WO2019224864A1 - Method for enhancing scn1a gene expression and method for treating dravet syndrome thereby - Google Patents

Abstract

Provided are a method for enhancing SCN1A gene expression and a method for treating Dravet syndrome using the aforesaid method. Also provided is RNA or RNA expression vector for enhancing SCN1A gene expression. Also provided are a cell in which SCN1A gene expression is enhanced and a cell preparation comprising the cell. More particularly, provided are: a method for treating Dravet syndrome by enhancing SCN1A gene expression in a parvalbumin-positive inhibitory interneuron using gRNA or crRNA targeting at least one Cas9 endonuclease binding site present on the promoter region of SCN1A gene; and a method for enhancing SCN1A gene expression for the aforesaid method.

Description

SCN1A gene expression enhancement method and treatment method for Drave syndrome

The present invention relates to a method for enhancing the expression of SCN1A gene and a method for treating Drave's syndrome thereby. The present invention also relates to an RNA or RNA expression vector for enhancing the expression of the SCN1A gene. The present invention further relates to a cell having enhanced expression of the SCN1A gene and a cell preparation containing the cell.

A decrease in the expression level of the SCN1A gene is known to cause epilepsy and social behavioral abnormalities (Ogiwara et al., J. Neuroscie., 27: 5903-5914, 2007, Ogiwara et al., Hum Mol. Genet., 22: 4784-4804, 2013, and Ito et al., Neurobiol. Dis., 49: 29-40, 2013). In order to improve the expression level of the SCN1A gene, it is conceivable to introduce the SCN1A gene into the cell, but it is a protein exceeding 200 kDa and it is difficult to introduce it into the cell because the gene size is large. In addition, the promoter region of the SCN1A gene is being analyzed, but it is a huge region of several tens of kilobp, and its control mechanism is still unclear (Nakayama T., et al., Hum. Mutat., 31). (7): 820-829, 2010).

CRISPR-on system has been developed as a method to enhance gene expression from intracellular genomic DNA (Cheng et al., Cell Research, 23: 1163-1171, 2013, Mali et al., Science, 339 (6121) : 823-826, 2013, and Konermann et al., Nature, 517 (7536): 583-588, 2015).

The present invention provides a method for specifically enhancing the expression of the SCN1A gene. The present invention also provides an RNA or RNA expression vector for specifically enhancing the expression of the SCN1A gene. The present invention further provides cells having enhanced expression of the SCN1A gene and cell preparations containing the cells.

The present inventors have found that the expression of the SCN1A gene can be remarkably enhanced when the CRISPR-on system is used with a plurality of sites in the promoter region of the SCN1A gene as target sequences. The present inventors have also found that the expression of the SCN1A gene can be effectively enhanced when any one or more of SEQ ID NOS: 1 to 8, particularly 4 or more are used as target sequences. Furthermore, the present inventors have found that Drave's syndrome can be treated by enhancing the expression level of the SCN1A gene in inhibitory neurons of Drave's syndrome model mice.

