WO2020016814A1

WO2020016814A1 - Nucleic acid-based detection of carbapenemase-producing bacteria

Info

Publication number: WO2020016814A1
Application number: PCT/IB2019/056130
Authority: WO
Inventors: Ann Huletsky; Dominique Boudreau; Marilyse VALLÉE
Original assignee: UNIVERSITé LAVAL
Priority date: 2018-07-20
Filing date: 2019-07-17
Publication date: 2020-01-23

Abstract

The invention relates to the field of bacterial resistance, and more particularly to detection of bacteria that are resistant to carbapenem antibiotics. Described herein are detection methods, primers, probes and kits for the simultaneous detection of a plurality of carbapenemase-resistant organisms, including a plurality of Klebsiella Pneumoniae Carbapenemase (KPC) variants and a plurality of New Delhi Metallo-beta-lactamase (NDM) variants.

Description

NUCLEIC ACID-BASED DETECTION OF CARBAPENEMASE-PRODUCING BACTERIA

FIELD OF THE INVENTION

[0001] The invention relates to the field of bacterial resistance, and more particularly to detection of bacteria that are resistant to carbapenem antibiotics.

BACKGROUND OF THE INVENTION

[0002] b-lactams including penicillins, cephalosporins, monobactams and carpabenems are the principal therapeutic choices for the treatment of gram-negative bacteria infections. Carbapenems have proved particularly useful as they have a broad spectrum and have a structure that renders them generally effective against most beta-lactamases producing bacteria which may be resistant to other beta-lactam antibiotics. Therefore, carbapenems are the last line of defence against multi-resistant bacterial infections, particularly multi-resistant gram negative bacteria. However, carbapenemase-producing organisms (CPO), including carbapenemase-producing Enterobacteriaceae (CPE) and non-fermenters (e.g. Pseudomonas aeruginosa and Acinetobacter baumannii) have been increasingly reported worldwide (Bonomo RA et al., Clinical Infectious Diseases (2018) 66:1290-1297). The emergence of CPO has become concern as there are few therapeutic options for treating infections caused by carbapenem-resistant bacteria. Actually, bacterial resistance to antibacterial drugs has been increasing relentlessly over the past two decades. In September 2017, the World Health Organization has declared that antibiotic resistance is one of the biggest threats to global health, food security, and development today.

[0003] Rapid detection of carbapenemase-producing organisms has thus become imperative. For instance, CPO pose a serious health risk when people become infected with them, because infections may be very difficult to treat. A particular problem is also that such bacteria are easily transmitted from human to human, from human to animal and from animal to human. In addition, CPO can transfer their carbapenem resistance to other bacteria in many ways, implicating that a person carrying a CPO may easily transmit the resistant bacteria to others with which he/she is in close contact. This is a major problem in hospital wards, making rapid and accurate detection of CPO very important, both for patient treatment as well as hospital hygiene.

[0004] To limit the spread of CPO, many countries have implemented strict infection control measures for infected and colonized patients. However, implementation of these control measures is costly. More over the infection control measures are not entirely effective as CPO- positive patients may sometimes be wrongly considered CPO-negative and thus propagate the harmful resistant bacteria.

[0005] The most clinically relevant carbapenemases encountered in CPO belong to Ambler class A (KPC type), Ambler class B or metallo- -lactamases (MBLs) such as IMP, VIM and NDM types, or Ambler class D (OXA-48-like). In the United States and Europe, a mixture of KPC, NDM, VIM and OXA-48-like carbapenemases dominates, while IMP-producing organisms are more prevalent in the Far East (Bonomo RA et al., Clinical Infectious Diseases (2018) 66:1290-1297).

[0006] The KPC carbapenemase name is the acronym of "Klebsiella Pneumoniae Carbapenemase". To date, the blaKPC gene currently comprises 41 variants of protein sequences, known as KPC-2 to KPC-44 (Bacterial Antimicrobial Resistance Reference Gene Database, NCBI, BioProject 313047, last reviewed on July 1 1 2019). KPC-1 was remove from the database after a sequencing error was reported (Higit H et al., Antimicrobial Agents and Chemotherapy (2001 ) 45:1 151 -1 161 ). The NDM carbapenemase name is the acronym of "New Delhi Metallo-beta-lactamase". To date, the blaNDM gene currently comprises 26 variants of protein sequences, known as NDM-1 to NDM-28 (Bacterial Antimicrobial Resistance Reference Gene Database, NCBI, BioProject 313047, last reviewed on July 1 1 2019). As used herein, the term“variant" (e.g. NDM-1 , NDM-2, NDM-3) refers to an enzyme which differs by one or more amino acids from the first protein sequence described and characterized for each carbapenemase (Widmann M et al., 2012, Antimicrobial Agents & Chemotherapy 56:3481 - 3491 ). These variants differ by one or more amino acid mutation, which could be a substitution, a deletion, or an insertion.

[0007] During the recent years, several diagnostic tests have been developed for identification of CPO. These include (i) tests for carbapenemase inhibition activity; (ii) the carbapenem inactivation method; (iii) detection of carbapenem hydrolysis by matrix-assisted laser desorption ionization-time of flight mass spectrometry, by biochemical tests or by an electrochemical method; (iv) immunochromatographic assays aiming to detect OXA-48-like CPO, IMP-like CPO and OXA-48/KPC CPO; and (v) diverse molecular tools able to detect the most prevalent carbapenemase-encoding genes (Dortet L and Nass T, Journal of Clinical Microbiology (2017) 55:654-655). [0008] Various nucleic acid-based assays and screening methods known in the art enable fast screening and provide a method for testing on presence or absence of pathogenic bacteria. For instance, primers and probes have previously been described for KPC genes in U.S. patent No. 7,968,292 and 9,593,381 , in International PCT publications WO 2016/174642 and WO 2016/094607. Methods and kits for detecting drug resistant microorganisms have been also described in patent publications WO 2017/160779 and US 2013/0065790.

[0009] Therefore, it is clear that, in view of the increasing threat and global prevalence of carbapenem-resistant bacteria, new strategies are required for more effective prevention, treatment, and diagnosis of carbapenem-resistant bacteria infection.

[00010] There is particularly a clinical need for the rapid detection of the carriers of carbapenem-resistant organisms containing NDM, KPC, IMP, VIM and OXA-48-like genes.

[00011] There is also a need to rapidly identify patients carrying or suspected of carrying CPOs so that appropriate infection control measures and therapeutic regimens are selected for a given patient and the likelihood of the spread of resistant bacteria is reduced.

[00012] Yet, there is an imperative need for the rapid detection of carbapenem-resistant organisms, particularly for screening methods and tools enabling the rapid and efficient detection of carbapenemase-producing bacteria. Early detection of infection typically allows for a more effective therapeutic treatment with a correspondingly more favourable clinical outcome, as well as improves hospital hygiene and reduces nosocomial infection.

[00013] Moreover, many CPO have various carbapenemase gene variants, and such gene variants may provide very different characteristics to CPO. Accordingly there is also a need for methods and tools that accurately, rapidly, and simultaneously detect a plurality of different carbapenemase enzyme genes at a single point in time.

[00014] The present invention addresses these needs and other needs as it will be apparent from review of the disclosure and description of the features of the invention hereinafter.

BRIEF SUMMARY OF THE INVENTION

[00015] According to another aspect, the invention relates to a method for detecting simultaneously a presence or an absence of a plurality of bla_KPC gene variants in a sample, comprising: a) providing a sample susceptible to comprise carbapenemase-producing bacteria;

b) providing a set of forward and reverse primers hybridizing specifically to multiple variants of bla_{K PC} gene;

c) carrying out an amplification reaction; and

d) detecting presence or absence of amplified nucleic acids;

wherein presence or absence of amplified nucleic acids for a given bla_KPC gene variant is indicative of the presence or absence of said bla_KPC gene variant in the sample, and

wherein a set of primers consisting of only one forward primer and only one reverse primer said set of primers provides for selective amplification of nucleic acids from at least 5, 10, 15, 20, 25, 30, 35, 37, 39, 40, 41 or more different bla_KPC gene variants.

[00016] According to another aspect, the invention relates to a nucleic acid-based method for detection of a plurality of bla_KPC gene variants, comprising:

a) providing a sample susceptible to comprise carbapenemase-producing bacteria; b) amplifying nucleic acids from carbapenemase-producing bacteria with a set of forward and reverse primers hybridizing specifically to multiple variants of bla_KPC gene;

c) detecting amplified nucleic acids;

wherein said set of primers provides for selective amplification of nucleic acids from at least 5, 10, 15, 20, 25, 30, 35, 37, 39, 40, 41 or more different bla_KPC gene variants with only one forward primer and only one reverse primer.

[00017] According to another aspect, the invention relates to a method for detecting simultaneously a presence or an absence of a plurality of b/a_NDM gene variants in a sample, comprising:

a) providing a sample susceptible to comprise carbapenemase-producing bacteria; b) providing a set of forward and reverse primers hybridizing specifically to multiple variants of bla_NDM gene;

c) carrying out an amplification reaction; and

d) detecting presence or absence of amplified nucleic acids;

wherein presence or absence of amplified nucleic acids for a given b/a_NDM gene variant is indicative of the presence or absence of said b/a_NDM gene variant in the sample, and wherein a set of primers consisting of only one forward primer and only one reverse primer said set of primers provides for selective amplification of nucleic acids from at least 5, 10, 15, 18, 20, 22, 23, 24, 25, 26 or more different b/a_NDM gene variants.

