WO2020000458A1 - Grna targeting sequence for specifically targeting human ngl gene and application thereof - Google Patents

Abstract

Provided is a gRNA targeting sequence for specifically targeting human NGL gene, which has a nucleotide sequence of 5'-AGCTGAGATTCCCCTCCATT-3'. Knockout of the NGL gene is achieved after introducing the gRNA and the CRISPR system into the target cell by the Cas9 carrier.

Description

GRNA-directed sequence specifically targeting human NGL gene and application thereof Technical field

The invention belongs to the technical field of gene editing, and particularly relates to a gRNA guide sequence specifically targeting a human NGL gene and an application thereof.

Background technique

NGL is a member of the epidermal growth factor receptor (EGFR) family of proto-oncogenes, and is involved in the regulation of growth and development of normal tissues. It can promote cell division and secretion of proteolytic enzymes, and enhance cell mobility. In this state, the expression of NGL increases, which in turn promotes tumor invasion and metastasis.

technical problem

NGL is involved in the regulation of growth and development of normal tissues, can promote cell division and secretion of proteolytic enzymes, and enhance the ability of cells to move, but under pathological conditions, the expression of NGL increases, thereby promoting tumor invasion and metastasis. NGL has intracellular tyrosine kinase-like activity, plays a role in embryonic development and differentiation, is widely expressed in human epithelial cells, and is closely related to the survival and evolution of a variety of tumors. Therefore, the research on NGL can greatly promote the development of the field of tumor prevention and treatment, but the lack of means for targeted knock-out of NGL gene expression in the prior art has caused a certain obstacle to the progress of related research.

Technical solutions

In view of the above problems, the present invention provides a gRNA targeting sequence that specifically targets the human NGL gene. The gRNA targeting sequence can be used to knock out the human NGL gene, thereby suppressing or eliminating the expression of NGL.

Yet another object of the present invention is to provide an application of the gRNA-directed sequence specifically targeting the human NGL gene.

The object of the present invention is achieved by the following technical solutions:

A gRNA-directed sequence that specifically targets the human NGL gene is NGL-gRNA, and its nucleotide sequence is:

NGL-gRNA: 5’- AGCTGAGATTCCCCTCCATT -3 ’;

A method for knocking out the human NGL gene using the CRISPR / Cas9 system includes the following steps:

a. Adding CACC to the 5 'end of the above gRNA guide sequence to obtain a forward oligonucleotide; meanwhile, to obtain the corresponding complementary DNA strand according to the guide sequence, and adding AAAC to the reverse oligonucleotide to obtain a reverse oligonucleoside. Acid; synthesize the aforementioned forward oligonucleotide and reverse oligonucleotide, respectively, and denature the synthesized forward oligonucleotide and reverse oligonucleotide, and anneal to form a double strand;

b. ligating the double strand prepared in step a with the Cas9 vector to obtain a recombinant knockout expression vector;

c. The recombinant knockout expression vector prepared in step b is transfected into the target cells, and puromycin is selected to obtain cells that successfully knocked out the NGL gene.

Further, the Cas9 vector in step b is a px459 vector;

Further, the target cell in step c is a Raji cell;

Further, the concentration of puromycin in step c is 1.0 μg / ml.

Beneficial effect

Compared with the prior art, the present invention has the following advantages and effects:

1. The present invention designs and synthesizes two single-stranded oligo sequences according to the gRNA-directed sequence, anneals to form a double-strand, and then ligates with the Cas9 vector. The Cas9 vector is used to introduce the gRNA and CRISPR system into the target cell. The Cas9 protein will be found under the guidance of the gRNA The matching DNA sequence is cut to realize the NGL gene knockout.

2. The vector contains a puromycin resistance gene. Puromycin can be used to screen cells, and cells that have not been transferred into the vector can be screened out.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 shows the Western Blot results of Raji cells in the control and experimental groups.

Embodiments of the invention

The present invention is described in further detail below with reference to the embodiments and the accompanying drawings, but the embodiments of the present invention are not limited thereto.

All cell lines used in the examples were purchased from ATCC, px459 vector was purchased from Addgene, endonuclease Bbs I was purchased from Thermo, Endo-Free Plasmid Mini Kit was purchased from Omega-biotek, Lipofectamine 2000 was purchased from Invitrogen, T4 DNA ligase Commercially available from NEB and puromycin from Sigma.

Example 1: Targeting NGL genetic gRNA design

According to the genomic sequence of human NGL gene, a gRNA targeting human NGL gene was designed. The 20nt oligonucleotide gRNA targeting sequence is: NGL-gRNA: 5'- AGCTGAGATTCCCCTCCATT -3 ', then add CACC to its 5' end to obtain a forward oligonucleotide, and 5 'to its reverse complementary sequence Add AAAC to the end. The above-mentioned forward oligonucleotide and reverse oligonucleotide were synthesized separately, denatured at 95 ° C, and annealed to form a double-stranded DNA molecule that can be ligated into the px459 vector.

Example 2: Constructing expressions gRNA Carrier

The px459 vector has a Bbs I digestion site and is digested with Bbs I. The digestion system (20 μl) is: Bbs I 1 μL; 10 × FastDigest buffer 2 μL; plasmid 1 μg; ddH2O supplemented to 20 μl; digestion conditions are: : Digestion for 1 h at 37 ° C. After the digestion is completed, the gel is recovered and purified.