According to the present invention, for example, the following inventions are provided.
[1] A combination of RNAs, which is a combination of gRNA or crRNA targeting at least one Cas9 endonuclease binding site present on the promoter region of the SCN1A gene.
[2] The RNA combination according to [1] above, which is a combination of gRNA or crRNA targeting at least four Cas9 endonuclease binding sites present on the promoter region of the SCN1A gene.
[3] The RNA combination according to [1] or [2] above,
[1] One RNA selected from the group consisting of the following (1) to (4) or a combination of 2 to 4 RNAs:
[2] One RNA selected from the group consisting of the following (5) to (8) or a combination of two to four RNAs, or [3] 2 selected from the group consisting of the following (1) to (8) ~ 8 RNA combinations:
(1) gRNA or crRNA targeting the sequence represented by SEQ ID NO: 1,
(2) gRNA or crRNA targeting the sequence represented by SEQ ID NO: 2,
(3) gRNA or crRNA targeting the sequence represented by SEQ ID NO: 3,
(4) gRNA or crRNA targeting the sequence represented by SEQ ID NO: 4,
(5) gRNA or crRNA targeting the sequence represented by SEQ ID NO: 5,
(6) gRNA or crRNA targeting the sequence represented by SEQ ID NO: 6,
(7) gRNA or crRNA targeting the sequence represented by SEQ ID NO: 7, and (8) gRNA or crRNA targeting the sequence represented by SEQ ID NO: 8.
[4] The combination of RNAs according to [3] above, which is a combination of RNAs according to [1].
[5] The combination of RNAs described in [4] above, which includes all the gRNAs described in (1) to (4) or all the crRNAs described in (1) to (4).
[6] The combination of RNAs according to [3] above, which is a combination of RNAs according to [2].
[7] A combination of RNAs according to [5] above, comprising all the gRNAs according to (5) to (8) or all the crRNAs according to (5) to (8).
[8] The combination of RNA according to [3], which is a combination of four or more gRNAs selected from the group consisting of (1) to (8) or a combination of crRNAs Combination.
[9] The RNA combination according to any one of [1] to [8] above, wherein each RNA is gRNA.
[10] A combination of nucleic acids encoding each RNA contained in the RNA combination according to any one of [1] to [9] above.
[11] An RNA expression vector comprising each of the nucleic acids contained in the nucleic acid combination according to [10] capable of expression.
[12] A medicine or combination medicine comprising the RNA or the combination of RNAs according to any one of [1] to [9] above.
[13] A medicine or combination medicine comprising the RNA expression vector according to [11] above.
[14] A eukaryotic cell that stably expresses the RNA or the combination of RNAs described in [1] to [9] above.
[15] A cell preparation comprising the eukaryotic cell according to [14] above.
[16] The combination of the above [1] to [10], the RNA expression vector of [11], or the above [14] for use in treating a disease caused by a decrease in the expression level of the SCN1A gene A medicament comprising the eukaryotic cell described in 1.
[17] The medicine or combination medicine described in [12] or [13] or the cell preparation described in [15] for use in treating a disease caused by a decrease in the expression level of the SCN1A gene.
[18] The disease caused by the decreased expression level of the SCN1A gene is any one disease selected from the group consisting of Dravet syndrome, febrile convulsions plus, autism, intellectual disability, and epilepsy in Alzheimer's disease The medicine according to [16] above, or the medicine, combination medicine or cell preparation according to [17] above.
[19] The medicine or combination medicine according to [18] above, wherein the disease caused by a decrease in the expression level of the SCN1A gene is a decrease in the expression level of the functional SCN1A gene due to a nonsense mutation or a frameshift mutation of the SCN1A gene Or cell preparation.