[00018] According to another aspect, the invention relates to a nucleic acid-based method for detection of a plurality of bla_NDM gene variants, comprising :

a) providing a sample susceptible to comprise carbapenemase-producing bacteria; b) amplifying nucleic acids from carbapenemase-producing bacteria with a set of forward and reverse primers hybridizing specifically to multiple variants of b/a_NDM gene;

c) detecting amplified nucleic acids;

wherein said set of primers provides for selective amplification of nucleic acids from at least 5, 10, 15, 18, 20, 22, 23, 24, 25, 26 or more different bla_NDM gene variants with only one forward primer and only one reverse primer.

[00019] According to another aspect, the invention relates to a nucleic acid-based method for simultaneous detection of a plurality of bla_KPC gene variants, and a plurality of b/a_NDM gene variants comprising:

a) providing a sample susceptible to comprise carbapenemase-producing bacteria; b) amplifying nucleic acids from carbapenemase-producing bacteria with: (i) a first set of forward and reverse primers hybridizing specifically to multiple variants of bla_{K PC} gene; (ii) a second set of forward and reverse primers hybridizing specifically to multiple variants of b/a_NDM gene;

c) detecting amplified nucleic acids;

wherein said first and second sets of primers are selected from Table 3.

[00020] According to another aspect, the invention relates to a primer for amplification of nucleic acids molecules, said primer comprising a polynucleotide sequence selected from the group of primers defined in Table 3, or a sequence exactly complementary thereto.

[00021] According to another aspect, the invention relates to a set of primers for amplification of bla_{K PC} variants comprising at least one forward primer and at least one reverse primer selected from Table 3. [00022] According to another aspect, the invention relates to a set of primers for amplification of bla_{N DM} variants comprising at least one forward primer and at least one reverse primer selected from Table 3.

[00023] According to another aspect, the invention relates to a probe for detection of nucleic acids molecules, said probe comprising a polynucleotide sequence selected from the group selected from the group of probes as defined Table 4, or a sequence exactly complementary thereto.

[00024] According to another aspect, the invention relates to the use of a primer as defined herein, or the use of a set of primers as defined herein, or the use a probe as defined herein, for identification of subjects carrying carbapenemase-producing bacteria, and/or for identification of presence or absence of carbapenemase-producing bacteria in environmental samples.

[00025] According to another aspect, the invention relates to a detection kit comprising one or more primer as defined herein and/or one or more probes as defined herein.

[00026] According to another aspect, the invention relates to a kit for detection of carbapenemase-producing bacteria comprising at least one forward primer, at least one reverse primer and at least one probe selected from the group of primers defined in Table 4 and probes defined in Table 5.

[00027] According to another aspect, the invention relates to a kit the detection of KPC carbapenemase genes, comprising at least one forward primer, at least one reverse primer and at least one probe as defined in Table 4 and Table 5.

[00028] According to another aspect, the invention relates to a kit the detection of NDM carbapenemase genes, comprising at least one forward primer, at least one reverse primer and at least one probe as defined in Table 4 and Table 5.

[00029] According to another aspect, the invention relates to a multiplex detection kit for simultaneous detection of at least two different carbapenemase genes comprising:

i) a first set of oligonucleotide molecules for the detection of KPC carbapenemase genes, said first set comprising at least one forward primer, at least one reverse primer and at least one probe as defined in Table 3 and Table 4; and ii) a second set of oligonucleotide molecules for the detection of NDM carbapenemase genes, said second set comprising at least one forward primer, at least one reverse primer and at least one probe as defined in Table 3 and Table 4.

[00030] According to another aspect, the invention relates to the use of any of the probes, primers, kits and methods described herein, for the diagnostic of patients carrying or not carbapenemase-producing bacteria, and/or for identification of presence or absence of carbapenemase-producing bacteria in environmental samples.

[00031] According to another aspect, the invention relates to a method for the treatment of a subject, comprising:

(i) identifying a subject carrying carbapenemase-producing bacteria with any of the probes, primers, kits and methods described herein; and

(ii) providing appropriate treatment to said subject.

[00032] Additional aspects, advantages and features of the present invention will become more apparent upon reading of the following non-restrictive description of preferred embodiments which are exemplary and should not be interpreted as limiting the scope of the invention.

BRIEF DESCRIPTION OF FIGURES

[00033] In order that the invention may be readily understood, embodiments of the invention are illustrated by way of example in the accompanying drawings.

[00034] FIGURE 1 is a sequence of a fragment of the gene bla_KPC from Klebsiella pneumoniae (gene bla_{K PC}-2, accession No. AY034847; SEQ ID NO: 7) showing the regions targeted by the primers and probes for the gene bla_{KP C-2}, according to one embodiment of the invention. The regions targeted by the primers are in bold and the amplified region is in grey. The region targeted by the probe in is double-underlined.

[00035] FIGURE 2 is a sequence of a fragment of the gene bla_NDM from Klebsiella pneumoniae (bla_{N D}M-I , accession No FN396876; SEQ ID NO: 8) showing the regions targeted by the primers and probes for the gene bla_{N D}M-I _> according to one embodiment of the invention. The regions targeted by the primers are in bold and the amplified region is in grey. The region targeted by the probe in is double-underlined. [00036] FIGURES 3A and 3B are graphs showing dynamic range and PCR efficiency of multiplex assay /?/S_KPC/NDM with Bio-Rad CFX96™ thermal cycler with gDNA from K. pneumoniae CCRI-2171 1 (bla_NDM) (FIG. 3A), gDNA from K. pneumoniae CCRI-19587 (bla_{K PC}) (FIG. 3B).

DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS

[00037] In the following description of the embodiments, references to the accompanying drawings are by way of illustration of an example by which the invention may be practiced. It will be understood that other embodiments may be made without departing from the scope of the invention disclosed.

A) General overview

[00038] The invention aims to provide methods and molecular tools (e.g. primers, probes, kits) for the rapid detection of bacteria that may be resistant to carbapenem antibiotics. The invention may find numerous applications for detecting the presence and/or absence of resistant bacteria in various biological samples. In embodiments, the invention relates to the rapid detection of carbapenem-resistant bacteria containing KPC and NDM genes.

[00039] In embodiments the bacteria may be present in a biological sample from a subject. As used herein the term“subject” includes animals such as mammals. Preferably, the subject is a mammal, including, but not limited to, species such as a human, a dog, a cat, a horse, a bovine, a rabbit, a rat, a mouse, and wild animals living in zoos (e.g. lion, tiger, elephant, panda, bear, etc.). More preferably, the subject is human subject, even more preferably a human patient suspected of carrying or infected with carbapenemase-producing bacteria.

[00040] In embodiments, the invention aims to detect carbapenemase-producing bacteria from human pathogens. Exemplary list of bacterial species pathogenic for human can be found in Taylor et al. 2001 and Woo et al. 2008 (Taylor LH et al., Philosophical Transactions of the Royal Society B: Biological Sciences (2001 ) 356:983-989; Woo PC et al., Clinical Microbiology & Infection (2008) 14:908-934).

[00041] As used herein, the term“biological sample” includes direct clinical sample (e.g. a biological specimen obtained from bodily fluids such as blood or urine, or throat swabs, nasal swabs, rectal swabs, dermal swabs, sputum, feces, bronchial aspirates, etc.), as well as processed specimens such as clinical isolates obtained following bacterial culture, and purified nucleic acids. The term“biological sample” also encompasses pure cultures of bacteria from various environments as well as various environmental samples that may originate from the environment including, but not limited to, hospitals (e.g. swabs of laboratory working surfaces, swabs of medical instruments, swabs of a patient room, etc.), public spaces (e.g. swabs of object from school, shopping malls, etc.), nature (e.g. water, air, soil, etc.), and the like.

[00042] In embodiments, the invention aims to detect simultaneously a plurality of bla_KPC gene variants and a plurality of bla_NDM gene variants that may be present in a biological sample (e.g. a clinical or environmental specimen).

[00043] The present invention is directed to amplification and/or detection of bacterial genomic DNA. As used herein, the term“bacterial genomic DNA” encompasses the different types of DNA that may be present in a bacterial cell, including plasmidic DNA and chromosomal DNA.

[00044] In preferred embodiments, the methods described herein are“sensitive”, i.e. they allow the detection of a low number of copies of bacterial genomic DNA.

[00045] In embodiments, the methods described herein are sufficiently“sensitive” to allow the detection of a reduced number of copies of bacterial genomic DNA. In embodiments, the detection methods described herein provide for detection, during the amplification/detection steps, of as low as less than 100 copies, or as low as less than 50 copies, or as low as less than 25 copies, or as low as less than 10 copies, or as low as less than 5 copies, or as low as only one copy of bacterial genomic DNA. Preferably, the methods, primers and probes of the invention provides for suitable analytical sensitivity. As used herein, the terms "Analytical Sensitivity" or "Sensitivity" or "Sensitive" encompass two concepts, the "limit of detection (LOD)" and the "Analytical Reactivity" or "Inclusivity". The LOD refers to the minimum concentration of nucleic acid or number of cells, which always gives a positive PCR result in all replicates tested, or in the major part (over 95%) of them. The analytical reactivity represents the ability to detect all or most targeted micro-organisms (FDA, Class II Special Controls Guideline: Multiplex Nucleic Acid Assay for Identification of Microorganisms and Resistance Markers from Positive Blood Cultures, 2015).

[00046] In preferred embodiments, the methods described herein are“selective”, i.e. these methods only allow the detection of a desired target molecule (e.g. a target nucleic acid or target sequence of genomic DNA from a resistant bacteria). Accordingly, the preferred selectivity of the invention allow to discriminate for amplification and/or detection of genomic DNA from a predetermined bacteria (e.g. bla_K PC and b/a_NDM genes) while avoiding amplification and/or detection of non-resistant bacteria. Preferably, the methods, primers and probes of the invention provides for suitable analytical specificity and/or reduced cross-reactivity. As used herein, the terms“Analytical specificity” or "Cross-reactivity" refers to the ability of an assay to amplify and/or detect a target(s) in one particular organism, rather than others, in a sample (see FDA, Class II Special Controls Guideline: Multiplex Nucleic Acid Assay for Identification of Microorganisms and Resistance Markers from Positive Blood Cultures, 2015).

