WO2019234274A1 - Modèle prédictif pour prédire le développement du diabète sucré de type 2 au moyen de miarn - Google Patents

Modèle prédictif pour prédire le développement du diabète sucré de type 2 au moyen de miarn Download PDF

Info

Publication number
WO2019234274A1
WO2019234274A1 PCT/ES2019/070374 ES2019070374W WO2019234274A1 WO 2019234274 A1 WO2019234274 A1 WO 2019234274A1 ES 2019070374 W ES2019070374 W ES 2019070374W WO 2019234274 A1 WO2019234274 A1 WO 2019234274A1
Authority
WO
WIPO (PCT)
Prior art keywords
mir
pcr
seq
mirnas
dmt2
Prior art date
Application number
PCT/ES2019/070374
Other languages
English (en)
Spanish (es)
Inventor
Oriol Alberto RANGEL ZÚÑIGA
Elena María YUBERO SERRANO
José LÓPEZ MIRANDA
Pablo PÉREZ MARTÍNEZ
Antonio CAMARGO GARCÍA
Rosa JIMÉNEZ LUCENA
Juan Francisco ALCALÁ DÍAZ
Javier DELGADO LISTA
Ana LEÓN ACUÑA
José David TORRES PEÑA
Antonio GARCÍA RÍOS
Francisco GÓMEZ DELGADO
Original Assignee
Servicio Andaluz De Salud
Universidad de Córdoba
Consorcio Centro de Investigación Biomédica en Red, M.P.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Servicio Andaluz De Salud, Universidad de Córdoba, Consorcio Centro de Investigación Biomédica en Red, M.P. filed Critical Servicio Andaluz De Salud
Publication of WO2019234274A1 publication Critical patent/WO2019234274A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers

