WO2020022476A1

WO2020022476A1 - System for highly efficient modification of target sequences

Info

Publication number: WO2020022476A1
Application number: PCT/JP2019/029381
Authority: WO
Inventors: 好司草野; 孝行木藤古; 亜峰朱; 豊隆森
Original assignee: 株式会社Ｉｄファーマ
Priority date: 2018-07-27
Filing date: 2019-07-26
Publication date: 2020-01-30
Also published as: JP2021176265A

Abstract

Provided is a technology for more efficient genetic modification, including target gene disruption, using a guide RNA-dependent nuclease. The present invention also addresses the problem of different cleavage efficiencies for each target sequence. Specifically, by the present invention, a new system was developed in which, when developing a target cleavage system that utilizes a guide RNA-dependent nuclease, only the nuclease gene is integrated into a negative-strand RNA viral vector, which has the properties of high infection efficiency and high transgene expression, and, after the viral vector has been introduced into cells in advance and the nuclease has been caused to be expressed, guide RNA is separately supplied to the cells. As a result, an increase in cleavage efficiency and a reduction in recleavage were both successfully achieved, and the efficiency of target gene modification was improved. The present invention is useful as an efficient genetic modification technology, and also has the feature of making it possible to adjust the enhancement and attenuation of genetic modification efficiency by adjusting cleavage efficiency through adjustment of the amount of guide RNA that is introduced.

Description

A system that modifies target sequences with high efficiency

(4) The present invention relates to a molecular genetic technique for easily and quickly modifying a gene sequence for the purpose of gene function analysis, gene therapy, breed improvement, biotechnological creation, and the like.

As a technique for cutting a nucleotide sequence site targeted for gene editing, ZFN method, TALEN method, CRISPR / Cas9 method, etc. are known, but the CRISPR / Cas9 method is currently most widely used because of its simplicity. (Morton, J., et al., Proc. Natl. Acad. Sci. USA 103, 37016370-16375 (2006); erCermak, T. et al., Nucleic Acids Res. 39, e82 (2011); Cong , L. et al., Science 339, 819-823 (2013); Mali, P. et al., Science 339, 823-826 (2013)). Regardless of the cleavage method, a recombination reaction occurs immediately after the cleavage as an intracellular function, and a change to an inserted / deleted / mutated sequence called indel may occur. Therefore, these intracellular functions are often used for gene disruption technology. In general, the frequency of genetic modification to a design sequence is significantly lower than the frequency of gene disruption, and therefore, the following method is generally employed to carry out the modification.

One of the typical methods is a donor consisting of a base sequence after exon modification and a sequence in which a drug-resistant gene inserted between site-specific recombinase recognition sequences (LoxP, FRT) is inserted in the immediate vicinity of an intron. DNA is introduced and cut within the corresponding exon-intron region on the genome. From the intron drug resistance marker gene to the exon-modified base sequence, after isolating a cell clone that has been replaced with the sequence of the donor DNA over a long chain, in order to remove the drug resistance marker gene, Introduction of site-specific recombinase (Cre, Flp) gene to obtain cells with only drug resistance markers missing (Li, H. L.et al., Stem Cell Reports 4, 143-154 (2015) ).

In another method, a donor DNA consisting of a drug resistance gene sandwiched between a transposase recognition sequence (PiggyBac (PB) IRE) is introduced into the exon-modified base sequence and the immediately adjacent intron, and the exon-intron region is cleaved. From the intron drug resistance marker gene to the exon-modified nucleotide sequence, after isolating a cell clone that has been replaced with the sequence of the donor DNA over a long chain (1 kb or more), for the cell clone, transposase (PiggyBac transposase) The gene is introduced to obtain cells from which the drug resistance marker and the recognition sequence (PiggyBac IRE) have been lost (Yusa, K. et al., Nature 478, 391-394 (2012)).

Recently, it has also been attempted to select cells that have been converted into modified base sequences through sib-screening without performing the insertion / removal of a selectable marker gene as in the above two methods by the droplet digital PCR method. I have. For example, from a population in which 0.02% are sequence-modified cells, tens of percent are inaccurate recombined cells changed to indels (insertion / deletion / mutation sequences), and the remainder are parental cells, a two-stage sib- It has been reported that sequence-modified cells could be selected after screening (Miyaoka, Y. et al., Nat. Methods 11, 291-293 (2014)).

は An object of the present invention is to provide a method for efficiently modifying a genomic sequence, and a vector and the like used in the method.

There are several problems with the conventional genome modification techniques described above.
(1) Cleavage at an off-target similar sequence When chromosome breakage occurs due to active oxygen or the like, recombination is usually performed accurately. The probability of active oxygen reacting again at the same position is extremely low, but in the ZFN method, TALEN method, CRISPR / Cas9 method, cleavage / rejoining is repeated at the target sequence or a similar sequence on the genome existing outside the target, In the process, cells are produced that have incorrect recombination that has been changed to an insertion / deletion / mutation sequence called indel.
During gene disruption, off-target analogous sequences on the genome can be cleaved, causing indel there. In the case of genetic modification to a design sequence, cleavage at the design sequence, which is an off-target similar sequence on the donor DNA, would prevent genetic modification. Even if the gene is modified according to the design sequence, if the sequence is similar before and after the genetic modification, re-cutting may occur after the modification.
Such off-target similar sequence cleavage may result in residual target sequence DNA and unintended sequence abnormalities, making it difficult to select designed genetically modified cells.

(2) Diversity of CRISPR / Cas9 cleavage efficiency between target sequences (guide RNA) There is a problem that the frequency of gene modification by CRISPR / Cas9 is variable and difficult to predict, and one of the causes is that cleavage efficiency is a target sequence. (Guide RNA). With a guide RNA having a low cleavage efficiency, it is difficult to modify the gene, and with a guide RNA having a high cleavage efficiency, a donor DNA having a similar design sequence may be destroyed. In that case, the cleavage efficiency should be suppressed, but expression control of Cas9 / sgRNA has not been realized at present.

(2) Two-stage selection In the conventional method, two stages are required due to low gene modification efficiency. First, a donor DNA in which a selectable marker gene is brought close to the target modified sequence fragment is introduced, a drug-resistant genetically modified cell clone in which both are inserted into the target site is isolated, and finally the selectable marker is removed. However, there is a problem that excessive labor and time are required for the two-stage screening operation.

(3) Remaining site-specific recombination sequence The modified sequence and the drug selection marker gene carried on the donor DNA are simultaneously introduced into the target site, and then the site-specific recombination enzyme recognition sequence (LoxP, FRT) is used. Although only the sandwiched selectable marker gene is removed by site-specific recombinase, one method, such as Cre / LoxP method or Flp / FRT method, leaves one recognition sequence. There is a problem that it cannot be applied.

(4) Loss of Target Cleavage Sequence In the site-specific recombination method and transposase method described above, a long chain (1 kb or more) region in the donor DNA sequence is introduced into the target cleavage site. In the method, not only the cleavage of the target sequence on the chromosomal locus but also the cleavage of the target sequence on the donor DNA suppresses the recombination reaction of the long chain region. However, when it was necessary to avoid cleavage on the donor DNA, but the donor DNA was designed with an unnecessary loss to remove the cleavage sequence, the donor DNA sequence was copied to the target site. In a sequence-modified cell, unnecessary loss is a final product, and therefore, there is a problem that it cannot be applied to genetic modification other than gene disruption.

Regardless of whether the site-specific recombination method or the transposase method is used, an additional step of selecting a cell into which the donor DNA has been introduced and then introducing a site-specific recombination enzyme, a vector expressing the transposase, etc. into the cell is added. The procedure is complicated, for example, it is necessary to confirm that the marker gene has been removed from the genome as expected, and to select cells from which the introduced vector has been removed.

In order to prevent the occurrence of Indel or traces of unnecessary DNA sequences derived from donor DNA from remaining on the genome of cells, and to enable highly precise genetic modification with high efficiency, the present inventors have It was considered that a nuclease such as Cas9 was expressed using a minus-strand RNA virus vector. Although not a genetic modification experiment, experiments have already been reported in which a minus-strand RNA virus vector expressing the Cas9 gene together with a self-excised guide RNA was introduced into cells (Park, et al., Mol Ther Methods Clin Dev., 2016, 3: 16057, doi: 10.1038 / mtm.2016.57). It is reported that indel occurred in 75 to 98% of cells transfected with the vector.

マイナス Negative-strand RNA virus vectors, such as Sendai virus vectors, are expressed in the cytoplasm and have no DNA phase in the expression process, so there is no risk that the viral genome is integrated into the host chromosome. In addition, it shows high infectivity to a wide range of cells, and has excellent abilities such as being able to highly express a loaded gene. However, regardless of whether the virus is a replicative minus-strand RNA virus vector or an envelope protein gene-deficient minus-strand RNA virus vector lacking replication ability, the viral genomic RNA replicates in the cytoplasm in order to express the loaded gene. It is necessary to activate the virus expression system by further expressing the genes encoding the respective viral proteins.Therefore, from the time the cell is infected with the vector until the expression of the loaded gene is sufficiently increased. It is unavoidable that a time lag occurs, and it is also difficult to strictly control the onset of expression. After infection, it is necessary to continue culturing until the expression level of the loaded gene is sufficiently increased, so that the expression period must be long. The present inventors have found that it is difficult to control the expression of a minus-strand RNA virus vector in this way, and when expressing a nuclease such as Cas9 using this vector, the expression period must be long, It was thought that it caused repeated cleavage and binding by nucleases in the cells, which promoted the production of indel. Then, they thought that if the timing at which the nuclease can function could be more strictly controlled and the repetition of cleavage and binding could be suppressed, the generation of indel could be suppressed.

In order to more strictly control the timing at which nucleases can function, the present inventors have focused on the fact that nucleases such as Cas9 exert their functions in a guide RNA-dependent manner. In the case of a guide RNA-dependent nuclease, the function is not exhibited even if the nuclease is expressed under conditions where guide RNAs necessary for expressing the activity of the nuclease are not available. A nuclease gene is loaded on the minus-strand RNA virus vector, and a guide RNA (for example, a set of tracrRNA and crRNA) required for the activity of the nuclease is not loaded, or even if it is loaded, a guide RNA required for the activity of the nuclease Is designed not to encode all, the nuclease protein (only nuclease protein or only nuclease protein and some guide RNA) is highly expressed from the minus-strand RNA virus vector, but is required for nuclease activity. The nuclease function is not exhibited because all the guide RNAs are not available. The present inventors first introduced a minus-strand RNA viral vector into cells, allowed only high expression of nuclease proteins and the like to accumulate in the cells, and then lacked guide RNA due to the expression of nuclease activity. Is supplied to the cells, a functional nuclease is generated at a stretch by combining the guide RNA separately supplied with a nuclease that is highly expressed in advance and the like, and the function is exhibited. We thought that it would be possible to overcome the drawback of the expression lag of the minus-strand RNA virus vector while enjoying the advantages of high expression.

In addition, use a temperature-sensitive minus-strand RNA virus vector as a minus-strand RNA virus vector, culture at an allowable temperature when expressing a nuclease gene, etc., and then raise the temperature to a non-permissible temperature before and after the supply of guide RNA. Thus, the vector can be quickly inactivated. This avoids unnecessary generation of nuclease after the supply of the guide RNA, so that it was thought that the timing at which the functional nuclease could exert its activity in cells could be more sharply controlled.

In fact, a nuclease gene is loaded into a temperature-sensitive negative-strand RNA virus vector, introduced into TG98 cells, and expressed at a permissive temperature.Then, donor DNA and guide RNAs dedicated to HPRT ^TG98 mutation are introduced into the cells, and non-permissive. When the cells were cultured at a temperature, it was found that cells whose genetic readings were changed and the reading frame was restored could be obtained at a surprisingly high frequency of 2.6 × 10 ⁻³ to 3.6 × 10 ⁻³ (see Experiments 2-1 and 2-2). . In the conventional method using an expression plasmid, two out of 17 clones that seemed to have successfully modified the donor DNA sequence were accompanied by an unintended sequence abnormality in base insertion, or 4 out of 17 clones. (Experiment 1-1) and 6 out of 12 clones (Experiment 1-2) were accompanied by residual target sequence DNA, whereas the method of the present invention obtained 12 clones (Experiment 1). Alternatively, it was confirmed that no such clone was found in 24 clones (Experiment 1-2). In the five clones derived from the experimental system into which the Cas9-sgRNA expression plasmid was introduced without infection with SeV (SeV-AzamiGreen) carrying the visible marker gene, there was no accompanying residual sequence of the target sequence DNA or unintended sequence abnormality of base insertion. Was.
This Cas9-loaded viral vector was expressed in TG439-1 cells under the same conditions, and the same donor DNA and HPRT ^TG439 mutation-specific guide RNAs were introduced and cultured at a non-permissive temperature. 0.52x10 ^-3 was found that it is possible to obtain a high frequency of ~ 1.5x10 ^-3. In addition, with the conventional method using an expression plasmid, 0 (in 5 clones of cells that were considered to be successfully modified into the donor DNA sequence) Experiment 4-1) or 0 out of 3 clones (Experiment 4-2). Also in the method of the present invention, the presence of the residual target sequence DNA or the unintended sequence abnormality of the base insertion was caused by 0 out of 12 clones which seemed to be successfully modified into the donor DNA sequence (Experiment 4-1). Alternatively, it was 0 out of 12 clones (Experiment 4-2).
It is not possible to determine the accompanying cause of the residual target sequence DNA and the unintended sequence abnormality observed from the TG98 gene reversion test described above. From the results of these TG98 and TG439-1 gene reversion tests, the method of the present invention in which RNAs and donor DNA were introduced after Cas9 expression from SeV was associated with the genetic modification, the target sequence DNA remained and unintended sequence abnormalities occurred. It is thought that was suppressed.

In addition, after introducing and expressing a minus-strand RNA virus vector carrying a nuclease gene into cells, an experiment was conducted in which only guide RNA was introduced into cells without using donor DNA. It was also found that target destruction can be achieved at a significantly higher frequency than the conventional method using (Experiments 3-1 and 3-2). However, the value is not significantly different from the above-described gene modification frequency when the donor DNA is used, and therefore, the values are higher than those of Experiments 2-1 and 2-2 with respect to the gene disruption frequency observed in Experiments 3-1 and 3-2. The values of the ratios of the gene reversion frequencies observed in Experiments 3-1 and 3-2 were much higher in the case of using the vector system of the present invention than in the conventional method using the expression plasmid. In the gene reversion of Experiments 1-1 and 1-2, the frequency of gene reversion was low under the conditions of donor DNA introduction in the conventional method using an expression plasmid, whereas in the method of the present invention, the frequency of gene reversion was low. This shows that a high gene reversion frequency can be maintained even under DNA introduction conditions.

Thus, the present inventors have developed a minus-strand RNA viral vector that carries only a nuclease gene and does not carry a guide RNA gene (or carries a nuclease gene and encodes some guide RNAs, but has a low nuclease activity). A minus-strand RNA virus vector that does not encode all necessary guide RNA) is first introduced into cells, and after nucleases and the like are accumulated, the supply of insufficient guide RNA to the cells suppresses indel production. The present inventors have found that high-frequency and high-quality genetic modification that could not be achieved by the method described above can be performed, and completed the present invention.

That is, the present invention provides a highly efficient gene modification technique using a minus-strand RNA virus vector, and more specifically includes the inventions described in the claims. It should be noted that an invention comprising any combination of two or more of the inventions described in the claims citing the same claim is also an invention intended in the present specification. That is, the present invention includes the following inventions.
[1] A method for producing a genetically modified cell using a guide RNA-dependent DNA nuclease,
(A) a temperature-sensitive minus-strand RNA virus vector that carries the nuclease gene and does not encode at least one guide RNA required for the activity of the nuclease is introduced into cells, and the vector is expressed at a permissive temperature; Accumulating the nuclease in cells in the absence of the guide RNA,
(B) supplying the missing guide RNA to the cells after step (a);
(C) raising the culture temperature to a non-permissible temperature before or after or simultaneously with step (b), and culturing in a state where the guide RNA is present in the cells.
[2] The method of [1], further comprising: (d) recovering a cell in which the gene has been modified.
[3] The method according to [1] or [2], wherein the guide RNA is introduced into the cells in the step (b).
[4] The method according to any one of [1] to [3], wherein the culture temperature is raised to a non-permissible temperature at the time of carrying out the step (b) or at the latest at least 24 hours after that.
[5] the method of any one of [1] to [4], wherein the nuclease is a CRISPR / Cas class 2 endonuclease;
[6] the method of any one of [1] to [5], wherein the minus-strand RNA virus vector does not encode a guide RNA;
[7] The method according to any one of [1] to [6], wherein the donor DNA is also introduced into the cells in the step (b).
[8] The method of [7], wherein the donor DNA does not contain a positive selection marker gene.
[9] The method of [7] or [8], further comprising, after the step (c), selecting a cell into which the sequence in the donor DNA has been integrated.
[10] The method according to [9], wherein the selection step is a step of examining cells without relying on a positive selection marker and selecting cells into which the sequence in the donor DNA has been integrated.
[11] A vector used in the method according to any one of [1] to [10], which carries a guide RNA-dependent DNA nuclease gene and contains at least one guide RNA required for the activity of the nuclease. Non-coding, temperature-sensitive negative-strand RNA viral vector.
[12] The vector according to [11], which is a temperature-sensitive Sendai virus vector.
[13] the vector of [12], which is an F gene deleted type temperature-sensitive Sendai virus vector;
(14) the Sendai virus vector has the F gene deleted, the M protein has G69E, T116A, and A183S mutations, the HN protein has A262T, G264R, and K461G mutations, the P protein has L511F mutation, and the L protein has The Sendai virus vector according to [12] or [13], wherein the genome contains mutations of N1197S and K1795E.
[15] The Sendai virus vector according to [14], wherein the genome further comprises the following mutations (i) and / or (ii):
(I) Mutations of D433A, R434A, and K437A of P protein (ii) Mutations of Y942H, L1361C and / or L1558I of L protein [16] From [11], wherein the nuclease is a CRISPR / Cas class 2 endonuclease The vector according to any one of [15].

In addition, any technical matter described in this specification and any combination thereof are intended in this specification. Further, in these inventions, inventions excluding any matter described in this specification or any combination thereof are also intended in this specification. In addition, with respect to the present invention, certain embodiments described in the specification not only disclose the invention, but also inventions excluding the embodiment from the inventions disclosed in the higher specification including the embodiment. It is disclosed.

Attenuation of cleavage at off-target analogous sequences Inaccurate recombination occurs after repeated cleavage and binding of target DNA. If repetition of cutting can be suppressed, it is considered that incorrect recombination can also be suppressed. The present invention can suppress repetitive cleavage of the target genome and suppress incorrect recombination by enhancing and shortening the expression of the cleavage enzyme. This makes it possible, for example, to suppress indels in off-target sequences during gene disruption, and to reduce the number of unintended sequence-abnormality-bearing cells in the target during gene modification to similar designed sequences. It can be expected to facilitate the selection of cells modified according to the sequence.

・ Reduction of diversity between target sequences (guide RNAs) for cleavage efficiency by CRISPR / Cas9 Gene modification is difficult for guide RNAs with low cleavage efficiency, and guide RNAs with high cleavage efficiency retain similar designed sequences Destruction of the donor DNA can occur. According to the present invention, a guide RNA having a low cleavage efficiency is prepared by increasing the amount of RNA separately introduced in order to increase the cleavage efficiency. In order to suppress this, the frequency of gene modification can be adjusted by reducing the amount of introduced RNA.