B) Primers and Probes

[00047] The present inventors have designed a series of primers and probes that may be used in amplification and detection of carbapenemase-producing bacteria.

[00048] Particularly, the primers and probes of the present invention are directed to genes from carbapenemase-producing organisms (CPO), including the genes KPC, NDM, and genetic variants thereof.

[00049] As used herein, the term“amplifying” or“amplification” refers to the process of synthesizing nucleic acid molecules that are complementary to one or both strands of a template nucleic acid molecule (e.g., KPC, NDM). Amplifying a nucleic acid molecule typically includes denaturing the template nucleic acid, annealing primers to the template nucleic acid under suitable conditions and temperature for specific recognition of the template, and enzymatically elongating from the primers to generate an amplification product. Amplification typically requires the presence of deoxyribonucleoside triphosphates, a DNA polymerase enzyme (e.g., Platinum® Taq, AptaTaq™), an appropriate buffer, and co-factors for optimal activity of the polymerase enzyme (e.g. MgCI₂). In embodiments, amplification is only meaningful if it can be detected. Accordingly reference to “absence of amplification”, “no amplification”, “avoids amplification” or similar expressions used herein, encompasses embodiments where there is a complete absence of amplification as well as embodiments where amplification is present, but below a minimal detectable threshold value. It is within the skill of those in the art to determine what is a suitable threshold value for the amplification and/or for the detection.

[00050] As used herein,“amplifying specifically” or“specific amplification” refers to the selection of amplification conditions maximizing amplification of one or a plurality of desired nucleic acid molecules, while avoiding amplification of other undesirable nucleic acid molecule in order to obtain solely or at least predominantly predetermined amplification products. The selection of the amplification conditions may include selection of one or more amplification parameters such as sequences of the primers, annealing temperatures, time of elongation, concentrations of the materials (primers, salts, polymerase, etc.), pH, the number of cycles in the thermoprotocol, etc.

[00051] The term "primer" is used herein as known to those skilled in the art and refers to oligomeric compounds, primarily to oligonucleotides but also to modified oligonucleotides, that are able to“prime” or initiate DNA synthesis by a template-dependent DNA polymerase. When placed in the proper environment, a primer is able to functionally act as an initiator of template- dependent nucleic acid synthesis. When presented with an appropriate nucleic acid template, suitable nucleoside triphosphate precursors of nucleic acids, a polymerase enzyme, suitable cofactors and conditions such as appropriate temperature and pH, the primer may be extended at its 3' terminus by the addition of nucleotides by the action of a polymerase or similar activity to yield a primer extension product. According to the present invention, the primer may be either RNA or DNA, either single-stranded or double-stranded, either derived from a biological system, generated by restriction enzyme digestion, or produced synthetically. The primer may vary in length depending on the particular conditions and requirement of the application. A primer in accordance with the present invention may be 10 to 50 or more nucleotides in length (e.g., 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, or 50 nucleotides long). The primer may comprise additional nucleotides, for example 1 , 2 or 3 nucleotides that may be added to either or both ends. Alternatively, 1 , 2 or 3 nucleotides may be deleted from or substituted in either or both ends of the primers. In some cases, 1 , 2 or 3 nucleotides may be added, deleted or substituted in the middle i.e. in other parts than the terminal parts of the primer. The primer must be of sufficient complementarity to the desired template to prime the synthesis of the desired extension product, that is, to be able to anneal with the desired template strand in a manner sufficient to provide the 3' hydroxyl moiety of the primer in appropriate juxtaposition for use in the initiation of synthesis by a polymerase or similar enzyme. It is not required that the primer sequence represents an exact complement of the desired template. For example, a non-complementary nucleotide sequence may be attached to the 5' end of an otherwise complementary primer. Alternatively, non-complementary bases may be interspersed within the oligonucleotide primer sequence, provided that the primer sequence has sufficient complementarity with the sequence of the desired template strand to functionally provide a template-primer complex for the synthesis of the extension product. [00052] Nucleic acid amplification in accordance with the invention requires a set of at least two primers comprising at least one forward primer and at least one reverse primer, each forward-reverse primer combination forming a primer pair. The two primers are designed to hybridize individually to opposite strands of a double-stranded nucleic acid molecule, leading to the generation of an amplification product (i.e. an amplicon) by extending from the 3' end of each primer. In some embodiments, a primer set may comprise more than two primers (e.g. 3, 4, 5, 6, 7, 8, or more primers) forming more than one primer pair, each primer pair having the potential of generating a different amplicon. For instance, the primer set according to the invention may comprise 1 forward primer and 2 reverse primers (for potentially generating up to

2 different amplicons), 2 forward primers and 1 reverse primers (for potentially generating up to

2 different amplicons), 2 forward primers and 2 reverse primers (for potentially generating up to

4 different amplicons), 2 forward primers and 3 reverse primers (for potentially generating up to

6 amplicons), 3 forward primers and 2 reverse primers (for potentially generating up to 6 amplicons), etc. Those skilled in the art will appreciate that generation of an amplicon may be dependent from various factors including, for instance, the presence or absence of the bacteria to be detected, the limit of detection, the amplifications conditions, etc. Preferably the primers of the invention have a melting temperature suitable for most nucleic acid amplification methods such as PCR and are minimally interfering with each other in a multiplex reaction.

[00053] The term "probe" as used herein refers to an oligonucleotide which contains a specific nucleotide sequence allowing the probe to hybridize specifically, under predetermined stringencies, to a nucleic acid molecule having a sequence complementary to the probe (e.g. a target nucleic acid or target sequence). A probe may be either single-stranded or double- stranded, either RNA or DNA, and occurring naturally or being produced synthetically.

[00054] The exact length of the probe will depend upon many factors, including temperature, chemical composition of the probe, sequence of the target, and use of the method. For example, for diagnostic applications, depending on the complexity of the target sequence, the probe may be 10 to 60 or more nucleotides in length (e.g., 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58 or 60 nucleotides long). In embodiments, probes are selected to be complementary to different strands of a particular target nucleic acid sequence. This means that the probes must be sufficiently complementary so as to be able to "specifically hybridize" or anneal with their respective target strands under a set of pre-determined conditions. Therefore, the probes sequence may not reflect the exact complementary sequence of the target nucleic acid. For example, a non-complementary nucleotide fragment may be attached to the 5' or 3' end of the probe, with the remainder of the probe sequence being complementary to the target strand. Alternatively, non-complementary bases or longer sequences can be interspersed into the probe, provided that the probe sequence has sufficient complementarity with the sequence of the target nucleic acid to anneal therewith specifically. Preferably the probes according to the invention have a melting temperature suitable for most detection methods including but not limited to capture probe hybridization and real-time PCR. When used in real-time PCR, probes are designed for minimally interfering with the primers and/or probes in a multiplex reaction. The probes are also designed for hybridizing specifically to a plurality of amplicons generated for the target sequence or same gene.

[00055] Primers and probes according to the present invention may comprise one or more modified nucleotide e.g. to alter nucleic acid hybridization properties relative to unmodified nucleotide. A "modified nucleotide" in the context of an oligonucleotide refers to an alteration in which at least one nucleotide of the oligonucleotide sequence is replaced by a different nucleotide that provides a desired property to the oligonucleotide. Exemplary modified nucleotides that can be substituted in the oligonucleotides described herein include, e.g., a C5- methyl-dC, a C5-ethyl-dC, a C5-methyl-dU, a C5-ethyl-dU, a 2,6-diaminopurine, a C5-propynyl- dC, a C5-propynyl-dU, a C7-propynyl-dA, a C7-propynyl-dG, a C5-propargylamino-dC, a C5- propargylamino-dU, a C7-propargylamino-dA, a C7-propargylamino-dG, a 7-deaza-2- deoxyxanthosine, a pyrazolopyrimidine analog, a pseudo-dU, a nitro pyrrole, a nitro indole, 2'-0- methyl Ribo-U, 2'-0-methyl Ribo-C, an N4-ethyl-dC, an N6-methyl-dA, and the like. Many other modified nucleotides that can be substituted in the oligonucleotides are referred to herein or are otherwise known in the art. In certain embodiments, modified nucleotide substitutions modify melting temperatures (Tm) of the oligonucleotides relative to the melting temperatures of corresponding unmodified oligonucleotides. To further illustrate, certain modified nucleotide substitutions can reduce non-specific nucleic acid amplification (e.g., minimize primer dimer formation or the like), increase the yield of an intended target amplicon, and/or the like in some embodiments. Examples of these types of nucleic acid modifications are described in, e.g., U.S. Pat. No. 6,001 ,61 1 , which is incorporated herein by reference. Therefore, there is, except possibly for the intended function, no fundamental difference between a “primer”, an “oligonucleotide”, or a“probe”. The present invention also encompasses nucleic acid molecules that are exactly complementary to the primers and probes defined herein. [00056] The term“hybriziding” refers to the annealing of one or more primers and/or probes to a given nucleic acid sequence or molecule. Hybridization conditions typically include a temperature that is below the melting temperature of the primers and/or probes but that avoids non-specific hybridization of the primers and/or probes. Preferably, the primers and probes of the present invention are sufficiently complementary to a target sequence so as to be able to "specifically hybridize" to the target sequence or nucleic acid molecule. As used herein, the term "specifically hybridize", "specifically hybridizing" or“hybridizing specifically" refers to the association between two single-stranded polynucleotide molecules of sufficiently complementary sequence to permit such hybridization under pre-determined stringent conditions generally used in the art (sometimes termed "substantially complementary"). In particular embodiments, the term refers to hybridization of an oligonucleotide with a sequence substantially complementary to a sequence contained within a selected target nucleic acid molecule (e.g. a target molecule of the invention), while excluding hybridization of said oligonucleotide with single-stranded nucleic acids not having a complementary sequence. Appropriate conditions enabling specific hybridization of single-stranded nucleic acid molecules of varying complementarity are well known in the art. For instance, the equation below is known in the art to predict reasonably well the melting temperature of oligonucleotide, 14-70 nucleotides in length, in cation concentration of 0.4 M or less: (Sambrook and Russell, Chapter 8 in Molecular Cloning: A Laboratory Manual, Third Edition, Volume 2 2001 , Cold Spring Harbor Laboratory Press):

T_m (in °C)= 81 .5 °C +16.6 Log [K+] + 0.41 (% [G+C]) - (675 In)

where n is the number of bases in the oligonucleotide

[00057] In preferred embodiments, the hybridization conditions are stringent conditions including but not limited to optimal concentration of ions e.g. Mg²⁺, K⁺ and NH₄ and suitable temperature. Examples of stringent hybridization conditions include hybridization at 58°C +/- 7°C, preferably +/-3°C.