Definitions

  • the present invention belongs to the field of biomedicine, and more specifically it relates to markers to identify the individuals at greater risk of developing type 2 diabetes mellitus.
  • miRNAs as disease biomarkers was first introduced and demonstrated in cancer, but previous studies have suggested circulating miRNAs (in plasma or serum) as potential biomarkers for the diagnosis of type 2 diabetes mellitus (DMT2) .
  • DMT2 type 2 diabetes mellitus
  • Zhang et al [Biochem Biophys Res Commun. (2015) 463 (1-2)] through a cross-sectional study that included 40 subjects (20 diagnosed with pre-diabetes and 20 diagnosed with DMT2) observed differences in expression between groups in miR126 levels. This paper suggests the possibility of using miR126 as a diagnostic and prediction biomarker. Further findings by the same authors, after a 2-year follow-up study, suggest the use of miR126 to differentiate between DMT2 and normoglycemic subjects [Biomed Res Int. (2013) 761617]. Initially, Zhang et al is based on a cross-sectional study without monitoring the development of the disease.
  • Liu et al (Int J Mol Sci (2014) 15 10567-77), suggests the same differences in miR126 expression between these three groups of subjects. In this 6-month longitudinal study, the intervention with diet and physical exercise stands out. Liu et al suggests a model that allows differentiating between diabetics, pre-diabetics and normoglycemic subjects, which includes the miR126 added to conventional diabetes prediction variables (blood glucose, HbA1c, age, gender and BMI). However, variables such as diet and physical exercise are not included in the model, which were study variables with a six-month follow-up. The inclusion of these variables could significantly modify the sensitivity and specificity of the proposed model.
  • FIG. 1 The orthogonal partial least squares discriminant analysis (OPLS-DA) was used to compare the circulating levels of miRNAs at the start of the study between incident cases of DMT2 (gray circle) and subjects without DMT2 (black circle) during the period of follow up.
  • the quality of the models obtained by OPLS-DA was evaluated using the parameters of R 2 and Q 2 .
  • the miRNAs with VI P> 1 score were considered important for differentiating between groups (Table in Figure 1).
  • the data was processed using SIMCA-P + (version 14.0.0.1359; Umetrics, Umea, Sweden).
  • FIG. 1 Levels of circulating miRNAs at the start of the study according to the year in which patients were diagnosed with DMT2.
  • the data represent the mean ⁇ typical error of the mean and correspond to the ANOVA analysis of a factor.
  • subjects who developed DMT2 Incidents DMT2
  • subjects who did not develop DMT2 not DMT2.
  • Statistical significance was assessed using the Mann-Whitney U test and those p values ⁇ 0.05 were considered significant.
  • FIG. 3 ROC analysis and classification by average importance of the variables included in the ROC model based on miRNAs + HbA1c.
  • Panel A shows the comparison between the AUC of the ROC curves of three models: red line, model based on miRNAs + HbA1c; green line, model based on clinical parameters; and blue line, model based on FINDRISC.
  • panel B you can see the average importance classification of the variables included in the ROC curve.
  • FIG. 4 Disease-free probability analysis through a COX regression model based on six miRNAs.
  • the data represent circulating levels for each miRNA per tertiles, low levels (T1), medium levels (T2) and high levels (T3).
  • the analysis was carried out using SPPS (now PASW Statistic for Windows (version 21.0)) (IBM, Chicago, Illinois) and adjusted for diet, age, sex, BMI, TG, HDL and glycosylated hemoglobin (HbA1c).
  • FIG. 1 Disease-free probability analysis through a multi-miRNA regression model including miR-103, miR-28-3p, miR-29a, miR-9, miR-150 and miR-30a-5p.
  • a first aspect of the invention relates to the use of miR-9 miR-28-3p; miR-29a; miR-103; miR-223; miR-126; miR-375; miR-30a-5p and miR-150, or any combination thereof; to differentiate between subjects who develop DMT2 and those who do not develop it.
  • the profile of all 9 miRNAs is used together with glycosylated hemoglobin (HbA1c) simultaneously ( Figure 1 and 3).