-Avoidance of two-stage selection The fundamental solution to the problem of wasting time and labor in two-stage selection is considered to be improved genetic modification efficiency. The guide RNA-dependent nuclease gene is mounted on a minus-strand RNA virus vector that is a high-frequency infection / high expression vector, and the guide RNA is separately supplied, whereby the method of the present invention for shortening the action time of the nuclease enables gene modification. Improved efficiency, no need for a selectable marker, and one-step selection that enables screening of genetically modified cells with only the modified sequence as a target inserted from a limited number of live cell clones, saving labor and time Can be reduced.

・ Avoidance of residual site-specific recombination sequences In the conventional method, since the gene modification efficiency is low, the selection marker sandwiched between the site-specific recombination sequences is brought close to the modified sequence on the donor plasmid, and both are located at the target site. It was necessary to isolate the inserted drug-resistant genetically modified cell clone and remove the selectable marker by site-specific recombination. According to this method, the final product (genome of the finally obtained cell) was required. Site-specific recombination sequences remain. In the present invention, since genetic modification occurs at a high frequency due to the improvement of the genetic modification efficiency, genetically modified cells into which the modified sequence has been introduced can be selected under non-selective conditions, thus eliminating the need for a selective marker / site-specific recombination system. Thus, the problem of the site-specific recombination sequence remaining can be avoided.

・ Avoid loss of target cleavage sequence information.Incorporation of the long chain (1 kb or more) region containing the selectable marker on the donor plasmid, induced by cleavage of the target sequence on the chromosomal locus, into the target site on the locus. Frequency is reduced by the presence of target homologous sequences (separable sequences) on the donor plasmid. In the conventional method, the cleavage of the donor plasmid is avoided by previously removing the cleavable sequence on the donor plasmid, or, in the case of a sequence encoding a protein, performing a synonymous conversion so as not to change the encoded amino acid sequence. And maintain the recombination reaction. In the present invention, since a selection marker is not required on the donor plasmid as described above, the recombination reaction is completed within a short chain (～ 20 bp or less) region containing only the sequence after modification. Genetic modification by such a short chain region recombination reaction, even if the target homologous sequence (separable sequence) is present on the donor plasmid, was found not to be reduced. Neither the removal of the target homologous sequence nor the synonymous conversion sequence is required, and thus no information on the target cleavage sequence and no synonymous conversion are involved. Regarding the difference in the effect of the cleavable sequence between the long-chain recombination reaction system and the short-chain recombination reaction system, during the long-chain recombination reaction, the reaction intermediate is liable to be destroyed by re-cleavage, It is conceivable that the probability of receiving a re-cut is low because of completion.

According to the present invention, the following inventions can be implemented.
(I) Method for modifying high-frequency target cleavage gene by short-term strong expression In the system of the present invention, two points are 1) expression of a cleavage enzyme gene from a minus-strand RNA virus vector; and 2) optimization of the amount of RNA introduced by transfection. By using the characteristics of a minus-strand RNA viral vector that has a high frequency of infectivity and has the function of strongly expressing a loaded gene, the cleavage enzyme can be brought into a highly active state for a short period of time. It is possible to carry out a high-frequency genetic modification method attributable to the cleavage ability.
(Ii) High-frequency infectious short-term strongly expressing virus vector This is an essential tool for performing high-frequency gene modification in the method of the present invention. Provided is a vector having a guide RNA-dependent nuclease gene mounted on a minus-strand RNA virus vector having a function of causing strong expression in E. coli.
(Iii) Donor DNA consisting of the modified sequence and its surrounding homologous region
Since the conventional genetic modification method has a low frequency, it is necessary to mount a selection marker on the donor plasmid.However, since the genetic modification method of the present invention has a high frequency, the selection marker can be omitted from the donor plasmid, A simplified donor DNA comprising only the modified sequence and its surrounding homologous regions, which is made possible only by the simultaneous use of this high-frequency technique, is provided.
(Iv) Improvement of the frequency of gene modification and improvement of genomic safety by adjusting the amount of introduced RNA The frequency of the gene modification method of the present invention is increased by the expression and introduction of a sufficient amount of a guide RNA-dependent nuclease using a minus-strand RNA virus vector. This can be further enhanced by quantitative optimization of the guide RNA (gRNA) molecule. For the first time, in the system of the present invention in which a sufficient amount of guide RNA-dependent nuclease is expressed, a method that can easily suppress genomic instability (only by adjusting the amount of introduced gRNA) and improve safety can be realized.

FIG. 7 is a diagram showing the outline of a conventional genome editing technique. The donor DNA contains a positive selection marker gene (Hyg) flanked by site-specific recombinase recognition sequences (loxP) adjacent to the target site, and a negative selection marker gene (TK )It is included. The target DNA of the cells is cleaved by CRISPR / Cas9, and the cells into which the donor DNA has been integrated are selected by hygromycin and ganciclovir (first step). Thereafter, the positive selectable marker gene (Hyg) is removed by the action of the site-specific recombination enzyme Cre (second stage). In addition to the need for a two-step selection, the loxP sequence cannot be finally removed. It is a figure showing the outline of the genome editing technology of the present invention. The minus-strand RNA virus vector does not carry the guide RNA gene, but carries only the nuclease protein gene. In the case of a replication-defective virus vector, the infectious virus is not released extracellularly (thick bar A in the figure). The nuclease protein expressed in the absence of guide RNA accumulates in the nucleus in large amounts (scissors A in the figure). Then, when the donor DNA and guide RNA are introduced into cells, the nuclease functions and recombination occurs at high frequency, so there is no need to select a drug, and it is possible to obtain the desired genetically modified product in one step (B in the figure). It is a figure which shows the demonstration experiment of high frequency gene modification (reversion) by the genome editing technique of this invention. HPRT gene fragments were used as donor DNA, and HPRT ^- cells were used as target cells. Cells are infected with a temperature-sensitive SeV vector carrying the Cas9 gene, and cultured at a permissive temperature (35 ° C.) to strongly express Cas9. Thereafter, guide RNA (tracrRNA, crRNA) and donor DNA are introduced and cultured at a non-permissive temperature (37 ° C.). Gene modification (reversion) reaction induced by targeted cleavage of the genomic DNA of the cell occurs at a high frequency, and the target cell is obtained by analyzing a limited number of colonies. It is a figure which shows the appearance frequency etc. of the gene reversion clone by SeV-Cas9 supernatant sample. Compared with the conventional method of expressing Cas9 and a guide RNA (sgRNA) from a plasmid, the frequency of appearance of HAT-resistant cells (HPRT ⁺ cells) in living cells was significantly increased in the method of the present invention using Cas9-expressing SeV (panel). A). It is a figure which shows confirmation of the structure of the target region in HAT resistant colonies. When the target region in the obtained HAT-resistant colony was amplified by PCR, the amplified fragment of the expected length was obtained in all the clones in the method of the present invention. Two clones were observed to be longer than expected (panel C). The result of having analyzed the target region of the obtained HAT resistant clone is shown. According to the conventional method, in Experiment 1 (Exp. 1), 4 out of 17 clones were accompanied by the residual of the target sequence DNA, 2 clones inserted adjacent to the unintended sequence, and in Experiment 2 (Exp. 2), 6 out of 12 clones While clones were associated with the residual target sequence DNA, no such clones were observed with the method of the present invention (Panel D). It is a figure which shows the appearance frequency etc. of the gene reversion clone by SeV-Cas9 refinement | purification sample. Cell viability was improved by changing the SeV-Cas9 supernatant sample to a purified sample. Compared with the conventional method of expressing Cas9 and a guide RNA (sgRNA) from a plasmid, the frequency of appearance of HAT-resistant cells (HPRT ⁺ cells) in living cells was significantly increased in the method of the present invention using Cas9-expressing SeV. FIG. 2 is a diagram showing the frequency of appearance of gene-disrupted clones by a purified SeV-Cas9 sample and the like. Compared with the conventional method of expressing Cas9 and guide RNA (sgRNA) from a plasmid, the frequency of 6-thioguanine-resistant cells (HPRT ^- cells) in living cells was significantly increased in the method of the present invention using Cas9-expressing SeV. . FIG. 10 is a diagram showing the frequency of appearance of gene-reverted clones by a purified SeV-Cas9 sample in second evaluation cells having different target sequences. Compared with the conventional method of expressing Cas9 and a guide RNA (sgRNA) from a plasmid, the frequency of appearance of HAT-resistant cells (HPRT ⁺ cells) in living cells was significantly increased in the method of the present invention using Cas9-expressing SeV. The result of having analyzed the target area | region of the HAT resistant clone obtained from the 2nd evaluation cell is shown. Neither the conventional method nor the method of the present invention observed any accompanying or unintended adjacent insertion of the target sequence DNA.

(4) The present invention provides a new gene modification method using a minus-strand RNA virus vector. The method uses a minus-strand RNA virus vector and does not express a guide RNA (or expresses some guide RNAs, but does not express all guide RNAs necessary for expression of nuclease activity). A guide RNA-dependent DNA nuclease is expressed from the vector. The deficient guide RNA (the guide RNA missing for the expression of the activity of the nuclease) is separately supplied to cells after the expression of the nuclease from the minus-strand RNA virus vector. That is, for example, they are separately introduced into cells or transcribed by a vector that can express more rapidly than, for example, a minus-strand RNA viral vector. More specifically, examples of the gene modification method of the present invention include the following methods.

In the present invention, the genetic modification includes desired gene editing, and includes, for example, gene conversion, gene repair, gene replacement, gene reversion, and gene disruption.

A genetic modification method using a guide RNA-dependent DNA nuclease,
(A) carrying a gene for a guide RNA-dependent DNA nuclease, introducing a minus-strand RNA viral vector not encoding at least one of the guide RNAs required for the expression of the activity of the nuclease into cells, and expressing the vector; Accumulating the nuclease in a cell in the absence of the at least one guide RNA;
(B) a step of, after step (a), supplying a deficient guide RNA to the cells.

After the step (b),
(C) recovering a cell in which the gene has been modified.

Negative-strand RNA virus vectors are highly infectious to a wide range of cells and have the ability to express on-board genes at extremely high levels, but it takes a certain amount of time from infection to high expression. Therefore, it is necessary to culture the vector for a certain period after infection, and during that time, the expression product of the loaded gene gradually accumulates in the cell. , Will continue to work in the cell. In the present invention, by intentionally expressing only a nuclease (or only a nuclease and some guide RNA) from a minus-strand RNA virus vector, and preventing the expression of all guide RNAs necessary for the expression of nuclease activity, It is characterized in that it is designed so that active nuclease cannot act on the cell while the nuclease gene carried by introducing the vector into the cell is expressed and accumulated in the cell.

Some guide RNA-dependent DNA nucleases require only one guide RNA, while others require multiple guide RNAs. For example, in the natural CRISPR-Cas9 system, as described above, two RNAs, crRNA and tracrRNA, form a complex with a nuclease, thereby exhibiting nuclease activity. Therefore, the nuclease cannot function without either of them. In contrast, Cpf1 does not require tracrRNA because the crRNA functions as a guide RNA to the target site. The minus-strand RNA virus vector of the present invention does not encode at least one (or all) of the guide RNAs required for the activity of the encoded guide RNA-dependent DNA nuclease. Cannot act on cells. For example, in the case of a nuclease that requires crRNA and tracrRNA for expression of the activity, the minus-strand RNA viral vector of the present invention does not encode either crRNA or tracrRNA, or both. In the case of nucleases that require only one guide RNA for the expression of the activity, the minus-strand RNA viral vector of the present invention does not encode the guide RNA. In the present invention, "encoding" a gene such as a guide RNA means that the gene is expressed so that it can be expressed, and that the gene is mounted so that it can be expressed.

マイナス The minus strand RNA virus vector used in the present invention is not particularly limited. For example, a paramyxovirus vector can be suitably used. Paramyxovirus refers to a virus belonging to Paramyxoviridae (Paramyxoviridae) or a derivative thereof. The Paramyxoviridae family includes Paramyxovirinae (including the genus Respirovirus (also referred to as Paramyxovirus), the genus Rubravirus, and the genus Mobilivirus) and the subfamily Pneumovirinae (Pneumovirinae) Genus and metapneumovirus genus). As the viruses included in the Paramyxoviridae virus, specifically, Sendai virus (Sendai virus), Newcastle disease virus (Newcastle disease virus), mumps virus (Mumps virus), measles virus (Measles virus), and RS virus (Respiratory syncytial virus) virus, rinderpest virus, distemper virus, simian parainfluenza virus (SV5),

human parainfluenza virus

1, 2, 3 and the like. More specifically, for example, Sendai virus (SeV), human parainfluenza virus-1 (HPIV-1), human parainfluenza virus-3 (HPIV-3), phocine distemper virus (PDV), canine distemper virus (CDV), dolphin molbillivirus (DMV), peste-des-petits-ruminants virus (PDPR), measures virus (MeV), rinderpest virus (RPV), Hendra virus (Hendra), Nipah virus (Nipah), human parainfluenza virus-2 (HPIV-2) ), Simian parainfluenza virus 5 (SV5), human parainfluenza virus 4a (HPIV-4a), human parainfluenza virus 4b (HPIV-4b), mumps virus (Mumps), and Newcastle disease virus (NDV). Rhabdoviruses include vesicular stomatitis virus (Resbbviridae), rabies virus (Rabies virus), and the like.

The genomic RNA of a minus-strand RNA virus is a minus strand (negative strand). When encoding a protein or RNA, it is encoded as an antisense sequence on the genomic RNA. In the present invention, such a case is also referred to as “encoding” a protein or RNA. Further, when a protein or RNA is encoded as an antisense sequence in a minus-strand RNA genome, it is also referred to as a gene of the protein or RNA being carried on the genome. The plus-strand (positive-strand) RNA genome (also called antigenome) is replicated using the minus-strand RNA genome as a template, and transcription occurs using the minus-strand RNA genome as a template to generate sense-strand RNA. In the present invention, the minus-strand RNA genome and the plus-strand RNA genome are collectively referred to as “genome”.

The viral vector of the present invention is preferably a virus belonging to the subfamily Paramyxoviridae (including the genera Respirovirus, Rubravirus, and Morbillivirus) or a derivative thereof, and more preferably the gene of Respirovirus (genus). Respirovirus (also referred to as Paramyxovirus) or a derivative thereof. Examples of respiroviruses to which the present invention can be applied include human parainfluenza virus type 1 (HPIV-1), human parainfluenza virus type 3 (HPIV-3), and bovine parainfluenza virus type 3 (BPIV-3). , Sendai virus (also called mouse parainfluenza virus type 1), measles virus, simian parainfluenza virus (SV5), and simian parainfluenza virus type 10 (SPIV-10). In the present invention, the paramyxovirus is most preferably a Sendai virus.

Paramyxovirus generally contains a complex composed of RNA and protein (ribonucleoprotein; RNP) inside the envelope. The RNA contained in the RNP is a single-stranded (-) strand (negative strand), which is the genome of the negative-strand RNA virus, and this single-stranded RNA binds to the NP protein, P protein, and L protein, Forming RNP. The RNA contained in this RNP serves as a template for transcription and replication of the viral genome (Lamb, RA, and D. Kolakofsky, 1996, myParamyxoviridae: The viruses and their replication. Pp.1177-1204. In Fields Virology, 3rd edn. Fields, B. N., D. M. Knipe, and P. M. Howley et al. (ed.), Raven Press, New York, N. Y.).

For example, the accession number of the database of the nucleotide sequence of each gene of Sendai virus is NPM29343, 30M30202, M30203, 30M30204, M51331, M55565, M69046, X17218 for the NP gene, M30202, M30203, M30204, M55565, M69046 for the P gene. , X00583, X17007, X17008, M gene D11446, K02742, M30202, M30203, M30204, M69046, U31956, X00584, X53056, and F gene D00152, D11446, D17334, D17335, M30202,30204, M30202,30204 , X02131, HN gene, D26475, M12397, M30202, M30203, M30204, M69046, X00586, X02808, X56131, and L gene D00053, M30202, M30203, M30204, M69040, X00587, X58886. As another example of the viral genes encoded by other viruses, for the NP gene (also called N gene), CDV, AF014953; DMV, X75961; HPIV-1, D01070; HPIV-2, M55320; HPIV-3, D10025 ; Mapuera, X85128; sMumps, D86172; MV, K01711; NDV, AF064091; PDPR, X74443; PDV, X75717; RPV, X68311; SeV, X00087; SV5, M81442; and Tupaia, ; DMV, Z47758; HPIV-l, M74081; HPIV-3, X04721; HPIV-4a, M55975; HPIV-4b, M55976; -4Mumps, D86173; MV, M89920; NDV, M20302; PDV, X75960; RPV, X68311 , 30M30202; SV5, AF052755; and Tupaia, 0AF079780, for the C gene CDV, AF014953; DMV, Z47758; HPIV-1. M74081; HPIV-3, D00047; MV, ABO16162; RPV, X68311; SeV, AB 0, AF079780, M gene 遺伝子 CDV, M12669; DMV Z30087; HPIV-1, S38067; HPIV-2, M62734; HPIV-3, D00130; HPIV-4a, D10241; HPIV-4b, D10242; Mumps, D86171; MV, 012AB012948; NDV, AF089819; PDPR, Z47977; PDV, X75717; RPV, M34018; SeV, U31956; and SV5, M32248; F gene CDV, M21849; DMV, NAJ224704; HPIV-2, M60182; HPIV-3. X05303, HPIV-4a, D49821; HPIV-4b, D49822; Mumps, 86D86169; MV, AB003178; NDV, AF048763; PDPR, Z37017; PDV, AJ224706; RPV, V215 , 17D17334; and SV5, AB021962, HN (H or G) gene CDV, AF112189; DMV, JAJ224705; HPIV-1, HP709498; HPIV-2. D000865; HPIV-3, AB012132; HPIV-4A, M34033; HPIV -4B, AB006954; Mumps, X99040; MV, K01711; NDV, AF204872; PDPR, Z81358; PDV, Z36979; RPV, AF132934; SeV, U06433; and SV-5, S76876. However, a plurality of strains are known for each virus, and there are also genes having sequences other than those exemplified above depending on the strain. Sendai virus vectors having a viral gene derived from any of these genes are useful as the vector of the present invention. For example, the Sendai virus vector of the present invention has 90% or more, preferably 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more identity with the coding sequence of any of the above viral genes. Includes base sequences with In addition, the Sendai virus vector of the present invention comprises, for example, an amino acid sequence encoded by the coding sequence of any of the above-mentioned virus genes and 90% or more, preferably 95% or more, 96% or more, 97% or more, 98% or more, Or a nucleotide sequence encoding an amino acid sequence having 99% or more identity. Further, the Sendai virus vector of the present invention, for example, in the amino acid sequence encoded by the coding sequence of any of the above viral genes, within 10, preferably within 9, within 8, within 7, within 6, It includes a nucleotide sequence encoding an amino acid sequence in which no more than 5, no more than 4, no more than 3, no more than 2, or 1 amino acid has been substituted, inserted, deleted, and / or added.

The sequence referred to in the database accession number such as the base sequence and the amino acid sequence described in the present specification refers to, for example, the sequence on the filing date or priority date of the present application, and the filing date and priority date of the present application. Can be specified as a sequence at any point in time, and is preferably specified as a sequence on the filing date of the present application. The sequence at each time point can be specified by referring to the revision history of the database.

As the minus-strand RNA virus vector of the present invention, a virus whose envelope contains a protein different from the original envelope protein of the virus may be used. For example, when producing a virus, a virus containing the same can be produced by expressing a desired exogenous envelope protein in a virus-producing cell. Such proteins are not particularly limited, and proteins such as desired adhesive factors, ligands, and receptors that impart infectivity to mammalian cells can be used. Specific examples include the G protein (VSV-G) of vesicular stomatitis virus (VSV). The VSV-G protein may be derived from any VSV strain. For example, VSV-G protein derived from Indiana serotype strain (J. Virology 39: 519-528 (1981)) can be used. It is not limited to this. For example, a Sendai virus vector can contain any combination of envelope proteins from other viruses.

