large amount of CTGF gene, and complementarily binds to at least a portion of a transcript of a large CTGF gene. It can also be supported.

The porous silica particles of the present invention may have a BET surface area of, for example, 200 m ² / g to 700 m ² / g. For example, within the above range 200 m ² / g to 700 m ² / g, 200 m ² / g to 650 m ² / g, 250 m ² / g to 650 m ² / g, 300 m ² / g to 700 m ² / g, 300 m ² / g to 650m ² / g, 300m ² / g to 600m ² / g, 300m ² / g to 550m ² / g, 300m ² / g to 500m ² / g, 300m ² / g to 450m ² / g, etc. It is not limited to this.

The porous silica nanoparticles of the present invention may have a volume per g, for example, 0.7 ml to 2.2 ml. For example, within the above range may be 0.7ml to 2.0ml, 0.8ml to 2.2ml, 0,8ml to 2.0ml, 0.9ml to 2.0ml, 1.0ml to 2.0ml and the like, but is not limited thereto. If the volume per gram is too small, the rate of decomposition may be too high, and excessively large particles may be difficult to manufacture or may not have an intact shape.

The porous silica particles of the present invention may have hydrophilic substituents and / or hydrophobic substituents on the outer surface and / or inside the pores. For example, only hydrophilic substituents may exist on both the surface and inside of the pores, or only hydrophobic substituents may exist, hydrophilic substituents may exist on the surface or inside of the pores, hydrophobic substituents may exist on the surface, hydrophilic substituents on the surface, and hydrophobic substituents inside the pores. It may be present and vice versa.

The release of nucleic acid molecules that complementarily bind to at least a portion of the transcript of the CTGF gene supported on the porous silica particles of the present invention is mainly performed by the decomposition of the nanoparticles. The interaction of the porous silica particles with the nucleic acid molecule release environment that complementarily binds to at least a portion of the carcass is regulated so that the rate of degradation of the nanoparticles is controlled to complementally bind to at least a portion of the transcript of the CTGF gene. The release rate may be regulated, and nucleic acid molecules complementarily binding to at least a portion of the transcript of the CTGF gene may be diffused and released from the nanoparticles, and at least a portion of the transcript of the CTGF gene is controlled by the control of the substituents. The binding force of the nucleic acid molecules that complementarily bind to the nanoparticles is controlled to at least the transcript of the CTGF gene. Release of nucleic acid molecules that complementarily bind to some can be controlled.

In addition, hydrophobic substituents are present inside the pores to enhance the binding ability of the poorly soluble (hydrophobic) CTGF gene to at least a portion of the transcript of the transcript, and in view of ease of use and formulation. The surface of the particles may also be treated such that a hydrophilic substituent is present.

Hydrophilic substituents are, for example, hydroxyl groups, carboxy groups, amino groups, carbonyl groups, sulfhydryl groups, phosphate groups, thiol groups, ammonium groups, ester groups, imide groups, thiimide groups, keto groups, ether groups, indene groups, sulfonyl groups, polyethylene Glycol groups and the like, and the hydrophobic substituent is, for example, substituted or unsubstituted C1 to C30 alkyl group, substituted or unsubstituted C3 to C30 cycloalkyl group, substituted or unsubstituted C6 to C30 aryl group, substituted Or an unsubstituted C2 to C30 heteroaryl group, a halogen group, a C1 to C30 ester group, a halogen-containing group, and the like.

In addition, the porous silica particles of the present invention may be one in which the outer surface and / or the inside of the pores are positively charged, negatively charged and / or uncharged. For example, both the surface and the inside of the pore may be positively charged, or may be negatively charged, only the surface or the inside of the pore may be positively charged, or may be negatively charged, the surface may be positively charged, and the interior of the pore may be negatively charged. The reverse is also possible, and vice versa.

The charging may be, for example, by the presence of a nonionic substituent, a cationic substituent or an anionic substituent.

The cationic substituent may be, for example, an amino group, another nitrogen-containing group, or the like as a basic group, and specifically, a heterocyclic aromatic compound group including a amino group, an aminoalkyl group, an alkylamino group, and a nitrogen atom, a cyan group, and a guanidine group. At least one functional group selected from the group consisting of, but is not limited thereto.

The anionic substituent may be, for example, a carboxy group (-COOH), a sulfonic acid group (-SO ₃ H), a thiol group (-SH), etc., as an acidic group, but is not limited thereto.

Likewise, by controlling the substituents, the interaction of the porous silica particles with the nucleic acid molecule release environment that complementarily binds to at least a part of the transcript of the CTGF gene is regulated by controlling the substituent, thereby controlling the rate of degradation of the nanoparticles themselves. The rate of release of nucleic acid molecules complementarily binding to at least a portion of the transcript may be controlled, and the nucleic acid molecules complementarily binding to at least a portion of the transcript of the CTGF gene may be diffused and released from the nanoparticles. By controlling the substituents, the binding force of the nucleic acid molecules that complementarily bind to at least a portion of the transcript of the CTGF gene is controlled to the nanoparticles, thereby controlling the release of the nucleic acid molecules that complementarily bind to the transcript of the CTGF gene. Can be.

In addition, the porous silica particles of the present invention support nucleic acid molecules that complementarily bind to at least a portion of the transcript of the CTGF gene in addition to the surface and / or the pores thereof, and complementarily to at least a portion of the transcript of the CTGF gene. Substituents may be used to transfer the binding nucleic acid molecules to target cells, to carry a substance for other purposes, or to bind other additional substituents, and may further include antibodies, ligands, cell permeable peptides, or aptamers bound thereto. It may include.

Substituents, charges, binders and the like within the aforementioned surfaces and / or pores may be added, for example, by surface modification.

Surface modification can be carried out, for example, by reacting a compound having a substituent to be introduced with the particles, which may be, for example, an alkoxysilane having a C1 to C10 alkoxy group, but is not limited thereto. The alkoxysilane has one or more alkoxy groups, and may have, for example, 1 to 3, and there may be a substituent to be introduced into a site where the alkoxy group is not bonded or a substituent substituted therewith.

For example, the porous silica particles of the present invention may be manufactured through a small pore particle preparation and a pore expansion process, and may be manufactured through a calcination process, a surface modification process, and the like, as necessary. If both the calcination and the surface modification process has gone through may be surface modified after calcination.

The small pore particles may be, for example, particles having an average pore diameter of 1 nm to 5 nm.

The small pore particles can be obtained by adding a surfactant and a silica precursor in a solvent, stirring and homogenizing.

The solvent may be water and / or an organic solvent, and the organic solvent may be, for example, ethers such as 1,4-dioxane (particularly cyclic ethers); Halogenated hydrocarbons such as chloroform, methylene chloride, carbon tetrachloride, 1,2-dichloroethane, dichloroethylene, trichloroethylene, perchloroethylene, dichloropropane, amyl chloride and 1,2-dibromoethane; Acetone, methyl isobutyl ketone, γ-butyrolactone, 1,3-dimethyl-imidazolidinone, methyl ethyl ketone, cyclohexanone, cyclopentanone, 4-hydroxy-4-methyl-2-pentanone, etc. Ketones; Carbon-based aromatics such as benzene, toluene, xylene and tetramethylbenzene; Alkyl amides such as N, N-dimethylformamide, N, N-dibutylformamide, N, N-dimethylacetamide and N-methylpyrrolidone; Alcohols such as methanol, ethanol, propanol and butanol; Ethylene glycol monoethyl ether, ethylene glycol monomethyl ether, ethylene glycol monobutyl ether, diethylene glycol monoethyl ether, diethylene glycol monomethyl ether, diethylene glycol monobutyl ether, propylene glycol monomethyl ether, propylene glycol monoethyl ether Glycol ethers (cellosolve) such as dipropylene glycol diethyl ether and triethylene glycol monoethyl ether; Dimethylacetamide (DMAc), N, N-diethylacetamide, dimethylformamide (DMF), diethylformamide (DEF), N, N-dimethylacetamide (DMAc), N-methylpyrrolidone ( NMP), N-ethylpyrrolidone (NEP), 1,3-dimethyl-2-imidazolidinone, N, N-dimethylmethoxyacetamide, dimethyl sulfoxide, pyridine, dimethyl sulfone, hexamethylphosphoamide , Tetramethylurea, N-methylcarrolactam, tetrahydrofuran, m-dioxane, P-dioxane, 1,2-dimethoxyethane and the like can be used. Specifically, alcohol, more specifically methanol can be used. May be, but is not limited thereto.

When using a mixed solvent of the water and the organic solvent, the ratio may be, for example, water and the organic solvent in a volume ratio of 1: 0.7 to 1.5, for example, 1: 1: 0.8 to 1.3, but is not limited thereto.

The surfactant may be, for example, cetyltrimethylammonium bromide (CTAB), hexadecyltrimethylammonium bromide (TMABr), hexadecyltrimethylpyridinium chloride (TMPrCl), tetramethylammonium chloride (TMACl), and the like, and specifically, CTAB may be used.

The surfactant may be added, for example, in an amount of 1 g to 10 g, for example, 1 g to 8 g, 2 g to 8 g, 3 g to 8 g, etc., per liter of solvent, but is not limited thereto.

The silica precursor may be added after stirring with the addition of a surfactant to the solvent. The silica precursor may be, for example, tetramethyl orthosilicate (TMOS), but is not limited thereto.

The stirring may be performed, for example, for 10 minutes to 30 minutes, but is not limited thereto.

The silica precursor may be added, for example, 0.5 ml to 5 ml per liter of solvent, for example, 0.5 ml to 4 ml, 0.5 ml to 3 ml, 0.5 ml to 2 ml, 1 ml to 2 ml, etc. within the above range, but is not limited thereto. It doesn't happen.

If necessary, sodium hydroxide may further be used as a catalyst, which may be added with stirring after adding the surfactant to the solvent and before adding the silica precursor.

The sodium hydroxide may be, for example, 0.5 ml to 8 ml per liter of solvent, for example, 0.5 ml to 5 ml, 0.5 ml to 4 ml, 1 ml to 4 ml, 1 ml to 3 ml, 2 ml to 3 ml, etc., based on 1 M aqueous sodium hydroxide solution. However, it is not limited thereto.

After addition of the silica precursor, the solution can be reacted with stirring. The stirring may be performed for example, for 2 hours to 15 hours, for example, within the above range, for example, 3 hours to 15 hours, 4 hours to 15 hours, 4 hours to 13 hours, 5 hours to 12 hours, 6 hours to 12 hours. , 6 hours to 10 hours, and the like, but is not limited thereto. If the stirring time (reaction time) is too short, nucleation may be insufficient.

After the agitation, the solution may be aged. Aging may be performed for example, from 8 hours to 24 hours, for example, within the range of 8 hours to 20 hours, 8 hours to 18 hours, 8 hours to 16 hours, 8 hours to 14 hours, 10 hours to 16 hours. , 10 hours to 14 hours, and the like, but is not limited thereto.

Thereafter, the reaction product may be washed and dried to obtain porous silica particles, and if necessary, separation of unreacted material may be preceded before washing.

Separation of the unreacted material may be carried out by separating the supernatant, for example by centrifugation, centrifugation may be carried out, for example at 6,000 to 10,000 rpm, the time is for example 3 minutes to 60 minutes, For example, it may be performed within 3 minutes to 30 minutes, 3 minutes to 30 minutes, 5 minutes to 30 minutes, and the like, but is not limited thereto.

The washing may be performed with water and / or an organic solvent, and in particular, since a substance that can be dissolved in each solvent may be different, water and an organic solvent may be used once or several times, or once or even with water or an organic solvent alone. Can be washed several times. The number of times may be, for example, two or more, ten or less, for example, three or more and ten or less, four or more and eight or less, four or more and six or less.

The organic solvent may be, for example, ethers such as 1,4-dioxane (particularly cyclic ethers); Halogenated hydrocarbons such as chloroform, methylene chloride, carbon tetrachloride, 1,2-dichloroethane, dichloroethylene, trichloroethylene, perchloroethylene, dichloropropane, amyl chloride and 1,2-dibromoethane; Acetone, methyl isobutyl ketone, γ-butyrolactone, 1,3-dimethyl-imidazolidinone, methyl ethyl ketone, cyclohexanone, cyclopentanone, 4-hydroxy-4-methyl-2-pentanone, etc. Ketones; Carbon-based aromatics such as benzene, toluene, xylene and tetramethylbenzene; Alkyl amides such as N, N-dimethylformamide, N, N-dibutylformamide, N, N-dimethylacetamide and N-methylpyrrolidone; Alcohols such as methanol, ethanol, propanol and butanol; Ethylene glycol monoethyl ether, ethylene glycol monomethyl ether, ethylene glycol monobutyl ether, diethylene glycol monoethyl ether, diethylene glycol monomethyl ether, diethylene glycol monobutyl ether, propylene glycol monomethyl ether, propylene glycol monoethyl ether Glycol ethers (cellosolve) such as dipropylene glycol diethyl ether and triethylene glycol monoethyl ether; Dimethylacetamide (DMAc), N, N-diethylacetamide, dimethylformamide (DMF), diethylformamide (DEF), N, N-dimethylacetamide (DMAc), N-methylpyrrolidone ( NMP), N-ethylpyrrolidone (NEP), 1,3-dimethyl-2-imidazolidinone, N, N-dimethylmethoxyacetamide, dimethyl sulfoxide, pyridine, dimethyl sulfone, hexamethylphosphoamide , Tetramethylurea, N-methylcarrolactam, tetrahydrofuran, m-dioxane, P-dioxane, 1,2-dimethoxyethane and the like can be used. Specifically, alcohol, more specifically ethanol can be used. May be, but is not limited thereto.

The washing may be carried out under centrifugation, for example at 6,000 to 10,000 rpm, the time being for example 3 to 60 minutes, for example 3 to 30 minutes, 3 within the above range. It may be performed in minutes to 30 minutes, 5 minutes to 30 minutes and the like, but is not limited thereto.

The washing may be performed by filtering out particles with a filter without centrifugation. The filter may have pores less than or equal to the diameter of the porous silica particles. Filtering the reaction liquid with such a filter leaves only particles on the filter, which can be washed by pouring water and / or an organic solvent on the filter.

In the washing, water and an organic solvent may be used alternately once or several times, and may be washed once or several times even with water or an organic solvent alone. The number of times may be, for example, two or more, ten or less, for example, three or more and ten or less, four or more and eight or less, four or more and six or less.