  • the plasma levels of miR-9 miR-28-3p; miR-29a; miR-103; miR-223; miR-126; miR-375 are significantly lower in patients who develop DMT2, compared to those patients who do not develop it.
  • the levels of miR-30a-5p and miR-150 are significantly higher in patients who develop DMT2, compared to those patients who do not develop it.
  • miR-9s are also used; miR-28-3p; miR-29a; miR-103; miR-30a-5p and miR-150 or any combination thereof; to detect individuals with a higher risk of developing DMT2.
  • the profile of all 6 miRNAs are used simultaneously.
  • HbA1c glycosylated hemoglobin
  • the authors of the present invention have identified, for the first time, a signature of nine circulating miRNAs, which are powerful predictive biomarkers in the development of DMT2; being a more sensitive tool than those currently used in clinical practice to predict the development of the disease, as demonstrated in our study ( Figure 3).
  • they have identified a profile of circulating miRNAs which, added to HbA1c, have the ability to differentiate between individuals with greater or lesser risk of developing DMT2 (Figure 3).
  • the authors performed ROC curve analysis and developed a predictive model that includes 9 miRNAs (miR-9, miR-28-3p; miR-29a; miR-103, miR-15a; miR- 223; miR-126; miR-145; miR-375) which together with HbA1c, has a higher predictive value than using only HbA1c levels or only FINDRISC or Finnish Diabetes Risk Score (FINDRISC) (Lindstrom, J. Tuomilehto 2003. Diab Care, 26 (2003), pp 725-731).
  • the sequences of the miRNAs are as follows:
  • hsa-m ⁇ R103 AGCAGCAUUGUACAGGGCUAUGA hsa-m ⁇ R-103a-3p
  • hsa-m ⁇ R223 UGUCAGUUUGUCAAAUACCCCA hsa-m ⁇ R-223-3p
  • hsa-miR29a UAGCACCAUCUGAAAUCGGUU cgr-m ⁇ R-29a-3p
  • hsa-m ⁇ R28-3p CACUAGAUUGUGAGCUCCUGGA hsa-m ⁇ R-28-3p
  • hsa-m ⁇ R150 CUGGUACAGGCCUGGGGGACAG hsa-m ⁇ R-150-3p
  • hsa-miR30a-5p UGUAAACAUCCUCGACUGGAAG hsa-m ⁇ R-30a-5p
  • hsa-m ⁇ R375 UUUGUUCGUUCGGCUCGCGUGA hsa-m ⁇ R-375
  • hsa-m ⁇ R126 UCGUACCGUGAGUAAUAAUGCG mmu-m ⁇ R-126a-3p
  • Another aspect of the invention relates to an in vitro method for identifying individuals susceptible to developing DMT2, which comprises measuring the circulating levels of miR-9 miR-28-3p; miR-29a; mi R-103] miR-150 and miR-30a-5p in a biological sample isolated from said individual, where low levels of the first 4 and high levels of the last 2 indicate an increased risk in the individual of developing DMT2.
  • Another aspect of the invention relates to the in vitro model for the diagnosis, prediction and / or prognosis of DMT2 in an individual comprising measuring the circulating levels of the 9 miRNAs: miR-9; miR-28-3p; miR-29a; miR-103; miR-15a; miR-223; miR-126; miR-145; miR-375, in an isolated biological sample of said individual, and also includes assigning individuals who have levels lower than those described hereinbefore to the group of individuals with a predisposition to develop DMT2. More preferably it comprises adding to the miRNA levels, the plasma levels of glycosylated hemoglobin (HbA1c).
  • HbA1c glycosylated hemoglobin
  • BMI body mass index
  • HDL cholesterol-HDL
  • SCORE -12.897125 + hsam ⁇ R103 * 0.001463 + hsam ⁇ R223 * -0.009799 + hsam ⁇ R29a * - 0.011630 + hsam ⁇ R28-3p * -0.001136 + hsamR126 * -0.019230 + hsam ⁇ R150 * 0.559287 + hsam ⁇ R150 -5p * 0.033738 + hsam ⁇ R375 * -0.014507 + hsam ⁇ R9 * -0.072493 + Age * 0.006753 + Gender * 0.331970 + diet * 0.208350 + BMI * 0.038656 + Waist perimeter * 0.014300 + Triglycerides * 0.004072 + HDL * -0.002205 + HbA1c * 1.447587.
  • the biological sample is plasma.
  • the invention also relates to the in vitro model for the diagnosis, prediction and / or prognosis of DMT2 in an individual measuring the circulating levels of miR-30a-5p and miR-150 in a biological sample isolated from said individual and, in addition, includes assigning individuals who have levels greater than 1, 2 times, to the levels of the same marker in a reference sample, to the group of individuals, with the highest risk of developing DMT2.
  • the biological sample is plasma.
  • a “biological sample”, as defined herein, refers to samples of body fluids may be blood, plasma, serum, urine, sputum, cerebrospinal fluid, milk, sweat, tears, peritoneal fluid, sweat, tears and feces or samples of ductal fluid and can also be fresh, frozen or fixed.