The minus-strand RNA virus vector used in the present invention may be a derivative, and the derivative may be a virus whose virus gene has been modified, a virus which has been chemically modified, or the like so as not to impair the gene transfer ability of the virus. included.

(4) The negative-strand RNA virus may be derived from a natural strain, a wild strain, a mutant strain, a laboratory passage strain, an artificially constructed strain, or the like. For example, the Sendai virus includes Z strain, but is not limited thereto (Medical \ Journal \ of \ Osaka \ University \ Vol.6, \ No.1, \ March \ 1955 \ p1-15). For example, any of the genes of the wild-type virus may be mutated or defective. For example, a transmissibility-defective virus having a mutation such as a stop codon mutation that is deficient or suppresses the expression of at least one gene encoding the envelope protein or coat protein of the virus can be suitably used. Viruses that do not express such envelope proteins are, for example, viruses that can replicate the genome in infected cells but cannot form infectious virions. Such a transmissibility-defective virus is particularly suitable as a highly safe vector. For example, a gene that does not encode the F or HN envelope protein (spike protein) gene or the F and HN genes in the genome can be used (WO00 / 70055 and WO00 / 70070; Li, H.-O). . Et al., J. Virol. 74 (14) 6564-6569 (2000)). The virus can amplify the genome in infected cells if it encodes at least proteins necessary for genome replication (eg, ΔN, P, and L proteins) in genomic RNA. To produce an infectious virus particle that is deficient in an envelope protein, for example, a defective gene product or a protein that can complement it is supplied exogenously in a virus-producing cell (WO00 / 70055} and {WO00 / 70070; Li, H.-O. et al., J. Virol. 74 (14) 6564-6569 (2000)). On the other hand, non-infectious virus particles can be recovered by not complementing the defective viral protein at all (WO00 / 70070).

It is also preferable to use a virus vector carrying a mutant virus protein gene. For example, a number of mutations are known in envelope proteins and coat proteins, including attenuating mutations and temperature-sensitive mutations. Viruses having these mutant protein genes can be suitably used in the present invention. In the present invention, a vector having reduced cytotoxicity may be used. Cytotoxicity can be measured, for example, by quantifying the release of lactate dehydrogenase (LDH) from the cells. For example, a vector whose cytotoxicity is significantly reduced as compared with the wild type can be used. The degree of attenuated cytotoxicity can be determined, for example, by culturing human HeLa cells (ATCC CCL-2) or monkey CV-1 cells (ATCC CCL 70) at an MOI of 3 and incubating for 3 days. A vector in which the amount of released LDH in the liquid is significantly reduced as compared with the wild type, for example, a vector in which the amount of released LDH is reduced by 20% or more, 25% or more, 30% or more, 35% or more, 40% or more, or 50% or more can be used. . Mutations that reduce cytotoxicity also include temperature-sensitive mutations.

The minus-strand RNA viral vector used in the present invention is not particularly limited, but preferably has at least one, more preferably at least 2, 3, 4, 5, or more viral genes having a deletion or mutation. May be. Deletions and mutations may be introduced in any combination for each gene. Here, the mutation may be a function-lowering mutation or a temperature-sensitive mutation, and is preferably at least at 37 ° C. compared to a wild-type or a virus not having the mutation at a particle-forming ability (non-propagating type) of the virus. For viruses, non-transmissible virus-like particle formation (NTVLP) forming ability (Inoue et al., J. Virol. 77: 3238-3246, 2003), growth rate and / or loading Is preferably a mutation that reduces the expression level of the gene to 1/2 or less, more preferably 1/3 or less, more preferably 1/5 or less, more preferably 1/10 or less, more preferably 1/20 or less. . For example, a minus-strand RNA viral vector suitably used in the present invention has at least two viral genes deleted or mutated. Such viruses include those in which at least two viral genes have been deleted, those in which at least two viral genes have been mutated, and those in which at least one viral gene has been mutated and at least one viral gene has been deleted. Includes what you are doing. The at least two mutated or deleted viral genes are preferably genes encoding an envelope constituent protein. For example, a vector in which the F gene is deleted and the M and / or HN gene is further deleted, or the M and / or HN gene further has a mutation (eg, an NTVLP formation-suppressing mutation and / or a temperature-sensitive mutation) is It is suitably used in the invention. Further, a vector in which, for example, the F gene is deleted, the M or HN gene is further deleted, and the remaining M and / or HN gene further has a mutation (for example, an NTVLP formation-suppressing mutation and / or a temperature-sensitive mutation) is also disclosed in It is suitably used in the invention. More preferably, the vector used in the present invention has at least three viral genes (preferably, at least three genes encoding an envelope-constituting protein; F, {HN,}, and M) deleted or mutated. Such viral vectors have at least three gene deletions, at least three gene mutations, at least one gene mutation and at least two gene deletions And at least two genes are mutated and at least one gene is deleted. In a more preferred embodiment, for example, a vector in which the F gene is deleted, the M and HN genes are further deleted, or the M and HN genes further have a mutation (eg, an NTVLP formation-suppressing mutation and / or a temperature-sensitive mutation) Is suitably used in the present invention. Further, for example, a vector in which the F gene is deleted, the M or HN gene is further deleted, and the remaining M or HN gene further has a mutation (eg, an NTVLP formation inhibitory mutation and / or a temperature-sensitive mutation) is preferable in the present invention. Used for Such a mutant virus can be produced according to a known method.

For example, a large number of mutations, including attenuating mutations and temperature-sensitive mutations, in viral structural proteins (NP, ΔM) and RNA synthases (P, ΔL) are known. Paramyxovirus vectors having these mutant protein genes can be suitably used in the present invention according to the purpose.

Specifically, for example, preferred mutations in the Sendai virus M gene include amino acids at sites arbitrarily selected from the group consisting of positions 69 (G69), 116 (T116), and 183 (A183) in the M protein. Substitution (Inoue, M. et al., J. Virol. 2003, 77: 3238-3246). The M protein of Sendai virus has a genome encoding a mutant M protein in which any of the above three sites, preferably a combination of any two sites, and more preferably all three sites are substituted with other amino acids Viruses are suitably used in the present invention.

Amino acid mutation is preferably substitution to another amino acid having a different side chain chemical property, for example, BLOSUM62 matrix (Henikoff, S. and Henikoff, J. G. (1992) Proc. Natl. Acad. Sci. USA 89: 10915-10919) is substituted with an amino acid having a value of 3 or less, preferably 2 or less, more preferably 1 or less, and more preferably 0. Specifically, G69, T116, and A183 of the Sendai virus M protein can be replaced with Glu (E), Ala (A), and Ser (S), respectively. It is also possible to use a mutation homologous to the M protein mutation of the measles virus temperature-sensitive strain 253P253-505 (Morikawa, Y. et al., Kitasato Arch. Exp. Med. 1991: 64; 15-30). is there. The mutation may be introduced, for example, using an oligonucleotide or the like according to a known mutation introduction method.

Preferred mutations in the HN gene include, for example, amino acid substitution at a site arbitrarily selected from the group consisting of positions 262 (A262), 264 (G264), and 461 (K461) of the Sendai virus HN protein. (Inoue, M. et al., J.Virol. 2003, 77: 3238-3246). A virus having a genome coding for a mutant HN protein in which any one of the three sites, preferably a combination of any two sites, and more preferably all three amino acids are replaced with other amino acids, It is preferably used. As described above, substitution of an amino acid is preferably substitution with another amino acid having a different side chain chemical property. In a preferred example, Sendai virus {A262, G264, and K461 of the HN protein are replaced with Thr (T), Arg (R), and Gly (G)}, respectively. Further, for example, with reference to the mumps virus temperature-sensitive vaccine strain Urabe AM9, mutation can be introduced into the 464th and 468th amino acids of the HN protein (Wright, K. E. et al., Virus Res. 2000: 67 ; 49-57).

セン The Sendai virus may have a mutation in the P gene and / or L gene. Specific examples of such mutations include a mutation at Glu (E86) at position 86 of the SeV P protein and a substitution of another amino acid at Leu (L511) at position 511 of the SeV P protein. As described above, substitution of an amino acid is preferably substitution with another amino acid having a different side chain chemical property. Specific examples include substitution of the 86th amino acid with Lys, substitution of the 511th amino acid with Phe, and the like. In the L protein, substitution of Asn at position 1197 (N1197) and / or Lys at position 1795 (K1795) of the SeV L protein with other amino acids is mentioned. Is preferably substituted with another amino acid having a different chemical property. Specific examples include substitution of the amino acid at position 1197 with Ser, substitution of the amino acid at position 1795 with Glu, and the like. Mutations in the P and L genes can significantly enhance the effects of persistent infectivity, suppression of secondary particle release, or suppression of cytotoxicity. Furthermore, these effects can be dramatically increased by combining mutation and / or deletion of the envelope protein gene. Further, the L gene includes substitution of Tyr (Y1214) at position 1214 and / or Met (M1602) at position 1602 of the SeV L protein with other amino acids. Substitution with another amino acid having a different chemical property is preferred. Specific examples include substitution of the amino acid at position 1214 with Phe, substitution of the amino acid at position 1602 with Leu, and the like. The mutations exemplified above can be arbitrarily combined.

For example, at least G at position 69, T at position 116, and A at position 183 of the SeVΔM protein, A at least position 262, G at position 264, and K at position 461 of the SeVΔHN protein, and at least 511 of the SeVΔP protein. At position L, at least N at position 1197 and K at position 1795 of the SeV L protein are each substituted with another amino acid, and the Sendai virus vector lacking or deleting the F gene, and F gene-deficient or deleted Sendai virus vectors having the same or lower and / or the same or higher NTVLP formation inhibition at 37 ° C. are suitable in the present invention.

More specifically, the F gene is deleted, the M protein has G69E, T116A, and A183S mutations, the HN protein has A262T, G264R, and K461G mutations, the P protein has L511F mutation, and the L protein has N1197S and A Sendai virus vector containing a K1795E mutation in its genome can be suitably used in the present invention. In the present invention, a combination of the deletion of the F gene and these mutations is referred to as “TSΔF”.

The introduction of a minus-strand RNA virus vector carrying a guide RNA-dependent DNA nuclease gene into cells may be carried out according to a well-known method as appropriate. In the embodiment, the MOI (multiplicity of infection) is performed at around 3, but the MOI is not particularly limited and may be adjusted as appropriate. The MOI may be, for example, on the order of 0.1 to 50, preferably 0.5 to 30, 1 to 20, 2 to 10, or 3 to 5, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, , Or 10.

標的 There is no particular limitation on the target cells into which the vector is introduced, and any desired cells that can be infected with the minus-strand RNA virus can be used. The organism from which the cell is derived is not particularly limited, and may be, for example, a desired eukaryotic cell. More specifically, the target cell is, for example, an animal cell or a plant cell, preferably an animal cell, more preferably a mammalian cell, such as a primate cell, specifically, a mouse, rat, monkey, and human Cells. The type of cells is not particularly limited, and cells of a desired tissue can be used. The genome is modified by introducing a donor polynucleotide into differentiated cells, undifferentiated cells, precursor cells, progenitor cells, and the like. be able to. Further, it can also be introduced into embryonic stem cells, pluripotent stem cells (for example, induced pluripotent stem cells (iPS cells)) and the like.

後 After introducing the vector in step (a), the nuclease expressed from the vector is cultured until it reaches at least the amount required to cause recombination. Although the period in the embodiment is 48 hours, the period may be appropriately adjusted. For example, 12 hours or more, 24 hours or more, 36 hours or more, or 48 hours or more. In addition, for example, expression can be carried out for 1 day or more, 2 days or more, 3 days or more, or 4 days or more. The upper limit of the culture period in step (a) is not particularly limited, but may proceed to the next step as long as nuclease is sufficiently accumulated. The period of step (a) is, for example, within 10 days, within 9 days, within 8 days, within 7 days, within 6 days, within 5 days, within 4 days, or within 3 days.

(4) After step (a), guide RNA that is insufficient for nuclease to exert its activity is supplied to the cells (step (b)). The guide RNA may be introduced into a cell, or a vector that expresses the guide RNA may be introduced into the cell and expressed from the vector.

When the guide RNA is expressed from a vector, a vector that can start expression more rapidly than the minus-strand RNA virus vector used in step (a) is used as the vector. Such vectors include, but are not limited to, non-viral vectors such as, for example, plasmid vectors. The promoter for transcribing RNA from the vector is not particularly limited, and a Pol I promoter, a Pol II promoter, a Pol III promoter, or a desired bacteriophage promoter can be used. For example, RNA polymerase and promoter of T4 phage and T7 phage can be exemplified. Examples of the polymerase II (PolII) promoter include, for example, a CMV promoter and a β-globin promoter. In order to express a relatively short RNA of several hundred bases or less, it is preferable to use a polymerase III (Pol III) promoter, which can provide a higher expression level than Pol II. Examples of the Pol III promoter include U6 promoter, H1 promoter, tRNA promoter, 7SK promoter, 7SL promoter, Y3 promoter, 5S rRNA promoter, Ad2 VAI and VAII promoter, and the like (Das, G. et al., 1988). , EMBO J. 7: 503-512; Hernandez, N., 1992, pp. 281-313, In S. L. McKnight and K. R. Yamamoto (ed.), Transcriptional regulation, vol. 1.Cold Spring Harbor Laboratory, Cold Spring Harbor, NY; Kunkel, G. R., 1991, Biochim. Biophys. Acta 1088: 1-9; Lobo, S. M., and N. Hernandez, 1989, Cell 58: 55-67; Mattaj Et.al., 1988, Cell 55: 435-442; Geiduschek, EP and GA Kassavetis, 1992, pp. 247-280, In Transcriptional regulation.Monograph 22 (ed.SL McKnight and KR Yamamoto), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.) In particular, the class III promoters include the promoters of the U6, 7SK, hY1 and hY3, H1, and MRP / Th RNA genes (Hernandez, N., 1992, pp. 281-313, In Transcriptional regulation.Monograph 22 (ed. . S. McKnight and KR Yamamoto), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York).

If it is difficult to accurately transcribe only the guide RNA when expressing the guide RNA from a vector, express it as a fusion RNA with a self-excised ribozyme so that the guide RNA is accurately excised after transcription be able to.

Preferably, the guide RNA itself is introduced into the cell instead of expressing the guide RNA via an expression vector. For that purpose, RNA may be introduced into cells by transfection or the like.

方法 There are many known methods for introducing nucleic acids such as RNA into cells. For example, the calcium phosphate method (Graham FL et al., 1973, Virology 52 (2): 456-467; Chen Cet et al., 1987, Mol. Cell Biol. 7 (8): 2745-2752), lipofection method (Felgner) PL et al., 1987, Proc Natl Acad Sci USA 84 (21): 7413-7417), DEAE dextran method (Vaheri A et al., 9651965, Virology 27 (3): 434-436; McCutchan JH et al., 1968, J. Natl. Cancer Inst. 41 (2): 351-357), electroporation method, microinjection method, particle gun method, and the like, but are not limited thereto. The introduction by a reagent using a polymer such as a cationic lipid, a dendrimer, or Polyethylenimine {(PEI)} is preferred because it is simple.

The guide RNA may be prepared by a desired method, and may be a synthetic RNA or an RNA expressed from a vector or the like. Further, it may be composed of a natural base or may contain a modified base. The guide RNA may be appropriately modified as long as the activity is maintained. For example, one or a plurality of guide RNAs may be introduced in step (b). In the natural CRISPR-Cas9 system, two RNAs, CRISPR RNA (crRNA) and trans-activated CRISPR RNA (tracrRNA), form a complex to orient Cas9 nuclease at the target DNA site, but crRNA and tracrRNA It is well known that the ends can be joined into one guide RNA (single guide RNA; sgRNA) (Mali, P. et a l., 2013, Science） 339 (6121): 823-826). Such sgRNA can be suitably used. In addition, a mutation can be appropriately introduced into the sequence of the guide RNA as long as the activity is maintained (Sander, JD et al., 2014, Nature Biotechnology, 32: 347-355).

In the CRISPR-Cas9 system, for example, the elements required for target cleavage are Cas9 protein, tracrRNA, and crRNA, but the common elements used wherever the target site is are Cas9 protein and tracrRNA. The cr9 alone can also be transfected by simultaneously loading the Cas9 gene and the tracrRNA gene in a strand RNA virus vector.

When introducing guide RNA into cells by transfection or the like, the amount of RNA to be introduced can be appropriately adjusted. Specifically, for example, the concentration of each guide RNA is 0.1 ng / ml to 2 mg / ml, more specifically, 0.2 ng / ml to 1 mg / ml, 0.4 ng / ml to 500 μg / ml, 1 ng / ml to 250 μg Cells are suspended in a solution containing 2 ng / ml, 2 ng / ml to 100 μg / ml, 5 ng / ml to 50 μg / ml, 10 ng / ml to 20 μg / ml, 20 ng / ml to 10 μg / ml, or 10 ng / ml to 5 μg / ml. The RNA can be introduced in a turbid manner, but is not limited thereto. The number of cells may be appropriately adjusted, for example, 1 × 10 ³ to 1 × 10 ⁷ / ml, specifically, 2 × 10 ³ to 8 × 10 ⁶ / ml, 5 × 10 ³ to 4 × 10 ⁶ / ml RNA can be introduced at a cell count of 1 × 10 ⁴ to 2 × 10 ⁶ / ml, but is not limited thereto. For example, RNA is introduced under conditions that only cells are present by limiting dilution of cells. May be. In the experiments 1-1 to 4-3 and the like in Examples, tracrRNA was used in an amount of 0.27 to 2.16 μg / well (6-well plate; 500 μl / well) (that is, 0.54 to 4.32 μg / ml), and crRNA 0.15 to 1.2 μg / well ( 6-well plate; 500 μl / well) (that is, 0.30 to 2.4 μg / ml), and the cell volume at that time was approximately 1 to 3 × 10 ⁶ cells per well, but no significant change in efficiency was observed. It can be performed with a wide range of RNA amounts. In Experiments 3-1 and 3-2, the efficiency was higher when a high dose of RNA (total of crRNA and tracrRNA was 6.72 μg / ml) was used than when half of the RNA was used. In the case of -3, the efficiency was higher when a 4-fold amount of RNA was used than when a relatively low dose of RNA (the total of crRNA and tracrRNA was 0.84 μg / ml) was used. Therefore, it is considered that the reaction efficiency can be controlled by adjusting the dose depending on the guide RNA used.

温度 In the present invention, a temperature-sensitive minus-strand RNA virus vector can be suitably used as the minus-strand RNA virus vector used in step (a). By using a temperature-sensitive negative-strand RNA virus vector, after step (a) is completed, the vector can be rapidly inactivated by raising the culture temperature, so that the expression period of the active nuclease is more strictly controlled. It is possible to do. A temperature-sensitive minus-strand RNA virus vector is a minus-strand RNA virus vector whose expression at 37 ° C is significantly reduced as compared to expression from a vector at a low temperature (eg, 32 ° C to 35 ° C, more specifically, 35 ° C, for example). Say For example, the temperature-sensitive negative-strand RNA virus vector used in the present invention has an expression at 37 ° C. of 以下 or less, preferably 1/3 or less, more preferably 1/3 or less, as compared to expression from a vector at a low temperature (eg, 35 ° C.). 1/4 or less, 1/5 or less, 1/6 or less, 1/7 or less, 1/8 or less, 1/9 or less, 1/10 or less, 1/20 or less, 1/30 or less, 1/40 or less, Decrease to 1/50 or less, or 1/100 or less. The expression level can be determined, for example, by measuring the fluorescence intensity using a fluorescent-labeled antibody against the expressed protein, or by expressing the GFP protein or the like and measuring the fluorescence intensity.