[00058] Nucleic acid molecules of the invention (e.g. primers and probes) may be prepared using general methods well known in the art, such as synthesis from appropriate nucleotide triphosphates, isolation from biological sources, etc. Synthetic oligonucleotides may be obtained using nucleic acid synthesizers or similar devices. The resultant construct may be purified according to methods known in the art, such as high performance liquid chromatography (HPLC). Long, double-stranded polynucleotides may be synthesized in stages, due to any size limitations inherent in the oligonucleotide synthesis methods. [00059] The probes and/or primers according to the invention may be useful in various molecular biology methods, including but not limited to, PCR amplification, Mutational Analysis/Conformation Sensitive Gel Electrophoresis (CSGE), Isolation and Amplification of DNA, Allele Specific PCR, Oligonucleotide Screening Methods, Ligase Mediated Allele Detection Method, Single-Strand Conformation Polymorphism Analysis. Similarly, detection of amplified nucleic acids may be carried out by using any suitable method or technique known in the art including, but not limited to, gel electrophoresis, melting curves, mass spectrometry, sequencing, using probes having a fluorescent dye, etc.

[00060] The probes according to the present invention are preferably labeled, directly or indirectly with a reporter molecule, such that by assaying for the presence or absence of the probe, one can detect the presence or absence of the target sequence. Direct labeling methods include radioisotope labeling, such as, but not limited to, ³²P or ³⁵S. Indirect labeling methods include fluorescent tags, biotin complexes which may be bound to avidin or streptavidin, or peptide or protein tags. Detection methods include, without limitation, photoluminescence, chemoluminescence, fluorescence, chromogenic and the like. In embodiments, the probes are labeled with a fluorophore including, but not limited to, Quasar 670™, Quasar 705™, CAL Fluor Red 610™, 6-FAM™, TET™, VIC™, ROX™, JOE™ and the like.

[00061] The primers and probes described herein may be useful for the amplification of selected regions of DNA from carbapenemases producing bacteria, particularly CPEs comprising one or more of the genes OXA-48, IMP, VIM and genetic variants thereof, as well as for the detection of such amplified nucleic acids. Such amplification may be carried out using standard amplification techniques including, but not limited to, polymerase chain reaction (PCR), real-time PCR (rtPCR), quantitative PCR (qPCR), reverse transcription PCR (RT-PCR), real time reverse transcription PCR (RT-qPCR), digital PCR, nucleic acid sequence based amplification (NASBA), ligase chain reaction (LCR), transcription-mediated amplification (TMA), and other isothermal amplification methods (e.g. recombinase polymerase amplification (RPA) and loop mediated amplification (LAMP)). In embodiments, primers and probes for different variants and/or different genes are combined together and used in real-time PCR multiplexing methods for accurately, rapidly, and simultaneously detecting a plurality of different carbapenemase genes and/or variants thereof.

[00062] Preferably, PCR methods are used with the primers of the invention for the amplification of nucleic acids. In embodiments, a reaction mixture, including or not a nucleic acid template, is subjected to a cycling to realize the polymerase chain reaction. Typically, double- stranded nucleic acids are subjected to a denaturation step of 1 to 60 sec. at about 90°C to about 100°C. The reactional mix is then cooled down to allow the annealing of each primer to its target sequence. Annealing temperature may be from about 45°C to about 65°C. Annealing times may be from about 10 to about 60 sec. The reactional mix may then be heated to a temperature where thermostable DNA polymerase will produce an optimal primer extension (an optional step in some PCR methods). The newly double-stranded molecule generated can be used as template material in the further steps of the reaction. The repetition of those steps are referred as cycling, and these steps are repeated at least once, preferably about 20, 30, 40, 45, 50 or 60 times or more, until a suitable analytical sensitivity is achieved.

[00063] Table 1 and Table 2 hereinafter provide information on selected examples of combinations of probes and primers according to the invention. In particular embodiments, the methods, primers, probes and kits according to the invention comprise the use of these particular examples.

Table 1. Combinations of primers and probes for the amplification and detection of bla_KPC variants in accordance with embodiments of the invention

Forward Probe bla_{K p}c variants detected

primer

KPC-Prim KPC-probe1 KPC-Primer 2 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13,

14 15 16 17 18 19 21 22 23

Table 2. Combinations of primers and probes for the amplification and detection of b/a_NDM variants

Forward primer Probe Reverse bla_{N DM} variants detected

primer

[00064] Sequences for the primers and probes of Tables 1 and 2 are provided hereinafter in the Example (Tables 3 and 4). In embodiments, the primers, and/or the probes of the present invention comprises a nucleotide sequence having at least 90%, 95%, 97%, 98%, 99%, 100% identity with the sequences provided in the Example (Tables 3 and 4).

[00065] Figure 1 provides the nucleic acid sequence of a fragment of the gene bla_KPC from Klebsiella pneumoniae (accession No. AY034847) showing an example of the regions targeted by primers and probes for the gene bla_{KP C-2}, according to one embodiment of the invention. Figure 2 provides the nucleic acid sequence of a fragment of the gene bla_NDM from Klebsiella pneumoniae (accession No. FN396876) showing an example of the regions targeted by primers and probes for the gene b/a_NDM-i, according to one embodiment of the invention. Those figures are illustrative only of the positioning of the primers, the amplified region and region targeted by the probes in these particular bacteria, and the particular primers and probes. These parameters may vary in accordance with bacterial species or variants.

[00066] In embodiments, the primer pair(s) and/or the probe(s) are selected for detection and/or amplification of nucleic acids from at least 5, 10, 15, 20, 25, 30, 35, 37, 39, 40, 41 or more different KPC variants having carbapenemase-producing activity.

[00067] In embodiments, the primer pair(s) and/or the probe(s) are selected for detection and/or amplification of nucleic acids from at least 5, 10, 15, 18, 20, 22, 23, 24, 25, 26 or more different NDM variants having carbapenemase-producing activity.

[00068] In embodiments, the primer pair(s) and/or the probe(s), are selected for a multiplex assay permitting simultaneous detection of at least one of KPC carbapenemase genes and NDM carbapenemase genes.

[00069] In embodiments, the primer pair(s) and/or the probe(s), are selected for a multiplex assay permitting simultaneous detection of at least one of KPC carbapenemase genes and NDM carbapenemase genes, and at least one additional carbapenemase gene including, but not limited to, OXA-48-like carbapenemase genes, VIM carbapenemase genes and IMP carbapenemase genes (e.g. KPC + OXA-48-like, KPC + IMP, KPC + VIM, NDM + OXA-48-like, NDM + IMP, NDM + VIM, KPC + NDM + OXA-48-like, KPC + NDM + IMP, KPC + NDM + VIM, KPC + NDM + OXA-48-like + IMP, KPC + NDM + OXA-48-like + IMP, KPC + NDM + IMP + VIM, KPC + NDM + OXA-48-like + IMP + VIM, etc.). Cl Kits

[00070] A further aspect of the invention relates to kits, e.g. detection, screening or diagnostic kits. The kits of the invention may be useful for the practice of the methods of the invention, particularly for diagnostic applications in subjects (e.g. humans) for the detection of carbapenemase-producing bacteria and/or for detecting presence and/or absence of bacteria in samples from various environments as well as various environmental samples as described hereinbefore.

[00071] Accordingly, a related aspect of the invention concerns kits (e.g. diagnostic, screening or detection kits) comprising at least one primer pair and at least one probe as defined herein.

[00072] In one embodiment, the kit comprises at least one forward primer from those provided in Tables 1 and 2. In one embodiment, the kit comprises at least one reverse primer from those provided in Tables 1 and 2. In one embodiment, the kit comprises at least one probe from those provided in Tables 1 and 2. In one embodiment, the kit comprises at least one primer pair from the primer pairs provided in Tables 1 and 2. In one embodiment, the kit comprises a combination of at least one primer pair and one probe, from the combinations provided in Tables 1 and 2. In embodiments the primers and/or the probes comprise a nucleotide sequence as defined in the Example (Tables 4 and 5). In embodiments the primers and/or the probes comprise a nucleotide sequence as defined in the Example (Tables 4 and 5).