The digested vector px459 and the annealed double strand obtained in Example 1 were ligated with T4 ligase. The ligation system (10 μl) was: annealed double strand (NGL-gRNA) 2 μl, px459 vector 2 μl, 10 × T4 DNA Ligase Buffer 1 μl, T4 DNA Ligase 1 μl, ddH2O to make up to 10 μl; ligation conditions: ligation at 16 ° C overnight.

The ligation product is transformed into competent cells Top 10, the specific transformation method is: take out the competent cells Top 10 at -80 ° C, and dissolve in an ice bath; then take 50 μl of competent cells and add 1 μl of the above-mentioned ligation products, mix them in an ice bath 30min; 42 ℃ water bath for 60 s, do not shake during the process; cool in ice bath for 2 min; then add 800 μl LB medium, shake at 37 ℃ for 30min; coat with LB plate containing 100 μg / ml ampicillin overnight, pick positive After cloning, the cells were shaken overnight at 37 ° C for expansion and sent for sequencing. The correct sequencing is the required Cas9 vector that targets the NGL gene, and is named px459-NGL vector.

Example 3: Endotoxin-free plasmid DNA Preparation

The correct strain was sequenced and identified in Example 2 and placed in an LB liquid medium having an ampicillin concentration of 100 μg / ml, and cultured at 250 rpm and 37 ° C. with shaking for 12-16 hours. Collect the bacterial solution by centrifugation at 10,000 rpm at 4 ° C, discard the supernatant, collect the bacterial cells, and then extract the plasmid according to the instructions of the Endo-Free Plasmid Mini Kit kit to obtain an endotoxin-free px459-NGL vector.

Embodiment 4: Raji Transfection of cells

Cultivate Raji cells until the fusion rate of Raji cells reaches 50% to 60%. The optimal transfection time is 12 to 18 hours after inoculation. Change the fresh culture medium before transfection. Add 3 ml medium to a 60 mm culture dish. Transfection 4 μg of px459-NGL plasmid was introduced according to the instructions of the Lipofectamine 2000 kit. 48 hours after transfection, 1 μg / ml puromycin was added for screening for 7 days. After the screening was completed, the concentration of puromycin was reduced to 0.5 μg / ml and the cells were expanded.

Embodiment 5: Western Blot Detection of transfection effect

The Raji cells without any treatment were used as the control group, and the cells selected in Example 4 were used as the experimental group. 100-200 μl of 5 × SDS-PAGE loading buffer was added, and boiled in boiling water for 5 minutes, and 15 μl of SDS was loaded. -PAGE protein electrophoresis. After electrophoresis, semi-dry transfer with conventional protein, blocking with 10% skimmed milk powder for 2 h, place the blocked PVDF membrane in rabbit anti-human NGL antibody, rinse the buffer 3 times, and then transfer the membrane to goat anti-rabbit secondary antibody Buffer, incubate at room temperature for 60 min, and rinse 4 times with rinsing buffer. After the rinsing was completed, the Western blot membrane was developed and detected by ECL, and the results are shown in FIG. 1. It can be seen that the NGL protein band cannot be detected by Western Blot in the NGL frameshift gene mutant Raji cells, while the NGL protein band appears in the control group, indicating that the gRNA sequence used to knock out the NGL gene of human cells can achieve NGL Gene knockout.

Industrial applicability

Compared with the prior art, the present invention has the following advantages and effects:

1. The present invention designs and synthesizes two single-stranded oligo sequences according to the gRNA-directed sequence, anneals to form a double-strand, and then ligates with the Cas9 vector. The Cas9 vector is used to introduce the gRNA and CRISPR system into the target cell. The Cas9 protein will be found under the guidance of the gRNA The matching DNA sequence is cut to realize the NGL gene knockout.

2. The vector contains a puromycin resistance gene. Puromycin can be used to screen cells, and cells that have not been transferred into the vector can be screened out.

Claims (5)

1. A gRNA targeting sequence specifically targeting human NGL gene is characterized in that the gRNA targeting sequence specifically targeting human NGL gene is NGL-gRNA, and its nucleotide sequence is:

   NGL-gRNA: 5'- AGCTGAGATTCCCCTCCATT -3 '.
2. A method for knocking out the human NGL gene by using the CRISPR / Cas9 system, which comprises the following steps:

   a. Adding CACC to the 5 ′ end of the gRNA guide sequence according to claim 1 to obtain a forward oligonucleotide; obtaining the corresponding complementary DNA strand according to the guide sequence, and adding AAAC to the 5 ′ end to obtain a reverse oligonucleotide. To the oligonucleotide; synthesize the above-mentioned forward oligonucleotide and reverse oligonucleotide, respectively, and denature the synthesized forward oligonucleotide and reverse oligonucleotide, and anneal to form a double strand;

   b. ligating the double strand prepared in step a with the Cas9 vector to obtain a recombinant knockout expression vector;

   c. The recombinant knockout expression vector prepared in step b is transfected into the target cells, and puromycin is selected to obtain cells that successfully knocked out the NGL gene.
3. The method for knocking out a human NGL gene by using the CRISPR / Cas9 system according to claim 2, wherein the Cas9 vector in step b is a px459 vector.
4. The method for knocking out human NGL genes by using the CRISPR / Cas9 system according to claim 2, wherein the target cell in step c is a Raji cell.
5. The method for knocking out human NGL genes using the CRISPR / Cas9 system according to claim 2, wherein the concentration of said puromycin in step c is 1.0 μg / ml.