For example, the drying may be performed at 20 ° C. to 100 ° C., but is not limited thereto, and may be performed in a vacuum state.

Thereafter, the pores of the obtained porous silica particles are expanded, and the pore expansion may be performed using a pore swelling agent.

For example, the pore swelling agent may be trimethylbenzene, triethylbenzene, tripropylbenzene, tributylbenzene, tripentylbenzene, trihexylbenzene, toluene, benzene, and the like, and specifically, trimethylbenzene may be used. It is not limited.

In addition, the pore swelling agent may use, for example, N, N-dimethylhexadecylamine (N, N-dimethylhexadecylamine, DMHA), but is not limited thereto.

The pore expansion may be carried out, for example, by mixing porous silica particles in a solvent with a pore swelling agent and heating to react.

The solvent may be, for example, water and / or an organic solvent, and the organic solvent may be, for example, ethers such as 1,4-dioxane (particularly cyclic ethers); Halogenated hydrocarbons such as chloroform, methylene chloride, carbon tetrachloride, 1,2-dichloroethane, dichloroethylene, trichloroethylene, perchloroethylene, dichloropropane, amyl chloride and 1,2-dibromoethane; Ketones such as acetone, methyl isobutyl ketone and cyclohexanone; Carbon-based aromatics such as benzene, toluene and xylene; Alkyl amides such as N, N-dimethylformamide, N, N-dibutylformamide, N, N-dimethylacetamide and N-methylpyrrolidone; Alcohols such as methanol, ethanol, propanol and butanol; And the like, and specifically, alcohol, more specifically ethanol can be used, but is not limited thereto.

The porous silica particles are, for example, 10 g to 200 g per liter of solvent, for example, 10 g to 150 g, 10 g to 100 g, 30 g to 100 g, 40 g to 100 g, 50 g to 100 g, 50 g to 80 g, 60 g to 80 g, etc., within the above range. It may be added in a ratio of, but is not limited thereto.

The porous silica particles may be evenly dispersed in a solvent, for example, the porous silica particles may be added to the solvent and ultrasonically dispersed. In the case of using a mixed solvent, the second solvent may be added after the porous silica particles are dispersed in the first solvent.

The pore swelling agent is for example 10 to 200 parts by volume, 100 to 150 parts by volume, 10 to 100 parts by volume, 10 to 80 parts by volume, 30 to 80 parts by volume, 30 to 80 parts by volume based on 100 parts by volume of solvent. 70 parts by volume may be added, but is not limited thereto.

The reaction can be carried out, for example, at 120 ° C to 190 ° C. For example, within the range of 120 ℃ to 190 ℃, 120 ℃ to 180 ℃, 120 ℃ to 170 ℃, 130 ℃ to 170 ℃, 130 ℃ to 160 ℃, 130 ℃ to 150 ℃, 130 ℃ to 140 ℃ It may be performed, but is not limited thereto.

The reaction may be performed, for example, for 6 hours to 96 hours. For example, within the range of 30 hours to 96 hours, 30 hours to 96 hours, 30 hours to 80 hours, 30 hours to 72 hours, 24 hours to 80 hours, 24 hours to 72 hours, 36 hours to 96 hours, 36 36 hours to 80 hours, 36 hours to 72 hours, 36 hours to 66 hours, 36 hours to 60 hours, 48 hours to 96 hours, 48 hours to 88 hours, 48 hours to 80 hours, 48 hours to 72 hours, 6 hours to 96 hours, 7 hours to 96 hours, 8 hours to 80 hours, 9 hours to 72 hours, 9 hours to 80 hours, 6 hours to 72 hours, 9 hours to 96 hours, 10 hours to 80 hours, 10 hours to 72 hours , 12 hours to 66 hours, 13 hours to 60 hours, 14 hours to 96 hours, 15 hours to 88 hours, 16 hours to 80 hours, 17 hours to 72 hours, and the like, but is not limited thereto.

The time and temperature can be adjusted within the ranges exemplified above so that the reaction can be carried out sufficiently without excess. For example, when the reaction temperature is lowered, the reaction time may be increased, or when the reaction temperature is lowered, the reaction time may be shortened. If the reaction is not sufficient, the expansion of the pores may not be sufficient, and if the reaction proceeds excessively, the particles may collapse due to the expansion of the pores.

The reaction can be carried out, for example, by gradually raising the temperature. Specifically, it may be carried out by gradually raising the temperature at a rate of 0.5 ℃ / min to 15 ℃ / min from the room temperature to the above temperature, for example, 1 ℃ / min to 15 ℃ / min, 3 ℃ / min within the above range To 15 ° C./minute, 3 ° C./minute to 12 ° C./minute, 3 ° C./minute to 10 ° C./minute, and the like, but are not limited thereto.

The reaction can be carried out under stirring. For example, it may be stirred at a speed of 100 rpm or more, and specifically, may be performed at a speed of 100 rpm to 1000 rpm, but is not limited thereto.

After the reaction, the reaction solution can be cooled slowly, for example, it can be cooled by gradually reducing the temperature. Specifically, it may be carried out by gradually decreasing the temperature at a rate of 0.5 ℃ / min to 20 ℃ / min from the temperature to room temperature, for example, 1 ℃ / min to 20 ℃ / min, 3 ℃ / min to within the above range 20 ° C./minute, 3 ° C./minute to 12 ° C./minute, 3 ° C./minute to 10 ° C./minute, and the like, but is not limited thereto.

After cooling, the reaction product may be washed and dried to obtain porous silica particles having expanded pores, and if necessary, separation of unreacted material may be preceded before washing.

The washing may be performed with water and / or an organic solvent, and in particular, since a substance that can be dissolved in each solvent may be different, water and an organic solvent may be used once or several times, or once or even with water or an organic solvent alone. Can be washed several times. The number of times may be, for example, two or more times, ten times or less, for example, three times, four times, five times, six times, seven times, eight times, and the like.

The organic solvent may be, for example, ethers such as 1,4-dioxane (particularly cyclic ethers); Halogenated hydrocarbons such as chloroform, methylene chloride, carbon tetrachloride, 1,2-dichloroethane, dichloroethylene, trichloroethylene, perchloroethylene, dichloropropane, amyl chloride and 1,2-dibromoethane; Ketones such as acetone, methyl isobutyl ketone and cyclohexanone; Carbon-based aromatics such as benzene, toluene and xylene; Alkyl amides such as N, N-dimethylformamide, N, N-dibutylformamide, N, N-dimethylacetamide and N-methylpyrrolidone; Alcohols such as methanol, ethanol, propanol and butanol; And the like, and specifically, alcohol, more specifically ethanol can be used, but is not limited thereto.

Thereafter, the obtained particles may be calcined, which is a process of heating the particles to remove silanol groups on the surface and inside thereof to lower the reactivity of the particles, to have a more compact structure, and to remove organic substances filling the pores. For example, it may be heated to a temperature of 400 ℃ or more. The upper limit thereof is not particularly limited, and may be, for example, 1000 ° C, 900 ° C, 800 ° C, 700 ° C, or the like. Heating can be carried out for example for 3 hours or more. The upper limit is not particularly limited and may be, for example, 24 hours, 12 hours, 10 hours, 8 hours, 6 hours, or the like. More specifically, it may be performed for 3 hours to 8 hours at 400 ° C to 700 ° C, specifically 4 hours to 5 hours at 500 ° C to 600 ° C, but is not limited thereto.

By removing the organic matter filling the pores, it is possible to prevent problems such as cytotoxicity and foaming caused by the remaining organic matter.

The porous silica particles obtained can then be surface modified, and the surface modification can be carried out on the surface and / or inside the pores. The particle surface and the inside of the pore may be surface modified identically, or may be surface modified differently.

The surface modification can cause the particles to charge or to have hydrophilic and / or hydrophobic properties.

More specifically, in order to effectively support a nucleic acid molecule that complementarily binds to at least a portion of the transcript of the CTGF gene, a heterocyclic aromatic compound group including an amino group, an aminoalkyl group, an alkylamino group, a nitrogen atom, a cyan group and a guanidine group Surface modification of the porous silica particles may be performed by having at least one substituent selected from the group consisting of.

Surface modification can be carried out, for example, by reacting a compound having substituents such as hydrophilic, hydrophobic, cationic, anionic and the like to be introduced with the particles, and the compound can be, for example, an alkoxysilane having a C1 to C10 alkoxy group. However, it is not limited thereto.

The alkoxysilane has one or more alkoxy groups, and may have, for example, 1 to 3, and there may be a substituent to be introduced into a site where the alkoxy group is not bonded or a substituent substituted therewith.

When the alkoxysilane reacts with the porous silicon particles, a covalent bond is formed between the silicon atom and the oxygen atom so that the alkoxysilane may be bonded to the surface and / or the inside of the pores of the porous silicon particle, and the alkoxysilane has a substituent to be introduced. As such, the corresponding substituents may be introduced into the surface of the porous silicon particles and / or within the pores.

The reaction may be carried out by reacting porous silica particles dispersed in a solvent with an alkoxysilane.

The solvent may be water and / or an organic solvent, and the organic solvent may be, for example, ethers such as 1,4-dioxane (particularly cyclic ethers); Halogenated hydrocarbons such as chloroform, methylene chloride, carbon tetrachloride, 1,2-dichloroethane, dichloroethylene, trichloroethylene, perchloroethylene, dichloropropane, amyl chloride and 1,2-dibromoethane; Acetone, methyl isobutyl ketone, γ-butyrolactone, 1,3-dimethyl-imidazolidinone, methyl ethyl ketone, cyclohexanone, cyclopentanone, 4-hydroxy-4-methyl-2-pentanone, etc. Ketones; Carbon-based aromatics such as benzene, toluene, xylene and tetramethylbenzene; Alkyl amides such as N, N-dimethylformamide, N, N-dibutylformamide, N, N-dimethylacetamide and N-methylpyrrolidone; Alcohols such as methanol, ethanol, propanol and butanol; Ethylene glycol monoethyl ether, ethylene glycol monomethyl ether, ethylene glycol monobutyl ether, diethylene glycol monoethyl ether, diethylene glycol monomethyl ether, diethylene glycol monobutyl ether, propylene glycol monomethyl ether, propylene glycol monoethyl ether Glycol ethers (cellosolve) such as dipropylene glycol diethyl ether and triethylene glycol monoethyl ether; Dimethylacetamide (DMAc), N, N-diethylacetamide, dimethylformamide (DMF), diethylformamide (DEF), N, N-dimethylacetamide (DMAc), N-methylpyrrolidone ( NMP), N-ethylpyrrolidone (NEP), 1,3-dimethyl-2-imidazolidinone, N, N-dimethylmethoxyacetamide, dimethyl sulfoxide, pyridine, dimethyl sulfone, hexamethylphosphoamide , Tetramethylurea, N-methylcarrolactam, tetrahydrofuran, m-dioxane, P-dioxane, 1,2-dimethoxyethane and the like can be used. Specifically, toluene can be used, but is not limited thereto. It doesn't happen.

The charge to the positive charge can be carried out by reacting with an alkoxysilane having a basic group such as a nitrogen-containing group such as an amino group, an aminoalkyl group, for example. Specifically, N- [3- (Trimethoxysilyl) propyl] ethylenediamine, N1- (3-Trimethoxysilylpropyl) diethylenetriamine, (3-Aminopropyl) trimethoxysilane, N- [3- (Trimethoxysilyl) propyl] aniline, Trimethoxy [3- (methylamino) propyl] silane, 3- (2-Aminoethylamino) propyldimethoxymethylsilane, etc. may be used, but is not limited thereto.

Charging to the negative charge may be carried out by reacting with an alkoxysilane having an acidic group such as, for example, a carboxyl group, a sulfonic acid group, a thiol group, and the like. Specifically, (3-Mercaptopropyl) trimethoxysilane may be used, but is not limited thereto.

The charge to the non-charge (not positive or negative charge, non-charged state) can be carried out by reacting with an alkoxysilane having a common functional group having no charge, a combination of charging to the positive charge and negative charge appropriately By doing so, it is possible to charge with no charge through the offset of positive and negative charge, but is not limited thereto.

The hydrophilic property is a hydrophilic group such as hydroxy group, carboxy group, amino group, carbonyl group, sulfhydryl group, phosphate group, thiol group, ammonium group, ester group, imide group, thiimide group, keto group, ether group, indene group, sulfo It may be made to react with the alkoxysilane which has a silyl group, a polyethyleneglycol group, etc. Specifically, N- [3- (Trimethoxysilyl) propyl] ethylenediamine, N1- (3-Trimethoxysilylpropyl) diethylenetriamine, (3-Aminopropyl) trimethoxysilane, (3-Mercaptopropyl) trimethoxysilane, Trimethoxy [3- (methylamino) propyl] silane, 3- (2-Aminoethylamino) propyldimethoxymethylsilane may be used, but is not limited thereto.

The hydrophobic nature may include hydrophobic substituents such as substituted or unsubstituted C1 to C30 alkyl groups, substituted or unsubstituted C3 to C30 cycloalkyl groups, substituted or unsubstituted C6 to C30 aryl groups, substituted or unsubstituted It can be made to react with the alkoxysilane which has a C2-C30 heteroaryl group, a halogen group, C1-C30 ester group, a halogen containing group, etc. Specifically, Trimethoxy (octadecyl) silane, Trimethoxy-n-octylsilane, Trimethoxy (propyl) silane, Isobutyl (trimethoxy) silane, Trimethoxy (7-octen-1-yl) silane, Trimethoxy (3,3,3-trifluoropropyl) Silane, Trimethoxy (2-phenylethyl) silane, Vinyltrimethoxysilane, Cyanomethyl, 3- (trimethoxysilyl) propyl] trithiocarbonate, (3-Bromopropyl) trimethoxysilane, etc. may be used, but is not limited thereto.

In addition, hydrophobic substituents are present in the pores to enhance the binding force with nucleic acid molecules or substances complementarily bound to at least a part of the transcript of the poorly soluble (hydrophobic) CTGF gene through the surface modification. In terms of ease and the like, the surface of the particle may be treated such as to have a hydrophilic substituent, and a substituent may be present on the surface to bind a nucleic acid molecule or a substance complementarily to at least a portion of a transcript of another CTGF gene. It may be.

In addition, the surface modification may be carried out in combination. For example, two or more surface modifications may be performed on the outer surface or inside the pores. As a specific example, a compound including a carboxyl group may be bonded to silica particles into which amino groups are introduced by amide bonds to change the positively charged particles to have different surface properties, but is not limited thereto.