[00073] In particular embodiments, a kit of the invention comprises components of nucleic acid amplification systems (e.g. DNA), including PCR reaction materials such as buffers and a thermostable polymerase. In a one embodiment, the kit is optimized for real-time PCR, more preferably in real-time multiplex PCR. A kit of the invention may further comprise one or more of the following elements: biological specimens collecting materials (e.g. cotton swab, blood samples collecting tubes, a buffer for the homogenization or for the lysis of cells in the sample(s), purified nucleic acids molecules (e.g. DNA) to be used as controls, incubation buffer(s), substrate and assay buffer(s), modulator buffer(s) and modulators (e.g. enhancers), standards, detection materials (e.g. antibodies, fluorochromes, fluorescein-labelled derivatives, luminogenic substrates, detection solutions, quencher(s) such as TAMRA™, Black Hole Quencher®, Iowa Black® etc.), laboratory supplies (e.g. desalting columns, reaction tubes or microplates (e.g. 96- or 384-well plates)), a user manual or instructions, etc. Preferably, the kit and methods of the invention are configured such as to permit a semi-quantitative or quantitative detection or measurement of amplicons, DNA or desired gene(s). In other embodiments, the kit of the present invention can be used in conjunction with commercially available amplification kits. The kit may optionally include instructional material, positive or negative control reactions, templates, or markers, molecular weight size markers for gel electrophoresis, and the like.

[00074] In one embodiment a kit for the simultaneous detection of KPC and NDM genes comprises blaKPC primers and probes selected from Table 1 , and blaNDM primers and probes selected from Table 2, which nucleotide sequence is as defined in Tables 3 and 4. Those oligonucleotides may be combined with commonly used PCR reagents, such as 25 to 100 mM KCI, 10 to 200 mM Tris-HCI (pH from 8.0 to 9.0), 1 to 8 mM MgCI₂, 0.1 to 1 mg/mL bovine serum albumin, 0,005 to 0.020 % of non-ionic detergent (e.g. Tween 20™), 0.1 to 1.5 mM of each oligonucleotide, 0.5 to 5 U of thermostable DNA polymerase , and 50 to 350 mM of each dATP, dTTP, dCTP, dGTP (or one or more of analogs thereof).

[00075] In embodiments, the kit comprises all of the components for a multiplex assay permitting simultaneous detection of a plurality of blaKPC variants and a plurality of blaNDM variants. In embodiments, the kit further comprises at least one additional set of primers and probe(s) for the detection of at least one of OXA-48-like carbapenemase genes, VIM carbapenemase genes and IMP carbapenemase genes. Nucleic acid sequences of primers and probes for OXA-48-like, VIM, and IMP are provided in the US provisional application US 62/701 ,104 filed July 20, 2018, and the International PCT patent application claiming priority to US 62/701 ,104 filed concurrently, both applications being incorporated herein by reference in their entirety.

D) Methods for detection

KPC variants

[00076] According to another particular aspect, the invention relates to a method for detecting simultaneously a presence or an absence of a plurality of bla_KPC gene variants in a sample. In one embodiment the method comprises the steps of:

a. providing a sample susceptible to comprise carbapenemase-producing bacteria; b. providing a set of forward and reverse primers hybridizing specifically to multiple variants of bla_KPC gene;

c. carrying out an amplification reaction; d. detecting presence or absence of amplified nucleic acids.

[00077] According to this method, presence or absence of amplified nucleic acids for a given bla_{K PC} gene variant is indicative of the presence or absence of said bla_KPC gene variant in the sample. Also, in this method a set of primers consisting of only one forward primer and only one reverse primer is designed to provide for selective amplification of nucleic acids from at least 5, 10, 15, 20, 25, 30, 35, 37, 39, 40, 41 or more different bla_{K PC} gene variants.

[00078] According to another particular aspect, the invention relates to a nucleic acid-based method for selective detection of a plurality of bla_KPC gene variants. In one embodiment the method comprises the steps of:

c) detecting amplified nucleic acids.

[00079] According to this method, the set of primers is designed to provide for selective amplification of nucleic acids from at least 5, 10, 15, 20, 25, 30, 35, 37, 39, 40, 41 or more different bla_KPC gene variants with only a pair of primers.

[00080] In embodiments, the bla_KPC gene variants which are amplified and detected are selected from the group consisting of bla_{K p}c-₂, bla_{K p}c-₃, bla_{K p}c-₄, bla_{K p}c-₅, bla_{K p}c-e, bla_KPC-7, bla_KPC- 8, b/a_Kpc-9, bla_KPC-w, bla^fc- , d/aKPc-12, bla^fc _^ b/aKPc-14, blaK_Pc--\5, b/aKPc-16: bla^pc-M, b/aKPc-18: d/a«pc-i9, b/a_Kpc-2i , bla^ -22, bla^c-24, bla^c-25_^ bla^c-26_^ bla_PPc-27, bla^c-28_^ bla^c-29, bla^c-30, d/a_Kpc-3i _> bla_KPC-32, bla^c-33, bla^c-34, bla^c-35_^ bla^pc-36, bla^c-37, bla^_Pc-38, bla^c-39, bla^_Pc-4o, bla_{K p}c-42, bla_KPC-43, bla_{K PC}-44· Preferably, the amplified blaKPC gene variants comprises at least variants least variants bla^z-i and bta^z-z·

[00081] According to the method described above and elsewhere herein, “detecting [...] absence of amplified nucleic acids” may not necessarily require an active measurement or detection step for detecting such“absence”. For instance, the“absence” of amplified nucleic acids may simply be extrapolated, deducted and/or calculated based on other measurements or it may correspond to a measurement value that is below a defined threshold, nil or very low. [00082] In embodiments, the detection of amplified nucleic acids comprises hybridizing amplified nucleic acids with a probe comprising as defined in Table 1. In embodiments the probe comprises a nucleotide sequence as defined in Table 5.

[00083] In embodiments, the amplifying comprises using polymerase chain reaction (PCR), reverse transcription PCR (RT-PCR), quantitative PCR (qPCR) and combinations thereof.

[00084] In embodiments the individual primer, primer pair(s) and the probe(s) are as defined herein, e.g. those provided in Tables 1 and 2. In embodiments the primer pair(s) and the probe(s) comprise a nucleotide sequence as defined in the Example (Tables 3 and 4).

[00085] In one embodiment, the forward primer comprises KPC-Primer 1 [SEQ ID NO: 1 ], the reverse primer comprises KPC-Primer 2 [SEQ ID NO: 2]

[00086] In one embodiment, the detecting comprises hybridizing amplified nucleic acids with a probe comprising KPC-probe1 [SEQ ID NO: 3]

[00087] In embodiments, the amplifying comprises simultaneous amplification of bacterial nucleic acids for at least one of KPC carbapenemase genes and NDM carbapenemase genes. For instance, in addition of KPC nucleic acids, amplified NDM nucleic acids may also be amplified and detected, thereby allowing detecting simultaneously presence or absence of KPC + NDM in a sample. Accordingly, in embodiments the amplifying consists of a multiplex reaction for simultaneous detection of a multitude of KPC carbapenemase genes, and a multitude of NDM carbapenemase genes.

[00088] As used herein, the term “simultaneous” when referring to amplification and/or detection generally refers to events (e.g. amplification and/or detection) that are somewhat contemporaneous and/or synchronized in order to occur in a single tube or in the course of a single process (e.g. a PCR reaction). As such,“simultaneous” is not limited to events that occur exactly at the same time.

NDM variants

[00089] According to another particular aspect, the invention relates to a method for detecting simultaneously a presence or an absence of a plurality of bla_NDM gene variants in a sample. In one embodiment the method comprises the steps of:

a) providing a sample susceptible to comprise carbapenemase-producing bacteria; b) providing a set of forward and reverse primers hybridizing specifically to multiple variants of bid _NDM gene;

c) carrying out an amplification reaction; and

d) detecting presence or absence of amplified nucleic acids.

[00090] According to this method, presence or absence of amplified nucleic acids for a given b/a_NDM gene variant is indicative of the presence or absence of said b/a_NDM gene variant in the sample. Also, in this method a set of primers consisting of only one forward primer and only one reverse primer is designed to provide for selective amplification of nucleic acids from at least 5, 10, 15, 18, 20, 22, 23, 24, 25 or 26 or more different b/a_NDM gene variants.

[00091] According to another particular aspect, the invention relates to a nucleic acid-based method for detection of a plurality of b/a_NDM gene variants. In one embodiment the method comprises:

a) providing a sample susceptible to comprise carbapenemase-producing bacteria; b) amplifying nucleic acids from carbapenemase-producing bacteria with a set of forward and reverse primers hybridizing specifically to multiple variants of bla_NDM gene; and

c) detecting amplified nucleic acids.

[00092] According to this method, the set of primers is designed to provide for selective amplification of nucleic acids from at least 5, 10, 15, 18, 20, 22, 23, 24, 25, 26 or more different bla_{N DM} gene variants with only 1 forward primer and only 1 reverse primer.

[00093] In embodiments, the bla_NDM gene variants which are amplified and detected are selected from the group consisting of bla^D - _> bla^D ^ WSNDM-3_I M NOM-_4I ^JNDM-_SI ^3NDM-_6I bla o -7, bla^D -8, bla^o -a, bla^o -w, bla^D - , bla^o - , d/aNDM-13, bla^ou-u, bla^o - s, bla^o - e, bla^o -p, d/a DM-18 bla^o - a, bla^D -2o, bla^o ^, bla^o -22, bla^D -23, bla^o -24, bla^o -27, bla^D -28·

Preferably, the amplified blaNDM gene variants comprises at least variant ZV<?_NDM-I·

[00094] In embodiments, the amplifying comprises using individual primers and/or primer pair(s) as defined in Table 2, and the detecting comprises hybridizing amplified nucleic acids with a probe as defined in Table 2. In embodiments the primers comprise a nucleotide sequence as defined in Table 3. In embodiments the probe comprises a nucleotide sequence as defined in Table 4. [00095] In one embodiment, the forward primer comprises NDM-Primer 1 [SEQ ID NO: 4] and the reverse primer comprises NDM-Primer 2 [SEQ ID NO: 5].