  • the biological sample is selected from among biological samples including different types of tissue samples, as well as biological fluid samples, such as blood, plasma, serum, urine, sputum, cerebrospinal fluid, milk, sweat, tears, peritoneal fluid, sweat, tears and feces, or any combination thereof.
  • biological fluid samples such as blood, plasma, serum, urine, sputum, cerebrospinal fluid, milk, sweat, tears, peritoneal fluid, sweat, tears and feces, or any combination thereof.
  • said samples are biological samples of blood, serum or plasma.
  • the isolated biological sample is the plasma of said individual.
  • miRNA levels can be obtained by microarray expression profiles, PCR, reverse transcriptase PCR, real time reverse transcriptase PCR, quantitative real time PCR, point PCR final, endpoint multiplex PCR, coid PCR, ice coid PCR, mass spectrometry, in situ hybridization (ISH), in situ multiplex hybridization or nucleic acid sequencing.
  • microarray expression profiles PCR, reverse transcriptase PCR, real time reverse transcriptase PCR, quantitative real time PCR, point PCR final, endpoint multiplex PCR, coid PCR, ice coid PCR, mass spectrometry, in situ hybridization (ISH), in situ multiplex hybridization or nucleic acid sequencing.
  • the levels of miRNAs can be obtained by:
  • miRNA levels are obtained by real-time reverse transcriptase PCR (RT-qPCR).
  • RT-qPCR real-time reverse transcriptase PCR
  • Other techniques could be, but not limited to, combined RT with LAMP, or some new technique such as LASH (ligase-assisted sandwich hybridization (LASH).
  • LASH ligase-assisted sandwich hybridization
  • the expression of miRNA is normalized.
  • Another aspect of the invention relates to a method for classifying a human subject into one of two groups, in which group 1 comprises the subjects that can be identified by any of the methods described above and in which group 2 represents the subjects remaining.
  • Another aspect of the invention relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a therapeutic agent suitable for treating a human subject of group 1 that can be identified by any of the methods described above.
  • kit or device of the invention comprising at least one oligonucleotide capable of hybridizing with (miR-9, SEQ ID: dme-miR-9a-5p; m ⁇ R-28-3p, SEQ ID: hsa-miR-28-3p; miR-29a, SEQ ID: oar-miR-29a; miR-103, SEQ ID: hsa-miR-103a-3p; miR-223 , SEQ ID: hsa-miR-223-3p; miR-126, SEQ ID: mmu-miR-126a-3p; miR-375, SEQ ID: hsa-miR-375; miR-30a-5p, SEQ ID: hsa -miR-30a-5p and miR-150, SEQ ID: hsa-miR-150-3p), and means for detecting said hybridization.
  • kit or device of the invention comprising at least one oligonu
  • kit or device to identify the individuals most at risk of developing DMT2, using any of the methods described above.
  • Another aspect of the invention relates to a computer program comprising program instructions to make a computer carry out the method according to the method of the invention.
  • the invention encompasses computer programs arranged on or within a carrier.
  • the carrier can be any entity or device capable of supporting the program.
  • the carrier may be constituted by said cable or other device or means.
  • the carrier could be an integrated circuit in which the program is included, the integrated circuit being adapted to execute, or to be used in the execution of, the corresponding processes.
  • the programs could be incorporated into a storage medium, such as a ROM, a CD ROM or a semiconductor ROM, a USB memory, or a magnetic recording medium, for example, a floppy disk or a disk hard.
  • a storage medium such as a ROM, a CD ROM or a semiconductor ROM, a USB memory, or a magnetic recording medium, for example, a floppy disk or a disk hard.
  • the programs could be supported on a transmissible carrier signal.
  • it could be an electrical or optical signal that could be transported through an electrical or optical cable, by radio or by any other means.
  • the invention also extends to computer programs adapted so that any processing means can implement the methods of the invention.
  • Such programs may have the form of source code, object code, an intermediate source of code and object code, for example, as in partially compiled form, or in any other form suitable for use in the implementation of the processes according to the invention .