The reaction of the porous silica particles with the alkoxysilane can be carried out, for example, under heating, and the heating is for example from 80 ° C. to 180 ° C., for example from 80 ° C. to 160 ° C., from 80 ° C. to 150 ° C. within the above range. , 100 ° C. to 160 ° C., 100 ° C. to 150 ° C., 110 ° C. to 150 ° C., etc., but is not limited thereto.

The reaction of the porous silica particles with the alkoxysilane is, for example, 4 hours to 20 hours, for example, 4 hours to 18 hours, 4 hours to 16 hours, 6 hours to 18 hours, 6 hours to 16 hours within the above range. , 8 hours to 18 hours, 8 hours to 16 hours, 8 hours to 14 hours, 10 hours to 14 hours, etc., but is not limited thereto.

The reaction temperature, time, and the amount of the compound used for surface modification may be selected according to the degree to be surface modified, and the reaction conditions vary depending on the degree of hydrophilicity, hydrophobicity, and charge of the nucleic acid molecules or materials of the present invention. By controlling the degree of hydrophilicity, hydrophobicity, and charge of the porous silica particles, the release rate of nucleic acid molecules or substances that complementarily bind to at least a portion of the transcript of the CTGF gene can be controlled. For example, if nucleic acid molecules or substances that complementarily bind to at least a portion of the transcript of the CTGF gene have a strong negative charge at neutral pH, the reaction temperature is increased to make the porous silica particles have a strong positive charge. Or increase the reaction time and increase the compound throughput, but are not limited thereto.

In addition, the porous silica particles of the present invention may be produced through, for example, the preparation of small pores, pore expansion, surface modification, and internal pore modification.

The small pore particle production and pore expansion process may be based on the above-described process, and the washing and drying process may be performed after the small pore particle production and after the pore expansion process.

If necessary, separation of the unreacted material may be preceded before washing, and separation of the unreacted material may be performed by separating the supernatant, for example, by centrifugation.

The centrifugation may be performed, for example, at 6,000 to 10,000 rpm, and the time may be, for example, 3 to 60 minutes, specifically, 3 to 30 minutes, 3 to 30 minutes, and 5 minutes within the above range. To 30 minutes, etc., but is not limited thereto.

The washing after the preparation of the particles of the small pores may be performed by a method / condition within the above-described range, but is not limited thereto.

The washing after the pore expansion may be performed under more relaxed conditions than the above example. For example, washing may be performed within three times, but is not limited thereto.

The surface modification and internal pore modification may be by the processes described above, respectively, the process may be performed in the order of surface modification and internal pore modification, and the washing process of the particles may be further performed between the two processes. Can be.

When the washing is performed in a more relaxed condition after the particle production and pore expansion of the small pores, the reaction solution such as a surfactant used for particle production and pore expansion is filled in the pores so that the inside of the pores is not modified during surface modification. Only the surface can be modified. Then, washing the particles may remove the reaction solution in the pores.

Particle washing between the surface modification and the internal pore reforming process may be water and / or an organic solvent, and in particular, water and an organic solvent may be alternately used once or several times because different materials may be dissolved for each solvent. Water or organic solvents alone may be washed once or several times. The number of times may be, for example, two or more, ten or less, specifically, three or more and ten or less, four or more and eight or less, four or more and six or less.

The washing may be carried out under centrifugation, for example at 6,000 to 10,000 rpm, the time being for example 3 to 60 minutes, specifically 3 to 30 minutes, 3 within the above range. It may be performed in minutes to 30 minutes, 5 minutes to 30 minutes and the like, but is not limited thereto.

In the washing, water and an organic solvent may be used alternately once or several times, and may be washed once or several times even with water or an organic solvent alone. The number of times may be, for example, two or more, ten or less, specifically, three or more and ten or less, four or more and eight or less, four or more and six or less.

Nucleic acid molecules complementarily bound to at least a portion of the transcript of the CTGF gene may be supported on the surface and / or within the pores of the porous silica particles, and the supported nucleic acid may be, for example, a porous silica particle in a solvent and a transcript of the CTGF gene. It may be performed by mixing a nucleic acid molecule that binds to at least a portion complementarily.

The solvent may be water and / or an organic solvent, and the organic solvent may be, for example, ethers such as 1,4-dioxane (particularly cyclic ethers); Halogenated hydrocarbons such as chloroform, methylene chloride, carbon tetrachloride, 1,2-dichloroethane, dichloroethylene, trichloroethylene, perchloroethylene, dichloropropane, amyl chloride and 1,2-dibromoethane; Ketones such as acetone, methyl isobutyl ketone and cyclohexanone; Carbon-based aromatics such as benzene, toluene and xylene; Alkyl amides such as N, N-dimethylformamide, N, N-dibutylformamide, N, N-dimethylacetamide and N-methylpyrrolidone; Alcohols such as methanol, ethanol, propanol and butanol; Etc. can be used.

In addition, PBS (phosphate buffered saline solution), SBF (Simulated Body Fluid), Borate-buffered saline, Tris-buffered saline may be used as the solvent.

The ratio of the porous silica particles and the nucleic acid molecule of the present invention is not particularly limited, for example, the weight ratio is 1: 0.05 to 0.8, for example, within the above range 1: 0.05 to 0.7, 1: 0.05 to 0.6, 1: 0.1 to 0.8, 1: 0.1 to 0.6, 1: 0.2 to 0.8, 1: 0.2 to 0.6, and the like.

Nucleic acid molecules complementarily binding to at least a portion of the transcript of the CTGF gene supported on the porous silica particles may be gradually released over an extended time. Such slow release may be continuous or discontinuous, linear or nonlinear, due to the characteristics of the porous silica particles and / or their interaction with nucleic acid molecules that complementarily bind to at least a portion of the transcript of the CTGF gene. Can vary.

A nucleic acid molecule that complementarily binds to at least a portion of the transcript of the CTGF gene supported on the porous silica particles is released as the porous silica particles are biodegraded, and the porous silica particles according to the present invention are slowly degraded to transfer the supported CTGF gene. Nucleic acid molecules that complementarily bind to at least a portion of the corpse can be released in a sustained manner. This may be controlled by, for example, adjusting the surface area, particle diameter, pore diameter, substituents on the surface and / or pores, degree of compactness of the porous silica particles, and the like, but are not limited thereto.

In addition, nucleic acid molecules complementarily bound to at least a portion of the transcript of the CTGF gene supported on the porous silica particles may be released while being separated from the porous silica particles and diffused, and thus, the transcripts of the porous silica particles and the CTGF gene may be released. It is influenced by the relationship with the nucleic acid molecule complementarily binding to at least a portion, the nucleic acid molecule release environment complementary to at least a portion of the transcript of the CTGF gene, thereby controlling at least the transcript of the CTGF gene The release of nucleic acid molecules that complementarily bind to some can be regulated. For example, it can be controlled by enhancing or weakening the binding strength of the porous silica particles to nucleic acid molecules that complementarily bind to at least a part of the transcript of the CTGF gene of the porous silica particles.

More specifically, in the case where the nucleic acid molecule or substance complementary to at least a part of the transcript of the supported CTGF gene is poorly soluble (hydrophobic), the surface of the particle and / or the inside of the pore have a hydrophobic substituent so that the porous silica The binding force between the particle and the nucleic acid molecule or substance complementarily binding to at least a portion of the transcript of the CTGF gene may be increased, whereby the nucleic acid molecule or substance complementarily binding to at least a portion of the transcript of the CTGF gene This can be released slowly. This may be, for example, the surface-modified porous silica particles with an alkoxysilane having a hydrophobic substituent.

As used herein, "poorly soluble" means to be insoluble (practically insoluble) or only slightly soluble (with respect to water), which means "Pharmaceutical Science" 18 ^th Edition ( USP, Remington, Mack Publishing Company).

The poorly water-soluble material may be, for example, water solubility of less than 10 g / L, specifically less than 5 g / L, more specifically less than 1 g / L at 1 atmosphere and 25 ° C., but is not limited thereto.

When the nucleic acid molecule or substance complementarily binding to at least a part of the transcript of the supported CTGF gene is water-soluble (hydrophilic), the surface of the particle and / or the inside of the pore have a hydrophilic substituent, so that the porous silica particles and the transcript of the CTGF gene The binding force with a nucleic acid molecule or substance complementarily binding to at least a portion of the may be increased, whereby the nucleic acid molecule or substance complementarily binding to at least a portion of the transcript of the CTGF gene may be released in a sustained manner. have. This may be, for example, the surface of the porous silica particles modified with an alkoxysilane having a hydrophilic substituent.

For example, the water-soluble substance may have a water solubility of 10 g / L or more at 1 atmosphere and 25 ° C., but is not limited thereto.

In the case where a nucleic acid molecule or substance complementary to at least a portion of the transcript of a supported CTGF gene is charged, the surface of the particle and / or the inside of the pore are charged with opposite charges, thereby The binding force with the nucleic acid molecule or substance complementarily binding to at least a portion of the transcript may be increased, whereby the nucleic acid molecule or substance complementarily binding to at least a portion of the transcript of the CTGF gene is released slowly. Can be. This may be, for example, the surface-modified porous silica particles with an alkoxysilane having an acidic group or a basic group.

Specifically, if the nucleic acid molecule or substance complementary to at least a portion of the transcript of the CTGF gene is positively charged at neutral pH, the surface of the particle and / or the inside of the pore may be negatively charged at neutral pH. Wherein the binding force between the porous silica particles and the nucleic acid molecule or substance complementarily binding to at least a portion of the transcript of the CTGF gene is increased, and the nucleic acid molecule or substance complementarily binds to at least a portion of the transcript of the CTGF gene. This can be released slowly. For example, the porous silica particles may be surface-modified with an alkoxysilane having an acidic group such as a carboxyl group (-COOH) and a sulfonic acid group (-SO ₃ H).

In addition, if the nucleic acid molecule or substance complementary to at least a portion of the transcript of the CTGF gene is negatively charged at a neutral pH, the surface of the particle and / or the inside of the pore may be positively charged, whereby Sustained release of nucleic acid molecules or substances that complementarily bind to at least a portion of the transcript of the CTGF gene by increasing the binding force between the silica particles and at least a portion of the transcript of the CTGF gene Can be. For example, the porous silica particles may be surface-modified with an alkoxysilane having a basic group such as an amino group or another nitrogen-containing group.

Nucleic acid molecules or substances that complementarily bind to at least a portion of the transcript of the CTGF gene may be released for a period of, for example, 7 days to 1 year or more, depending on the type of treatment required, the release environment, and the porous silica particles used. have.

In addition, since the porous silica particles of the present invention are 100% biodegradable, the nucleic acid molecules or substances complementarily binding to at least a part of the transcript of the CTGF gene supported thereon may be 100% released.

As described above, the nucleic acid molecule that complementarily binds to at least a portion of the transcript of the CTGF gene has a complementarity with the sequence of SEQ ID NO: 10 nucleotides (nt), 11 nucleotides, 12 nucleotides, 13 It may be at least nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, or at least 18 nucleotides in total, and the related detailed description is as described above.

The present invention provides a pharmaceutical composition for preventing or treating fibroproliferative diseases, including; a composition for inhibiting CTGF gene expression comprising porous silica particles carrying nucleic acid molecules complementarily bound to at least a portion of a transcript of the CTGF gene described above. To provide a composition.

Details of the nucleic acid molecule, porous silica particles, suppression of CTGF gene expression, fibrotic disease, various formulations of the pharmaceutical composition and the like are as described above.

Hereinafter, the present invention will be described in detail with reference to Examples.

Hereinafter, siRNA used in the present invention may be abbreviated as 'siCTGF', porous silica particles of the present invention as 'DegradaBALL or DDV', and DegradaBALL carrying siCTGF may be abbreviated as 'LEM-S401'.

실험방법Experiment method

1. 실험재료1. Experimental Materials

DegradaBALL combined with DegradaBALL and TAMRA is Lemonex, Inc. (Cell counting kit-8) is provided by Dojindo molecular technologies, Inc. (Maryland, USA). TGF-ß was purchased from Peprotech (New Jersey, USA), 10% Phosphate Buffered Saline (PBS), Dulbecco's Modified Eagle's Medium (DMEM), Fetal Bovine Serum (FBS), Roswell Park Memorial Laboratory 1640 (RPMI 1640) , Penicillin-streptomycin and 0.05% trypsin-EDTA were purchased from WelGene (South Korea). All nucleic acid molecules were synthesized by Lemonex (Seoul, Korea), and their sequences and nucleic acid molecule sequences used throughout the present specification are shown in Table 1 below. All PCR primers were purchased from Cosmogenetech (Seoul, Korea). Anti-mouse CTGF antibodies were purchased from Abcam (Cambridge, UK) and

anti-mouse collagen

1, 3 antibodies were purchased from Invitrogen (Carlsbad, CA, USA). Trizol cell lysis solution was purchased from Molecular Probes Invitrogen (Carlsbad, CA, USA) and all PCR reagents were obtained from TaKaRa Bio Inc. Purchased from (Shiga, Japan). All chemicals were used as received.