[00096] In one embodiment, the detecting comprises hybridizing amplified nucleic acids with a probe comprising NDM-probe1 [SEQ ID NO: 6].

Simultaneous detection of bla_KPr. and gene variants

[00097] In certain aspects, the invention relates to methods for simultaneous detection of a plurality gene variants from different genes, i.e. any combination of bla_KPC and bla_NDM genes.

[00098] In one particular aspect the invention relates to a nucleic acid-based method for simultaneous detection of a plurality of bla_KPC gene variants and a plurality of b/a_NDM gene variants. In one embodiment the method comprises the steps of:

a) providing a sample susceptible to comprise carbapenemase-producing bacteria; b) amplifying nucleic acids from carbapenemase-producing bacteria with (i) a first set of forward and reverse primers hybridizing specifically to multiple variants of bla_{K PC} gene; and (ii) a second set of forward and reverse primers hybridizing specifically to multiple variants of bla_NDM gene; and

c) detecting amplified nucleic acids.

[00099] In this method, the first and second sets of primers are selected from Table 1 and Table 2, respectively. Preferably the primers comprise a nucleotide sequence as defined herein, for instance the sequences provided in Table 3. In embodiments the probe comprises a nucleotide sequence as defined in Table 4.

[000100] In accordance with the nucleic acid based methods described herein, any suitable method may be used for amplification of the nucleic acids. Preferably, the amplifying comprises at least one of polymerase chain reaction (PCR), and quantitative PCR (qPCR).

E) Diagnostic and treatment methods

[000101] As can be appreciated, the probes, primers, kits and methods described herein may be useful for bacterial detection, clinical diagnostic and/or treatment purposes.

[000102] Accordingly the present invention encompasses the use of any of the probes, primers, kits and methods described herein for diagnostic of subjects, e.g. human patient, carrying or not carrying carbapenemase-producing bacteria. [000103] In one embodiment, a kit for the detection of KPC carbapenemase genes comprises at least one forward primer, at least one reverse primer and at least one probe as defined in

Table 3 and Table 4.

[000104] In one embodiment, a kit for the detection of NDM carbapenemase genes, comprises at least one forward primer, at least one reverse primer and at least one probe as defined in

Table 3 and Table 4.

[000105] One particular aspect the invention relates to a multiplex detection kit for simultaneous detection of at least two different carbapenemase genes. In one embodiment the kit comprises a first set of oligonucleotide molecules for the detection of KPC carbapenemase genes and a second set of oligonucleotide molecules for the detection of NDM carbapenemase genes.

[000106] One particular aspect the invention relates to a multiplex detection kit for simultaneous detection of at least two different carbapenemase genes. In one embodiment the kit comprises a first set of oligonucleotide molecules for the detection of KPC carbapenemase genes and a second set of oligonucleotide molecules for the detection of NDM carbapenemase genes. According to a more specific aspect, the invention relates to a multiplex detection kit for simultaneous detection of KPC carbapenemase genes and NDM carbapenemase genes. In one embodiment the kit comprises:

i) a first set of oligonucleotide molecules for the detection of KPC carbapenemase genes, the first set comprising at least one forward primer, at least one reverse primer and at least one probe as defined in Table 3 and Table 4;

ii) a second set of oligonucleotide molecules for the detection of NDM carbapenemase genes, the second set comprising at least one forward primer, at least one reverse primer and at least one probe as defined in Table 3 and Table 4;

[000107] Advantageously, the kits of the present invention may further comprises at least one additional set of primers and/or additional probe(s) for the detection of at least one of OXA-48- like carbapenemases, VIM carbapenemases and IMP carbapenemases. The methods and kits of the present invention may further be used in combination and/or comprise additional set of primers and/or additional probe(s) for the detection of additional resistance genes including but not limited to CTX-M, SHV, TEM b-lactamases and/or for the detection of bacterial species, including, but not limited to, Klebsiella pneumoniae, Escherichia coli and/or Pseudomonas aeruginosa. [000108] The present invention also encompasses the use of any of the probes, primers, kits and methods described herein in the treatment of subjects carrying or suspected of carrying carbapenemase-producing bacteria.

[000109] For instance, a treatment method according to the invention may comprise the steps of: (i) identifying a subject (e.g. human patient) carrying carbapenemase-producing bacteria with the probes, primers, kits and methods described herein; and (ii) providing appropriate treatment to such infected subject. The appropriate treatment may comprise providing to the infected subject adequate antibiotic therapy and/or implementing strict infection control measures around the infected subject and/or around any subject that may have been in contact with the infected subject.

[000110] The probes, primers, kits and methods described herein may also be useful in implementing adequate hygiene procedures, for instance by providing detection of presence or absences of bacteria in various environments including, but not limited to, hospitals (e.g. laboratory working surfaces, medical instruments, patient rooms, etc.), public spaces (e.g. schools, shopping malls, etc.), nature (e.g. water, air, soil, etc.) and the like. The invention may also find applications in epidemiologic studies.

[000111] Those skilled in the art will recognize, or be able to ascertain, using no more than routine experimentation, numerous equivalents to the specific procedures, embodiments, claims, and examples described herein. Such equivalents are considered to be within the scope of this invention, and covered by the claims appended hereto. The invention is further illustrated by the following example, which should not be construed as further or specifically limiting.

EXAMPLES

[000112] Example 1 : Multiplex assay for simultaneous detection of KPC carbapenemase genes and NDM carbapenemase genes in human subjects

[000113] Design of primer and probes

[000114] The bla_KPC gene currently comprises 41 variants of protein sequences (known as KPC-2 to KPC-44). Analysis of the sequences available in the NCBI public databases (NR and WGS) shows percentages of identity at the nucleotide level ranging from 96.7% to 99.9% between the different bla_{K PC}. In order to obtain a specific and ubiquitous PCR assay, conserved regions were identified on 223 sequences. Primers and probes were thus designed with the objective of targeting all the 32 KPC variants, including the most prevalent variants KPC-2 and KPC-3, by using a minimal set of oligonucleotides while achieving the highest analytical sensitivity.

[000115] The b/a_NDM gene currently comprises 26 variants of protein sequences (known as NDM-1 to NDM-28). Analysis of the sequences available in the NCBI public databases (NR and WGS) shows percentages of identity at the nucleotide level ranging from 98.2% to 99.9% between the different bla_NDM. In order to obtain a specific and ubiquitous PCR assay, conserved regions were identified on 356 sequences. Primers and probes were thus designed with the objective of targeting all the 24 NDM variants, including the most prevalent variants NDM-1 , by using a minimal set of oligonucleotides while achieving the highest analytical sensitivity.

[000116] Table 3 hereinafter provides the nucleic acid sequence and other features of the selected primers.

[000117] Table 4 hereinafter provides the nucleic acid sequence and other features of the selected probes.

Table 3: Features of the primers useful for the amplification of bla_{K PC} and bla_{H D}M bacterial

genes

Identification Size Nucleotidic sequence SEQ ID NO: Amplicon

(nuc.) (5' - 3') (pb)

KPC-Primer 1 21 AT ATC T GAC AAC AGGC AT GAC 1

135 KPC-Primer 2 18 C C GAT AGAGC GC AT GAAG 2

NDM-Primer 1 17 CACCGAATGTCTGGCAG 4

170 NDM-Primer 2 19 CAGGTTGATCTCCTGCTTG 5

Table 4: Features of the probes selected for the detection of amplified bla_{K PC} and bla_{H DM} bacterial genes fragments

Identification Size Nucleotidic sequence SEQ ID NO: Fluorophore

(nuc.) (5- . 3')

KPC-probe1 22 CAATACAGTGATAACGCCGCCG 3 Quasar 670™

NDM-probe1 23 CTTCCAACGGTTTGATCGTCAGG 6 CAL Fluor Red 610™

[000118] Analytical reactivity (inclusivity) and analytical specificity (cross-reactivity) analysis of the selected primers and probes

[000119] Analytical reactivity (inclusivity) and analytical specificity (cross-reactivity) of the selected primers and probes was analysed in silico with the BLASTn software (Altschul SF et al., Journal of Molecular Biology (1990) 215:403-410). The softwares searched among all the DNA sequences available in the NCBI public databases (NR and WGS; NCBI Resource Coordinators. (2016). Database resources of the National Center for Biotechnology Information. Nucleic Acids NCBI Resource Coordinators. (2016). Database resources of the National Center for Biotechnology Information. Nucleic Acids Research 44(Database issue):D7-D19. http://doi.Org/10.1093/nar/gkv1290).

[000120] For the gene bla_{K PC}, the sequences were obtained from the public databases (480 sequences from NCBI (NR) and 1478 sequences from partially assembled genomes (WGS)). Short sequences that did not encompass all the oligonucleotides hybridization regions and sequences under 50% of the complete gene were excluded from the analysis. The results of in silico inclusivity analysis showed that 1954/1958 sequences are 100% identical with the selected oligonucleotides set.

[000121] For the gene bla_NDM, the sequences were obtained from the public databases (732 sequences from NCBI (NR) and 523 sequences from partially assembled genomes (WGS)). Short sequences that did not encompass all the oligonucleotides hybridization regions and sequences under 50% of the complete gene were excluded from the analysis. The results of in silico inclusivity analysis showed that 1255/1255 sequences are 100% identical with the selected oligonucleotides set. [000122] PCR testing

[000123] PCR amplifications were carried out to test the primers and probes under real-life multiplex conditions for simultaneous detection of KPC and NDM genes. The composition of the PCR mix was in accordance with the materials and concentrations indicated hereinbefore in the section “Kits”. The primers and probes that were used are selected from the combinations presented in Table 1 and Table 2.