FIG. 1 is a schematic diagram showing the translation start point and the upstream region of the human SCN1A gene. The positional relationship between multiple transcripts of the human SCN1A gene and the designed target sequence of gRNA is shown. FIG. 2 is a schematic diagram showing the translation start point and upstream region of the mouse Scn1a gene. The positional relationship between a plurality of transcripts of the mouse Scn1a gene and the target sequence of the designed gRNA is shown. FIG. 3 is a diagram showing the effect of increasing the transcript of the human SCN1A gene using the CRISPR-on system by semi-quantitative RT-PCR in human cultured cells (HEK293FT). FIG. 4 shows the effect of increasing the transcriptional product of the mouse Scn1a gene using the CRISPR-on system by semi-quantitative RT-PCR in mouse cultured cells (Neuro2A). FIG. 5 is a diagram showing the effect of increasing the transcription product of the mouse Scn1a gene using the CRISPR-on system by Northern blot analysis. In mouse cultured cells (Neuro2A), when transcription was activated using a combination of four gRNAs for the mouse Scn1a gene, the expression level of the full-length transcription product (mRNA) of the gene could be greatly increased. FIG. 6 shows a schematic diagram of the construction of the targeting vector Ai-VPR prepared in Example and the insertion site on the genome. FIG. 7 shows that dCAS-VPR was expressed in Neuro2a cells. FIG. 8 shows that the expression of the endogenous SCN1A gene was improved using gRNA targeting dCAS-VPR and the promoter of the SCN1A gene. FIG. 9 shows the insertion strategy of targeting vector Ai-VPR into the wild type allele of mouse ES cells. FIG. 10 shows that 4 strains (5D, 5E, 7H and 9G) were obtained as ES cells into which Ai-VPR was inserted. FIG. 11 shows the design positions of each primer for verifying the production of transgenic mice expressing dCAS9-VPR in a CRE-dependent manner. FIG. 12 shows amplification products obtained by the primers described in FIG. 11 using the obtained transgenic mouse genome as a template. FIG. 13 shows the design positions of primers in dCAS9-VPR allele before and after recombination with Cre in Rosa26 allyl. FIG. 14 shows the amplification products by the primers described in FIG. 13 using the obtained transgenic mouse genome as a template. FIG. 15 shows that the obtained mouse expresses dCAS9-VPR in a Cre-dependent manner. FIG. 16 is a view of dCAS9-VPR positive cells observed in the olfactory bulb, cerebral cortex, hippocampus, striatum, and cerebellum by immunohistochemical staining. FIG. 17 shows a crossover method for obtaining a Drave syndrome syndrome mouse that expresses dCAS9-VPR in a Vgat-dependent manner. FIG. 18 shows the survival curves of mice of each genotype. In the figure, “dCAS” indicates that dCAS9-VPR has been incorporated, “1A” indicates that the one-sided allele of the SCN1A gene has a nonsense mutation of R1407X, and “Cre” indicates Vgat-Cre recombinase. Indicates that it has acted. FIG. 19 shows a method for constructing a gRNA-expressing adeno-associated virus (AAV) vector targeting the SCN1A gene. FIG. 20 shows the administration of a gRNA-expressing adeno-associated virus (AAV) vector targeting the SCN1A gene and the time schedule for various analyses. FIG. 21 shows the sensitivity of heat-induced seizures in the treatment and control groups. FIG. 22 shows the time course of the sensitivity of heat-induced convulsive seizures in the treatment group and the control group.

Detailed Description of the Invention

In this specification, “CRISPR / Cas9 system” is a clustered regularly interspaced short palindromic repeats / CRISPR-associated protein (CRISPR / Cas) system discovered as acquired immunity of eubacteria and archaea. System (Jinek, M., et al. (2012) Science 337, 816-821).
Specifically, a plurality of cassettes into which the fragmented foreign DNA (20 bp) has been incorporated are repeated in the genomic region called the bacterial CRISPR region, and different foreign DNAs are incorporated into each cassette. Yes.
Each cassette is considered to be generated by fragmenting DNA of a foreign organism (for example, phage) into cells and incorporating it into the CRISPR region.
Each cassette encodes CRISPR RNA (crRNA). crRNA has a protospacer sequence and a sequence complementary to trans-crRNA (tracrRNA) described later. The protospacer sequence is 20 nucleotides long and has a sequence complementary to the target DNA sequence. The protospacer sequence need not have 100% complementarity with the target sequence, and mismatch is allowed in the region of 6 nucleotides from the 5 ′ end. crRNA forms a complex with trans-crRNA (tracrRNA) that is separately transcribed via a complementary portion. The complex of crRNA and tracrRNA forms an additional complex with Cas9 endonuclease. The protospacer moiety in the crRNA hybridizes complementary to the foreign DNA, thereby leading the Cas9 endonuclease to the target sequence of the foreign DNA. The foreign DNA is cleaved by the Cas9 endonuclease at the site of the target sequence, and the CRISPR / Cas9 system protects the host from the foreign DNA.
As described above, the CRISPR / Cas9 system was discovered by eubacteria and archaea functioning as acquired immunity against new foreign DNA. By designing a protospacer made of foreign DNA, the genome of a mammal can be obtained. The CRISPR / Cas9 system has rapidly spread to the world as a genome editing system because it can be sequence-dependently cleaved and thereby the mammalian genome can be edited.
The system currently used mainly is the second type CRISPR / Cas9 system derived from S. pyogenes .