  • Computer programs also cover cloud applications based on that procedure.
  • Another aspect of the invention relates to a computer-readable storage medium comprising program instructions capable of causing a computer to carry out the steps of the method of the invention.
  • Another aspect of the invention relates to a transmissible signal comprising program instructions capable of causing a computer to carry out the steps of the method of the invention.
  • CORDIOPREV study is a controlled, prospective, randomized, simple, blind dietary intervention study developed in 1002 Patients with CHD (high cardiovascular risk), aged between 20 and 75 years, who had their last coronary event within Six months before inclusion in the study, without serious illnesses and life expectancy of less than five years.
  • CHD high cardiovascular risk
  • the subjects were randomized into two different dietary models (Mediterranean diet and low-fat and high-carbohydrate diet).
  • the intervention phase is still in progress and will have a median follow-up of seven years.
  • the study was conducted with all 462 non-diabetic patients (n 462) at the start of the CORDIOPREV study. After a 60-month follow-up period, 43 subjects were diagnosed with DMT2 during the first year, 24 in the second year, 11 in the third year, 19 in the fourth year and 10 in the fifth year, for a total of 107 subjects who developed DMT2 (incidents-DMT2). Subjects were diagnosed based on an annual tolerance test for glucose (OGTT) and following the criteria established by the American Diabetes Association (ADA).
  • OGTT annual tolerance test for glucose
  • ADA American Diabetes Association
  • the remaining 355 subjects did not develop T2DMT2 during the study period and were used as a control group (non-DMT2).
  • the initial characteristics of the subjects in the study are shown in Table 1.
  • LDLc CT- (HDL + TG / 5).
  • Glucose measurements were made using the hexokinase method.
  • the hs-C reactive protein (hs-CRP) was determined by high sensitivity ELISA (BioCheck, Inc., Foster City, CA, USA). Plasma insulin concentrations were measured by enzymatic microparticle immunoassay (Abbott Diagnostics, Matsudo-shi, Japan). The concentrations of non-esterified fatty acid were measured by colorimetric enzymatic assay (Roche Diagnostics, Penzberg, Germany). ApoA-1 and ApoB concentrations were determined by immunoturbidimetry.
  • ISI 10,000 ⁇ V ([fasting plasma insulin X fasting plasma glucose] X [mean glucose in OGTT X average insulin in OGTT]).
  • IGI insulingenic index
  • IGI [30 min fasting insulin-insulin (pmol / 1)] / [30 min fasting glucose (mmol / 1)].
  • the function of beta cells was estimated by calculating the readiness index (DI) as follows:
  • DI ISI x [AUC30 min insulin / AUC30 min glucose],
  • AUC30 min is the area below the curve between the baseline and 30 min of the OGTT for insulin (pmol / I) and glucose (mmol / I), respectively, calculated by the trapezoidal method.
  • the indices used to determine specific tissue IR were the hepatic insulin resistance index (HIRI) and the insulin muscle sensitivity index (MISI), which were calculated as described in the previous work of our group and following the methods described by Matsuda and DeFronzo for HIRI and Abdul-Ghani and collaborators for MISI.
  • the FINDRISC index was calculated following the indications published by Lindstróm, et al, in 2003.
  • the miRNA expression study was carried out in 24 miRNAs, which, based on a literature search, were selected according to their association with insulin sensitivity, insulin secretion, inflammation and growth and proliferation of beta cells (Table 4).
  • the levels of circulating miRNAs were determined in RNA samples obtained from plasma samples and following the protocol of the miRNeasy Mini Kit (Qiagen, Hilden, Germany).
  • 200 pL of EDTA-plasma was mixed with 1 mL of Qiazol, incubated for 5 min at room temperature and subsequently mixed with 200 pL of chloroform.
  • 2 pg of MS2 RNA (Roche, Mannheim, Germany) was added before the chloroform step.
  • the organic and aqueous phase were then separated by centrifugation at 12,000 g for 15 minutes, at 4 ° C.
  • RNA was precipitated by the addition of 100% ethanol.