In the present invention, a permissive temperature refers to a temperature at which expression of a temperature-sensitive vector is not significantly suppressed, and a non-permissive temperature refers to a temperature at which expression of a temperature-sensitive vector is suppressed. . More specifically, the permissible temperature is determined, for example, by the expression level of the temperature-sensitive vector at the optimal temperature (the maximum temperature at which the expression level per 24 hours is maximum) and the non-optimum temperature of the temperature-sensitive vector (the expression level per 24 hours). At the minimum temperature) (eg, the lowest temperature at 37-39 ° C), with the boundary between the expression level and the lower temperature as the allowable temperature, and the higher temperature as the non-permissible temperature. can do. The permissible temperature is, for example, a temperature of less than 36.5 ° C, for example, 36 ° C or less, or 35.5 ° C or less, or a temperature of 35 ° C or less, and the non-permissible temperature is, for example, a temperature of 36.6 ° C or more, for example, 36.8 ° C or more, or 37 ° C. The above temperature may be used.

方法 The method of the present invention using a temperature-sensitive negative-strand RNA virus vector includes, for example, the following method.

A genetic modification method using a guide RNA-dependent DNA nuclease,
(A) a temperature-sensitive minus-strand RNA viral vector carrying the nuclease gene and not encoding at least one of the guide RNAs required for the expression of the nuclease activity is introduced into cells, and the vector is expressed at a permissive temperature. Allowing the nuclease to accumulate in a cell in the absence of the at least one guide RNA,
(B) supplying the missing guide RNA to the cells after step (a);
(C) raising the culture temperature to a non-permissible temperature before or after or simultaneously with step (b), and culturing in a state where the guide RNA is present in the cells.

After the step (c),
(D) recovering a cell in which the gene has been modified.

The difference from the case where a temperature-sensitive vector is not used is that cells are cultured at a permissive temperature in step (a), and the culture temperature is increased to a non-permissive temperature before or after step (b) or simultaneously with step (b). (Step (c)) of culturing in a state where the guide RNA supplied in step (1) is present in the cells. This inactivates the minus-strand RNA virus vector in a state where the functional guide RNA is present in the cell. The culturing temperature in step (a) may be appropriately selected depending on the vector to be used, so long as expression from the vector is not inhibited, for example, in the range of 30 ° C to 36 ° C, for example, 32 ° C to 35 ° C, for example, about 32 ° C. ° C, about 33 ° C, about 34 ° C, about 35 ° C or about 36 ° C.

The timing of raising the culture temperature to the non-permissible temperature (step (c)) may be simultaneous with the execution of step (b) or before or after step (b). In order to form a sufficient amount of the active nuclease and then quickly eliminate the active nuclease, it is desirable that the step (b) is not too far in time. For example, it is preferable that the culture temperature has risen to a non-permissible temperature at the time of carrying out the step (b) or at the latest after 24 hours. For example, the culturing temperature can be increased immediately before, immediately after, or immediately after the step (b) is performed. In the examples, the temperature was raised to the non-permissible temperature simultaneously with the start of lipofection. For example, within 24 hours before and after the step (b) was performed, preferably within 23 hours, within 22 hours, within 20 hours, within 18 hours, and within 16 hours Even within 15 hours, within 12 hours, within 10 hours, within 8 hours, within 6 hours, within 4 hours or within 3 hours, the culture temperature is set to a non-permissible temperature (eg, 37 to 38 ° C, 37 to 37.5 ° C, Or about 37 ° C).

The temperature-sensitive negative-strand RNA virus vector to be used is not particularly limited, and a vector into which a desired temperature-sensitive mutation or another mutation is introduced can be used.

For example, in the case of Sendai virus (SeV), mutations in the L protein include amino acids at sites arbitrarily selected from positions 942 (Y942), 1361 (L1361), and 1558 (L1558) of the SeV L protein. To amino acids. As described above, substitution of an amino acid is preferably substitution with another amino acid having a different side chain chemical property. Specific examples include substitution of the 942th amino acid with His, substitution of the 1361th amino acid with Cys, substitution of the 1558th amino acid with Ile, and the like. Particularly, an L protein in which at least the position 942 or 1558 is substituted can be suitably used. For example, in addition to position 1558, a mutant L protein in which position 1361 is substituted with another amino acid is also suitable. Further, a mutant L protein in which positions 1558 and / or 1361 in addition to position 942 are substituted with other amino acids is also suitable. These mutations can increase the temperature sensitivity of the L protein.

Also, examples of mutations in the P protein include substitution of an amino acid at a site arbitrarily selected from positions 433 (D433), 434 (R434), and 437 (K437) of the SeVΔP protein with another amino acid. As described above, substitution of an amino acid is preferably substitution with another amino acid having a different side chain chemical property. Specific examples include substitution of the 433rd amino acid with Ala {(A)}, substitution of the 434th amino acid with Ala {(A)}, substitution of the 437th amino acid with Ala {(A)}, and the like. In particular, a P protein in which all three sites are substituted can be suitably used. These mutations can increase the P protein's temperature sensitivity.

A mutant P protein in which at least three positions of D at position 433, R at position 434, and K at position 437 of the SeV P protein have been substituted with another amino acid, and at least L at position 1558 of the SeV L protein has been substituted. A Sendai virus vector deficient or deficient in the F gene, which encodes a mutated L protein (preferably a mutated L protein in which L at least at position 1361 is also substituted with another amino acid), and which has cytotoxicity similar to or less than this. A Sendai virus vector deficient or deficient in the following and / or F gene having the same or higher temperature sensitivity is also suitably used in the present invention. Each viral protein may have mutations in other amino acids (eg, within 10, 5, 5, 4, 3, 2, or 1 amino acid) in addition to the mutations exemplified herein. Since the vector having the mutation shown above has a high temperature sensitivity, the cells are kept at normal temperature (for example, about 37 ° C., specifically 36.5 to 37.5 ° C., preferably 36.6 to 37.4 ° C., more preferably 36.7 to 37.3 ° C.). ), The vector can be easily removed. In removing the vector, the cells may be cultured at a slightly elevated temperature (eg, 37.5 to 39 ° C., preferably 38 to 39 ° C., or 38.5 to 39 ° C.).

If a specific vector is exemplified, for example, the F gene is deleted, the M protein has G69E, T116A, and A183S mutations, the HN protein has A262T, G264R, and K461G mutations, the P protein has L511F mutation, and L A Sendai virus vector containing N1197S and K1795E mutations in the genome of the protein can be used.

Also preferably, for example, F gene deletion, G69E, T116A, and A183S mutations in the M protein, A262T, G264R, and K461G mutations in the HN protein, L511F mutation in the P protein, and N1197S and A Sendai virus vector containing a K1795E mutation in the genome, further including the following mutations (i) and / or (ii) in the genome:
(I) Mutation of D433A, R434A, and K437A of P protein (ii) Mutation of Y942H, L1361C and / or L1558I of L protein

More specifically, the F gene is deleted, the G protein has a mutation of G69E, T116A, and A183S, the HN protein has a mutation of A262T, G264R, and K461G, the P protein has a mutation of L511F, and the L protein has a mutation. A Sendai virus vector which contains mutations of N1197S and K1795E in its genome and further contains any of the following mutations (i) to (iv) in its genome:
(I) Mutations of D433A, R434A, and K437A of P protein, and mutations of L1361C and L1558I of L protein (TS15)
(Ii) Mutations in D433A, R434A, and K437A of the P protein (TS12)
(Iii) Mutations of L942Y, L1361C, and L1558I of L protein (TS7)
(Iv) P protein mutations D433A, R434A, and K437A, and L protein L1558I mutation (TS13)
(V) Mutations in D433A, R434A, and K437A of the P protein, and mutations in L1361C of the L protein (TS14)

If the nuclease gene is to be carried on a vector, the nuclease gene must be immediately before (3 'side of the genome) or immediately after (5' side of the genome) any of the viral genes (NP, P, M, F, HN, or L) Can be inserted. For example, it can be integrated immediately after the Sendai virus P gene, that is, immediately downstream of the P gene (immediately 5 ′ to the minus-strand RNA genome), but is not limited thereto.

These vectors suppress the formation of nontransmissible virus-like particles (NTVLP) at 37 ° C and are excellent vectors with low cytotoxicity. NTVLP formation can be measured according to the literature Inoue et al., J. Virol. 77: 3238-3246, 2003. The cytotoxicity of the vector can be measured, for example, by quantifying the release of lactate dehydrogenase (LDH) from the cells. Specifically, for example, the amount of LDH release in a culture solution obtained by infecting HeLa (ATCC CCL-2) or monkey CV-1 (ATCC CCL 70) with MOI 3 and culturing for 3 days is measured. The lower the LDH release, the lower the cytotoxicity. The temperature sensitivity can be determined by measuring the growth rate of the virus or the expression level of the carried gene at the normal temperature of the virus host (for example, 37 ° C. to 38 ° C.). If the growth rate of the virus and / or the expression level of the carried gene are lower than those without the mutation, the mutation is determined to be a temperature-sensitive mutation, and the lower the growth rate and / or the expression level, Temperature sensitivity is determined to be high.

For example, production of a minus-strand RNA virus can be carried out using the following known method (WO97 / 16539; WO97 / 16538; WO00 / 70055; WO00 / 70070; WO01 / 18223; WO03 / 025570; WO2005) / 071092; WO2006 / 137517; WO2007 / 083644; WO2008 / 007581; Hasan, M. K. et al., J. Gen. Virol. 78: 2813-2820, 1997, Kato, A. et al., 1997, EMBO J. 16: 578-587 and Yu, D. et al., 1997, Genes Cells 2: 457-466; Durbin, A. P. et al., 1997, Virology 235: 323-332; Whelan, S. P Et al., 1995, Proc. Natl. Acad. Sci. USA 92: 8388-8392; Schnell. M. J. et al., 1994, EMBO. 13: 4195-4203; Radecke, F. et al. , 1995, EMBO J. 14: 5773-5784; sonLawson, N. D. et al., Proc. Natl..Acad. Sci. USA 92: 4477-4481; Garcin, D. et al., 1995, EMBO J. 14: 6087-6094; Kato, A. et al., 1996, Genes Cells 1: 569-579; Baron, M. D. and Barrett, T., 1997, J. Virol. 71: 1265-1271; Bridgen, A. and Elliott, R. M., 1996, Proc. Natl. Acad. Sci. USA 93: 15400-15404; Tokusumi, T. et al. Virus Res. 2002: 86; 33-38, Li, H.-O. et. al., J. Virol. 2000: 74; 6564-6569). In addition, regarding the method of virus propagation and the method of production of the recombinant virus, see also Virology Experimental Studies, Vol. 2, Revised Edition (National Institutes of Health, Gakuyukai, Maruzen, 1982).

ガイド There is no particular limitation on the guide RNA-dependent nuclease gene to be mounted on the vector of the present invention, and a desired guide RNA-dependent DNA endonuclease gene that can be used for genome editing can be mounted. Examples include nucleases of the CRISPR-Cas system, especially class 2 nucleases of the CRISPR-Cas system, such as type II, type V and type VI nucleases. Specifically, Cas9 (Jinek M. et al. (2012) Science. 337 (6096): 816-821), Cpf1 (Accession No. NZ_CP010070.1) (Zetsche B et al., Cell (2015) 163 ( 3): 759-71), and C2c1 (Yang H et al., Cell. (2016) 167 (7): 1814-1828), but are not limited thereto. Any of these homologs from other organisms can be carried.

The present invention also relates to a method for producing a genetically modified cell or a cell population containing the genetically modified cell by the genetic modification method using the guide RNA-dependent DNA nuclease of the present invention. The method includes, for example, the following method.

A method for genetic modification using a guide RNA-dependent DNA nuclease, or a method for producing the cell or a cell population containing the cell,
(A) carrying a gene for a guide RNA-dependent DNA nuclease, introducing a minus-strand RNA viral vector not encoding at least one of the guide RNAs required for the expression of the activity of the nuclease into cells, and expressing the vector; Accumulating the nuclease in a cell in the absence of the at least one guide RNA;
(B) a step of, after step (a), supplying a deficient guide RNA to the cells.

After the step (b),
(C) a step of collecting the obtained cell population,
May be further included.
Alternatively, after step (b) or (c),
(C ′) a step of collecting cells in which the gene has been modified,
May be further included.

In the method, it is also preferable to use a temperature-sensitive negative-strand RNA virus vector. That is, the present invention includes, for example, the following method.

A method for genetic modification using a guide RNA-dependent DNA nuclease, or a method for producing the cell or a cell population containing the cell,
(A) a temperature-sensitive minus-strand RNA viral vector carrying the nuclease gene and not encoding at least one of the guide RNAs required for the expression of the nuclease activity is introduced into cells, and the vector is expressed at a permissive temperature. Allowing the nuclease to accumulate in a cell in the absence of the at least one guide RNA,
(B) supplying the missing guide RNA to the cells after step (a);
(C) raising the culture temperature to a non-permissible temperature before or after or simultaneously with step (b), and culturing in a state where the guide RNA is present in the cells.

After the step (c),
(D) recovering the obtained cell population,
May be further included.
Alternatively, after step (c) or (d),
(D ′) recovering a cell in which the gene has been modified,
May be further included.

The present invention also provides a minus-strand RNA virus vector encoding a guide RNA-dependent nuclease as described above and not encoding at least one guide RNA required for the expression of the activity of the nuclease, using the method of the present invention to obtain a genome. Uses for making modifications and for producing genomically modified cells or producing cell populations comprising such cells using the methods of the invention are provided. The present invention also provides a reagent (genome modifying agent) for carrying out genomic modification using the method of the present invention, comprising the minus-strand RNA virus vector. The present invention also provides a composition comprising the minus-strand RNA virus vector for performing genomic modification using the method of the present invention. The negative-strand RNA viral vectors and compositions can be used for medical and non-medical applications, and are useful in medical and non-medical embodiments. For example, the present invention can be used for therapeutic, surgical, and / or diagnostic, or non-therapeutic, non-surgical, and / or non-diagnostic purposes. The methods of the invention are practiced, for example, ex vivo (eg, in vitro or ex vivo). In the present invention, implementation in vitro includes implementation in ex vivo. The invention is also useful for in vivo implementations that do not include ex vivo embodiments.

A composition comprising a minus-strand RNA viral vector that encodes the guide RNA-dependent nuclease of the present invention and does not encode at least one of the guide RNAs required for the expression of the activity of the nuclease may be suitably a pharmaceutically acceptable carrier. Or it may contain a medium. The composition of the present invention is used as a pharmaceutical composition, for example, a pharmaceutical composition for genome repair of a genetic disease. The carrier and the medium are not particularly limited, but include, for example, water (eg, sterile water), physiological saline (eg, phosphate buffered saline), glycol, ethanol, glycerol, lactose, sucrose, calcium phosphate, gelatin, dextran, agar, Examples include oils such as pectin, olive oil, peanut oil, sesame oil and the like, and also include buffers, diluents, preservatives, stabilizers, excipients and the like. The present invention also provides a kit comprising the minus-strand RNA virus vector of the present invention, which carries a guide RNA-dependent nuclease gene and does not encode at least one guide RNA required for expression of the activity of the nuclease. The composition and the kit are useful for genome editing using a guide RNA-dependent nuclease, that is, gene modification including gene disruption, gene conversion, and gene repair.

組成 The composition of the present invention can be appropriately combined with a guide RNA. For example, the kit of the present invention can include a composition containing a minus-strand RNA viral vector and a reagent containing guide RNA. As described above, since the sequence of tracrRNA does not depend on the target site, a kit containing a combination of the minus-strand RNA virus vector of the present invention and tracrRNA corresponding to the nuclease encoded by the vector is useful in the present invention. . In addition, crRNA may be contained in addition to tracrRNA, and crRNA and tracrRNA may be mixed, or may be fused to form a single strand as described above. The compositions and kits of the present invention may further include donor DNA. In addition, an instruction manual can be appropriately attached to the composition and the kit. The compositions and kits of the present invention are useful for genome editing and genetic modification using the method of the present invention.

For example, using the minus-strand RNA virus vector of the present invention, a target genome site can be efficiently destroyed. As shown in Examples 7 and 8, the method of the present invention was able to destroy the target gene more frequently than the conventional method using a plasmid vector carrying the Cas9 gene. Nevertheless, from Examples 5 and 12, it can be expected that the frequency of occurrence of unintended sequence abnormalities and residual target sequence DNA is low. Therefore, the method of the present invention is considered to be useful as a method for destroying only the target site of interest while minimizing the risk of sequence abnormality at sites other than the target site.

In addition, when a nuclease is allowed to act on the target genomic DNA, by coexisting with a donor DNA having a sequence homologous to the genomic DNA, recombination is induced between the target DNA and the donor DNA, and Cells having a genome in which the existing sequence (donor sequence) is integrated can be obtained. The donor DNA includes a DNA having a high homology with the sequence of the genomic DNA of the target cell, and the donor DNA may be double-stranded or any single-stranded DNA.

The donor DNA may further include other sequences as long as it contains DNA having high homology with the genomic sequence of the target cell. The donor DNA may be prepared as a desired vector, for example, a plasmid vector, a phage vector, a cosmid vector, a virus vector, an artificial chromosome vector (for example, including a yeast artificial chromosome vector (YAC) and a bacterial artificial chromosome vector (BAC)). And the like. When the donor DNA has a vector backbone and functions as a vector, the donor DNA (donor DNA) of the present invention is also referred to as a donor vector (donor vector). When the vector is a plasmid vector, the donor DNA of the present invention is also referred to as a donor plasmid (donor plasmid). The donor DNA that functions as a vector can be maintained in a suitable host (cell or E. coli). If the vector has replication ability, the donor DNA can be replicated in the host. The donor DNA of the present invention preferably has autonomous replication ability in a suitable host (for example, E. coli).

There is no particular limitation on the length of the genomic fragment contained in the donor DNA, and if it has at least the length necessary for recombination with the genome of the cell when introduced into the cell, it has the desired length. Fragments can be used. The length of the genomic fragment contained in the donor DNA may be a desired length including, for example, a range from oligo length (for example, tens of bases to tens of bases) to chromosome length (several hundred Mb or more). 0.01kb or more, 0.05kb or more, 0.5kb or more, 1kb or more, 1.5kb or more, 2kb or more, 3kb or more, 4kb or more, or 5kb or more, for example, 10,000kb or less, 5,000kb or less, 500kb or less, 300kb or less, 200kb or less Hereinafter, it is 100 kb or less, 80 kb or less, 50 kb or less, 30 kb or less, 20 kb or less, or 10 kb or less. By expanding the genomic fragment contained in the donor DNA to about several tens kb or several hundred kb corresponding to the size of one locus, it is also possible to collectively modify a plurality of mutation sites over a wide range. The donor DNA of the present invention may include such a long genomic fragment.

導入 By introducing the donor DNA into the cells, recombination is induced between the sequence of the genomic fragment contained in the donor DNA (donor sequence) and the corresponding genomic sequence in the target cell. For example, the sequence of the donor sequence (genomic fragment or the like) contained in the donor DNA is usually 90% or more, preferably 95% or more, 96% or more, 97% or more of the sequence of the corresponding fragment of the genome of the target cell. , 98% or more, 99% or more, or 99.9% or more.

That is, the present invention is a gene modification method using a guide RNA-dependent DNA nuclease,
(A) carrying a gene for a guide RNA-dependent DNA nuclease, introducing a minus-strand RNA viral vector not encoding at least one of the guide RNAs required for the expression of the activity of the nuclease into cells, and expressing the vector; Accumulating the nuclease in a cell in the absence of the at least one guide RNA;
(B) after step (a), supplying the missing guide RNA and donor DNA to the cells.