Target sequence 1:5'-CTC ATT AGA CTG GAA CTT -3'(Position in gene sequence: 1280)Target sequence 1: 5'-CTC ATT AGA CTG GAA CTT -3 '(Position in gene sequence: 1280)	siRNA GC content: 38.9%siRNA GC content: 38.9%
	siRNA Sense strand: 서열번호 15'- CUCAUUAGACUGGAACUU -3'siRNA Sense strand: SEQ ID NO: 15'- CUCAUUAGACUGGAACUU -3 '
	siRNA Antisense strand: 서열번호 25'- AAGUUCCAGUCUAAUGAG -3'siRNA Antisense strand: SEQ ID NO: 25'- AAGUUCCAGUCUAAUGAG -3 '
	dsRNA: 서열번호 35'- CUCAUUAGACUGGAACUU UU UCU AAA G-3'dsRNA: SEQ ID NO: 35'- CUCAUUAGACUGGAACUU UU UCU AAA G-3 '
	antisense PNA: 서열번호 875'-TTA GAC TGG AAC TTG A-3'antisense PNA: SEQ ID NO: 875'-TTA GAC TGG AAC TTG A-3 '
	antisense PNA 서열번호 885'-CAT TAG ACT GGA ACT T-3'antisense PNA SEQ ID NO: 885'-CAT TAG ACT GGA ACT T-3 '
Target sequence 2:5'-G GAA CTT GAA CTG ATT CA-3'(Position in gene sequence: 1291)Target sequence 2: 5'-G GAA CTT GAA CTG ATT CA-3 '(Position in gene sequence: 1291)	siRNA GC content: 38.9%siRNA GC content: 38.9%
	siRNA Sense strand: 서열번호 45'-GGAACUUGAACUGAUUCA -3'siRNA Sense strand: SEQ ID NO: 45'-GGAACUUGAACUGAUUCA -3 '
	siRNA Antisense strand: 서열번호 55'- UGAAUCAGUUCAAGUUCC -3'siRNA Antisense strand: SEQ ID NO: 55'- UGAAUCAGUUCAAGUUCC -3 '
	dsRNA: 서열번호 65'- GGAACUUGAACUGAUUCA UU CCU UUC UAA AG-3'dsRNA: SEQ ID NO: 65'- GGAACUUGAACUGAUUCA UU CCU UUC UAA AG-3 '
Target sequence 3:5'-CTG AGT GAC TCT ATA TAG CT-3'(Position in gene sequence: 2185)Target sequence 3: 5'-CTG AGT GAC TCT ATA TAG CT-3 '(Position in gene sequence: 2185)	siRNA GC content: 40.0%siRNA GC content: 40.0%
	siRNA Sense strand: 서열번호 75'- CUGAGUGACUCUAUAUAGCU -3'siRNA Sense strand: SEQ ID NO: 75'- CUGAGUGACUCUAUAUAGCU -3 '
	siRNA Antisense strand: 서열번호 85'- AGCUAUAUAGAGUCACUCAG -3'siRNA Antisense strand: SEQ ID NO: 85'- AGCUAUAUAGAGUCACUCAG -3 '
	dsRNA: 서열번호 95'- CUGAGUGACUCUAUAUAGCU UU UCU AAA G-3'dsRNA: SEQ ID NO: 95'- CUGAGUGACUCUAUAUAGCU UU UCU AAA G-3 '
Target sequence 4:5'-GCA TGA AGA CAT ACC GAG C-3'(Position in gene sequence: 1030)Target sequence 4: 5'-GCA TGA AGA CAT ACC GAG C-3 '(Position in gene sequence: 1030)	siRNA GC content: 52.6%siRNA GC content: 52.6%
	siRNA Sense strand: 서열번호 105'- GCAUGAAGACAUACCGAGC -3'siRNA Sense strand: SEQ ID NO: 105'- GCAUGAAGACAUACCGAGC -3 '
	siRNA Antisense strand: 서열번호 115'- GCUCGGUAUGUCUUCAUGC -3'siRNA Antisense strand: SEQ ID NO: 115'- GCUCGGUAUGUCUUCAUGC -3 '
	dsRNA: 서열번호 125'- GCAUGAAGACAUACCGAGC UU UCU AAA G-3'dsRNA: SEQ ID NO: 125'- GCAUGAAGACAUACCGAGC UU UCU AAA G-3 '
Target sequence 5:5'-ATG TTT GCA CCT TTC TAG-3'(Position in gene sequence: 2296)Target sequence 5: 5'-ATG TTT GCA CCT TTC TAG-3 '(Position in gene sequence: 2296)	siRNA GC content: 38.9%siRNA GC content: 38.9%
	siRNA Sense strand: 서열번호 135'- AUGUUUGCACCUUUCUAG -3'siRNA Sense strand: SEQ ID NO: 135'- AUGUUUGCACCUUUCUAG -3 '
	siRNA Antisense strand: 서열번호 145'- CUAGAAAGGUGCAAACAU -3'siRNA Antisense strand: SEQ ID NO: 145'- CUAGAAAGGUGCAAACAU -3 '
	dsRNA: 서열번호 155'- AUGUUUGCACCUUUCUAG UU CCU UUC UAA AG-3'dsRNA: SEQ ID NO: 155'- AUGUUUGCACCUUUCUAG UU CCU UUC UAA AG-3 '
Target sequence 6:5'-TG AGA GGA GAC AGC CAG T-3'(Position in gene sequence: 26)Target sequence 6: 5'-TG AGA GGA GAC AGC CAG T-3 '(Position in gene sequence: 26)	siRNA GC content: 55.6%siRNA GC content: 55.6%
	siRNA Sense strand: 서열번호 165'- UGAGAGGAGACAGCCAGU -3'siRNA Sense strand: SEQ ID NO: 165'- UGAGAGGAGACAGCCAGU -3 '
	siRNA Antisense strand: 서열번호 175'- ACUGGCUGUCUCCUCUCA -3'siRNA Antisense strand: SEQ ID NO: 175'- ACUGGCUGUCUCCUCUCA -3 '
	dsRNA: 서열번호 185'- UGAGAGGAGACAGCCAGU UU CCU UUC UAA AG-3'dsRNA: SEQ ID NO: 185'- UGAGAGGAGACAGCCAGU UU CCU UUC UAA AG-3 '
Target sequence 7:5'-TTC GGT GGT ACG GTG TAC -3'(Position in gene sequence: 518)Target sequence 7: 5'-TTC GGT GGT ACG GTG TAC -3 '(Position in gene sequence: 518)	siRNA GC content: 55.6%siRNA GC content: 55.6%
	siRNA Sense strand: 서열번호 195'- UUCGGUGGUACGGUGUAC -3'siRNA Sense strand: SEQ ID NO: 195'- UUCGGUGGUACGGUGUAC-3 '
	siRNA Antisense strand: 서열번호 205'- GUACACCGUACCACCGAA -3'siRNA Antisense strand: SEQ ID NO: 205'- GUACACCGUACCACCGAA -3 '
	dsRNA: 서열번호 215'- UUCGGUGGUACGGUGUAC UU CCU UUC UAA AG-3'dsRNA: SEQ ID NO: 215'- UUCGGUGGUACGGUGUAC UU CCU UUC UAA AG-3 '
Target sequence 8:5'-TCC TTC CAG AGC AGC TGC AA-3'(Position in gene sequence: 549)Target sequence 8: 5'-TCC TTC CAG AGC AGC TGC AA-3 '(Position in gene sequence: 549)	siRNA GC content: 55.0%siRNA GC content: 55.0%
	siRNA Sense strand: 서열번호 225'- UCCUUCCAGAGCAGCUGCAA -3'siRNA Sense strand: SEQ ID NO: 225'-UCCUUCCAGAGCAGCUGCAA -3 '
	siRNA Antisense strand: 서열번호 235'- UUGCAGCUGCUCUGGAAGGA -3'siRNA Antisense strand: SEQ ID NO: 235'- UUGCAGCUGCUCUGGAAGGA -3 '
	dsRNA: 서열번호 245'- UCCUUCCAGAGCAGCUGCAA UU UCU AAA G-3'dsRNA: SEQ ID NO: 245'-UCCUUCCAGAGCAGCUGCAA UU UCU AAA G-3 '
Target sequence 9:5'-TG TGT GAC GAG CCC AAG GA-3'(Position in gene sequence: 699)Target sequence 9: 5'-TG TGT GAC GAG CCC AAG GA-3 '(Position in gene sequence: 699)	siRNA GC content: 57.9%siRNA GC content: 57.9%
	siRNA Sense strand: 서열번호 255'- UGUGUGACGAGCCCAAGGA -3'siRNA Sense strand: SEQ ID NO: 255'- UGUGUGACGAGCCCAAGGA -3 '
	siRNA Antisense strand: 서열번호 265'- UCCUUGGGCUCGUCACACA -3'siRNA Antisense strand: SEQ ID NO: 265'-UCCUUGGGCUCGUCACACA -3 '
	dsRNA: 서열번호 275'- UGUGUGACGAGCCCAAGGA UU UCU AAA G-3'dsRNA: SEQ ID NO: 275'-UGUGUGACGAGCCCAAGGA UU UCU AAA G-3 '
Target sequence 10:5'-TGC CTG GTC CAG ACC ACA GA-3'(Position in gene sequence: 801)Target sequence 10: 5'-TGC CTG GTC CAG ACC ACA GA-3 '(Position in gene sequence: 801)	siRNA GC content: 60.0%siRNA GC content: 60.0%
	siRNA Sense strand: 서열번호 285'- UGCCUGGUCCAGACCACAGA -3'siRNA Sense strand: SEQ ID NO: 285'- UGCCUGGUCCAGACCACAGA-3 '
	siRNA Antisense strand: 서열번호 295'- UCUGUGGUCUGGACCAGGCA -3'siRNA Antisense strand: SEQ ID NO: 295'-UCUGUGGUCUGGACCAGGCA -3 '
	dsRNA: 서열번호 305'- UGCCUGGUCCAGACCACAGA UU CCU UUC UAA AG-3'dsRNA: SEQ ID NO: 305'-UGCCUGGUCCAGACCACAGA UU CCU UUC UAA AG-3 '
Target sequence 11:5'-CAG GCT AGA GAA GCA GAG-3'(Position in gene sequence: 890)Target sequence 11: 5'-CAG GCT AGA GAA GCA GAG-3 '(Position in gene sequence: 890)	siRNA GC content: 55.6%siRNA GC content: 55.6%
	siRNA Sense strand: 서열번호 315'- CAGGCUAGAGAAGCAGAG -3'siRNA Sense strand: SEQ ID NO: 315'- CAGGCUAGAGAAGCAGAG -3 '
	siRNA Antisense strand: 서열번호 325'- CUCUGCUUCUCUAGCCUG -3'siRNA Antisense strand: SEQ ID NO: 325'- CUCUGCUUCUCUAGCCUG -3 '
	dsRNA: 서열번호 335'- CAGGCUAGAGAAGCAGAG UU UCU AAA G-3'dsRNA: SEQ ID NO: 335'- CAGGCUAGAGAAGCAGAG UU UCU AAA G-3 '
Target sequence 12:5'-TGT GCA TGG TCA GGC CTT-3'(Position in gene sequence: 913)Target sequence 12: 5'-TGT GCA TGG TCA GGC CTT-3 '(Position in gene sequence: 913)	siRNA GC content: 55.6%siRNA GC content: 55.6%
	siRNA Sense strand: 서열번호 345'- UGUGCAUGGUCAGGCCUU -3'siRNA Sense strand: SEQ ID NO: 345'- UGUGCAUGGUCAGGCCUU -3 '
	siRNA Antisense strand: 서열번호 355'- AAGGCCUGACCAUGCACA -3'siRNA Antisense strand: SEQ ID NO: 355'- AAGGCCUGACCAUGCACA -3 '
	dsRNA: 서열번호 365'- UGUGCAUGGUCAGGCCUU UU CCU UUC UAA AG-3'dsRNA: SEQ ID NO: 365'- UGUGCAUGGUCAGGCCUU UU CCU UUC UAA AG-3 '
Target sequence 13:5'-TGA TTT CAG TAG CAC AAG-3'(Position in gene sequence: 1330)Target sequence 13: 5'-TGA TTT CAG TAG CAC AAG-3 '(Position in gene sequence: 1330)	siRNA GC content: 38.9%siRNA GC content: 38.9%
	siRNA Sense strand: 서열번호 375'- UGAUUUCAGUAGCACAAG -3'siRNA Sense strand: SEQ ID NO: 375'- UGAUUUCAGUAGCACAAG -3 '
	siRNA Antisense strand: 서열번호 385'- CUUGUGCUACUGAAAUCA -3'siRNA Antisense strand: SEQ ID NO: 385'- CUUGUGCUACUGAAAUCA -3 '
	dsRNA: 서열번호 395'- UGAUUUCAGUAGCACAAG UU CCU UUC UAA AG-3'dsRNA: SEQ ID NO: 395'- UGAUUUCAGUAGCACAAG UU CCU UUC UAA AG-3 '
Target sequence 14:5'-TAG CGT GCT CAC TGA CCT-3'(Position in gene sequence: 1623)Target sequence 14: 5'-TAG CGT GCT CAC TGA CCT-3 '(Position in gene sequence: 1623)	siRNA GC content: 55.6%siRNA GC content: 55.6%
	siRNA Sense strand: 서열번호 405'- UAGCGUGCUCACUGACCU -3'siRNA Sense strand: SEQ ID NO: 405'- UAGCGUGCUCACUGACCU -3 '
	siRNA Antisense strand: 서열번호 415'- AGGUCAGUGAGCACGCUA -3'siRNA Antisense strand: SEQ ID NO: 415'- AGGUCAGUGAGCACGCUA -3 '
	dsRNA: 서열번호 425'- UAGCGUGCUCACUGACCU UU CCU UUC UAA AG-3'dsRNA: SEQ ID NO: 425'- UAGCGUGCUCACUGACCU UU CCU UUC UAA AG-3 '
Target sequence 15:5'-CTG ATT CGA ATG ACA CTG TT-3'(Position in gene sequence: 1742)Target sequence 15: 5'-CTG ATT CGA ATG ACA CTG TT-3 '(Position in gene sequence: 1742)	siRNA GC content: 40.0%siRNA GC content: 40.0%
	siRNA Sense strand: 서열번호 435'- CUGAUUCGAAUGACACUGUU -3'siRNA Sense strand: SEQ ID NO: 435'- CUGAUUCGAAUGACACUGUU -3 '
	siRNA Antisense strand: 서열번호 445'- AACAGUGUCAUUCGAAUCAG -3'siRNA Antisense strand: SEQ ID NO: 445'- AACAGUGUCAUUCGAAUCAG -3 '
	dsRNA: 서열번호 455'- CUGAUUCGAAUGACACUGUU UU CCU UUC UAA AG-3'dsRNA: SEQ ID NOs: 455'- CUGAUUCGAAUGACACUGUU UU CCU UUC UAA AG-3 '
Target sequence 16:5'-CAG ATT GTT TGC AAA GGG-3'(Position in gene sequence: 2081)Target sequence 16: 5'-CAG ATT GTT TGC AAA GGG-3 '(Position in gene sequence: 2081)	siRNA GC content: 44.4%siRNA GC content: 44.4%
	siRNA Sense strand: 서열번호 465'- CAGAUUGUUUGCAAAGGG -3'siRNA Sense strand: SEQ ID NO: 465'- CAGAUUGUUUGCAAAGGG -3 '
	siRNA Antisense strand: 서열번호 475'- CCCUUUGCAAACAAUCUG -3'siRNA Antisense strand: SEQ ID NO: 475'- CCCUUUGCAAACAAUCUG -3 '
	dsRNA: 서열번호 485'- CAGAUUGUUUGCAAAGGG UU CCU UUC UAA AG-3'dsRNA: SEQ ID NO: 485'- CAGAUUGUUUGCAAAGGG UU CCU UUC UAA AG-3 '
Target sequence 17:5'-GCA TCA GTG TCC TTG GCA-3'(Position in gene sequence: 2102)Target sequence 17: 5'-GCA TCA GTG TCC TTG GCA-3 '(Position in gene sequence: 2102)	siRNA GC content: 55.6%siRNA GC content: 55.6%
	siRNA Sense strand: 서열번호 495'- GCAUCAGUGUCCUUGGCA -3'siRNA Sense strand: SEQ ID NO: 495'- GCAUCAGUGUCCUUGGCA -3 '
	siRNA Antisense strand: 서열번호 505'- UGCCAAGGACACUGAUGC -3'siRNA Antisense strand: SEQ ID NO: 505'- UGCCAAGGACACUGAUGC -3 '
	dsRNA: 서열번호 515'- GCAUCAGUGUCCUUGGCA UU CCU UUC UAA AG-3'dsRNA: SEQ ID NO: 515'- GCAUCAGUGUCCUUGGCA UU CCU UUC UAA AG-3 '
Target sequence 18:5'-GAC ATT AAC TCA TTA GAC -3'(Position in gene sequence: 1272)Target sequence 18: 5'-GAC ATT AAC TCA TTA GAC -3 '(Position in gene sequence: 1272)	siRNA GC content: 33.3%siRNA GC content: 33.3%
	siRNA Sense strand: 서열번호 525'-GACAUUAACUCAUUAGAC -3'siRNA Sense strand: SEQ ID NO: 525'-GACAUUAACUCAUUAGAC -3 '
	siRNA Antisense strand: 서열번호 535'-GUCUAAUGAGUUAAUGUC -3'siRNA Antisense strand: SEQ ID NO: 535'-GUCUAAUGAGUUAAUGUC -3 '
	dsRNA: 서열번호 545'-GACAUUAACUCAUUAGAC UU UCU AAA G-3'dsRNA: SEQ ID NO: 545'-GACAUUAACUCAUUAGAC UU UCU AAA G-3 '
Target sequence 19:5'-AAC TCA TTA GAC TGG AAC -3'(Position in gene sequence: 1278)Target sequence 19: 5'-AAC TCA TTA GAC TGG AAC -3 '(Position in gene sequence: 1278)	siRNA GC content: 38.9%siRNA GC content: 38.9%
	siRNA Sense strand: 서열번호 555'- AACUCAUUAGACUGGAAC -3'siRNA Sense strand: SEQ ID NO: 555'- AACUCAUUAGACUGGAAC -3 '
	siRNA Antisense strand: 서열번호 565'- GUUCCAGUCUAAUGA GUU -3'siRNA Antisense strand: SEQ ID NO: 565'- GUUCCAGUCUAAUGA GUU -3 '
	dsRNA: 서열번호 575'- AACUCAUUAGACUGGAAC UU UCU AAA G-3'dsRNA: SEQ ID NO: 575'- AACUCAUUAGACUGGAAC UU UCU AAA G-3 '
	antisense PNA 서열번호 895'-TCC AGT CTA ATG AGT T-3'antisense PNA SEQ ID NO: 895'-TCC AGT CTA ATG AGT T-3 '
	antisense PNA 서열번호 905'-TTC CAG TCT AAT GAG T-3'antisense PNA SEQ ID NO: 905'-TTC CAG TCT AAT GAG T-3 '
Target sequence 20:5'-ACT CAT TAG ACT GGA ACT -3'(Position in gene sequence: 1279)Target sequence 20: 5'-ACT CAT TAG ACT GGA ACT -3 '(Position in gene sequence: 1279)	siRNA GC content: 38.9%siRNA GC content: 38.9%
	siRNA Sense strand: 서열번호 585'- ACUCAUUAGACUGGAACU -3'siRNA Sense strand: SEQ ID NO: 585'- ACUCAUUAGACUGGAACU -3 '
	siRNA Antisense strand: 서열번호 595'- AGUUCCAGUCUAAUGAGU -3'siRNA Antisense strand: SEQ ID NO: 595'- AGUUCCAGUCUAAUGAGU -3 '
	dsRNA: 서열번호 605'- ACUCAUUAGACUGGAACU UU UCU AAA G-3'dsRNA: SEQ ID NO: 605'- ACUCAUUAGACUGGAACU UU UCU AAA G-3 '
	antisense PNA 서열번호 915'-AGT TCC AGT CTA ATG A-3'antisense PNA SEQ ID NO: 915'-AGT TCC AGT CTA ATG A-3 '
Target sequence 21:5'- TTA GAC TGG AAC TTG AAC -3'(Position in gene sequence: 1284)Target sequence 21: 5'- TTA GAC TGG AAC TTG AAC -3 '(Position in gene sequence: 1284)	siRNA GC content: 38.9%siRNA GC content: 38.9%
	siRNA Sense strand: 서열번호 615'- UUAGACUGGAACUUGAAC -3'siRNA Sense strand: SEQ ID NO: 615'- UUAGACUGGAACUUGAAC-3 '
	siRNA Antisense strand: 서열번호 625'-GUUCAAGUUCCAGUCUAA -3'siRNA Antisense strand: SEQ ID NO: 625'-GUUCAAGUUCCAGUCUAA -3 '
	dsRNA: 서열번호 635'- UUAGACUGGAACUUGAAC UU UCU AAA G-3'dsRNA: SEQ ID NO: 635'-UUAGACUGGAACUUGAAC UU UCU AAA G-3 '
	antisense PNA 서열번호 925'-TCA AGT TCC AGT CTA A-3'antisense PNA SEQ ID NO: 925'-TCA AGT TCC AGT CTA A-3 '
	antisense PNA 서열번호 935'-TTC AAG TTC CAG TCT A-3'antisense PNA SEQ ID NO: 935'-TTC AAG TTC CAG TCT A-3 '
Target sequence 22:5'- ATT AGA CTG GAA CTT GAA -3'(Position in gene sequence: 1283)Target sequence 22: 5'- ATT AGA CTG GAA CTT GAA -3 '(Position in gene sequence: 1283)	siRNA GC content: 33.3%siRNA GC content: 33.3%
	siRNA Sense strand: 서열번호 645'- AUUAGACUGGAACUUGAA -3'siRNA Sense strand: SEQ ID NO: 645'- AUUAGACUGGAACUUGAA -3 '
	siRNA Antisense strand: 서열번호 655'-UUCAAGUUCCAGUCUAAU -3'siRNA Antisense strand: SEQ ID NO: 655'-UUCAAGUUCCAGUCUAAU -3 '
	dsRNA: 서열번호 665'- AUUAGACUGGAACUUGAA UU UCU AAA G-3'dsRNA: SEQ ID NO: 665'- AUUAGACUGGAACUUGAA UU UCU AAA G-3 '
	antisense PNA 서열번호 945'-CAA GTT CCA GTC TAA T-3'antisense PNA SEQ ID NO: 945'-CAA GTT CCA GTC TAA T-3 '
	antisense PNA 서열번호 955'-TTC AAG TTC CAG TCT A-3'antisense PNA SEQ ID NO: 955'-TTC AAG TTC CAG TCT A-3 '
Target sequence 23:5'- CAT TAG ACT GGA ACT TGA -3'(Position in gene sequence: 1282)Target sequence 23: 5'- CAT TAG ACT GGA ACT TGA -3 '(Position in gene sequence: 1282)	siRNA GC content: 38.9%siRNA GC content: 38.9%
	siRNA Sense strand: 서열번호 675'- CAUUAGACUGGAACUUGA -3'siRNA Sense strand: SEQ ID NO: 675'- CAUUAGACUGGAACUUGA -3 '
	siRNA Antisense strand: 서열번호 685'-UCAAGUUCCAGUCUAAUG -3'siRNA Antisense strand: SEQ ID NO: 685'-UCAAGUUCCAGUCUAAUG-3 '
	dsRNA: 서열번호 695'- CAUUAGACUGGAACUUGA UU UCU AAA G-3'dsRNA: SEQ ID NO: 695'- CAUUAGACUGGAACUUGA UU UCU AAA G-3 '
	antisense PNA 서열번호 965'-CAA GTT CCA GTC TAA T-3'antisense PNA SEQ ID NO: 965'-CAA GTT CCA GTC TAA T-3 '
	antisense PNA 서열번호 975'-TCA AGT TCC AGT CTA A-3'antisense PNA SEQ ID NO: 975'-TCA AGT TCC AGT CTA A-3 '
Target sequence 24:5'- TCA TTA GAC TGG AAC TTG -3'(Position in gene sequence: 1281)Target sequence 24: 5'- TCA TTA GAC TGG AAC TTG -3 '(Position in gene sequence: 1281)	siRNA GC content: 38.9%siRNA GC content: 38.9%
	siRNA Sense strand: 서열번호 705'- UCAUUAGACUGGAACUUG -3'siRNA Sense strand: SEQ ID NO: 705'- UCAUUAGACUGGAACUUG -3 '
	siRNA Antisense strand: 서열번호 715'-CAAGUUCCAGUCUAAUGA -3'siRNA Antisense strand: SEQ ID NO: 715'-CAAGUUCCAGUCUAAUGA -3 '
	dsRNA: 서열번호 725'- UCAUUAGACUGGAACUUG UU UCU AAA G-3'dsRNA: SEQ ID NOs: 725'- UCAUUAGACUGGAACUUG UU UCU AAA G-3 '
	antisense PNA 서열번호 985'-AGT TCC AGT CTA ATG A-3'antisense PNA SEQ ID NO: 985'-AGT TCC AGT CTA ATG A-3 '
	antisense PNA 서열번호 995'-CAA GTT CCA GTC TAA T-3'antisense PNA SEQ ID NO: 995'-CAA GTT CCA GTC TAA T-3 '
Mouse CTGF siRNAMouse CTGF siRNA	siRNA Sense strand: 서열번호 735'- gcaccagugu gaagacaua -3'siRNA Sense strand: SEQ ID NO: 735'- gcaccagugu gaagacaua -3 '
Mouse CTGF siRNAMouse CTGF siRNA	siRNA Antisense strand: 서열번호 745'- uaugucuuca cacuggugc -3'siRNA Antisense strand: SEQ ID NO: 745'- uaugucuuca cacuggugc -3 '
Human ß-actin PrimerHuman ß-actin Primer	Forward: 서열번호 755' gctcgtcgac aagggctc -3'Forward: SEQ ID NO: 755 'gctcgtcgac aagggctc -3'
Human ß-actin PrimerHuman ß-actin Primer	Reverse: 서열번호 765'- caaacatgat ctgggtca -3' Reverse: SEQ ID NO: 765'- caaacatgat ctgggtca -3 '
Human CTGF PrimerHuman CTGF Primer	Forward: 서열번호 775'- caagggcctc ttctgtgact -3'Forward: SEQ ID NO: 775'- caagggcctc ttctgtgact -3 '
Human CTGF PrimerHuman CTGF Primer	Reverse: 서열번호 785'- ccgtcggtac atactccaca -3'Reverse: SEQ ID NO: 785'-ccgtcggtac atactccaca -3 '
Mouse ß-actin PrimerMouse ß-actin Primer	Forward: 서열번호 795'- gcctcccttc ttgggtatgg aa -3'Forward: SEQ ID NO: 795'- gcctcccttc ttgggtatgg aa -3 '
Mouse ß-actin PrimerMouse ß-actin Primer	Reverse: 서열번호 805'- cagctcagta acagtccgcc -3'Reverse: SEQ ID NO: 805'- cagctcagta acagtccgcc -3 '
Mouse CTGF PrimerMouse CTGF Primer	Forward: 서열번호 815'- gggcctcttc tgcgatttc -3'Forward: SEQ ID NO: 815'- gggcctcttc tgcgatttc -3 '
Mouse CTGF PrimerMouse CTGF Primer	Reverse: 서열번호 825'- atccaggcaa gtgcattggt a -3'Reverse: SEQ ID NO: 825'- atccaggcaa gtgcattggt a -3 '
Mouse Collagen 1 PrimerMouse Collagen 1 Primer	Forward: 서열번호 835'- gagcggagag tactggatcg -3'Forward: SEQ ID NO: 835'- gagcggagag tactggatcg -3 '
Mouse Collagen 1 PrimerMouse Collagen 1 Primer	Reverse: 서열번호 845'- gttcgggctg atgtaccagt -3'Reverse: SEQ ID NO: 845'- gttcgggctg atgtaccagt -3 '
Mouse Collagen 3 PrimerMouse Collagen 3 Primer	Forward: 서열번호 855'- agctttgtgc aaagtggaac ctgg -3'Forward: SEQ ID NO: 855'- agctttgtgc aaagtggaac ctgg -3 '
Mouse Collagen 3 PrimerMouse Collagen 3 Primer	Reverse: 서열번호 865'- caaggtggct gcatcccaat tcat -3'Reverse: SEQ ID NO: 865'- caaggtggct gcatcccaat tcat -3 '