[000124] The PCR efficiency and the dynamic range for each target of the KPC/NDM multiplex were determined.

[000125] PCR efficiency is defined as the measurement of the amplification yield after each PCR cycle. The dynamic range determines the concentration variation of the target for which the slope of the calibration curve remains linear and with an R²> 0.98. Six concentrations were tested, these concentrations covering six logs, i.e. 10⁶, 10⁵, 10⁴, 1000, 100 and 10 copies of genomic DNA from K. pneumoniae CCRI-19587 (b/a_Kpc-₃) and CCRI-2171 1 (b/a_NDM-i) (5 replicates for each dilution).

[000126] The dynamic range of the multiplex for bla_K PC/NDM revealed to be linear from 1 0 to 1 0⁶ copies with genomic DNA (including chromosomal and plasmidic DNA) from the strains K. pneumoniae CCRI-19587 (b/a_Kpc-₃) and CCRI-2171 1 (b/a_NDM-i ) (Figures 3A-3C). The PCR efficiencies were 99.2% with genomic DNA from K. pneumoniae CCRI-19587 (b/a_Kpc-₃). and 97.1 % with genomic DNA from K. pneumoniae CCRI-2171 1 (b/a_NDM-i ) · R² values were greater than 0.99 for the 2 targets. All these data were considered entirely satisfactory, at least in terms of PCR efficiency and dynamic range.

[000127] The limit of detection (LOD) was subsequently determined for each of the targets in presence of 1 .25, 2.5, 5, 10, 15, 20 and 25 copies of genomic DNA from K. pneumoniae CCRI- 19587 (bla_{K p}c_-3) and CCRI-2171 1 (b/a_NDM-i ) · Fifteen replicates for each quantity of genomic DNA were tested to establish the LODs. The results obtained are shown in Table 5. Table 5: Limit of detection (LOD) of the targets in the b/a_Kpc_/NDM multiplex assay

[000128] The cross-reactivity of the bla_Kpc_/No multiplex assay was evaluated using crude lysates (~ 1 .5x10⁸ CFUs) or genomic DNA between 3 ng (~ 3x10⁵ genome copies) and 53 ng (~ 5.3x10⁶ genome copies) from a range of bacterial species (130) possessing other carbapenemase genes or other antibiotic resistance genes (19) and bacterial species found in the intestinal flora (29) or tested for cross-reactivity by detection kits currently available on the market (82). The list of species targeted for cross-reactivity tests is presented in Table 6. None of these 130 strains were detected with the bla_K PC/NDM multiplex assay.

Table 6: Bacterial species used for cross-reactivity tests with the b/a_Kpc_/NDM multiplex

assay

[000129] Inclusivity of the bla_Kpc_/No multiplex assay was also tested using genomic DNA of 35 strains other than those for which the LOD was determined, these strains carrying different variants of the bla_KPC (25) and bla_NDM (10) genes. Each of the targeted strains was amplified with an amount of genomic DNA corresponding of 2 to 4 times the LOD of the control strains carrying each gene. All of the strains targeted were amplified 10 times out of 10 (10/10) with an amount of genomic DNA corresponding to 2X the LOD. The list of strains carrying genes bla_KPC and bla_NDM for which genomic DNA was assessed for inclusivity testing is presented in Table 7. Table 7. Results of inclusivity testing for the bla_K multiplex assay with genomic DNA of strains carrying genes bla_K PC and b/a_NDM used at concentrations close to the LOD.

[000130] Clinical performance

[000131] The clinical performance of the bla_K PC/NDM multiplex assay was next tested with biological specimens. The biological specimens were obtained from the microbiology laboratory of different hospitals in the province of Quebec. These biological specimens were 731 residual swabs from anonymous patients tested with standard of care culture methods, most of the specimens were rectal swabs.

[000132] Comparison of test results obtained for the /?/S_KPC/NDM multiplex assay compared with those of the reference culture methods are shown in Table 8. The results obtained were compiled to evaluate the overall clinical performance of the bla_K PC/NDM multiplex assay. The composition of primers and probes of the bla_K PC/NDM multiplex assay is presented in Table 9.

Table 8: Comparative results of testing of patients biological samples using the b/a_Kpc_/NDM multiplex assay with those of the reference culture methods

Among ^a the 18 p ^ositives,’ 16 were bla KPC and 2 were bla NDM

Only 2 inhibitory samples; rate of inhibition: 2/751 =0.26%

Table 9: Primers and probes composing the bla_{K PC}/NDM multiplex assay

[000133] We can thus conclude that the clinical performance of the /?/S_KPC/NDM multiplex assay is excellent with a clinical sensitivity of 100% and a clinical specificity 100%.

[000134] Example 2: Multiplex assay for simultaneous detection of KPC carbapenemase genes NDM carbapenemase genes in human subjects using a stand-alone diagnostic system

[000135] A kit for a bla_{K PD}/NDM multiplex assay was designed in accordance with the features defined hereinbefore in the section “Kit” hereinabove. The kit was assembled in a fluidic cartridge for use in the automated diagnostic platform revogene™ (GenePOC™, Quebec City, Canada).

[000136] The clinical performance of the bla_K PC/NDM multiplex kit and its associated multiplex assay were tested using biological specimens obtained from the microbiology laboratory of different hospitals in the province of Quebec. These biological specimens were 21 residual rectal swabs from anonymous patients tested with standard of care culture methods of each hospital.

[000137] Table 10 provides the test results obtained with the fluidic cartridge multiplex assay kit with those of the standard of care culture methods. In this table, specimens with NEG status (i.e. negative) for the culture method or the present kit/assay were exempt of any of the bla_KPC or bla_{N DM} genes_. Positive samples are identified in the table by the gene for which the specimen is found positive (e.g. KPC or NDM). As can be appreciated, the results obtained using the fluidic cartridge multiplex assay kit match those of the standard of care culture methods, except for specimens #46 and #47 which were negative in the multiplex assay but positive for NDM and KPC, respectively, by standard of care culture methods. These results confirm the sensitivity and robustness of the kit and assay according to the present invention.

Table 10. Detection of resistant bacteria using a fluidic cartridge compared with standard of care culture methods

[000138] Headings are included herein for reference and to aid in locating certain sections. These headings are not intended to limit the scope of the concepts described therein, and these concepts may have applicability in other sections throughout the entire specification. Thus, the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

[000139] The singular forms“a”,“an” and“the” include corresponding plural references unless the context clearly dictates otherwise. Thus, for example, reference to "a primer" includes one or more of such primer, and reference to "the method" includes reference to equivalent steps and methods known to those of ordinary skill in the art that could be modified or substituted for the methods described herein.

[000140] Unless otherwise indicated, all numbers expressing quantities of ingredients, reaction conditions, concentrations, properties, and so forth used in the specification and claims are to be understood as being modified in all instances by the term“about”. At the very least, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques. Accordingly, unless indicated to the contrary, the numerical parameters set forth in the present specification and attached claims are approximations that may vary depending upon the properties sought to be obtained. Notwithstanding that the numerical ranges and parameters setting forth the broad scope of the embodiments are approximations, the numerical values set forth in the specific examples are reported as precisely as possible. Any numerical value, however, inherently contains certain errors resulting from variations in experiments, testing measurements, statistical analyses and such.

[000141] It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the present invention and scope of the appended claims.

Claims

CLAIMS:

1 . A method for detecting simultaneously a presence or an absence of a plurality of bla_K gene variants in a sample, comprising:

a) providing a sample susceptible to comprise carbapenemase-producing bacteria;

b) providing a set of forward and reverse primers hybridizing specifically to multiple variants of bla_K gene;

c) carrying out an amplification reaction; and

d) detecting presence or absence of amplified nucleic acids;

wherein a set of primers consisting of only one forward primer and only one reverse primer provides for selective amplification of nucleic acids from at least 5, 10, 15, 20, 25, 30, 35, 37, 39, 40, 41 or more different bla_KPC gene variants.

2. A nucleic acid-based method for detection of a plurality of bla_KPC gene variants, comprising:

c) detecting amplified nucleic acids;

wherein said set of primers provides for selective amplification of nucleic acids from at least 5, 10, 15, 20, 25, 30, 35, 37, 39, 40, 41 or more different bla_K gene variants with only one forward primer and only one reverse primer.

3. The method of claim 1 or 2, wherein said bla_KPC gene variants are selected from the group consisting of b/aKPc-2, bla^ pc-₃, blam , blades, b/awc-e_r blaKPc-7, blaKPc-₈, b/a^pc-s, b/a\(pc-io, h/a^pc-n, bla Q-u, b/a_KPC-ri, b/a^pc-u, /akpc-i_5i b/a^pc^, bla_{P Q}-u, bla^pz-i^, bla^pQ.^, <?_Kpc-2 bla^p -22, bla^pc^, bla^p .

25 _r blaypz-28, bla^ PC-27, blaypz-28, blaypz-25, /<3kPC-3CV b/appC-31, blaypz-32, b/ac pc-33i blaypz-33, /<3kpC-35, b/ac pc-36i ZV<?KPC-37i b/a^pcps, ZVakpc-39, /<?KPC-4C ^kPC^i ^KPC-43_/ bla_P -_PP.

4. The method of any one of claims 1 to 3, wherein said bla_KPC gene variants comprise at least variants b/a_Kpc-2 and b!a, KPC-3·

5. The method of any one of claims 1 to 4, wherein said forward primer comprises KPC- Primer 1 [SEQ ID NO :1 ] and wherein said reverse primer comprises KPC-Primer 2 [SEQ ID NO :2].