In addition, the above method, after the step (b),
(C) selecting a cell in which the gene has been modified,
May be further included.
This step may be a “step of selecting a cell into which the sequence in the donor DNA has been integrated”.

As described above, a temperature-sensitive negative-strand RNA virus vector can be used as described above. That is, the present invention is a gene modification method using a guide RNA-dependent DNA nuclease,
(A) a temperature-sensitive minus-strand RNA viral vector carrying the nuclease gene and not encoding at least one of the guide RNAs required for the expression of the nuclease activity is introduced into cells, and the vector is expressed at a permissive temperature. Allowing the nuclease to accumulate in the cell in the absence of the at least one guide RNA,
(B) after step (a), supplying the missing guide RNA and donor DNA to the cells;
(C) raising the culture temperature to a non-permissive temperature before or after or simultaneously with the step (b), and culturing the cells in a state where the guide RNA and the donor DNA are present in the cells.

In addition, the said method, after a process (c),
(D) selecting cells in which the gene has been modified,
May be further included.
This step may be a “step of selecting a cell into which the sequence in the donor DNA has been integrated”.

(4) The guide RNA and the donor DNA may be introduced into cells together or separately into cells, but it is convenient and preferable to introduce them together. There is no particular limitation on the method of introducing the donor DNA into the cells, and the donor DNA can be introduced by a desired method such as lipofection, electroporation, microinjection, or the particle gun method, similarly to the above guide RNA.

The amount of the donor DNA to be introduced is not particularly limited, and may be appropriately determined. For example, in Experiments 1-1 and 2-2 described in Examples, the concentration was 2.5 μg / well (6-well plate; 500 μl), and the cell amount at that time was approximately 2 to 2.5 × 10 ⁶ cells per well. However, the present invention is not limited thereto, and can be applied with a wide range of donor DNA amounts.

において In the present invention, the donor DNA may or may not contain the positive selectable marker gene and / or the negative selectable marker gene. Here, the positive selectable marker gene is a gene that encodes a marker used to select cells that carry the marker (and / or remove cells that do not have the marker gene), Refers to a gene encoding a marker that is used to remove cells that carry the marker (and / or select cells that do not have the marker gene). The positive selectable marker gene and the negative selectable marker gene can be appropriately selected. For example, examples of the positive selectable marker gene include various drug resistance genes such as Hyg (hygromycin resistance gene), Puro (puromycin resistance gene), and β-geo (fusion gene of β galactosidase and neomycin resistance gene). However, it is not limited to them. Negative selectable marker genes include, for example, genes that directly or indirectly induce inhibition of cell growth or survival, and specifically, herpes simplex virus-derived thymidine kinase (TK) gene, diphtheria toxin A fragment (DT -A) gene, cytosine deaminase (CD) gene and the like, but are not limited thereto.

When using a positive selectable marker, the positive selectable marker gene is inserted into a fragment (eg, in an intron) of the donor DNA that is introduced into the genome of the target cell. The positive selectable marker gene may be inserted between site-specific recombinase recognition sequences (LoxP, ΔFRT, etc.) so that it can be removed later.

When a negative selection marker is used, it is inserted into a portion of the donor DNA other than the fragment to be introduced into the genome of the target cell (in the case of using a plasmid vector, in the backbone of the plasmid).

However, according to the method of the present invention, it is not always necessary to use a selection marker, since an extremely high percentage of cells in which the donor DNA has been integrated into the genome can be obtained. When a positive selectable marker gene is not used, it is not necessary to insert a heterologous sequence (sequence not originally possessed by the species to which the target cell belongs) such as the marker gene or the site-specific recombinase recognition sequence described above in the donor DNA. Instead, the donor sequence contained in the donor DNA can be composed of only the sequence that is ultimately to be introduced into the target cell. For example, when it is desired to replace an abnormal gene or disease gene possessed by a target cell with a normal gene, the donor sequence can be composed of only the sequence of the normal gene. As a result, a heterologous sequence such as a marker gene or a recognition sequence of a site-specific recombinase does not remain in the genome of the finally obtained cell, so that ideal gene modification is possible. That is, the present invention provides a gene modification method using the minus-strand RNA virus vector of the present invention and a donor DNA having no positive selection marker gene.

Specifically, in the present invention, in the above-mentioned “step of selecting a cell in which a gene has been modified” (or “step of selecting a cell into which a sequence in a donor DNA has been integrated”), the cell is selected without relying on a selection marker. Testing to select for cells that have incorporated the donor sequence in the donor DNA. According to the method of the present invention, cells that have undergone the desired recombination (cells in which the donor sequence in the donor DNA has been integrated into the target site) can be obtained, for example, in 1 × 10 ^{− 4} or more, for example, 2 × 10 ^-4 or more, 3 × 10 ^-4 or more, 4 × 10 ^-4 or more, 5 × 10 ^-4 or more, 6 × 10 ^-4 or more, 7 × 10 ^-4 or more, 8 × 10 ^{− 4} or more, 9 × 10 ^-4 or more, 1 × 10 ^-3 or more, 2 × 10 ^-3 or more, 3 × 10 ^-3 or more, 4 × 10 ^-3 or more, 5 × 10 ^-3 or more, 6 × 10 ^-3 Above, 7 × 10 ⁻³ or more, 8 × 10 ⁻³ or more, 9 × 10 ⁻³ or more, 1 × 10 ⁻² or more, or 2 × 10 ⁻² or more. In fact, as shown in the examples, cells having the desired recombination (cells in which the sequence of the donor DNA was integrated into the target site) were observed in a ratio of 9.7 × 10 ⁻³ to 2.4 × 10 ⁻² of all living cells. (Experiments 1-1 and 2-2). Therefore, it is expected that a target recombinant cell can be obtained by examining a limited number of cells without relying on a selection marker. The upper limit of the ratio is not particularly limited, but may be, for example, less than 1, for example, 0.8 or less, 0.7 or less, 0.6 or less, 0.5 or less, 0.4 or less, or 0.3 or less. In the present invention, in the above-mentioned “step of selecting cells in which the gene is modified” (or “step of selecting cells in which the sequence in the donor DNA is integrated”), for example, less than 5000 For a method of examining cells and selecting cells into which the sequence of the donor DNA has been incorporated, preferably less than 3000 cells, more preferably less than 2000, less than 1000, less than 800, less than 600, 500 cells Less than 400, less than 300, less than 200, less than 100, or less than 50 cells and selecting a cell into which the sequence of the donor DNA has been integrated. The above numerical value may be an average value, an approximate value, an expected value, or the like.

Whether or not the target modification is present can be determined by, for example, directly or indirectly detecting a sequence specific to the target modification site.For example, the base sequence is confirmed by amplifying the target site by PCR. Alternatively, PCR can be performed by using a primer specific to the mutation site or the like, and the presence or absence of the PCR product, the length of the amplified fragment, and the like can be confirmed.

The gene modification method using the vector of the present invention has a very high efficiency of obtaining a modified product modified according to the sequence of the donor DNA, and has a low incidence of unintended sequence abnormality due to the residual target sequence DNA due to the genetic modification. .

細胞 There is no particular limitation on the cells for which the frequency of genetic modification is measured, but in the case of comparison, it is preferably measured using a cell line derived from the same cells. For example, fibrosarcoma-derived cells, specifically, cell lines derived from HT-1080 cells (ATCC @ CCL-121) can be suitably used.

The present invention also relates to the following method for producing a genetically modified cell or a cell population containing the cell. That is, the present invention is a method for producing a genetically modified cell using a guide RNA-dependent DNA nuclease, or a method for producing a cell population containing the cell,
(A) carrying a gene for a guide RNA-dependent DNA nuclease, introducing a minus-strand RNA viral vector not encoding at least one of the guide RNAs required for the expression of the activity of the nuclease into cells, and expressing the vector; Accumulating the nuclease in a cell in the absence of the at least one guide RNA;
(B) supplying, after the step (a), the insufficient guide RNA and donor DNA to the cells.

In addition, the above-mentioned method, after the step (b),
(C) a step of collecting the obtained cell population,
May be further included.
Alternatively, after step (b) or (c),
(C ′) a step of selecting cells in which the gene has been modified,
May be further included.
This step may be a “step of selecting a cell into which the sequence in the donor DNA has been integrated”.

As the minus strand RNA virus vector, a temperature sensitive minus strand RNA virus vector can be used. That is, the present invention is a method for gene modification using a guide RNA-dependent DNA nuclease, or a method for producing a genetically modified cell using a guide RNA-dependent DNA nuclease or a cell population containing the cell,
(A) a temperature-sensitive minus-strand RNA viral vector carrying the nuclease gene and not encoding at least one of the guide RNAs required for the expression of the nuclease activity is introduced into cells, and the vector is expressed at a permissive temperature. Allowing the nuclease to accumulate in a cell in the absence of the at least one guide RNA,
(B) after step (a), supplying the missing guide RNA and donor DNA to the cells;
(C) raising the culture temperature to a non-permissive temperature before or after or simultaneously with the step (b), and culturing the cells in a state where the guide RNA and the donor DNA are present in the cells.

In addition, the above-mentioned method, after the step (c),
(D) recovering the obtained cell population,
May be further included.
Alternatively, after step (c) or (d),
(D ′) selecting cells in which the gene has been modified,
May be further included.
This step may be a “step of selecting a cell into which the sequence in the donor DNA has been integrated”.

The cell population produced by the method of the present invention frequently contains cells in which the target site of the genome has been modified as desired. In addition, it is expected that the target site is accurately modified in each cell, and the generation of indel at the external position of the target is suppressed. For example, in the cell population produced by the method of the present invention using donor DNA, the ratio of cells containing the donor sequence derived from the donor DNA at the target site is 1 × 10 ^-4 or more in all living cells, for example, 2 × 10 ^-4 or more, 3 × 10 ^-4 or more, 4 × 10 ^-4 or more, 5 × 10 ^-4 or more, 6 × 10 ^-4 or more, 7 × 10 ^-4 or more, 8 × 10 ^-4 or more, 9 × 10 ^{− 4} or more, 1 × 10 ^-3 or more, 2 × 10 ^-3 or more, 3 × 10 ^-3 or more, 4 × 10 ^-3 or more, 5 × 10 ^-3 or more, 6 × 10 ^-3 or more, 7 × 10 ^-3 The above is 8 × 10 ⁻³ or more, 9 × 10 ⁻³ or more, 1 × 10 ⁻² or more, or 2 × 10 ⁻² or more. The upper limit of the ratio is not particularly limited, but may be, for example, less than 1, for example, 0.8 or less, 0.7 or less, 0.6 or less, 0.5 or less, 0.4 or less, or 0.3 or less. As described above, in the method of the present invention, since it is not essential to select cells with a selection marker, the cell population obtained by the method of the present invention contains cells that do not carry the selection marker gene at a high frequency. May be. The cell population of the present invention contains, for example, 0.3 or more, for example, 0.4 or more, 0.5 or more, 0.6 or more, 0.7 or more, 0.8 or more, or 0.9 or more cells that do not have a selection marker gene (for example, a drug resistance gene). Good. Alternatively, in the cell population of the present invention, not all cells need to carry the selectable marker gene.

The cell population produced by the method of the present invention includes cells containing a donor sequence derived from a donor DNA at a target site in the genome (ie, cells in which the target site in the genome has been modified as desired, and base cells in the target site in the genome). Of cells containing unintended modifications involving insertions and / or deletions), the percentage of cells containing unintended modifications involving insertion and / or deletion of bases at target sites in the genome is, for example, 0.5 or less, preferably 0.4 or less, 0.3 or less, 0.2 or less, or 0.1 or less (for example, 7% or less, 6% or less, 5% or less, 4% or less, 3% or less, 2% or less, or 1% or less).

(4) The embodiment of the genetic modification of the present invention will be described in more detail with reference to the drawings.

FIG. 2 shows a genetic modification scheme according to one embodiment of the present invention.
A shows infection of the Send9 virus vector carrying Cas9, amplification of the template by replication, transcription of Cas9 mRNA from the template, non-reinfection of this vector, and a large amount of Cas9 nuclease that translocated to the nucleus after translation.
In B, the vector backbone of the donor plasmid is indicated by a thin line, the sequence after modification of the donor plasmid is indicated by a thick line, and the sequence homologous to the altered gene is indicated by a thick line, and the locus to be altered is indicated by a long thick line below. Shows that when the donor plasmid is introduced into cells at the modified locus, the homologous regions of the modified locus and the donor plasmid are aligned with each other, and that the target sequence is recognized by the Cas9 / tracrRNA / crRNA complex. .
In C, cleavage induces a recombination reaction of the modified sequence, indicating that a genetically modified product can be formed.In addition, since high-frequency genetic modification occurs due to frequent cleavage, this genetically modified clone can be used in one step without drug selection. This shows that the system can be selected from live cell clones.
(The donor DNA is a DNA sequence homologous to the modified gene, a 5488 bp fragment spanning intron 1, exon 2, intron 2, exon 3, and intron 3 of the human HPRT gene having the modified sequence (represented by a vertical line). As the donor DNA, a donor plasmid having an origin of E. coli DNA replication can be used, but it is considered that only a homologous DNA fragment of the modified gene may be used. It has an array (star).)

FIG. 3 shows the procedure of a demonstration experiment of high-frequency gene modification using the SeV-Cas9 technology.
AB shows the same genetic modification scheme as FIG. The target of the HPRT locus of the test cell (TG98) has a two base-insertion frameshift mutation ( ^HPRTTG98 ). In this demonstration experiment, the frequency of gene modification is quantified as the frequency of gene reversion from HPRT ^TG98 to HPRT +. Since TG98 cells cannot proliferate in HAT medium and only HPRT + revertant cells can proliferate in HAT medium among the cell population, the frequency of appearance of HAT-resistant colonies is measured. Since the donor plasmid has a SmaI molecular marker (ACCCGGG) obtained by synonymously converting the SexAI site (ACCAGGT) on exon 2, sequence modification of the gene coordinate region can be confirmed by a change from the SexAI site to the SmaI site. It is also conceivable that this donor plasmid is not used as a template for the gene modification reaction, but returns to the HPRT + sequence from the double-base insertion mutation.
CD indicates the operating procedure along the reaction of AB. After infection of Cas9-loaded temperature-sensitive Sendai virus vector and strong expression of Cas9 under low temperature conditions, RNA molecules and donor DNA are simultaneously introduced under high temperature conditions to attenuate Cas9 expression, and seeded on a non-selective medium. Five days later, selection is performed in a HAT medium, the frequency of appearance of clones reverting to HAT-resistant HPRT + is measured, and the frequency of gene reversion is accurately quantified.

FIG. 4 (FIGS. 4-1 to 4-3) shows the results of the gene reversion test using the supernatant sample of SeV-Cas9 and the procedure for confirming the structure of the gene revertant in the candidate revertant clone (HAT-resistant colony).
A shows a comparison between the expression system of Cas9 sgRNA from a plasmid, the expression system of Cas9 from SeV, and the introduction system of RNAs in the frequency of appearance of HAT-resistant colonies in living cells in

Experiments

1 and 2. In each of the two conditions, the total number of cells, the total number of living cells, the cell viability, the total number of HAT-resistant colonies, and the frequency of appearance of HAT-resistant colonies in living cells are shown. In

Experiments

1 and 2, the frequency of appearance of HAT resistant colonies was about 0.003% in the Cas9 sgRNA co-expression system from the plasmid, whereas it was about 1-2% in the Cas9 expression from RNA and the RNAs introduction system in the plasmid. Under the conditions of the present invention, the frequency is significantly higher than that under general plasmid conditions.
B shows the structure of the gene variant and the position of the PCR primer. PCR analysis of the 5488 bp fragment of the homologous locus region with the 5 'outer primer GT68 and the 3' outer primer GT69 confirms that insertion of the backbone portion of the donor plasmid has not occurred by obtaining a fragment corresponding to 9367 bp. Subsequently, a fragment corresponding to 525 bp is obtained from the PCR using primers GT19 / GT22 to amplify the region of exon 2 where the molecular marker sequence is located, and the sequence is determined.
C shows the results of PCR-based structural analysis of the HAT resistant clone isolated from Experiment 1. Since a PCR product equivalent to 9367 bp was confirmed by the primer GT68 / GT69, it indicates that insertion of the backbone portion of the donor plasmid has not occurred. As shown in the lower left and lower right photographs of C, a PCR product equivalent to 525 bp was obtained by the primer GT19 / GT22 which amplifies the region of exon 2 where the molecular marker sequence was located, and thus sequence analysis was performed. For the two clones with white arrows, PCR products larger than 525 bp were obtained. This suggests that there is an insertion of about 100100 bp (see D).
In D, the second row shows the results of sequence analysis of 17 and 12 HAT-resistant clones derived from the Cas9 sgRNA co-expression system from plasmids in Experiment 1-1 and Experiment 1-2, respectively. Of the 17 HAT-resistant clones from Experiment 1-1, the reading frame was restored in all clones, but the following abnormalities were accompanied: 1) The target sequence DNA remained in 4 of 17 clones (Possibility of random insertion); 2) 2 out of 17 clones were associated with unintended insertion of sequences in adjacent introns. All of the 12 HAT resistant clones from Experiment 2-1 had their genes reverted, but had the following abnormalities: 1) 6 of 12 clones had residual target sequence DNA (no Possibility of random insertion).
The third column shows the results of Cas9 expression from SeV and sequence analysis of 12 and 24 HAT-resistant clones derived from the RNAs transfection system in Experiment 1-1 and Experiment 1-2, respectively. All of the 12 HAT resistant clones from Experiment 1-1 had their reading frames restored. The reading frame was restored in all 24 HAT resistant clones from Experiment 1-2. No unintended sequence abnormality was observed in the expression of Cas9 from SeV or the RNAs transfection system. This difference is due to the fact that in the conventional method, cleavage / rejoining of the design sequence on the donor DNA or the sequence after genetic modification, which is an off-target analogous sequence, is likely to occur, but the cleavage of the off-target analogous sequence in the method of the present invention. Suggests that it is suppressed.
From the above results, it can be said that the method combining nuclease expression from a minus-strand RNA virus vector and RNA introduction is a highly safe method that can suppress unintended sequence abnormalities from being attached to genetic modification.

FIG. 5 shows a gene reversion test using a purified sample of SeV-Cas9 on TG98 evaluation cells. Experiments 2-1 and 2-2 show that the frequency of appearance of HAT-resistant colonies in living cells was higher than that of Cas9 sgRNA co-expression system from plasmid. 2 shows a comparison between Cas9 expression from SeV and an RNAs transfection system. In each of the two conditions, the total number of cells, the total number of living cells, the cell viability, the total number of HAT-resistant colonies, and the frequency of appearance of HAT-resistant colonies in living cells are shown. The appearance frequency of HAT-resistant colonies is about 0.004% in the Cas9 sgRNA co-expression system from the plasmid, whereas it is about 0.3% in the Cas9 expression from RNA and the RNAs introduction system. It shows a remarkable increase in frequency more than the simple plasmid condition. In addition, while the cell viability was 1-2% in Experiments 1-1 and 1-2 using the supernatant sample of SeV-Cas9, Experiment 2-1 using the purified sample of SeV-Cas9, In 2-2, it can be seen that it was improved to 10-13%. Based on the results obtained from the improved experimental conditions, it is considered that in the gene reversion of the HPRT ^TG98 mutation, the expression of Cas9 from SeV and the frequency of gene reversion in living cells by the RNAs transfection system are about 0.3%.