  • the mixture was applied to a miRNeasy Mini rotating column and centrifuged at 8,000 g for 2 min. TO Next, 700 ml of RWT buffer was added to the RNeasy MinElute centrifuge column at 8,000 g for 2 min. It was then washed again with 500 pL of RPE buffer and 500 pL of 80% ethanol.
  • RNA was eluted in 14 pL of RNase-free water. The purity and concentration of the RNA were evaluated by spectrophotometry using NanoDrop ND-2000 (ThermoFisher, Waltham, MA). RNA retrotranscription was carried out using the TaqMan Reverse Transcription Kit (Life Technologies, Carlsbad, CA, USA). The RT mix contains 2 pL RNA and 3 pL RT from the group of custom primers with a final volume of 7.5 pL.
  • the RT primer set was selected from specific primers of our set of target miRNAs in the database (https://www.thermofisher.com/en/en/home/life-science/pcr/real-time-pcr/ real-time-pcrassavs / mirna-ncrna-taqman-assays.html).
  • the plates were incubated in the iQ5 thermal cycler (Bio-Rad Laboratories, Inc., Hercules, CA, USA) at 16 ° C for 30 minutes, then 42 ° C for 30 minutes at, and finally at 85 ° C for 5 min; In this step, the cDNA was stored at -20 ° C for a maximum time of one week. Then, we prepare a mixture containing 10 ml of customized PreAmp primers, with a specific group for our set of target miRNAs, and 7.5 pL of RT mix and 20 pL of TaqMan PreAmp Master Mix (Life Technologies, Carlsbad, CA, USA). ) Up to a final volume of 40 pL.
  • the mixture was incubated in the Thermocycler iQ5 using the following steps: denaturation at 95 ° C for 10 min; then 55 ° C for 2 min and 72 ° C for 2 min; followed by 20 cycles of amplification (15 seconds at 95 ° C and 4 minutes at 60 ° C per cycle) and finally incubated 99.9 ° C for 10 minutes.
  • the preamplified products were then diluted with RNase-free water in a ratio of 1: 40 and used for real-time RT-PCR reactions.
  • miR-143 and miR-144 were selected as those with more stable CT values and used as reference (using the method Bestkeeper) to calculate the relative expression of the remaining 15 miRNAs.
  • Relative expression data was analyzed using OpenArray® Real-Time qPCR Analysis Software (Life Technologies, Carlsbad, CA, USA).
  • the orthogonal partial least squares discriminant analysis was used to compare the levels of miRNAs, in order to analyze the differences between incident patients-DMT2 and without DMT2 during follow-up.
  • the quality of the models obtained by OPLS-DA was evaluated by studying the parameters R 2 and Q 2 .
  • the miRNAs with a VIP> 1 were considered important to differentiate between groups.
  • the risk ratio (HR) was compared in the analysis between C1 versus C2 and C1 versus C3.
  • Linear regression and COX regression analyzes were adjusted for age, sex, diet, glycosylated hemoglobin (HbA1c), BMI, triglycerides, c-HDL and waist circumference. P values 0.05 were considered statistically significant.
  • ROC feature analysis Operative function
  • the models were corrected by those covariates that were allowed avoiding over-estimation of information, the set of covariates included: diet, age, sex, BMI, c-HDL, TG, HbA1c and waist circumference.
  • the degree of excess optimism was estimated by initial resampling of the original set (1000 randomized samples).
  • BMI body mass index
  • c-HDL high density lipoprotein
  • c-LDL low density lipoprotein
  • TG triglycerides
  • Apo A1 Apolipoprotein A1
  • Apo B apolipoprotein B
  • hs-CRP high sensitivity C-reactive protein
  • HbA1 c glycosylated hemoglobin
  • HIRI liver insulin resistance index
  • MISI muscle insulin sensitivity index
  • ISI insulin sensitivity index
  • IGI insulingenic index
  • DI readiness index
  • HOMA-IR insulin evaluation of resistance homeostasis model
  • HbA1c glycosylated hemoglobin
  • GLU glucose
  • HOMA-B homeostasis model evaluation - beta cell function
  • HOMA-IR homeostasis model insulin resistance evaluation
  • MIRI muscle insulin resistance index
  • IGI insulingenic index
  • ISI insulin sensitivity index
  • DI index provision
  • HIRI liver insulin resistance index. * p ⁇ 0.05. Correlation analysis performed by a linear regression model adjusted for age, body and gender mass index (BMI), triglycerides (TG) and high density lipoproteins (c-HDL), using SPSS (now PASW Statistic for Windows (version 21.0)) (IBM, Chicago, Illinois).