2. 동물모델2. Animal Model

All animal experiments were performed in compliance with the Institutional Animal Care and Use Committees (IACUC) of Seoul National University, and C57BL / 6 male rats (5 weeks) were purchased from ORIENT BIO (Seongnam, Korea).

3. 세포 생존 측정3. Cell survival measurement

A549 and HaCaT cells were seeded in 96-well culture plates with 100 μl of growth medium (50-70% confluency) at a density of 10,000 cells per well. Cells were treated with the appropriate concentration of DegradaBALL in serum containing medium and incubated at 37 ° C. for 24 hours. After incubation, the cells were washed twice with 1 x PBS, and then 100 μl of serum-free medium containing 10 μl of CCK-8 was added, followed by further incubation for 1 hour. The optical density of each well in the culture plate was measured at 450 nm wavelength. Mean and standard deviation of the deviation of triplicates were calculated and plotted.

4. 세포 기반 CTGF knockdown 분석4. Cell Based CTGF Knockdown Assay

To demonstrate the CTGF gene silencing efficiency of LEM-S401 in vitro , 500 μl of LEM-S401 (12.5, 25, 50, and 100 nM) in serum-free medium was inoculated with 25,000 cells of confluency per well. A549 and HaCaT cells in the plate were treated. After 6 hours of incubation in a humidified 5% CO ₂ incubator at 37 ° C., the serum-free culture was removed and washed twice with 1 × PBS before the serum-containing cell medium was replaced. After 6 hours again, the serum containing culture medium was removed and washed with 1 x PBS. 500 μl of TGF-ß (2 ng / mL) was treated with cells in a medium containing serum, and after 12 hours of culture for CTGF induction, total RNA was extracted using Trizol.