FIG. 6 shows a gene disruption test using a purified sample of SeV-Cas9. Experiments 3-1 and 3-2 show that the frequency of appearance of 6-thioguanine-resistant (6TG ^R ) colonies in living cells indicates that the Cas9 sgRNA co-expression system from plasmid was used 7 shows a comparison between Cas9 expression from RNA and SeV, and an RNAs transfection system. In each of the two conditions, the total cell number, the total number of viable cells, cell viability, total 6TG ^R resistant colony number represents the frequency of occurrence of 6TG ^R resistant colonies of viable cells. Frequency of 6TG ^R resistant colonies, whereas there about 0.17% in Cas9 sgRNA coexpression system from plasmid, Cas9 expression from SeV, the RNAs introduction system is about 0.3-0.5%, in the present invention conditions, The frequency is significantly higher than that of general plasmid conditions. It was confirmed that Cas9 expression and RNA introduction system can be used for gene disruption purpose. In addition, a dose-response relationship between the amount of introduced RNA and the frequency of gene disruption was observed.

FIG. 7-1 shows a gene reversion test using a purified sample of SeV-Cas9 on TG439-1 evaluation cells, and experiments 4-1, 4-2, and 4-3 show plasmids in the frequency of appearance of HAT-resistant colonies in living cells. 2 shows a comparison between a Cas9 sgRNA co-expression system from Escherichia coli and a Cas9 expression from SeV and RNAs transfection system. In each of the two conditions, the total number of cells, the total number of living cells, the cell viability, the total number of HAT-resistant colonies, and the frequency of appearance of HAT-resistant colonies in living cells are shown. The frequency of appearance of HAT-resistant colonies is about 0.003% in the Cas9 sgRNA co-expression system from the plasmid, whereas it is about 0.1% in the Cas9 expression from SeV and RNAs introduction system. It shows a remarkable increase in frequency more than the simple plasmid condition.
The results of sequence analysis of five and three HAT-resistant clones derived from the Cas9 sgRNA co-expression system from plasmids in Experiment 4-1 and Experiment 4-2 are shown on the left side of FIG. 7-2. 1) There was no accompanying residual target sequence DNA; 2) No unintended sequence insertion in adjacent introns. The right side of FIG. 7-2 shows the results of Cas9 expression from SeV and sequence analysis of 12 and 12 HAT-resistant clones derived from the RNAs transfection system in Experiment 4-1 and Experiment 4-2, respectively. No unintended sequence abnormality accompanying the gene reversion as in 1) and 2) was observed.
In Experiment 4-3, a dose-response relationship between the amount of the introduced RNA and the frequency of gene disruption was observed.

The problems of the conventional method in the CRISPR / Cas9-induced gene modification method and the superiority of the method of the present invention are described below.
FIG. 1 illustrates a typical scheme of a conventional gene modification method. FIG. 2 illustrates a scheme of the present invention (a novel gene modification method) that solves the conventional problem. The table below shows the problems of the conventional method and the solution by the present invention. That is, since the minus-strand RNA virus vector used in the present invention does not have a DNA phase, there is no danger of unintended insertion into the chromosome of a cell (at the top of the table). In addition, cleavage of off-target similar sequences, problems of excessive labor and time due to two-step selection, problems of site-specific recombination sites remaining (traces), removal of target cleavage sequences from donors, regulation of gene modification frequency Problems such as those described above (see the table) are shown to be solved or improved by the present invention. It can be said that these problems were solved or improved by improving the frequency of genetic modification by several tens of times or more (at the bottom of the table) by the system of the present invention that realized the shortening and enhancement of Cas9 expression.

[Table 1]

The present invention is capable of regulating the frequency of genetic modification, suppressing the occurrence of unintended sequence abnormalities associated with genetic modification, introducing a desired modification into the genome of cells at a high rate, or repairing mutations in the genome. For example, it is useful as a molecular genetics system for highly efficiently modifying a gene sequence for the purpose of gene function analysis, gene therapy, breed improvement, and biotechnological creation. In particular, the present invention can be used to convert a disease-causing sequence into a normal sequence in a causative gene of a hereditary disease.

Hereinafter, the present invention will be described in more detail with reference to examples, but the present invention is not limited to these examples. Also, all references and other references cited herein are incorporated as part of this specification.

[Example 1] Construction of pBS-HPRTEx2SMAI plasmid A subplasmid construction method for producing a donor plasmid used in the present invention is described below. In the present invention, “pBS” indicates pBluescript SK +.

構築 Construction of the pBS-HPRTEx2 subplasmid was performed as follows. Using genomic DNA of HT-1080 cells derived from Fibrosarcoma as a template, using 5'- AGCCTGGGCAACATAGCGAGACTTC -3 '(GT28) (SEQ ID NO: 1) and 5'- TCTGGTCCCTACAGAGTCCCACTATACC -3' (GT22) (SEQ ID NO: 2), Perform PCR reaction with KOD-PLUS-DNA polymerase (TOYOBO) (94 cycles of 94 ° C for 2 minutes → 94 ° C for 15 seconds, 60 ° C for 30 seconds, 68 ° C for 3 minutes and 30 seconds for 40 cycles → 68 ° C for 7 minutes) As a result, a PCR product of about 2800 base was obtained. Using genomic DNA of HT-1080 cells derived from Fibrosarcoma as a template, using 5'- GCTGGGATTACACGTGTGAACCAACC -3 '(GT19) (SEQ ID NO: 3) and 5'- TGGCTGCCCAATCACCTACAGGATTG -3' (GT24) (SEQ ID NO: 4), Perform a PCR reaction with KOD-PLUS-DNA polymerase (94 ° C for 2 minutes → 94 ° C for 15 seconds, 58 ° C for 30 seconds, 68 ° C for 8 minutes, 40 cycles → 68 ° C for 7 minutes). A PCR product was obtained. Using the above 2800-bp PCR product and 3100-bp PCR product as templates, 5′- ATCCACTAGTTCTAGAAGCCTGGGCAACATAGCGAGACTTC -3 ′ (GT29) (SEQ ID NO: 5) and 5′- CACCGCGGTGGCGGCCGCTGGCTGCCCAATCACCTACAGGATTG -3 ′ (GT30) (SEQ ID NO: 6) Using KOD-PLUS-DNA polymerase (TOYOBO Co., Ltd., code number KOD-101), PCR reaction (94 ° C-2 minutes → 94 ° C-15 seconds, 58 ° C-30 seconds, 68 ° C-6 minutes, 40 cycles → 68 ° C for 7 minutes) to obtain a PCR product of about 5500 base. The 5500-bp @PCR product and pBluescript \ SK + digested with NotI were ligated with an In-Fusion \ kit (Clontech Laboratories, Inc., catalog number 639649) to obtain pBS-HPRTEx2 (18-7). Thereafter, this plasmid was used as a template for site-directed Δmutagenesis.

Construction of the pBS-HPRTEx2ISCEI subplasmid was performed as follows. The genomic DNA of HT-1080 cells from Fibrosarcoma as a template, 5'- TAGTTCTAGAGCGGCCGCAGCCTGGGCAACATAGCGAGACTTC -3 '(GT35) ( SEQ ID NO: 7) and I-SceI recognition sequence including (underlined) 5'- ATTACCCTGTTATCCCTA ACCTGGTTCATCATCACTAATCTG -3' ( GT34) (SEQ ID NO: 8) and PCR reaction (94 ° C for 2 minutes → 94 ° C for 15 seconds, 94 ° C for 15 seconds, 58 ° C for 30 seconds, 68) by KOD-PLUS-DNA polymerase (TOYOBO Co., code number KOD-101) 40 cycles of -3 ° C for 3 minutes → 68 ° C for 7 minutes) to obtain a PCR product of about 2500 bases. Using the genomic DNA of HT-1080 cells derived from Fibrosarcoma as a template, 5′- TAGGGATAACAGGGTAAT TATGACCTTGATTTATTTTGCATACC -3 ′ (GT33) (SEQ ID NO: 9) containing the I-SceI recognition sequence (underlined) and 5′-CACCGCGGGGGCGGCCGCTGGCTGCCCAATCACCTACAGGATTG-3 ′ Using GT30) (SEQ ID NO: 6), PCR reaction with KOD-PLUS-DNA polymerase (94 ° C for 2 minutes → 94 ° C for 15 seconds, 58 ° C for 30 seconds, 68 ° C for 3 minutes, 40 cycles → 68 ° C) -7 minutes) to obtain a PCR product of about 2900 bases. The 2500-bp PCR product, the 2900-bp PCR product, and pBluescript SK + digested with NotI were ligated with an In-Fusion kit (TOYOBO) to obtain pBS-HPRTEx2ISCEI (21-1). Thereafter, this plasmid was used as a replacement plasmid for a fragment having a modified sequence obtained from site-directed mutagenesis.

Construction of the pBS-HPRTEx2SMAI plasmid was performed as follows. Using the plasmid pBS-HPRTEx2 (18-7) of the first term as a template, 5′-GG G TATGACCTTGATTTATTTTGCATACC-3 ′ (GT42) (SEQ ID NO: 10) and 5′- G GGTTCATCATCACTAATCTG-3 containing the modified sequence SMAI (underlined) Using '(GT43) (SEQ ID NO: 11), pBS-HPRTEx2SMAI (P1) was obtained by using KOD-PLUS-Inverse PCR mutagenesis kit (TOYOBO) as one of the site-directed mutagenesis methods. The pBS-HPRTEx2SMAI (P1) plasmid DNA was digested with BglII and SphI. The donor plasmid pBS-HPRTEx2SMAI (P1-6) was obtained.

[Example 2] Preparation of evaluation cells (TG98 cells) for gene reversion test Preparation of target cells for gene reversion using SeV-Cas9 was performed as follows. A target sequence was set as Protospacer Adjacent Motif (PAM) at 5'-CCA-3 'of the SexAI site (5'-ACCAGGT-3') in exon 2 of the HPRT gene of Fibrosarcoma-derived HT-1080 cells, To isolate cells with mutations near the sequence, use CAG-hspCas9-H1-gRNA linearized SmartNuclease vector DNA (System Biosciences Catalog No. CAS920A-1) to insert the target sequence (underlined) immediately after the H1 promoter. 5'-TGTATGAGACCAC AATAAATCAAGGTCATAACC -3 '(GT50) (SEQ ID NO: 12) and 5'-AAAC GGTTATGACCTTGATTTATT GTGGTCTCA-3' (GT51) (SEQ ID NO: 13) are ligated to form a plasmid pCas9- sgHPRT1 was obtained.
Next, HT-1080 cells derived from Fibrosarcoma were prepared, pCas9-sgHPRT1 plasmid DNA was introduced using X-tremeGene HP DNA Transfection Reagent Version 08 (Roche Cat. No. 06 366 236 001), and seeded on a dish. The medium was replaced with a medium containing 7.5 μg / mL 6-thioguanine (Wako Cat. No. 203-03771) to obtain two 6-thioguanine resistant colonies from 1 × 10 ⁶ HT-1080 cells. As a result of sequence analysis, both clones were found to have mutations in the target sequence. In one of them, as shown in the upper row of the table in FIG. 4D, a frame shift occurred due to insertion of two bases (GGTTATGACCTTGATTTATT (SEQ ID NO: 44) → GGT TA TATGACCTTGATTTATT (SEQ ID NO: 45) underlined). This mutation is ^designated as HPRT ^TG98 , and this clone is designated as TG98 cells.
As described above, a TG98 cell line was obtained as one of the HPRT gene mutants of Fibrosarcoma-derived HT-1080 cells, and was used as an evaluation cell in a gene reversion test using a Cas9-loaded Sendai virus vector or plasmid (control).

Example 3 Evaluation of Gene Reversion Test Preparation of Plasmid pCas9-sgRNA for TG98 Cell HT-1080 Cell HPRT Gene Mutant TG98 Cell Line Cleavage Targeted near the Two-Base Insertion Mutation (HPRT ^TG98 ) in Exon 2 of TG98 Cell Line In order to prepare a plasmid that can be prepared, a target sequence having PAM at 5′-CCA-3 ′ of the SexAI site (5′-ACCAGGT-3 ′) is set, and CAG-hspCas9-H1-gRNA linearized SmartNuclease vector DNA ( Using System Biosciences catalog number CAS920A-1), immediately after the H1 promoter, 5'-TGTATGAGACCAC TAAATCAAGGTCATATAACC -3 '(GT99) containing the target sequence (underlined) (SEQ ID NO: 14) and 5'-AAAC GGTTATATGACCTTGATTTA GTGGTCTCA-3 A double-stranded oligonucleotide consisting of '(GT100) (SEQ ID NO: 15) was ligated to obtain plasmid pCas9-sgHPRT1m, which was used as a control in a gene reversion experiment. The 5th to 4th TA from the 3 'end of GT99 and the 8th to 9th TA from the 5' end of GT100 indicate the positions of the two-base insertion mutation.

[Example 4] Preparation of Send9 virus vector SeV-Cas9 carrying Cas9 Preparation of a Sendai virus vector SeV-Cas9 carrying Cas9 was performed as follows. First PCR product in which the Cas9 nuclease sequence was divided into 10 by the first PCR in order to load the Cas9 nuclease sequence derived from the Cas9 SmartNuclease All-in-one Vector (System Biosciences Catalog No. CAS920A-1) into the Sendai virus vector SeV In the second PCR, when the four first PCR products on the 5 ′ side are used as templates, when the three first PCR products near the center are used as templates, the three first PCR products on the 3 ′ side are used as templates. In each case, the second PCR product was obtained from each case, and in the third PCR, using the three second PCR products as templates, a third PCR product over the entire length of the Cas9 nuclease sequence was obtained, and this was mounted on the Sendai virus vector. . The reason that the Cas9 nuclease sequence is divided into 10 in the first PCR is that nine A rich sequences (5A or 6A) are scattered in the Cas9 nuclease sequence, but the Sendai virus vector This is to avoid such an error phenomenon because an error due to the RNA-dependent RNA polymerase of Sendai virus tends to occur during the production process. PCR primers were set so that the A rich sequence site became a joint of the split PCR, and each primer sequence was replaced from A / T to G / C under the restriction of synonymous codons.

[Table 2]
First PCR primer and template DNA

*: DNA of CAG-hspCas9-H1-gRNA linearized SmartNuclease vector (System Biosciences catalog # CAS920A-1) was used.

Each primer sequence is shown below.
Not1_CAS9_N (SEQ ID NO: 16): ATATGCGGCCGCTCGCCACCATGGCTAGTATGCAGAAACTG
CAS9_A96G_C (SEQ ID NO: 17): CCGATACTATACTTCTTGTCGGCAGCGGGC
CAS9_A96G_N (SEQ ID NO: 18): GCCCGCTGCCGACAAGAAGTATAGTATCGG
CAS9_A222G_C (SEQ ID NO: 19): GGCTCCAATCAGATTCTTCTTGATACTGTG
CAS9_A222G_N (SEQ ID NO: 20): CACAGTATCAAGAAGAATCTGATTGGAGCC
CAS9_A789G_C (SEQ ID NO: 21): CCAAACAGGCCGTTCTTCTTTTCGCCTGG
CAS9_A789G_N (SEQ ID NO: 22): CCAGGCGAAAAGAAGAACGGCCTGTTTGG
CAS9_A789G_C (SEQ ID NO: 23): CCAAACAGGCCGTTCTTCTTTTCGCCTGG
CAS9_A1413G_N (SEQ ID NO: 24): GAGAAGATCGAAAAGATTCTGACTTTCCGC
CAS9_A1602G_C (SEQ ID NO: 25): GCTTGGGCAGCACTTTCTCATTTGGCAGG
CAS9_A1602G_N (SEQ ID NO: 26): CCTGCCAAATGAGAAAGTGCTGCCCAAGC
CAS9_A2673G_C (SEQ ID NO: 27): CACTCTTTCCTCGGTTCTTGTCGCTGCGGG
CAS9_A2673G_N (SEQ ID NO: 28): CCCGCAGCGACAAGAACCGAGGAAAGAGTG
CAS9_A3147G_C (SEQ ID NO: 29): CTCTTGGCGATCATCTTTCTGACATCGTAC
CAS9_A3147G_N (SEQ ID NO: 30): GTACGATGTCAGAAAGATGATCGCCAAGAG
CAS9_A3546G_C (SEQ ID NO: 31): CAGTTTCTTGCTCTTTCCCTTCTCCACC
CAS9_A3546G_N (SEQ ID NO: 32): GGTGGAGAAGGGAAAGAGCAAGAAACTG
CAS9_A3750G_C (SEQ ID NO: 33): CAGTTCATTTCCTTTCTGCAGCTCGCCGGC
CAS9_A3750G_N (SEQ ID NO: 34): GCCGGCGAGCTGCAGAAAGGAAATGAACTG
CAS9_EIS_Not1_C (SEQ ID NO: 35): ATATGCGGCCGCGAACTTTCACCCTAAGTTTTTCTTACTCACTTCTTCTTCTTTGCCTGTCCTGCTTTC

Using these primer pairs and the template DNA, a PCR reaction (94 ° C for 2 minutes → 98 ° C for 10 seconds, 55 ° C for 55 minutes) using KOD-PLUS-Ver. 2-DNA polymerase (TOYOBO Co., code number KOD-211) 30 cycles of 68 ° C. for 1 minute and 30 cycles of 68 ° C. for 17 minutes) were performed to obtain respective PCR products. After confirming the size of the PCR product by electrophoresis, the product was purified by NucleoSpin ^™ Gel and PCR Clean-up (MACGEREY-NAGEL Catalog No. 740609.250 / U0609C).

[Table 3]
Second PCR primers and template DNA

Using these primer pairs and the template DNA, a PCR reaction (94 ° C for 2 minutes → 98 ° C for 10 seconds, 55 ° C for 55 minutes) using KOD-PLUS-Ver. 2-DNA polymerase (TOYOBO Co., code number KOD-211) 30 cycles of 68 seconds at 68 ° C. for 30 seconds → 68 minutes at 68 ° C.) were performed to obtain respective PCR products. After confirming the product size by electrophoresis, the product was purified by NucleoSpin ^™ Gel and PCR Clean-up (MACGEREY-NAGEL Catalog No. 740609.250 / U0609C).

[Table 4]
Third PCR primer and template DNA

Using these primer pairs and template DNA, a PCR reaction (94 ° C for 2 minutes → 98 ° C for 10 seconds, from 65 ° C) using KOD-PLUS-Ver. 2-DNA polymerase (TOYOBO Co., code number KOD-211) Step down to 55 ° C-30 seconds, 68 ° C-4 minutes 30 seconds, 10 cycles each) → (98 ° C-10 seconds, 55 ° C-30 seconds, 68 ° C-4 minutes 30 seconds, 30 cycles → 68 ° C-17) Min) to obtain a full-length PCR product. After confirming the product size by electrophoresis, the product was purified by NucleoSpin ^™ Gel and PCR Clean-up (MACGEREY-NAGEL Catalog No. 740609.250 / U0609C). NotI-digested and gel-extracted full-length Cas9 fragment was digested with NotI and BAP-treated plasmid pSeV (PM) TS15 / ΔF DNA (F gene deleted, M (G69E / T116A / A183S), HN (A262T / G264 / K461G), P (D433A / R434A / K437A / L511F), DNA encoding the genome of Sendai virus vector (WO2003 / 025570, WO2010 / 008054) having mutation of L (L1361C / L1558I / N1197S / K1795E). , And a plasmid carrying the full-length Cas9 gene (VCas9) optimized for SeV after confirming the cloned CAS9 nucleotide sequence. pSeV (PM) CAS9TS15 / ΔF was obtained. Sendai virus was reconstituted using this plasmid DNA as a template to obtain a Send9 virus vector SeV (PM) CAS9TS15 / ΔF carrying Cas9.