As used herein, “Cas9” means an endonuclease having an activity of cleaving DNA such as genomic DNA in the CRISPR / Cas9 system. As used herein, “Cas9” is synonymous with “Cas9 endonuclease” and is used interchangeably. The Cas9 endonuclease is hybridized to the target sequence in a complementary manner by a 20 bp protospacer from the 5 ′ side of the crRNA as described above, and the Cas9 endonuclease is guided to the target sequence. Cas9 endonuclease has two endonuclease domains (RuvC1-like nuclease domain and HNH-like nuclease domain), each of which cleaves each strand of double-stranded DNA, resulting in double-strand breaks in the target sequence. Introduce into DNA. The CRISPR / Cas9 system can lead the endonuclease Cas9 to foreign DNA in a sequence-specific manner, thereby degrading the foreign DNA.
The target sequence is generally known to have a protospacer adjacent motif (PAM) immediately thereafter. The PAM sequence is 5′-NGG (where N is A, T, G or C) in the case of S. pyogenes . PAM sequences vary depending on the species of Cas9 endonuclease.

As used herein, “dCas9” is Cas9 in which the endonuclease activity of the two endonuclease domains of the Cas9 endonuclease is inactivated. Amino acid mutations corresponding to D10A and H840A can be introduced into Cas9 to inactivate the endonuclease. The crRNA and tracrRNA lead dCas9 to the target sequence on the genomic DNA, but do not cleave the genomic DNA because it does not have endonuclease activity.
dCas9 can be used to recruit the transcriptional activation protein onto the genomic DNA in a sequence-specific manner by linking with the transcriptional activation protein.

In the present specification, “crRNA” means crRNA in the CRISPR / Cas9 system, and is RNA having a protospacer portion and a portion that hybridizes with tracrRNA. It is produced as pre-crRNA from the CRISPR region on the bacterial genome and processed into mature crRNA by the action of RNaseIII and the like. crRNA requires complex formation with tracrRNA to direct Cas9 endonuclease or dCas9 to the target sequence. The protospacer sequence of crRNA has a sequence complementary to the target sequence or its complementary strand (however, a mismatch of 1 to several bases is allowed).

In the present specification, “tracrRNA” means tracrRNA in the CRISPR / Cas9 system, and hybridizes with crRNA. It is transcribed as pre-trasrRNA from the CRISPR region on the bacterial genome and processed into mature tracrRNA by the action of RNaseIII and the like.

In the present specification, “gRNA” (guide RNA) is a single-stranded RNA obtained by linking crRNA and tracrRNA, and is sometimes referred to as a single-stranded guide RNA (sgRNA). In gRNA, crRNA and tracrRNA are hybridized under physiological conditions to form a hairpin structure at the junction. Cas9 can form a complex with gRNA having a hairpin structure. In gRNA, crRNA and tracrRNA to be ligated may be full-length, mature type, or matured by removing unnecessary sequences (mainly 3 ′ side) from mature type sequences. It is known that it may be a partial sequence of a type sequence (Jinek, M., et al. (2012) Science 337, 816-821). Since gRNA has crRNA and tracrRNA in the molecule and can bind to Cas9 endonuclease or dCas9, gRNA alone can lead Cas9 endonuclease or dCas9 to the target sequence.

In this specification, “CRISPR-on” or “CRISPR-ON” means transcriptional activity in a sequence-specific manner using a fusion protein of Cas9 (dCas9) in which endonuclease activity is inactivated and transcriptional activation protein. This refers to a system that binds a protein to a promoter region and thereby activates the expression of a gene driven by the promoter. The dCas9 fusion protein that can be used in the CRISPR-on system is not particularly limited, and examples thereof include a dCas9-VP48 fusion protein, a dCas9-VP64 fusion protein, a dCas9-VP96 fusion protein, a dCas9-VP160 fusion protein, and a dCas-VPR fusion protein. It is done.

As used herein, “subject” means a mammal, and in particular can be a human.

In the present specification, “treatment” is used to mean “treatment” and “prevention”. Therefore, in the present specification, the “pharmaceutical composition used for treating Drave syndrome” means a pharmaceutical composition (for example, a therapeutic or preventive agent for Drave syndrome) used for treating or preventing Drave syndrome. .
As used herein, “treatment” means treatment, cure, prevention or amelioration of a disease or disorder or a reduction in the rate of progression of a disease or disorder. As used herein, “prevention” means reducing the likelihood of the onset of a disease or condition or delaying the onset of a disease or condition.