To determine the duration of CTGF knockdown by LEM-S401, A549 and HaCaT cells were treated with 500 μl of LEM-S401 (50 nM siCTGF) and siCTGF (50 nM) containing LNP in serum-free medium. In a humidified 5% CO ₂ incubator, after 6 hours of incubation at 37 ° C., the serum-free culture was removed, washed twice with 1 × PBS, and the serum-containing cell medium was replaced. After incubation for the indicated times, cells were treated with 500 μl of TGF-ß (2 ng / mL) in serum-containing culture medium, and cells were further incubated for 24 hours for CTGF induction. Total RNA was extracted using Trizol.

5. RT-PCR5. RT-PCR

All RNAs extracted in vitro and in vivo were used for thermal cycling using the following reaction conditions. cDNA synthesis: 5 minutes at 65 ° C., 2 minutes at 42 ° C., 50 minutes at 42 ° C., 15 minutes at 70 ° C., 1 cycle of inactivation, amplification: 30 seconds at 95 ° C., 60 seconds at 55 ° C., 72 ° C. 30 seconds 30 cycles.

6. siCTGF 및 다공성 실리카 입자의 6. of siCTGF and porous silica particles In vivoIn vivo 이미징 Imaging

30 μl of LEM-S401 (33 mM) (FITC-conjugated siCTGF and TAMRA-binding DegradaBALL) were injected into the mouse skin at seven different sites. After sacrifice, fluorescence images of the excised mouse skin were taken using an FOBI in vivo imaging device (NeoScience Co., Ltd., Seoul, Korea). The obtained skin sample was placed in 4% PFA solution. The sample was inserted into paraffin and cut to 10 μm thickness. After dehydration, the sections were stained with DAPI. Samples were observed with a BX71 microscope equipped with a 20x objective (Olympus, Tokyo, Japan).

7. 마우스 피부 상처 모델을 이용한 7. Using a Mouse Skin Wound Model In vivoIn vivo 실험 Experiment

Mouse skin was punctured to injure using a biopsy punch (4 mm). Over time, silicone splints (outer 15 mm, inner 8 mm) were sutured around the wound using black silk thread to clearly observe the wound. 30 μL of LEM-S401 (3 mM) in 1 × PBS was injected subcutaneously every 4 days (4 days, 8 days, 12 days) at 4 different sites around the wound. The wounds were managed with changing Tegaderm and bandages every other day, and 16 days later, mice were sacrificed.

To demonstrate that LEM-S401 can inhibit CTGF expression during tissue remodeling, a hole was cut in the mouse skin, wounded and wrapped with a band using a biopsy punch (4 mm). After the wound was completely closed, 30 μl of LEM-S401 (33 mM) in 1 × PBS was injected subcutaneously into the wound site at 4 different sites every 4 days (10 days, 14 days, 18 days, 22 days), and mice were Sacrifice was made on day 26.

8. 면역조직화학8. Immunohistochemistry

Mouse skin samples were incubated in 4% PFA solution at 4 ° C. for 24 hours. The sample was then inserted into paraffin and sections were made 10 μm thick. The sectioned samples were dehydrated and incubated twice for 10 minutes each in permeate solution (0.2% tween 20 in 1 × PBS). The samples were then incubated for 45 minutes in humidified atmospheric blocking solution (5% normal goat serum, 0.2% tween 20 in 1 × PBS). Samples were incubated for 3 hours at room temperature with a primary antibody solution containing 0.2% tween 20 with a 1: 100 dilution of 2% normal goat serum and antibody in PBS in a humidification chamber. Samples were rinsed three times for 10 minutes each in permeate solution and incubated with a secondary antibody dilution solution containing 2% normal goat serum and 0.2% tween 20 in 1 × PBS for 2 hours at room temperature. Samples were washed with permeate solution and stained with DAPI. Samples were observed under a BX71 microscope equipped with a 20x objective (Olympus, Tokyo, Japan).

9. 다공성 실리카 입자(DDV 또는 DegradaBALL)9. Porous Silica Particles (DDV or DegradaBALL)

9-1. 다공성 실리카 입자의 제조9-1. Preparation of Porous Silica Particles

(1) Preparation of Porous Silica Particles

1) Preparation of Small Pore Particles

Into a 2 L round bottom flask was placed 960 mL of distilled water (DW) and 810 mL of MeOH. 7.88 g of CTAB was added to the flask, followed by rapid addition of 4.52 mL of 1 M NaOH while stirring. After stirring for 10 minutes to add a homogeneous mixture, 2.6 mL of TMOS was added. After stirring for 6 hours to mix uniformly, it was aged for 24 hours.

The reaction solution was then centrifuged at 8000 rpm for 10 minutes at 25 ° C. to remove the supernatant, centrifuged at 8000 rpm for 10 minutes at 25 ° C., and washed five times with alternating ethanol and distilled water.

Thereafter, the resultant was dried in an oven at 70 ° C. to obtain 1.5 g of powdery microporous silica particles (pore average diameter of 2 nm and particle size of 200 nm).

2) pore expansion

1.5 g of small pore porous silica particle powder was added to 10 ml of ethanol for ultrasonic dispersion, and 10 ml of water and 10 ml of TMB (trimethyl benzene) were added for ultrasonic dispersion.

Thereafter, the dispersion was placed in an autoclave and reacted at 160 ° C. for 48 hours.

The reaction was carried out starting at 25 ° C. and warming up at a rate of 10 ° C./min, then slowly cooling at a rate of 1-10 ° C./min in the autoclave.

The cooled reaction solution was centrifuged at 8000 rpm for 10 minutes at 25 ° C. to remove the supernatant, and centrifuged at 8000 rpm for 10 minutes at 25 ° C. and washed five times with ethanol and distilled water.

Then, dried in an oven at 70 ℃ to obtain a powdery porous silica particles (pore diameter 10 ~ 15nm, particle diameter 200nm).

3) calcination

The porous silica particles prepared in 2) were put in a glass vial, heated at 550 ° C. for 5 hours, and cooled slowly to room temperature after completion of the reaction to prepare particles.

(2) Preparation of Porous Silica Particles

Porous silica particles were prepared in the same manner as in 9-1- (1), except that the reaction conditions at the time of pore expansion were changed to 140 ° C. and 72 hours.

(3) Preparation of Porous Silica Particles (10L Scale)

Porous silica particles were prepared in the same manner as in Example 9-1- (1), except that a 5 times larger container was used and each material was used in a 5 times capacity.

(4) Preparation of Porous Silica Particles (Particle Diameter 300nm)

Porous silica particles were prepared by the same method as 9-1- (1), except that 920 ml of distilled water and 850 ml of methanol were used to prepare the small pore particles.

(5) Preparation of Porous Silica Particles (Particle Size 500nm)

Porous silica particles were prepared in the same manner as in 9-1- (1), except that 800 ml of distilled water, 1010 ml of methanol, and 10.6 g of CTAB were used to prepare the small pore particles.

(6) Preparation of Porous Silica Particles (Particle Diameter 1000nm)

Porous silica particles were prepared in the same manner as in 9-1- (1), except that 620 ml of distilled water, 1380 ml of methanol, and 7.88 g of CTAB were used to prepare the small pore particles.

(7) Preparation of Porous Silica Particles (Pore Diameter 4nm)

Porous silica particles were prepared in the same manner as 9-1- (1), except that 2.5 mL of TMB was used for pore expansion.

(8) Preparation of Porous Silica Particles (Pore Diameter 7nm)

Porous silica particles were prepared in the same manner as 9-1- (1), except that 4.5 mL of TMB was used for pore expansion.

(9) Preparation of Porous Silica Particles (Pore Diameter 17nm)

Porous silica particles were prepared in the same manner as 9-1- (1), except that 11 mL of TMB was used for pore expansion.

(10) Preparation of Porous Silica Particles (Pore Diameter 23nm)

Porous silica particles were prepared in the same manner as 9-1- (1), except that 12.5 mL of TMB was used for pore expansion.

(11) Preparation of Porous Silica Particles (Dual Modification)

1) Preparation of Small Pore Particles

Small pore particles were prepared in the same manner as in Example 9-1- (1) -1).

2) pore expansion

In the same manner as in Example 9-1- (1) -2), the small pore particles were reacted with TMB, cooled and centrifuged to remove the supernatant. Thereafter, centrifuged under the same conditions as in Example 9-1- (1) -2), washed three times with alternating ethanol and distilled water, and then dried under the same conditions as in Example 9-1- (1) -2). Powdery porous silica particles (pore diameter 10-15 nm, particle diameter 200 nm) were obtained.

3) surface modification

After dispersing 0.8 g to 1 g of porous silica particles having expanded pores in 50 mL of toluene, 5 mL of (3-aminopropyl) triethoxysilane was added thereto, followed by heating at reflux at 120 ° C for 12 hours. The procedure is followed by the washing and drying procedures described above, followed by 1 mL of threethylene glycol (PEG3, 2- [2- (2-methoxyethoxy) ethoxy] acetic acid) and 100 mg of EDC (1-Ethyl-3- (3). -dimethylaminopropyl) carbodiimide) and 200 mg of N-Hydroxysuccinimide (NHS) were dispersed in 30 mL of PBS and allowed to react for 12 hours while stirring at room temperature. The product is then washed and dried.

The reaction solution of the previous step remains inside the pore, so that the inside of the pore is not modified.

4) pore inside washing

800 mg of surface modified particle powder was dissolved in 40 ml of 2M HCl / ethanol and refluxed under vigorous stirring for 12 hours.

Thereafter, the cooled reaction solution was centrifuged at 8000 rpm for 10 minutes to remove the supernatant, centrifuged at 8000 rpm for 10 minutes at 25 ° C, and washed five times with alternating ethanol and distilled water.

After drying in an oven at 70 ℃ to obtain a powdery porous silica particles.

5) Pore internal reforming

(1) A propyl group was introduced into the pores in the same manner as in Example 9-2- (2) -1) described later.

(2) An octyl group was introduced into the pores in the same manner as in Example 9-2- (2) -2) described later.

9-2. 다공성 실리카 입자의 표면 개질9-2. Surface Modification of Porous Silica Particles

(1) Approach with positive charge

1) 300nm particle size

The porous silica particles of Example 9-1- (4) were reacted with (3-Aminopropyl) triethoxysilane (APTES) to charge with a positive charge.

Specifically, 100 mg of porous silica particles were dispersed in a 10 mL toluene in a 100 mL round bottom flask with a bath sonicator. Then 1 mL of APTES was added and stirred at 400 rpm and stirred at 130 ° C. for 12 hours.

After the reaction was slowly cooled to room temperature, the supernatant was removed by centrifugation at 8000rpm for 10 minutes, centrifuged at 8000rpm for 10 minutes at 25 ℃ and washed five times alternately with ethanol and distilled water.

After drying in an oven at 70 ℃ to obtain a porous porous silica particles having an amino group on the surface and inside the pores.

2) particle of 200nm particle size

① The porous silica particles of Example 9-1- (1) were charged with positive charge by reacting with (3-Aminopropyl) triethoxysilane (APTES), except that 0.4 ml of APTES was added and the reaction time was 3 hours. Was modified in the same manner as in the method of 9-2- (1) -1).

② The porous silica particles of Example 9-1- (9) were charged with positive charge by reacting with (3-Aminopropyl) triethoxysilane (APTES), and the other method was the method of 9-2- (1) -1). Modified in the same manner as

③ The porous silica particles of Example 9-1- (10) were charged with positive charge by reacting with (3-Aminopropyl) triethoxysilane (APTES), and were modified in the same manner as in the method of 9-2- (1) -1). It was.

(2) Introduction of hydrophobic groups

1) Profile

The porous silica particles of Example 9-1- (1) were reacted with Trimethoxy (propyl) silane to introduce propyl groups into the surface and the pores, and 0.35ml of Trimethoxy (propyl) silane was added instead of APTES, followed by 12 hours of reaction. Modification was carried out in the same manner as in Example 9-2- (1) except for the above.

2) octyl group

The porous silica particles of Example 9-1- (1) were reacted with Trimethoxy-n-octylsilane to introduce propyl groups on the surface and inside of the pores, and 0.5 ml of Trimethoxy-n-octylsilane was added instead of APTES, and reacted for 12 hours. Modification was carried out in the same manner as in Example 9-2- (1) except for the above.

(3) Approach by negative charge

1) carboxyl group

The porous silica particles of Example 9-1- (1) were charged with negative charge by reacting with succinic anhydride,

Example 9 except that DMSO (dimethyl sulfoxide) was used instead of toluene, 80 mg of succinic anhydride was added instead of APTES, stirred at room temperature for 24 hours, and DMSO was used instead of distilled water. The modification was carried out in the same manner as in the method of -2- (1) -1).

2) thiol group

It was modified in the same manner as in Example 9-2- (1) -1) except that 1.1 mL of MPTES was used instead of APTES.

3) sulfonic acid group

100 mg of the porous silica nanoparticles of Example 9-2- (3) -2) were dispersed in 1 mL of 1 M aqueous sulfuric acid solution and 20 mL of 30% hydrogen peroxide solution, and stirred at room temperature to induce an oxidation reaction. Oxidized to a group. After the same washing and drying in the same manner as in Example 9-2- (1) -1).

9-3. 핵산분자의 담지9-3. Support of Nucleic Acid Molecules

10 μg of porous silica particles of Example 9-2- (1) -2) -② and 50 pmol of nucleic acid molecules were mixed under 1 × PBS conditions, and then placed at room temperature for 30 minutes.

실험결과Experiment result

1. 본 발명 핵산분자의 CTGF 발현 억제 분석1. CTGF expression inhibition assay of nucleic acid molecule of the present invention

According to the above embodiment, the inhibition rate of CTGF expression of the prepared nucleic acid molecules (PNA, siRNA or dsRNA; see Table 1) is shown in Tables 2 and 3 below.