[Example 5] Gene reversion test using SeV-Cas9 to TG98 cells Gene reversion using HPV gene exon 2 double mutation (HPRT ^TG98 ) (Example 2) in TG98 cells using SeV-Cas9 In order to perform the test, the donor plasmid pBS-HPRTEx2SMAI (P1-6) (Example 1) Two types of RNA that are lipofected simultaneously with DNA, 1) crRNA 5'-UAAAUCAAGGUCAUA UA ACC-3 '(acting as target RNA) ( GT79) (SEQ ID NO: 36), 2) A tracrRNA (Fasmac catalog number GE002) serving as a scaffold RNA for Cas9 enzyme was prepared. UA in the crRNA (5-4th from the 3 'end of GT79 (underlined)) indicates a site corresponding to a two-base insertion mutation.

The gene reversion test (FIG. 2) was performed as follows. On the day before the infection with SeV-Cas9, 5 × 10 ⁵ TG98 cells / 2-mL DMEM medium (including 6-thioguanine) / well was applied to a 6-well plate and adherent culture was performed. After approximately 24 hours, the medium was removed and 2 mL Opti While adding -MEM and keeping at 37 ° C, the number of cells in one well was measured to calculate the total number of cells to be infected, and the Send9 virus vector SeV (PM) CAS9TS15 / ΔF carrying Cas9 corresponding to a multiplicity of infection of 3 was calculated. (Example 4) was collected, adjusted to 0.5 mL SeV-Cas9 solution / well by diluting with Opti-MEM, removing the previously added Opti-MEM, and adding 0.5 mL SeV-Cas9 solution / well. Then, adsorption infection was started at 32 ° C. and 5% CO ₂ , and the mixing operation was performed every 15 minutes. After 2 hours, the SeV-Cas9 solution was removed, 2 mL Opti-MEM / well was added, and 2-mL was added. The medium was replaced with a DMEM medium (containing 6-thioguanine) / well and cultured at 32 ° C. under 5% CO ₂ . After about 24 hours, the medium was replaced with a new DMEM medium, transferred to 35 ° C. and 5% CO ₂ , and cultured for about 24 hours.

1 hour before seeding the lipofection solution, the medium was removed from the SeV-infected cell culture plate, and Opti-MEM was added at 2 mL / well. X-tremeGene HP DNA Transfection Reagent Version 08 (Roche Catalog No. 06 366 236 001) was used to introduce crRNA GT79 and tracrRNA (Fasmac catalog number GE002) and donor plasmid DNA by the lipofection method. Mix 0.15 μg of crHPRT1mR (GT79), 0.27 μg of tracrRNA, and 2.5 μg of pBS-HPRTEx2SMAI (P1-6) donor plasmid, adjust to 1 μg RNA / DNA / 100 μL with Opti-MEM, and add 1 μg RNA / DNA. Then, 1 μL of X-tremeGene / HP / DNA / Transfection / Reagent was added, and a DNA / RNA / liposome complex was formed at 25 ° C. for 15 minutes, and the volume was adjusted to a total volume of 0.5 μmL / well with Opti-MEM. This RNA concentration of 0.42 μg / 0.5 mL / well is expressed as 1 × RNAs. As a control, a lipofection solution was prepared using the plasmid pCas9-sgHPRT1m (Example 3) at 5 μg / 0.5 μmL / well instead of SeV-Cas9 / tracrRNA / crRNA.

This lipofection solution was added to a 6-well plate at 0.5 mL / well and incubated at 37 ° C., 5% CO ₂ -17 hours. To apply lipofection cells, replace the lipofection solution in each well with 2 mL PBS / well, remove, add 0.25% trypsin / 1 mM EDTA solution at 0.5 mL / well, incubate at 37 ° C for 1 minute, and add 0.5 mL Add DMEM medium / well and detach / suspend cells by pipetting 3 to 4 times (P1000 pipette), collect in one 50-mL tube, measure cell number, centrifuge at 1,200 rpm for 3 minutes, and supernatant The cells were suspended in DMEM medium (without 6-thioguanine) at ⁴ × 10 ⁴ cells / mL, applied to a 10 mL / 10-cm diameter dish, and non-selective culture was started under the conditions of 37 ° C. and 5% CO ₂ ( Day 0). On Day 5, change to DMEM medium (including HAT) supplemented with 1/50 volume of HAT Supplement (50x), Liquid (ThermoFisher catalog # 21060017) and start selective cultivation. Replace with the same medium every 2 or 3 days. On Day 14, the number of HAT resistant colonies was measured on four dishes.

The procedure of gene revertant isolation and structural analysis was performed as follows. For each HAT resistant colony, 200 μL of P1000 Pipetman was removed under a microscope to remove the cells, suspended in one well of a 6-well plate supplemented with 2 mL of HAT supplemented medium, and assigned a HAT clone number. Then, selective culture was performed under the conditions of 37 ° C. and 5% CO ₂ , and the culture was continued to near confluence. Remove the medium, add / remove PBS at 2 mL / well, add 0.25% trypsin / 1 mM EDTA solution at 500 μL / well, incubate at 37 ° C for 1 minute, add DMEM medium at 500 μL / well, and perform 3-4 times. Peel and suspend cells by P1000 pipetting, collect cells in one 1.5-mL Eppendorf tube, remove the supernatant by centrifugation at 2,500 rpm for 3 minutes, add 100 μL PBS, suspend cells by pipetting, suspend 40 μL each Dispense into 2 cryotubes, add Cell Banker 1 Plus in a 500 μL / cryotube, store at -80 ° C, centrifuge the remaining 20 μL PBS cell suspension at 2,500 rpm for 3 minutes, remove the supernatant, and remove the cell pellet. Stored frozen at -80 ° C. The frozen cell pellet was thawed in ice, and genomic DNA was extracted using a GeneElute Mammalian Genomic DNA miniprep Kit (SIGMA-ALDRICH, catalog number G1N350), and stored at 4 ° C as a 100 μL sample. Using genomic DNA of the HAT clone as a template, 1) (GT68); using 5'-ACGACCTCGCCCGGCCTTGTATT-3 '(GT68) (SEQ ID NO: 37) and 5'-GCCACTGCACCCAGCCGTATGT-3' (GT69) (SEQ ID NO: 38) , KOD-FX-DNA polymerase (TOYOBO Co., code number KFX-101) was used to perform a PCR reaction (94 ° C-2 minutes → 98 ° C-10 seconds, 68 ° C-20 minutes 40 cycles → 68 ° C for 7 minutes) Since a PCR product of about 9300 bases was obtained in the same manner as the PCR product using HT-1080 genomic DNA as a template, it was confirmed that the donor plasmid was not inserted (Experiment 1-1 (FIG. 4B, C)). 2) 5) -GCTGGGATTACACGTGTGAACCAACC-3 '(GT19) (SEQ ID NO: 3) and 5'-TCTGGTCCCTACAGAGTCCCACTATACC-3' (GT22) (SEQ ID NO: 2) -Perform a PCR reaction (94 ° C-2 minutes → 98 ° C-10 seconds, 68 ° C-1 minute 40 cycles → 68 ° C for 7 minutes) using DNA polymerase (TOYOBO Co., Ltd., code number KFX-101). Confirm the PCR product (Experiment 1- (Figure 4B, C under), carried out in 1-2), PCR clean-up (MACHEREY-NAGEL, after purification by 740,609.250), was sequenced (performed in experiments 1-1 and 1-2).

First, the above gene reversion test was performed twice. In Experiment 1-1, the appearance rate of HAT resistant clones in living cells was 3.7 e-5 under the conditions of plasmid pCas9-sgHPRT1m introduction, and 9.7 e-3 under the conditions of SeV-Cas9 infection / crHPRT1mR (GT79) / tracrRNA introduction. According to the calculation, the frequency of the present invention was 265 times higher than that of general plasmid conditions (FIG. 4A, Experiment 1-1). In Experiment 1-2, the appearance rate of HAT-resistant clones in living cells was 2.5e-5 under the conditions of plasmid pCas9-sgHPRT1m introduction, and 2.4e-2 under the conditions of SeV-Cas9 infection / crHPRT1mR (GT79) / tracrRNA introduction. From the calculation, the frequency of the present invention was 975 times higher than that of the general plasmid under the conditions of the present invention (FIG. 4A, Experiment 1-2). In Experiment 1-1, the cell viability was 11% under the plasmid pCas9-sgHPRT1m introduction condition and 2.0% under the SeV-Cas9 infection / crRNA GT79 / tracrRNA introduction condition (FIG. 4A, Experiment 1-1). In Experiment 1-2, the cell viability was 1.4% under the conditions of SeV-Cas9 infection / crHPRT1mR (GT79) / tracrRNA introduction, compared to 12% under the conditions of plasmid pCas9-sgHPRT1m introduction (FIG. 4A, Experiment 1-2). CellV viability was significantly reduced by SeV-Cas9 infection. This may be due to the fact that the used SeV-Cas9 sample is a supernatant sample before ultrafiltration / column purification. A similar experiment was performed using the purified sample after purification, and the degree of frequency increase under the conditions of the present invention with respect to the plasmid pCas9-sgHPRT1m introduction conditions was determined.

[Example 6] Gene reversion to TG98 cells using SeV-Cas9 Using a purified sample of SeV-Cas9, the gene reversion test of Example 5 was further performed twice as Experiment 2-1 and Experiment 2-2. .
In Experiment 2-1, the cell viability was 11% to 17% under the conditions of SeV-Cas9 infection / crHPRT1mR (GT79) / tracrRNA, whereas the cell viability was 15% under the conditions of plasmid pCas9-sgHPRT1m (Figure 5 Experiment 2). 1) In Experiment 2-2, the cell viability was 11% to 15% under the conditions of SeV-Cas9 infection / crHPRT1mR (GT79) / tracrRNA, compared to 14% under the conditions of plasmid pCas9-sgHPRT1m (FIG. 5). Experiment 2-2), no decrease in cell viability due to SeV-Cas9 infection was observed.
In Experiment 2-1, the appearance rate of HAT-resistant clones in living cells was 3.9e-5 under the plasmid pCas9-sgHPRT1m transfection condition, but 2.6e under the SeV-Cas9 infection / crHPRT1mR (GT79) / tracrRNA transfection condition. -3 to 3.5e-3, which was 69 to 90 times higher than that of general plasmid conditions under the conditions of the present invention (FIG. 5, Experiment 2-1). In Experiment 2-2, the frequency of HAT resistant clones in living cells was 3.9e-5 under the conditions of plasmid pCas9-sgHPRT1m introduction, and 3.3e-3 under the conditions of SeV-Cas9 infection / crHPRT1mR (GT79) / tracrRNA introduction. 3.6e-3, which was 85-91 times higher than that of general plasmid conditions under the conditions of the present invention (FIG. 5, Experiment 2-2).
It can be said that the frequency of gene reversion was significantly higher than that of plasmid pCas9-sgHPRT1m in both the supernatant sample of SeV-Cas9 (FIG. 4A, experiments 1-1 and 1-2) and the purified sample. No significant difference occurred in the cell viability between the plasmid pCas9-sgHPRT1m introduction condition and the SeV-Cas9 infection / crHPRT1mR (GT79) / tracrRNA introduction condition. Based on the results of Experiments 2-1 and 2-2, plasmid pCas9- The degree of frequency increase by the conditions of the present invention with respect to the sgHPRT1m introduction condition is determined to be about 60 to 90 times.

In Experiment 1-1 and Experiment 1-2, a reverted HAT clone was isolated and subjected to structural analysis by the procedure described in Example 5.
In the Cas9 sgRNA co-expression system from plasmid in Experiment 1-1, in 17 HAT-resistant clones, the PCR analysis of the 5488 bp fragment of the target region with the 5 ′ outer primer GT68 and the 3 ′ outer primer GT69 revealed that a fragment corresponding to 9367 bp was obtained. (Fig. 4C, upper left), it was confirmed that insertion of the backbone portion of the donor plasmid had not occurred. Subsequently, PCR using primers GT19 / GT22 to amplify the region of exon 2 showed that 525 bp was mainly detected. A considerable PCR product was obtained (FIG. 4C, lower left). For the two clones with white arrows, PCR products larger than 525 bp were obtained. This indicates that there is an insertion of about 100 bp. Sequence analysis of the primer GT19 / GT22 PCR products showed that all of the 17 HAT resistant clones (FIG. 4D, middle row, 2nd row) had their target sequence sites reverted, with the following abnormalities: 1) Two out of 17 clones were accompanied by insertions in the proximal intron; 2) Four other out of 17 clones suggest that the 2-base insert mutated DNA remains somewhere. This is probably because the two-base insertion mutant sequence DNA was randomly integrated with the return of the target sequence. In the Cas9 sgRNA co-expression system from plasmid in Experiment 1-2, the target sequence site was restored in 12 HAT-resistant clones (lower second row in FIG. 4D), but 17 clones derived from Experiment 2 Analysis of the presence of such abnormalities revealed that insertions in the proximal intron were absent in 12 clones, but in 6 of the 12 clones the double-base insertion mutant DNA was found somewhere (on the genome). Possibility of suggesting that it remains.

In the system expressing Cas9 from SeV and introducing RNAs in Experiment 1-1, in 12 HAT-resistant clones, the PCR analysis of the 5488 bp fragment of the target region with the 5 ′ outer primer GT68 and the 3 ′ outer primer GT69 revealed that the 967 bp equivalent was obtained. Since the fragment was obtained (upper right in FIG. 4C), it was confirmed that insertion of the backbone portion of the donor plasmid had not occurred. Subsequently, PCR using primers GT19 / GT22 for amplifying the exon 2 region revealed that the fragment was equivalent to 525 bp. (FIG. 4C, lower right). From the sequence analysis of the primer GT19 / GT22 PCR products, the target sequence site was restored in all of the 12 HAT-resistant clones (middle column, 3D in FIG. 4D), and insertions in adjacent introns and mutations at two-base insertions were observed. No incidental phenomenon of sequence fragments remaining on the genome was observed. In addition, in the system expressing Cas9 from SeV and introducing RNAs in Experiment 1-2, in 24 HAT-resistant clones (lower third row in FIG. 4D), the target sequence site was restored, and insertion into adjacent introns was prevented. No incidental phenomenon of the 2-base insertion mutant sequence fragment remaining on the genome was observed.
In the Cas9 sgRNA co-expression system from plasmid, even if the reading frame is restored, 1) insertion in the adjacent intron; 2) the danger associated with the persistence of the double-base insertion mutant sequence fragment remaining somewhere on the genome Therefore, it is considered that such risk is lower in the Cas9 expression from SeV and the RNAs introduction system.

[Example 7] Gene disruption test using SeV-Cas9 for HT-1080 cells In order to perform a gene disruption test using SeV-Cas9, a SexAI site in exon 2 of the HPRT gene of Fibrosarcoma-derived HT-1080 cells ( 5'-CCAGGT-3 ') 5'-CCA-3' is set as a target sequence with Protospacer Adjacent Motif (PAM), and two types of RNA to be lipofected, 1) crRNA 5'-AAUAAAUCAAGGUCAUAACC-3 ' (crHPRT1R (GT78)) (SEQ ID NO: 39), 2) tracrRNA (Fasmac catalog number GE002) was prepared.

The gene disruption test was performed as follows. On the day before the infection with SeV-Cas9, 5x10 ⁵ HT-1080 cells / 2-mL DMEM medium / well was applied to a 6-well plate and adherent culture was performed. After approximately 24 hours, the medium was removed and 2 mL Opti-MEM was added. While keeping at 37 ° C., the number of cells in one well was measured by counting the number of cells to be infected, and the Send9 virus vector SeV (PM) CAS9TS15 / ΔF with Cas9 corresponding to a multiplicity of infection of 3 (Example 4) ) Was collected, adjusted to 0.5 mL SeV-Cas9 solution / well by diluting with Opti-MEM, removing the previously added Opti-MEM, adding 0.5 mL SeV-Cas9 solution / well, and adding Adsorption infection was started under 5% CO ₂ conditions, mixing operation was performed every 15 minutes, and after 2 hours, SeV-Cas9 solution was removed, 2 mL Opti-MEM / well was added, and 2-mL DMEM medium / well was added. And the cells were cultured under the conditions of 32 ° C. and 5% CO ₂ . After about 24 hours, the medium was replaced with a new DMEM medium, transferred to 35 ° C. and 5% CO ₂ , and cultured for about 24 hours.

1 hour before seeding the lipofection solution, the medium was removed from the SeV-infected cell culture plate, and Opti-MEM was added at 2 mL / well. X-tremeGene | HP | DNA | Transfection | Reagent | Version | 08 (Roche | catalog number 06 | 366 | 236 | 001) was used to introduce crRNA | GT79 and tracrRNA | (Fasmac catalog number GE002) by the lipofection method. Mix 0.15 μg of crHPRT1R (GT78), 0.27 μg of tracrRNA, adjust to 1 μg RNA / 100 μL with Opti-MEM, add 1 μL of X-tremeGene HP DNA Transfection Reagent per 1 μg RNA, and add 25 ° C-15 ° C. A DNA / RNA / liposome complex was formed in a minute, and the volume was adjusted to a total volume of 0.5 μmL / well with Opti-MEM. This RNA amount of 0.42 μg / 0.5 μmL / well is expressed as 1 × RNAs. As a control, a lipofection solution was prepared using 5 μg / 0.5 μmL / well of plasmid pCas9-sgHPRT1 (Example 2) instead of SeV-Cas9 / tracrRNA / crRNA. In this test, no donor plasmid was introduced.

This lipofection solution was added to a 6-well plate at 0.5 mL / well and incubated at 37 ° C., 5% CO ₂ -17 hours. To apply lipofection cells, replace the lipofection solution in each well with 2 mL PBS / well, remove, add 0.25% trypsin / 1 mM EDTA solution at 0.5 mL / well, incubate at 37 ° C for 1 minute, and add 0.5 mL Add DMEM medium / well and detach / suspend cells by pipetting 3 to 4 times (P1000 pipette), collect in one 50-mL tube, measure cell number, centrifuge at 1,200 rpm for 3 minutes, and supernatant The cells were suspended in a DMEM medium at ⁴ × 10 ⁴ cells / mL, applied to a 10 mL / diameter 10-cm dish, and non-selective culture was started at 37 ° C. under 5% CO ₂ (Day 0). On Day 5, the medium was replaced with DMEM medium (containing 6-thioguanine) and selective culture was started. The medium was replaced every 2 or 3 days, and the number of 6-thioguanine-resistant colonies on Day 14 and after was represented on two dishes. It was measured.