6. The method of any one of claims 1 to 5, wherein said detecting comprises hybridizing amplified nucleic acids with a probe comprising KPC-probe1 [SEQ ID NO :3].

7. The method of any one of claims 1 to 6, wherein said method provides for detection of as low as less than 100 copies, or as low as less than 50 copies, or as low as less than 25 copies, or as low as less than 10 copies, or as low as less than 5 copies, or as low as 1 copy of bacterial genomic DNA.

8. A method for detecting simultaneously a presence or an absence of a plurality of b/a_NDM gene variants in a sample, comprising:

a) providing a sample susceptible to comprise carbapenemase-producing bacteria;

b) providing a set of forward and reverse primers hybridizing specifically to multiple variants of bla^o_M gene;

c) carrying out an amplification reaction; and

d) detecting presence or absence of amplified nucleic acids;

wherein presence or absence of amplified nucleic acids for a given b/a_NDM gene variant is indicative of the presence or absence of said b/a_NDM gene variant in the sample, and

wherein a set of primers consisting of only one forward primer and only one reverse primer provides for selective amplification of nucleic acids from at least 5, 10, 15, 18, 20, 22, 23, 24, 25, 26 or more different bla_NDM gene variants.

9. A nucleic acid-based method for detection of a plurality of b/a_NDM gene variants, comprising:

c) detecting amplified nucleic acids; wherein said set of primers provides for selective amplification of nucleic acids from at least 5, 10, 15, 18, 20, 22, 23, 24, 25, 26 or more different bla_NDM gene variants with only one forward primer and only one reverse primer.

10. The method of claim 8 or 9, wherein said bla_NDM gene variants are selected from the group consisting of /a m-i, b/a m-2, b/a m-₃, b/a^ DM-4_? blames, bla^_M- , bldi-mi-i, bla^n-z, bla^^,

1 1 . The method of any one of claims 8 to 10, wherein said bla_KPC gene variants comprise at least variant b/a^ _DM-I-

12. The method of any one of claims 8 to 1 1 , wherein said forward primer comprises NDM- Primer 1 [SEQ ID NO :4] and wherein said reverse primer comprises NDM-Primer 2 [SEQ ID NO :5],

13. The method of any one of claims 8 to 12, wherein said detecting comprises hybridizing amplified nucleic acids with a probe comprising NDM-probe1 [SEQ ID NO :6].

14. The method of any one of claims 8 to 13, wherein said method provides for detection of as low as less than 100 copies, or as low as less than 50 copies, or as low as less than 25 copies, or as low as less than 10 copies, or as low as less than 5 copies, or as low as 1 copy of bacterial genomic DNA.

15. A nucleic acid-based method for simultaneous detection of a plurality of bla_KPC gene variants and a plurality of b/a_NDM gene variants comprising :

a) providing a sample susceptible to comprise carbapenemase-producing bacteria; b) amplifying nucleic acids from carbapenemase-producing bacteria with: (i) a first set of forward and reverse primers hybridizing specifically to multiple variants of bla_{K PC} gene; and (ii) a second set of forward and reverse primers hybridizing specifically to multiple variants of bla_{N D}M gene;

c) detecting amplified nucleic acids;

wherein said first and second sets of primers are selected from Table 3.

16. The method of claim 15, wherein said bla_KPC gene variants are selected from the group consisting of b/aKPc-2, bla c-3, bla c-4, blades, bla c-6, bla^pc-i, blades, blades, bla^pc-io, bla_KPC-i i , b/a_Kpc-i2, d/aKPc-13 ^SKPC-M, ^SKPC-IS blaKPc-ie, bla^_Pc-M, bla_P,pc-i8, b/aKPc-19, b/a« pc-21 _> bla KPc-22, blaKPc-24, blaKPc-25, blaKPc-26, blaKPc-27, £>/¾ pc-28 blaKPc-29, blaKPc-30, d/aKPc-31 , blaKPc-32, bla_KPC-33, blaKPc-34, blaKPc-35, blaKPc-36, blaKPc-37, blaKPc-38, blaKPc-39, blaKPc-40, blaKPc-42, blaKPc-43, bla^pc-_{44 3} rid

wherein said bla_NDM gene variants are selected from the group consisting of bla_{N D}M-I > bla^o -2, bla^D -3, bla^o -4, bla^o -5, bla^o -e, bla^o -7, bla^o -8, bla^o s, bla^o -w, bla^D - , d/aNDM-12! d/aNDM-13i d/aNDM-14! d/aNDM-15i d/aNDM-16i d/aNDM-17! d/aNDM-18i d/aNDM-19! d/aNDM-20i d/aNDM-21 1 d/aNDM-22, d/a DM-23! bla^D -24, bla^D -27, bla^D -28·

17. The method of claim 15 or 16, wherein said first set of primer comprises KPC-Primer 1 [SEQ ID NO: 1 ] and KPC-Primer 2 [SEQ ID NO: 2]; and wherein said second set of primers comprises NDM-Primer 1 [SEQ ID NO: 4] and NDM-Primer 2 [SEQ ID NO: 5].

18. The method of any one of claims 15 to 17, wherein said detecting comprises hybridizing amplified nucleic acids with at least one probe selected from KPC-probe1 [SEQ ID NO :3] and NDM-probe1 [SEQ ID NO :6].

19. The method of any one of claims 15 to 18, wherein said method provides for detection of as low as less than 100 copies, or as low as less than 50 copies, or as low as less than 25 copies, or as low as less than 10 copies, or as low as less than 5 copies, or as low as 1 copy of bacterial genomic DNA.

20. The method of any one of claims 1 to 19, wherein said amplifying comprises at least one of polymerase chain reaction (PCR), quantitative PCR (qPCR), reverse transcription PCR (RT- PCR) and isothermal amplification.

21 . A primer for amplification of nucleic acids molecules, said primer said primer comprising a polynucleotide sequence selected from the group consisting of: KPC-Primer 1 [SEQ ID NO: 1 ], KPC-Primer 2 [SEQ ID NO: 2], NDM-Primer 1 [SEQ ID NO: 4] and NDM-Primer 2 [SEQ ID NO: 5], or a sequence exactly complementary thereto.

22. A set of primers for amplification of a plurality of bla_KPC gene variants, comprising KPC- Primer 1 [SEQ ID NO: 1 ] and KPC-Primer 2 [SEQ ID NO: 2],

23. A set of primers for amplification of a plurality of bla_NDM gene variants, comprising NDM- Primer 1 [SEQ ID NO: 4] and NDM-Primer 2 [SEQ ID NO: 5].

24. A set of primers for simultaneous amplification of a plurality of bla_{K p}c gene variants and a plurality of bla_{N DM} gene variants, comprising KPC-Primer 1 [SEQ ID NO: 1 ], KPC-Primer 2 [SEQ ID NO: 2], NDM-Primer 1 [SEQ ID NO: 4] and NDM-Primer 2 [SEQ ID NO: 5].

25. A probe for detection of nucleic acids molecules, said probe comprising a polynucleotide sequence selected from the group consisting of KPC-probe1 [SEQ ID NO: 3] and NDM-probe1 [SEQ ID NO: 6], or a sequence exactly complementary thereto.

26. Use of a primer according to claim 21 , or use of a set of primers according to any one of claims 22 to 24, or use a probe according to claim 25, for identification of subjects carrying carbapenemase-producing bacteria, and/or for identification of presence or absence of carbapenemase-producing bacteria in environmental samples.

27. Use of a primer according to claim 21 , or use of a set of primers according to any one of claims 22 to 24, or use a probe according to claim 25, for identification of subjects carrying at least one of bacteria having blaKPC gene and bacteria having blaNDM gene.

28. A detection kit comprising one or more primer according to claim 21 and one or more probe according to claim 25.

29. A kit for detection of carbapenemase-producing bacteria comprising at least one forward primer, at least one reverse primer and at least one probe selected from the group of primers defined in Table 3 and probes defined in Table 4.

30. The kit of claim 29, wherein said kit comprises two sets of primers for simultaneous detection of a plurality of bla_KPC Qene variants and a plurality of bla_NDM gene variants.

31 . A kit for the detection of a plurality of bla_KPC gene variants, comprising KPC-Primer 1 [SEQ ID NO: 1 ], KPC-Primer 2 [SEQ ID NO: 2] and KPC-probe1 [SEQ ID NO: 3].

32. A kit for the detection of a plurality of bla_NDM gene variants, comprising NDM-Primer 1 [SEQ ID NO: 4], NDM-Primer 2 [SEQ ID NO: 5], and NDM-probe1 [SEQ ID NO: 6].

33. A multiplex detection kit for simultaneous detection of at least two carbapenemase genes, comprising:

i) a first set of oligonucleotide molecules for the detection of KPC carbapenemase genes, said first set comprising at least one forward primer, at least one reverse primer and at least one probe as defined in Table 3 and Table 4;

ii) a second set of oligonucleotide molecules for the detection of NDM carbapenemase genes, said second set comprising at least one forward primer, at least one reverse primer and at least one probe as defined in Table 3 and Table 4;

34. The kit as defined in any one of claims 28 to 33, further comprising at least one additional set of primers for the detection of at least one of OXA-48-like carbapenemase genes, VIM carbapenemase genes, and IMP carbapenemase genes.

35. Use of any of the probes, primers, kits and methods described hereinbefore, for the diagnostic of patients carrying or not carbapenemase-producing bacteria, and/or for identification of presence or absence of carbapenemase-producing bacteria in environmental samples.

36. A method for the treatment of a subject, comprising:

(i) identifying a subject carrying carbapenemase-producing bacteria with any of the probes, primers, kits and methods according to any of the previous claims; and

(ii) providing appropriate treatment to said subject.