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Biomedical Technology (AREA)
  • Urology & Nephrology (AREA)
  • General Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Hematology (AREA)
  • Medicinal Chemistry (AREA)
  • Food Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Pathology (AREA)

Abstract

La présente invention porte sur des marqueurs et sur une méthode de prédiction ou de pronostic d'individus présentant un risque majeur de développer le diabète sucré, une trousse ou un dispositif et ses utilisations.
PCT/ES2019/070374 2018-06-04 2019-06-03 Modèle prédictif pour prédire le développement du diabète sucré de type 2 au moyen de miarn WO2019234274A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
ESP201830540 2018-06-04
ES201830540 2018-06-04

Publications (1)

Publication Number Publication Date
WO2019234274A1 true WO2019234274A1 (fr) 2019-12-12

Family

ID=68770736

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/ES2019/070374 WO2019234274A1 (fr) 2018-06-04 2019-06-03 Modèle prédictif pour prédire le développement du diabète sucré de type 2 au moyen de miarn

Country Status (1)

Country Link
WO (1) WO2019234274A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11553759B2 (en) 2018-06-08 2023-01-17 Decathlon Method for producing a shoe and shoe that can be obtained by said method

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
CAMARGO A ET AL.: "Circulating miRNAs as predictive biomarkers of type 2 diabetes mellitus development: from the CORDIOPREV study", EUROPEAN JOURNAL OF CLINICAL INVESTIGATION 20180501, vol. 48, no. 1, 5 January 2018 (2018-01-05), pages 205, XP055665476, ISSN: 1365-2362 *
CHIEN HUNG- YU ET AL.: "Circulating microRNA as a diagnostic marker in populations with type 2 diabetes mellitus and diabetic complications", JOURNAL OF THE CHINESE MEDICAL ASSOCIATION: JCMA NETHERLANDS, vol. 78, no. 4, 31 March 2015 (2015-03-31), pages 204 - 211, ISSN: 1728-7731 *
JIMENEZ-LUCENA ROSA ET AL.: "Circulating miRNAs as Predictive Biomarkers of Type 2 Diabetes Mellitus Development in Coronary Heart Disease Patients from the CORDIOPREV Study", MOLECULAR THERAPY. NUCLEIC ACIDS UNITED STATES, vol. 12, 9 July 2018 (2018-07-09), pages 146 - 157, XP055665479, ISSN: 2162-2531, Retrieved from the Internet <URL:https://www.sciencedirect.com/science/article/pii/S2162253118300994?via%3Dihub> [retrieved on 20190805] *
ZHU HONGMEI ET AL.: "Identification of microRNA biomarkers in type 2 diabetes: a meta-analysis of controlled profiling studies", DIABETOLOGIA, 20150213, vol. 58, no. 5, 13 February 2015 (2015-02-13), BERLIN, DE, pages 900 - 911, XP035479131, ISSN: 0012-186X, DOI: 10.1007/s00125-015-3510-2 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11553759B2 (en) 2018-06-08 2023-01-17 Decathlon Method for producing a shoe and shoe that can be obtained by said method

Similar Documents

Publication Publication Date Title
Huo et al. Brain and blood metabolome for Alzheimer's dementia: findings from a targeted metabolomics analysis
Villard et al. Diagnostic value of cell-free circulating microRNAs for obesity and type 2 diabetes: a meta-analysis
Ashar et al. Association of mitochondrial DNA levels with frailty and all-cause mortality
TWI816927B (zh) 用於計算世系特異性之遺傳風險評分之媒體、方法及系統
Hromadnikova et al. Diabetes mellitus and cardiovascular risk assessment in mothers with a history of gestational diabetes mellitus based on postpartal expression profile of micrornas associated with diabetes mellitus and cardiovascular and cerebrovascular diseases
Hernández-Alonso et al. Chronic pistachio intake modulates circulating microRNAs related to glucose metabolism and insulin resistance in prediabetic subjects
Iida et al. A functional variant in ZNF512B is associated with susceptibility to amyotrophic lateral sclerosis in Japanese
EP3600472B1 (fr) Analyse et prédiction de lésions cérébrales traumatiques et de symptômes de commotion cérébrale
US11149313B2 (en) Methods of using miRNAs from bodily fluids for detection and differentiation of neurodegenerative diseases
JP2018157776A (ja) 代謝疾患の遺伝的リスク検出法
Han et al. Analysis of genetic mutations in Chinese patients with systemic primary carnitine deficiency
Qiu et al. Identification of differentially expressed genes in omental adipose tissues of obese patients by suppression subtractive hybridization
Divoux et al. MicroRNA‐196 regulates HOX gene expression in human gluteal adipose tissue
Jiang et al. Hyperhomocysteinemia and related genetic polymorphisms correlate with ulcerative colitis in Southeast China
Vasilopoulos et al. Association between polymorphisms in MTHFR and APOA5 and metabolic syndrome in the Greek population
Sakai et al. Development of novel diagnostic system for pancreatic cancer, including early stages, measuring mRNA of whole blood cells
Jørsboe et al. An LDLR missense variant poses high risk of familial hypercholesterolemia in 30% of Greenlanders and offers potential of early cardiovascular disease intervention
WO2019234274A1 (fr) Modèle prédictif pour prédire le développement du diabète sucré de type 2 au moyen de miarn
Liu et al. Physiological adjustments and circulating MicroRNA reprogramming are involved in early acclimatization to high altitude in Chinese Han Males
Cao et al. A genome-wide methylation study of body fat traits in the Norfolk Island isolate
Friedenberg et al. Use of RNA-seq to identify cardiac genes and gene pathways differentially expressed between dogs with and without dilated cardiomyopathy
US20210404006A1 (en) Salivary Extracellular Rna Biomarkers for Gingivitis
Yu et al. Transcriptomic changes in human renal proximal tubular cells revealed under hypoxic conditions by RNA sequencing
Norwood et al. Transcriptomic and bioinformatic analysis of Clcn7-dependent autosomal dominant osteopetrosis type 2. Preclinical and clinical implications
Tuzlukaya et al. PLASMA miR-103 AND miR-107 LEVELS IN OBESE CHILDREN: THE SIGN OF INSULIN RESISTANCE.

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19815765

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 19815765

Country of ref document: EP

Kind code of ref document: A1