[Example 8] Gene disruption of HT-1080 cells using SeV-Cas9 Using a purified sample of SeV-Cas9, the gene disruption test of Example 7 was performed twice as experiments 3-1 and 3-2. . In Experiment 3-1, the frequency of 6-thioguanine-resistant (6TG ^R ) clones in living cells was 1.8 e-3 under the plasmid pCas9-sgHPRT1 transfection condition, compared to the SeV-Cas9 infection / crHPRT1R (GT78) / tracrRNA transfection condition. in a 3.5e-3 ~ 5.3e-3 (Fig. 6 experiment 3-1), in experiment 3-2, the 6TG ^R clone frequencies in living cells, to 1.6e-3 with plasmid pCas9-sgHPRT1 delivery conditions In the condition of SeV-Cas9 infection / crHPRT1R (GT78) / tracrRNA introduction, the ratio was 3.6e-3 to 5.3e-3 (Experiment 3-2 in FIG. 6). A threefold increase in frequency was observed. In terms of gene disruption frequency, the SeV-Cas9 infection / crHPRT1R (GT78) / tracrRNA transfection system was significantly higher than the plasmid pCas9-sgHPRT1 transfection system, so the former was considered to have a higher frequency of cleavage per cell than the latter. Can be

Example 9 Additional Production of Evaluation Cells for Gene Reversion Test Additional production of evaluation cells for gene reversion using SeV-Cas9 was performed as follows. In order to obtain a new mutation of HT-1080 as an additional evaluation cell in a gene reversion test, a gene disruption experiment using SeV-Cas9 was performed again as in Example 8. Mix 0.15 μg of crHPRT1R (GT78) and 0.27 μg of tracrRNA, adjust to 1 μg RNA / 100 μL with Opti-MEM, add 1 μL of X-tremeGene HP DNA Transfection Reagent per 1 μg RNA, and add A DNA / RNA / liposome complex was formed within a minute, and the volume was adjusted to 0.5 mL (1 well) with Opti-MEM. This RNA amount of 0.42 μg / well is expressed as 1 × RNAs. Purification Sample SeV-Cas9 is previously infected, in HT1080 cells 1 well worth, was lipofection 8XRNAs, 6-thioguanine resistant (6TG ^R) clones frequency of viable cells, SeV-Cas9 infection / 8x crHPRT1R ( Under GT7) / 8x tracrRNA introduction conditions, it was 7.0e-3. From the frequency, it is expected that gene-disrupted clones will be present in 137 non-selective colonies generated on the two dishes applied for viable cell counting. When 6 thioguanine was introduced and culture was continued at 18, most of the colonies were detached on Day 25, but only two colonies continued to grow. These 6-thioguanine-resistant colonies were stored as TG438 and TG439, and sequence analysis was performed. No mutation was found in the target sequence for TG438, but for TG439, as shown in the upper row of Table 7-2B. In addition, a frame shift occurred due to insertion of a two-base TG at the same position as HPRT ^TG98 (Fig. 4-3D: Insertion of TA) (Fig. 7-2B: Insertion of TG), and this mutation was ^designated as HPRT ^TG439 . The TG439 cells were isolated by a limiting dilution method (16 cells / well (96-well plate)) to obtain TG439-1 cells. It was used as the second evaluation cell in the gene reversion test.

[Example 10] Preparation of plasmid pCas9-sgRNA for second evaluation cell TG439-1 in gene reversion test Two-base insertion mutation (HPRT ^TG439 ) in exon 2 of HPRT gene mutant TG439-1 cell line of HT-1080 cell In order to prepare a plasmid that can be cleaved in the vicinity of the target, set a target sequence with PAM 5'-CCA-3 'of the SexAI site (5'-ACCAGGT-3'), CAG-hspCas9-H1-gRNA 5'-TGTATGAGACCAC TAAATCAAGGTCATACAACC -3 '(GT204) containing the target sequence (underlined) immediately after the H1 promoter using linearized SmartNuclease vector DNA (System Biosciences Catalog No. CAS920A-1) and 5'- A double-stranded oligonucleotide consisting of AAAC GGTTGTATGACCTTGATTTA GTGGTCTCA-3 ′ (GT205) (SEQ ID NO: 41) was ligated to obtain a plasmid pCas9-sgHPRT1m3, which was used as a control in a gene reversion experiment. The CA at the 5-4th position from the 3 ′ end of GT204 and the TG at the 8-9th position from the 5 ′ end of GT205 indicate the positions of the 2-base insertion mutation.

[Example 11] Gene reversion test using SeV-Cas9 for TG439-1 cells SeV-Cas9 was used for a two-base insertion mutation (HPRT ^TG439 ) of HPRT gene exon 2 of TG439-1 cells (Example 9). In order to perform a gene reversion test, the donor plasmid pBS-HPRTEx2SMAI (P1-6) (Example 1), two types of RNA that are lipofected simultaneously with DNA, 1) crRNA 5'-UAAAUCAAGGUCAUA CA ACC- which functions as a targeting RNA 3 ′ (crHPRT1m3R (GT206)) (SEQ ID NO: 42), 2) A tracrRNA (Fasmac catalog number GE002) serving as a scaffold RNA for Cas9 enzyme was prepared. CA in crRNA (5-4th from the 3 'end of GT206 (underlined)) indicates a sequence corresponding to a two-base insertion mutation.

The gene reversion test (FIG. 2) was performed as follows. On the day before the infection with SeV-Cas9, 5 × 10 ⁵ TG439-1 cells / 2-mL DMEM medium (containing 6-thioguanine) / well was applied to a 6-well plate and adherent culture was performed. After approximately 24 hours, the medium was removed. While adding 2 mL Opti-MEM and keeping at 37 ° C., the number of cells in one well was measured to calculate the total number of cells to be infected, and the Send9 virus vector SeV (PM) CAS9TS15 with Cas9 corresponding to a multiplicity of infection of 3 was calculated. / ΔF (Example 4) was collected, adjusted to 0.5 mL SeV-Cas9 solution / well by diluting with Opti-MEM, and the previously added Opti-MEM was removed, and 0.5 mL SeV-Cas9 solution / well was removed. To start adsorption infection at 32 ° C. and 5% CO ₂ , and perform a mixing operation every 15 minutes. After 2 hours, remove the SeV-Cas9 solution and add 2 mL Opti-MEM / well. The cells were replaced with -mL DMEM medium (containing 6-thioguanine) / well, and cultured at 32 ° C under 5% CO ₂ conditions. After about 24 hours, the medium was replaced with a new DMEM medium, transferred to 35 ° C. and 5% CO ₂ , and cultured for about 24 hours.

1 hour before seeding the lipofection solution, the medium was removed from the SeV-infected cell culture plate, and Opti-MEM was added at 2 mL / well. X-tremeGene | HP | DNA | Transfection | Reagent | Version | 08 (Roche | catalog number 06 | 366 | 236 | 001) was used to introduce crHPRT1m3 (GT206), tracrRNA | (Fasmac catalog number GE002) and donor plasmid DNA by the lipofection method. 0.15 μg HP crHPRT1m3R (GT206), 0.27 μg tra tracrRNA, 2.5 μg p pBS-HPRTEx2SMAI (P1-6) Donor plasmid mixed, adjusted to 1 μg RNA DNA / 100 μL with Opti-

MEM

1, 1 μg RNA DNA Then, 1 μL of X-tremeGene / HP / DNA / Transfection / Reagent was added thereto to form a DNA / RNA / liposome complex at 25 ° C. for 15 minutes, and the volume was increased to 0.5 μmL (1 μwell) with Opti-MEM. This RNA concentration of 0.42 μg / 0.5 mL / well is expressed as 1 × RNAs. As a control, a lipofection solution was prepared using 5 μg /0.5 mL / well of plasmid pCas9-sgHPRT1m3 (Example 10) instead of SeV-Cas9 / crHPRT1m3R (GT206) / tracrRNA.

This lipofection solution was added to a 6-well plate at 0.5 mL / well and incubated at 37 ° C., 5% CO ₂ -17 hours. To apply lipofection cells, replace the lipofection solution in each well with 2 mL PBS / well, remove, add 0.25% trypsin / 1 mM EDTA solution at 0.5 mL / well, incubate at 37 ° C for 1 minute, and add 0.5 mL Add DMEM medium / well and detach / suspend cells by pipetting 3 to 4 times (P1000 pipette), collect in one 50-mL tube, measure cell number, centrifuge at 1,200 rpm for 3 minutes, and supernatant Removed, suspended at 4x10 ⁴ cells / mL in DMEM medium (no 6-thioguanine, no HAT supplement), applied to 10 mL / diameter 10-cm dish, non-selective culture at 37 ° C, 5% CO ₂ Started (Day 0). On Day 5, change to DMEM medium (including HAT) supplemented with 1/50 volume of HAT Supplement (50x), Liquid (ThermoFisher catalog # 21060017) and start selective cultivation. Replace with the same medium every 2 or 3 days. On the other hand, the number of HAT resistant colonies was measured around Day 18 on two dishes.
[Example 12] Gene reversion to TG439-1 cells using SeV-Cas9 Using the purified sample of SeV-Cas9, the gene reversion test of Example 11 was performed as Experiments 4-1 to 4-2 and 4-3. Performed three times. In Experiment 4-1, the frequency of HAT resistant clones in living cells was 5.2e-5 under the conditions of plasmid pCas9-sgHPRT1m3 introduction, and 9.2e-4 under the conditions of SeV-Cas9 infection / crRNA GT206 / tracrRNA introduction, Under the conditions of the present invention, an 18-fold increase in frequency was observed compared to general plasmid conditions (FIG. 7-1, Experiment 4-1). In Experiment 4-2, the frequency of HAT resistant clones in living cells was 2.6e-5 under the plasmid pCas9-sgHPRT1m3 transfection condition, and 5.2e-4 under the SeV-Cas9 infection / crHPRT1m3R (GT206) / tracrRNA transfection condition. In fact, under the conditions of the present invention, the frequency was increased by 20 times as compared with the general plasmid conditions (FIG. 7-1, Experiment 4-2). In Experiment 4-3, the frequency of HAT-resistant clones in living cells increased from 7.4e-5 under the conditions of plasmid pCas9-sgHPRT1m3 introduction, and from 9.2e-4 under the conditions of SeV-Cas9 infection / crHPRT1m3R (GT206) / tracrRNA introduction. 1.5e-3, which was 13-20 times higher than that of general plasmid conditions under the conditions of the present invention (FIG. 7-1, Experiment 4-3). Regarding the gene reversion frequency, it can be said that it was confirmed that the TG439-1 cells, as well as the TG98 cells, were significantly higher than the plasmid pCas9-sgHPRT1m3 in the purified SeV-Cas9 sample.

In Experiments 4-1 and 4-2, a reverted HAT clone was isolated and subjected to structural analysis by the procedure shown in Example 5.
In the Cas9 sgRNA co-expression system from plasmids in Experiments 4-1 and 4-2, 525 bp was mainly obtained from PCR using primers GT19 / GT22, which amplify the exon 2 region, in 5 and 3 HAT-resistant clones, respectively. When considerable PCR products were obtained and subjected to sequence analysis, the target sequence site was restored in all of the five or three HAT-resistant clones. In addition, 1) insertion of an unintended sequence in the adjacent intron; 2) no residual double-base insertion mutant sequence DNA was observed.

In the expression of Cas9 from SeV and the RNAs transfection system in Experiments 4-1 and 4-2, in each of 12 HAT-resistant clones, a PCR product equivalent to 525 bp was obtained from PCR using primers GT19 / GT22 for amplifying the exon 2 region. And sequence analysis revealed that the target sequence site was restored in all 12 and 12 HAT resistant clones. In addition, no accompanying phenomena such as insertion in the adjacent intron and residual DNA having a two-base insertion mutant sequence were not observed.
From the results of the gene reversion test for TG439-1 cells, it was found that the expression of Cas9 from SeV and the frequency of gene reversion by the RNAs transfection system were remarkably higher than those of the Cas9 sgRNA co-expression system from plasmid. On the other hand, unintended sequence abnormalities associated with gene reversion were not observed in the Cas9 sgRNA co-expression system from the plasmid, as in the Cas9 expression system from SeV and the RNAs transfection system.
As a result of the gene reversion test for TG98 cells, unintended sequence abnormalities occurred with the gene reversion in the Cas9 sgRNA co-expression system from the plasmid. The main cause was considered to be cleavage of non-target similar sequences (donor DNA or modified sequences).
However, it is difficult to consider low-frequency gene reversion in the Cas9 sgRNA co-expression system from plasmids in TG439-1 cells as the main cause of the possibility of cleavage of off-target similar sequences (donor DNA or modified sequences).
A possible explanation for the gene reversion test system for TG98 cells and TG439-1 cells is that Cas9 expression from SeV, in the RNAs introduction system, it becomes possible to cleave when a donor plasmid is introduced together with RNAs, whereas In the Cas9 sgRNA co-expression system, the donor plasmid is introduced together with the present plasmid. However, it may be because a sufficient amount of time is required for Cas9 sgRNA to be sufficiently expressed, and a sufficient amount of the donor plasmid does not remain at that time. (The problem of the time difference between the existence of the Cas9 sgRNA complex and the donor can be improved by selecting a cell that carries the Cas9 sgRNA-containing plasmid or a DNA virus vector system carrying the Cas9 sgRNA. There is a problem that the DNA vector carrying Cas9 sgRNA is inserted into the genome.)
In the Cas9 expression and RNAs transfection system from SeV, when a Cas9-RNAs complex is formed, the donor is present there and the reaction to gene reversion starts. At that time, the genome insertion of the viral vector does not occur because of the cytoplasmic RNA vector. Therefore, Cas9 expression from SeV, in the RNAs transfection system, compared with the Cas9 sgRNA co-expression system from the DNA type vector, the existence time between the Cas9-RNAs complex and the donor is well matched, its features However, it is considered that this results in a higher frequency of gene reversion.

In Experiments 2-1 and 2-2 (TG98 gene reversion test), the amount of RNA was varied in the range of 2 to 8 × RNAs, but no dose-response relationship was observed (FIG. 5). Also, in Experiment 4-2 (TG439-1 gene reversion test), no dose-response relationship was observed from the comparison between 4xRNAs and 8xRNAs (FIG. 7-1). However, in Experiment 4-3 (TG439-1 gene reversion test), a dose-response relationship was observed from a comparison between 1xRNAs and 4xRNAs (FIG. 7-1). Further, in Experiments 3-1 and 3-2 (HT-1080 gene disruption test), a dose-response relationship was observed in the range of 4 to 8 × RNAs (FIG. 6). These results indicate that there is a dose-response relationship between the amount of introduced RNAs and the frequency of gene modification in the 1-4xRNAs dose region.
There is a problem that the frequency of gene modification by CRISPR / Cas9 is variable and difficult to predict for each target sequence, and one of the causes is considered to be that the cleavage efficiency differs between target sequences. To increase the frequency of genetic modification by increasing the amount of introduced RNA for targets with low cleavage efficiency, and to reduce the amount of introduced RNA for targets with high cleavage efficiency to attenuate the destruction of donor DNA that retains similar designed sequences Is considered possible. That is, it can be said that one of the features of the present method is that the frequency of gene modification can be adjusted by adjusting the amount of introduced RNA.

While the preferred embodiments of the invention have been described in detail, it will be obvious to those skilled in the art that these embodiments may be varied. Thus, it is intended that the present invention be practiced in other ways and embodiments than those specifically set forth herein, which are also included in the present invention. That is, the present invention includes all modifications that fall within the scope of the spirit of the appended claims or the essential part thereof.

According to the present invention, it has become possible to regulate the frequency of gene modification, to suppress the occurrence of unintended sequence abnormality accompanying the gene modification, and to provide a method for modifying a target gene with extremely high efficiency. In the conventional method, in order to perform genetic modification, a two-step selection is performed, in which a cell into which a donor DNA has been inserted is selected using a selectable marker gene and a step in which a cell from which the selectable marker gene has been removed is selected. However, since the present invention can obtain genetically modified cells with extremely high efficiency, it is not always necessary to use a selectable marker gene, and it is possible to obtain target cells by one-stage selection. Is also possible.

Further, in the conventional method for removing the selectable marker gene, it is inevitable that the recognition sequence of the site-specific recombinase remains even after the removal, but it is not necessary to use the selectable marker gene in the method of the present invention. In addition, since there is no need to remove the selectable marker gene, the problem that the recognition sequence of the site-specific recombinase remains can be avoided.

The present invention is also useful for gene disruption (gene targeting). When the gene is disrupted, a phenotype (eg, a disorder) appears at the cell or individual level, from which the original gene function can be inferred. Recently, the use of new gene disruption technology using CRISPR / Cas9 has been expanding from basic research to clinical research. However, while CRISPR / Cas9 technology can destroy target genes with high efficiency, it often involves disruption of non-target genes, and it is not possible to immediately identify whether the manifested disorder is due to target gene disruption or non-target gene disruption. Can not. In the past, there is a risk that a mutant strain created by chemical mutagen treatment may cause a misinterpretation of gene function as seen in the stage of their functional analysis. To avoid the misinterpretation by CRISPR / Cas9 technology and to identify the correct causative gene of the impaired function, it requires undue effort and time, including complementation tests.

However, in the method of the present invention, since the frequency of gene modification can be regulated and the occurrence of unintended sequence abnormalities due to the gene modification can be suppressed, cells in which only the target site is destroyed can be more efficiently used. It can be expected that the experimental efficiency will be improved.

In addition, most enzymes consist of multiple domains, but gene disruption techniques are inadequate to elucidate the function of the domains, and instead, the base sequence of a specific exon corresponding to the amino acid sequence in the domain is refined. Must be modified. Conventionally, in the CRISPR / Cas9 technology, gene-disrupted cells are several tens times higher than gene-modified cells, so that selection of the former requires the application of a selectable marker gene. In order to select without a selection marker, it is necessary to apply an expensive device (droplet \ digital \ PCR) that can simplify sib-screening.

However, as described above, the method of the present invention can obtain genetically modified cells with extremely high efficiency, so that genetic modification can be performed more easily. Therefore, labor and time for specifying the causative gene of the dysfunction can be reduced. In addition, it can be said that the conversion of a specific sequence for domain analysis was made possible due to the improvement of the cutting efficiency. As described above, the present invention provides an extremely useful technique in basic and applied research such as investigation of the cause of a genetic disease, and in genetic modification in all situations including clinical application such as gene therapy.

Claims

A method for producing a genetically modified cell using a guide RNA-dependent DNA nuclease,
(A) a temperature-sensitive minus-strand RNA virus vector that carries the nuclease gene and does not encode at least one guide RNA required for the activity of the nuclease is introduced into cells, and the vector is expressed at a permissive temperature; Accumulating the nuclease in cells in the absence of the guide RNA,
(B) supplying the missing guide RNA to the cells after step (a);
(C) raising the culture temperature to a non-permissible temperature before or after or simultaneously with step (b), and culturing in a state where the guide RNA is present in the cells.
The method according to claim 1, further comprising: (d) recovering a cell in which the gene has been modified.
方法 The method according to claim 1 or 2, wherein the guide RNA is introduced into the cells in step (b).
(4) The method according to any one of (1) to (3), wherein the culture temperature has been raised to a non-permissible temperature at the time of carrying out step (b) or at the latest at least 24 hours after that.
方法 The method according to any one of claims 1 to 4, wherein the nuclease is a CRISPR / Cas class 2 endonuclease.
(6) The method according to any one of (1) to (5), wherein the minus-strand RNA virus vector does not encode a guide RNA.
(7) The method according to any one of (1) to (6), wherein the donor DNA is also introduced into the cells in the step (b).
(8) The method according to (7), wherein the donor DNA does not contain a positive selection marker gene.
9. The method according to claim 7 or 8, further comprising, after step (c), selecting a cell into which the sequence in the donor DNA has been integrated.
(10) The method according to (9), wherein the selection step is a step of examining cells without relying on a positive selection marker and selecting cells into which the sequence in the donor DNA has been integrated.
A vector for use in the method according to any one of claims 1 to 10, which carries a guide RNA-dependent DNA nuclease gene and does not encode at least one guide RNA required for the activity of the nuclease. Minus strand RNA virus vector.
The vector according to claim 11, which is a temperature-sensitive Sendai virus vector.
The vector according to claim 12, which is a F gene deleted temperature-sensitive Sendai virus vector.
Sendai virus vector deleted the F gene, G protein mutations G69E, T116A, and A183S, HN protein mutations A262T, G264R, and K461G, P protein mutation L511F, and L protein N1197S and K1795E The Sendai virus vector according to claim 12 or 13, which comprises a mutation of
The Sendai virus vector according to claim 14, further comprising the following mutations (i) and / or (ii) in the genome.
(I) Mutation of D433A, R434A, and K437A of P protein (ii) Mutation of Y942H, L1361C and / or L1558I of L protein
ベクター The vector according to any one of claims 11 to 15, wherein the nuclease is a CRISPR / Cas class 2 endonuclease.