Referring to Tables 1 and 2 below, a nucleic acid molecule comprising a strand having complementarity with at least 10 nucleotides complementarity with the sequence of SEQ ID NO: 1 (sense RNA consisting of the sequence of SEQ ID NO: 1 and antisense RNA consisting of the sequence of SEQ ID NO: 2) A siRNA consisting of a siRNA, a strand consisting of a sequence of SEQ ID NO: 3 and a dsRNA consisting of a strand complementary thereto, a sense RNA consisting of a sequence of SEQ ID NO: 52, and an antisense RNA consisting of a sequence of SEQ ID NO: 53, consisting of the sequence of SEQ ID NO: 54 A dsRNA consisting of a strand and its complementary strand, a siRNA consisting of a sense RNA consisting of a sequence of SEQ ID NO: 55 and an antisense RNA consisting of a sequence of SEQ ID NO: 56, a strand consisting of a sequence of SEQ ID NO: 57, and a dsRNA consisting of a complementary strand thereof, Antisense consisting of a sense RNA consisting of the sequence of SEQ ID NO: 58 and a sequence of SEQ ID NO: 59 SiRNA consisting of an RNA, siRNA consisting of a strand consisting of a sequence of SEQ ID NO: 60 and a dsRNA consisting of a strand complementary thereto, a sense RNA consisting of a sequence of SEQ ID NO: 61, and an antisense RNA consisting of a sequence of SEQ ID NO: 62, a sequence of SEQ ID NO: 63 Consisting of a strand consisting of a strand consisting of dsRNA and complementary strands thereof, a sense RNA consisting of a sequence of SEQ ID NO: 64, and an antisense RNA consisting of a sequence of SEQ ID NO: 65, a strand consisting of the sequence of SEQ ID NO: 66, and a strand complementary thereto dsRNA, a sense RNA consisting of a sequence of SEQ ID NO: 67 and an siRNA consisting of an antisense RNA consisting of a sequence of SEQ ID NO: 68, a strand consisting of a sequence of SEQ ID NO: 69 and a dsRNA consisting of a strand complementary thereto, a sense consisting of the sequence of SEQ ID NO: 70 Consisting of RNA and antisense RNA consisting of the sequence of SEQ ID NO: 71 antisense PNA consisting of a siRNA, a strand consisting of a sequence of SEQ ID NO: 72 and a dsRNA consisting of a strand complementary thereto, and one sequence selected from the group consisting of SEQ ID NOs: 87 to 99), an inhibition rate of more than 90% On the other hand, other nucleic acid molecules that do not satisfy this, it can be seen that shows a low inhibition rate of less than 75%.

In particular, a nucleic acid molecule comprising a strand having complementarity of only 7 nucleotides (sense RNA consisting of the sequence of SEQ ID NO: 4 and antisense RNA consisting of the sequence of SEQ ID NO: 5; strand consisting of the sequence of SEQ ID NO: 6 and complementary thereto In the case of dsRNA consisting of strands, the expression rate is significantly lower than about 60%, suggesting that the technical significance of the complementarity with the sequence of SEQ ID NO: 1 is 10 nucleotides or more.

Among them, siRNA consisting of a sense RNA consisting of a sequence of SEQ ID NO: 1 and an antisense RNA consisting of a sequence of SEQ ID NO: 2, including the strand having the highest expression inhibition and comprising a strand complementary to the sequence of SEQ ID NO: 1 and all 18 nucleotides; Alternatively, the following experiment was performed by selecting a strand consisting of a strand consisting of the sequence of SEQ ID NO: 3 and a strand complementary thereto.

염기서열 번호(/는 sense strand와 antisense strand 간 pair를 의미)Sequence number (/ means pair between sense strand and antisense strand)	발현 억제율 (%)Expression inhibition rate (%)	염기서열 번호Sequence number	발현 억제율 (%)Expression inhibition rate (%)
1/2 또는 31/2 or 3	93.793.7	37/38 또는 3937/38 or 39	74.674.6
4/5 또는 64/5 or 6	62.462.4	40/41 또는 4240/41 or 42	71.871.8
7/8 또는 97/8 or 9	67.267.2	43/44 또는 4543/44 or 45	63.563.5
10/11 또는 1210/11 or 12	72.672.6	46/47 또는 4846/47 or 48	74.274.2
13/14 또는 1513/14 or 15	74.174.1	49/50 또는 5149/50 or 51	71.671.6
16/17 또는 1816/17 or 18	61.361.3	52/53 또는 5452/53 or 54	90.390.3
19/20 또는 2119/20 or 21	74.774.7	55/56 또는 5755/56 or 57	90.190.1
22/23 또는 2422/23 or 24	72.372.3	58/59 또는 6058/59 or 60	91.991.9
25/26 또는 2725/26 or 27	67.867.8	61/62 또는 6361/62 or 63	92.292.2
28/29 또는 3028/29 or 30	63.563.5	64/65 또는 6664/65 or 66	91.591.5
31/32 또는 3331/32 or 33	71.671.6	67/68 또는 6967/68 or 69	92.892.8
34/35 또는 3634/35 or 36	72.972.9	70/71 또는 7270/71 or 72	91.691.6

PNA 염기서열 번호PNA sequence number	발현 억제율 (%)Expression inhibition rate (%)	PNA 염기서열 번호PNA sequence number	발현 억제율 (%)Expression inhibition rate (%)
8787	90.390.3	9494	92.192.1
8888	90.190.1	9595	90.590.5
8989	91.291.2	9696	91.791.7
9090	90.790.7	9797	90.490.4
9191	91.591.5	9898	90.290.2
9292	90.290.2	9999	91.491.4
9393	91.391.3

2.2. 다공성 실리카 입자(DDV 또는 DegradaBALL)Porous Silica Particles (DDV or DegradaBALL)

2-1. 입자의 형성 및 기공의 확장 확인2-1. Confirmation of Particle Formation and Pore Expansion

Experimental Method Small pore particles and prepared porous silica particles of the particles of Examples 9-1- (1) to (3) were observed under a microscope to determine whether the small pore particles were uniformly formed, or the pores were sufficiently expanded to allow the porous silica particles It was confirmed whether was formed uniformly (Figs. 28 to 31).

FIG. 28 is a photograph of porous silica particles of 9-1- (1), and FIG. 29 is a photograph of porous silica particles of 9-1- (2), confirming that spherical porous silica particles having sufficiently expanded pores are formed evenly. Can,

Fig. 30 is a photograph of small pore particles of 9-1- (1), and Fig. 31 is a comparative photograph of small pore particles of 9-1- (1) and 9-1- (3). You can see that is generated evenly.

2-2. BET 표면적 및 기공의 부피 계산2-2. Calculation of BET Surface Area and Pore Volume

Experimental Method The surface area and pore volume of the small pore particles of Example 9-1- (1) and the porous silica particles of Examples 9-1- (1), (7), (8) and (10) were calculated. The surface area was calculated by Brunauer-Emmett-Teller (BET) method, and the pore size distribution was calculated by Barrett-Joyner-Halenda (BJH) method.

Micrographs of the particles are shown in FIG. 32, and the calculation results are shown in Table 4 below.

구분division	기공 직경(nm)Pore diameter (nm)	BET 표면적(m ²/g)BET surface area (m ² / g)	기공 부피(mL/g)Pore Volume (mL / g)
실시예 9-1-(1)의 소기공 입자Small Pore Particles of Example 9-1- (1)	2.12.1	13371337	0.690.69
실시예 9-1-(7)Example 9-1- (7)	4.34.3	630630	0.720.72
실시예 9-1-(8)Example 9-1- (8)	6.96.9	521521	0.790.79
실시예 9-1-(1)Example 9-1- (1)	10.410.4	486486	0.820.82
실시예 9-1-(10)Example 9-1- (10)	2323	395395	0.970.97

2-3. 생분해성 확인2-3. Check biodegradability

Experimental Method In order to confirm the biodegradability of the porous silica particles of Example 9-1- (1), the degree of biodegradation at 37 ° C. and SBF (pH 7.4) was observed under a microscope at 0 hours, 120 hours, and 360 hours. Shown in 33.

Referring to this, it can be seen that porous silica particles are biodegraded and nearly decomposed after 360 hours.

2-4. 흡광도비 측정2-4. Absorbance Ratio Measurement

The absorbance ratio according to Equation 1 according to time was measured.

[Equation 1]

A _t / A ₀

Wherein A ₀ is the absorbance of the porous silica particles measured by placing 5 ml of the 1 mg / ml suspension of the porous silica particles into a cylindrical permeable membrane having pores having a diameter of 50 kDa,

Specifically, 5 mg of porous silica particle powder was dissolved in 5 ml of SBF (pH 7.4). Thereafter, 5 ml of the porous silica particle solution was placed in a permeable membrane having pores having a diameter of 50 kDa shown in FIG. 34. 15 ml of SBF was added to the outer membrane, and the SBF of the outer membrane was replaced every 12 hours. Decomposition of the porous silica particles was performed at 37 ° C. with 60 rpm horizontal stirring.

The absorbance was then measured by UV-vis spectroscopy and analyzed at λ = 640 nm.

(1) absorbance ratio measurement

Experimental method The absorbance ratio of the porous silica particles of Example 9-1- (1) was measured according to the above method, and the results are shown in FIG. 35.

Referring to this, it can be seen that t, which has an absorbance ratio of 1/2, decomposes very slowly in about 58 hours.

(2) by particle size

Experimental method The absorbance of the porous silica particles of Examples 9-1- (1), (5), and (6) was measured according to Equation 1, and the results are shown in FIG. 36 (SBF as a suspension and a solvent). Use).

Referring to this, it can be seen that t decreases with increasing particle size.

(3) by pore average diameter

Experimental Method The absorbances of the porous silica particles of Examples 9-1- (1) and (9) and the microporous porous silica particles of Experimental Method Example 9-1- (1) as controls were measured according to Equation (1). The results are shown in FIG. 37 (SBF was used as the suspension and the solvent).

Referring to this, it can be seen that the porous silica particles of the example have a significantly larger t than the control.

(4) pH

Experimental Method The absorbance for each pH of the porous silica particles of Example 9-1- (4) was measured. Absorbance was measured in SBF and in Tris at

pH

2, 5, and 7.4 and the results are shown in FIG. 38.

Referring to this, there is a difference in t for each pH, but the ratio t of the absorbance is 1/2 or more.

(5) Daejeon

Experimental method The absorbance of the porous silica particles of Example 9-2- (1) -1) was measured, and the results are shown in FIG. 39 (using Tris (pH 7.4) as the suspension and the solvent).

Referring to this, t, which has a ratio of absorbance 1/2 of the positively charged particles, was 24 or more.

2-5. 담지한 핵산분자의 방출2-5. Release of Supported Nucleic Acid Molecules

10 [mu] l of porous silica particles loaded with Cy5-siRNA were resuspended in SBF (pH 7.4, 37 [deg.] C.) and placed in a permeable membrane (tube in FIG. 40) with a pore diameter of 20 kDa.

Thereafter, the permeation tube was soaked in 1.5 ml of SBF.

Release of siRNA was carried out at 37 ° C. with 60 rpm horizontal stirring.

Before 24 hours, the solvent was recovered at 0.5, 1, 2, 4, 8, 12, and 24 hours elapsed, and thereafter, at 24 hours, 0.5 ml of the solvent was recovered for fluorescence measurement. SBF was added.

Fluorescence intensity of Cy5-siRNA was measured at 670 nm wavelength (λ _ex = 647 nm) to measure the degree of emission of siRNA, and the results are shown in FIG. 41.

Referring to this, it can be seen that the time of siRNA release by 50% is about 48 hours.

3. 3. in vitroin vitro 상 LEM-S401의 CTGF mRNA knockdown의 효과적 유도 확인 Confirmation of Effective Induction of CTGF mRNA Knockdown of Putative LEM-S401

To measure target gene knockdown efficiency of LEM-S401, A549 (human lung cancer non-small cell) cells and HaCaT (human keratinocyte cells) cells were treated with DegradaBALL (LEM-S401) carrying siCTGF. Because both cell lines have functionally active CTGF transcription pathways, A549 and HaCaT cells are widely used as in vitro model cells in fibrosis studies. First, A549 cells were treated with various concentrations of LEM-S401 (12.5, 25, 50 and 100 nM) and then incubated with 2 ng / mL TGF-ß to induce CTGF expression (FIG. 1). Previous studies have shown that TGF-ß induces CTGF expression in vitro , and it was confirmed that CTGF expression was significantly increased by treating TGF-ß with A549 and HaCaT cells (FIG. 17). Treatment of LEM-S401 on cell lines reduced mRNA expression levels of CTGF in a concentration dependent manner. On the other hand, the control group (siCTGF only, scrambled siRNA and vehicle (DegradaBALL) only) did not show a significant difference in the mRNA level of CTGF in both A549 and HaCaT cells (Fig. 2, 3). These results indicate that LEM-S401 efficiently transfected siCTGF into cells and induced knockdown of CTGF gene.

4. 4. in vitroin vitro 상 LEM-S401의 서방적 siCTGF 방출 Sustained Release siCTGF Release of Phase LEM-S401

In this experiment, LEM-S401 maintained a longer CTGF knockdown effect than LNP in A549 and HaCaT cells. A549 and HaCaT cells were treated with siCTGF supported on LEM-S401 (50 nM) and LNP (50 nM), and then CTGF expression was induced by TGF-ß treatment. Downregulation of CTGF in A549 cells lasted up to 96 hours after LEM-S401 treatment (CTGF expression level, 72 hours: 26.3%, 96 hours: 26.9%). However, the knockdown efficiency of siCTGF loaded on LNP was not high at both 72 and 96 hours (CTGF expression level, 72 hours: 46.4%, 96 hours: 58.6%). In addition, knockdown efficiency (CTGF expression level, 72 hours: 34.3%, 96 hours: 35.8%) of LEM-S401 in HaCaT cells was determined by siCTGF (CTGF expression level, 72 hours: 62.5%, 96 hours: 78.8%) loaded on LNP. ) And consistently superior (Figures 4, 5). Taken together, it can be seen that LEM-S401 inhibits the target mRNA expression level for a longer time period compared to siCTGF loaded in LNP in cells.

5. 마우스 피부 상처 모델에서, LEM-S401의 CTGF 발현 및 비대흉터 형성 억제능 확인5. Inhibition of CTGF Expression and Hypertrophy Scar Formation of LEM-S401 in Mouse Skin Wound Model

Next, experiments were conducted to determine if LEM-S401 could downregulate CTGF expression in vivo. Prior to measuring gene knockdown efficacy in vivo, C57BL / 6 mice were injected with fluorescent label LEM-S401 consisting of FITC-conjugated siCTGF loaded on TAMRA-conjugated DegradaBALL and unsupported (free) FITC-conjugated We tried to compare the duration of the injection of LEM-S401 and free siCTGF by injecting only siCTGF through the subcutaneous injection route. Thus, fluorescence image analysis of resected mouse skin and sectioned skin was performed on

days

1, 3 and 5 after injection. Fluorescence of TAMRA-DegradaBALL carrying FITC-siCTGF showed strong luminescence at the injection site on day 1. In addition, the fluorescence decreased slowly with time, but the fluorescence was maintained at the injection site until 5 days after the injection (FIG. 6). The tendency for fluorescence at the injection site to decrease with this time was in accordance with the tendency of the skin section slide (FIG. 6). On the other hand, no fluorescence signal was observed in the excised skin or fragmented skin slides from mice injected with only unsupported free FITC-siCTGF, which was a small fragment that caused the free siCTGF to disperse rapidly in the body or to induce very rapid diffusion. Implying degradation (FIG. 7). The data show that, compared to free siCTGF, LEM-S401 can maintain significantly higher concentration levels of siCTGF in the skin, at least 3 days after infusion.

Next, it was demonstrated in the rat skin wound model that LEM-S401 can induce CTGF gene knockdown and reduce collagen overproduction. After making a wound hole with a biopsy punch in the rat's back skin (day 0), silicone splints were sutured around the wound for management and observation. LEM-S401 was injected subcutaneously around the wound at 0,4,8,12 days. Mice were sacrificed on day 16, and expression levels of CTGF in the skin were analyzed by RT-PCR. The expression level of CTGF was significantly decreased in the LEM-S401 treated group, whereas no change was observed in the group treated with siCTGF or DegradaBALL alone. In addition,

collagen type

1,3 expression levels were also significantly downregulated in the LEM-S401 treated group (FIGS. 8-10).

Collagen types

1,3 known to be induced by CTGF are the major components of hypertrophic scars and keloids. Thus, it can be assured that CTGF inhibited expression by LEM-S401 influenced the expression level of

collagen type

1,3.

Uneven, bumpy, and irregular skin surfaces caused by overgrowth of wound connective tissue are major features of hypertrophic scars and keloids. Wounded skin pictures on day 10 showed irregular features in the control group, but skin pictures in the LEM-S401 treated group appeared regular and smooth (FIG. 11). This proves that LEM-S401 inhibits uncontrolled uneven skin formation and prevents hypertrophic scar formation. Immunohistochemical analysis also showed that the expression of CTGF and

collagen types

1,3 were significantly lower in the LEM-S401 treated group than the control group (FIGS. 12-15). In the repair of skin wounds, tissue remodeling occurs in the dermis after the epidermis has recovered. In this process, the expression of collagen fibers increases, which can lead to hypertrophic scars or keloids if collagen formation is uncontrollable. Therefore, in order to confirm whether LEM-S401 can suppress the expression of CTGF and collagen during tissue remodeling, LEM-S401 was injected after the epidermis was recovered. Specifically, a biopsy punch was used to puncture the mouse skin (day 0), and after 10 days, 14, 18 and 22 days of epidermal recovery, LEM-S401 was injected into the wound site. Typically, in the mouse wound model, 10 days was sufficient to fully restore the epidermis after wound formation. After sacrifice on day 26, expression levels of CTGF and

collagen type

1,3 were analyzed by RT-PCR. The expression levels of CTGF and collagen in the LEM-S401 treated group were significantly lower than those in the control group (FIGS. 18 to 20). Immunohistochemical analysis showed that CTGF and

collagen type

1,3 protein expression levels were significantly reduced in the LEM-S401 treated group (FIGS. 21-24).

Claims

A composition for inhibiting CTGF gene expression comprising; a nucleic acid molecule consisting of a sequence of SEQ ID NO: 1 and a sequence complementary to 10 nucleotides or more.
The method of claim 1, wherein the nucleic acid molecule consisting of a sequence of at least 16 nucleotides complementary to the sequence of SEQ ID NO: 1; composition comprising a.
The composition according to claim 1, wherein the nucleic acid molecule consisting of a sequence complementary to the entire sequence of SEQ ID NO: 1.
The composition of claim 1, wherein the nucleic acid molecule forms one strand of siRNA, dsRNA, PNA, or miRNA.
The method according to claim 4, siRNA consisting of the sense RNA consisting of the sequence of SEQ ID NO: 1 and antisense RNA consisting of the sequence of SEQ ID NO: 2, the strand consisting of the sequence of SEQ ID NO: 3 and dsRNA consisting of the strands complementary thereto, the sequence of SEQ ID NO: 52 A siRNA consisting of a sense RNA consisting of an antisense RNA consisting of a sequence of SEQ ID NO: 53 and a strand consisting of a sequence of SEQ ID NO: 54 and a dsRNA consisting of a strand complementary thereto, a sense RNA consisting of a sequence of SEQ ID NO: 55, and a sequence of SEQ ID NO: 56 SiRNA consisting of an antisense RNA consisting of, a strand consisting of a sequence of SEQ ID NO: 57 and a dsRNA consisting of a complementary strand thereof, a siRNA consisting of a sense RNA consisting of a sequence of SEQ ID NO: 58 and an antisense RNA consisting of a sequence of SEQ ID NO: 59, SEQ ID NO: DsRN consisting of a strand consisting of a sequence of 60 and a strand complementary thereto A, siRNA consisting of a sense RNA consisting of the sequence of SEQ ID NO: 61 and antisense RNA consisting of the sequence of SEQ ID NO: 62, a dsRNA consisting of a strand consisting of the sequence of SEQ ID NO: 63 and a strand complementary thereto, a sense consisting of the sequence of SEQ ID NO: 64 SiRNA consisting of RNA and antisense RNA consisting of the sequence of SEQ ID NO: 65, dsRNA consisting of the strand of SEQ ID NO: 66 and complementary strands thereof, sense RNA consisting of the sequence of SEQ ID NO: 67, and antisense consisting of the sequence of SEQ ID NO: 68 SiRNA consisting of an RNA RNA, a strand consisting of a sequence of SEQ ID NO: 69 and a dsRNA consisting of a complementary strand thereof, a siRNA consisting of a sense RNA consisting of a sequence of SEQ ID NO: 70 and an antisense RNA consisting of a sequence of SEQ ID NO: 71, a sequence of SEQ ID NO: 72 Consisting of a strand consisting of dsRNA and complementary strands; Composition comprising at least one siRNA or dsRNA selected from.
The composition of claim 5, further comprising a sequence of UU or dTdT at the 3 ′ end of the sense RNA and antisense RNA sequence.
The composition of claim 4, comprising at least one PNA consisting of one sequence selected from the group consisting of SEQ ID NOs: 87-99.
The method of claim 7, wherein at least one end of the PNA peptide consisting of at least one sequence selected from the group consisting of SEQ ID NO: 101 to 113; Or mPEG 5000 is further bound.
A pharmaceutical composition for preventing or treating fibroproliferative disease, comprising the composition of any one of claims 1 to 8.
The method of claim 9, wherein the fibrotic disease is hypertrophic scar, keloid, fibrosis, pulmonary fibrosis, idiopathic pulmonary fibrosis, liver fibrosis, kidney fibrosis, cystic fibrosis, myelofibrosis, peritoneal fibrosis, scleroderma, diabetic retinopathy, Duken Muscular dystrophy, radiation-induced fibrosis, myocardial fibrosis, diabetic kidney disease, chronic renal failure, chronic viral hepatitis, cholangiofibrosis, fatty liver, alcoholic fatty hepatitis, nonalcoholic steatohepatitis, proliferative vitreoretinopathy, musculoskeletal tumor, osteosarcoma, rhabdomyomus Sarcoma, Glioblastoma, Lung Cancer, Ovarian Cancer, Esophageal Cancer, Colon Cancer, Pancreatic Cancer, Kidney Sclerosis, Sarcoidosis, Glaucoma, Macular Degeneration, Subretinal Fibrosis, Choroidal Neovascularization, Vitreoretinopathy, Proliferative Vitreoretinopathy, Diabetic Retinopathy , Keratitis, pterygium, censorship, scleroderma, fibroids, systemic sclerosis, glomerulonephritis, human immunodeficiency viral kidney disease, acute respiratory distress The composition is at least one selected from the group consisting of Ran syndrome, chronic obstructive pulmonary disease, Raynaud's disease, rheumatoid arthritis, polymyositis, vascular stenosis, periodontitis and periodontal gingiva.
And porous silica particles carrying nucleic acid molecules that complementarily bind to at least a portion of the transcript of the CTGF gene.

The porous silica particles react with silica particles having pores less than 5 nm in diameter at 120 ° C. to 180 ° C. for 24 to 96 hours to expand the pores less than 5 nm in diameter; And calcining the pores of expanded silica particles at a temperature of 400 ° C. or higher for at least 3 hours.

The average diameter of the porous silica particles is 100 nm to 1000 nm, the BET surface area is 200m 2 / g to 700m 2 / g, the volume per g is 0.7ml to 2.2ml,

The porous silica particles, the ratio of the absorbance of the following formula 1 is t is 24 or more, CTGF gene expression inhibition composition:

[Equation 1]

A t / A 0

Wherein A 0 is the absorbance of the porous silica particles measured by placing 5 ml of the 1 mg / ml suspension of the porous silica particles in a cylindrical permeable membrane having pores having a diameter of 50 kDa,

Outside of the permeable membrane is in contact with the permeable membrane, 15ml of the same solvent as the suspension is located, the inside and outside of the permeable membrane is stirred 60 rpm at 37 ℃ horizontal,

The pH of the suspension is 7.4,

A t is the absorbance of the porous silica particles measured after t hours have elapsed since the measurement of A 0 ).
The composition of claim 11, wherein the porous silica particles are positively or uncharged at neutral pH at their outer surface or inside the pore.
The composition of claim 11, wherein the porous silica particles have hydrophilic or hydrophobic functional groups.
The composition of claim 11, wherein the nucleic acid molecule is at least 10 nucleotides complementary to the sequence of SEQ ID NO: 1.
The composition of claim 11, wherein the nucleic acid molecule is at least 16 nucleotides complementary to the sequence of SEQ ID NO: 1.
The composition of claim 11, wherein the nucleic acid molecule consists of a sequence complementary to the entire sequence of SEQ ID NO: 1.
The composition of claim 11, wherein the nucleic acid molecule forms one strand of siRNA, dsRNA, PNA or miRNA.
The method of claim 17, wherein the siRNA consisting of the sense RNA consisting of the sequence of SEQ ID NO: 1 and antisense RNA consisting of the sequence of SEQ ID NO: 2, the strand consisting of the sequence of SEQ ID NO: 3 and dsRNA consisting of the strands complementary thereto, the sequence of SEQ ID NO: 52 A siRNA consisting of a sense RNA consisting of an antisense RNA consisting of a sequence of SEQ ID NO: 53, a strand consisting of a sequence of SEQ ID NO: 54, and a dsRNA consisting of a strand complementary thereto, a sense RNA consisting of a sequence of SEQ ID NO: 55, and a sequence of SEQ ID NO: 56 SiRNA consisting of an antisense RNA consisting of, a strand consisting of a sequence of SEQ ID NO: 57 and a dsRNA consisting of a complementary strand thereof, a siRNA consisting of a sense RNA consisting of a sequence of SEQ ID NO: 58 and an antisense RNA consisting of a sequence of SEQ ID NO: 59, SEQ ID NO: Strand consisting of the sequence of 60 and complementary thereto A siRNA consisting of NA, a sense RNA consisting of a sequence of SEQ ID NO: 61, and an antisense RNA consisting of a sequence of SEQ ID NO: 62, a dsRNA consisting of a strand consisting of the sequence of SEQ ID NO: 63, and a complementary strand thereof, a sense consisting of the sequence of SEQ ID NO: 64 SiRNA consisting of RNA and antisense RNA consisting of SEQ ID NO: 65, dsRNA consisting of strand of SEQ ID NO: 66 and complementary strands thereof, sense RNA consisting of SEQ ID NO: 67, and antisense consisting of SEQ ID NO: 68 SiRNA consisting of an RNA siRNA, a strand consisting of a sequence of SEQ ID NO: 69 and a dsRNA consisting of a strand complementary thereto, a sense RNA consisting of a sequence of SEQ ID NO: 70 and an antisense RNA consisting of an sequence of SEQ ID NO: 71, a sequence of SEQ ID NO: 72 Consisting of a strand consisting of a dsRNA and complementary strands; A composition comprising at least one siRNA or dsRNA selected from the group.
The composition of claim 18, further comprising a sequence of UU or dTdT at the 3 ′ end of the sense RNA and antisense RNA sequence.
The composition of claim 17, comprising at least one PNA consisting of one sequence selected from the group consisting of SEQ ID NOs: 87-99.
The peptide of claim 20, further comprising: a peptide consisting of at least one sequence selected from the group consisting of SEQ ID NOs: 101 to 113 at at least one end of the PNA; Or mPEG 5000 is further bound.
A pharmaceutical composition for the prophylaxis or treatment of fibrotic disease, comprising the composition of any one of claims 11 to 21.
The fibrotic disease according to claim 22, wherein the fibrotic disease is hypertrophic scar, keloid, fibrosis, pulmonary fibrosis, idiopathic pulmonary fibrosis, liver fibrosis, kidney fibrosis, cystic fibrosis, myelofibrosis, peritoneal fibrosis, scleroderma, diabetic retinopathy, Duken Muscular dystrophy, radiation-induced fibrosis, myocardial fibrosis, diabetic kidney disease, chronic renal failure, chronic viral hepatitis, cholangiofibrosis, fatty liver, alcoholic fatty hepatitis, nonalcoholic steatohepatitis, proliferative vitreoretinopathy, musculoskeletal tumor, osteosarcoma, rhabdomyomus Sarcoma, Glioblastoma, Lung Cancer, Ovarian Cancer, Esophageal Cancer, Colon Cancer, Pancreatic Cancer, Kidney Sclerosis, Sarcoidosis, Glaucoma, Macular Degeneration, Subretinal Fibrosis, Choroidal Neovascularization, Vitreoretinopathy, Proliferative Vitreoretinopathy, Diabetic Retinopathy , Keratitis, pterygium, censorship, scleroderma, fibroids, systemic sclerosis, glomerulonephritis, human immunodeficiency viral kidney disease, acute respiration It is syndrome, chronic obstructive pulmonary disease, Raynaud, rheumatoid arthritis, multiple myositis, vascular restenosis, periodontal disease, and at least one selected from the group consisting of chijueun composition.