In the present specification, the “SCN1A gene” is a gene encoding Nav1.1, which is one of the α subunits of voltage-gated sodium channels. Nav1.1 is known to be expressed in the central nervous system in humans. SCNA1 gene mutation is also called febrile convulsions + (Generalized Epilepsy with Febrile Seizures Plus: GEFS +) or Drave syndrome (formerly "infant severe myoclonic epilepsy", but this designation is sometimes called myoclony It has been observed in a wide range of epilepsy patients, including
Studies using heteroknock-in mice introduced with the nonsense mutation R1407X of Scn1a reveal that the Scn1a gene is responsible for epilepsy (Ogiwara et al., J. Neuroscie., 27: 5903-5914, 2007 ). In addition, it has been clarified that very severe epileptic symptoms occur in conditional knockout mice in which Scn1a is heteroknocked out only by inhibitory neurons (Ogiwara et al., Hum. Mol. Genet., 22: 4784-4804, 2013). It has also been clarified that mutations in the Scn1a gene cause a decrease in social behavior (Ito et al., Neurobiol. Dis., 49: 29-40, 2013). Therefore, a decrease in the expression level of functional Scn1a can cause these diseases.
In the present specification, the term “SCN1A gene” is used to include orthologs of mouse and other species of SCN1A gene in addition to human SCN1A gene.

In the present specification, the “promoter region of the SCN1A gene” means a region related to transcription activation or repression of the SCN1A gene. In the human SCN1A gene, it is known that there are four non-coding exons, exon A, exon B, exon C and exon D, upstream of the translation start point (Nakayama T., 開始 et al., Hum. Mutat., 31 (7): 820-829, 2010).

In this specification, “combination” means a combination of two or more different components. In combination, the components may be included in separate forms or mixed.

The present inventors have clarified that transcription of the SCN1A gene can be activated by the CRISPR-on system that targets a plurality of sites in the promoter region of the SCN1A gene. In particular, the present inventors have shown that transcription of the SCN1A gene can be activated by the CRISPR-on system that targets four or more sites in the promoter region of the SCN1A gene. In this CRISPR-on system, dCas-transcription activating protein fusion protein can be used as a common component. The dCas-transcription activating protein fusion protein can have a nuclear translocation signal. In this CRISPR-on system, the transcription of the SCN1A gene can be activated by providing as many crRNAs or gRNAs corresponding to the target sequences as the number of target sequences. The transcriptionally activated SCN1A gene can be a gene that encodes a functional or reduced function SCN1A.

Therefore, according to the present invention, an RNA that is a combination of gRNA or crRNA targeting at least one, two, three, or four or more Cas9 endonuclease binding sites present on the promoter region of the SCN1A gene A combination of is provided. Since the Cas9 endonuclease binding site may exist only immediately before the PAM sequence as described above, those skilled in the art should determine the promoter region sequence from among the sequences of the promoter region in consideration of the PAM sequence required by the Cas9 endonuclease. Can do.

In humans, among the promoter region of the SCN1A gene, in particular, the region upstream -1 to −600 of exon A (hereinafter sometimes referred to as “promoter region 1”) and the region upstream −1 to −600 of exon B ( The Cas9 endonuclease binding site present on (hereinafter sometimes referred to as “promoter region 2”) can be the target. Therefore, according to the present invention, at least one place, two places present on the region of −1 to −600 upstream of exon A and / or the region of −1 to −600 upstream of exon B of the promoter region of the SCN1A gene, Combinations of RNA are provided that are combinations of gRNAs or crRNAs that target three or more than four Cas9 endonuclease binding sites. Here, exon A is a region starting from the first base of, for example, variant 1 (Genbank accession number: NM_001165963.1) of the SCN1A transcript. Exon B is a region starting from the first base of, for example, variant 3 (Genbank accession number: NM_001165964.1) of the SCN1A transcript.
According to the present invention, an RNA that is a combination of gRNA or crRNA targeting at least one, two, three, or four or more of the Cas9 endonuclease binding sites present on the promoter region 1 of the SCN1A gene A combination of is provided.
Further according to the present invention, an RNA that is a combination of gRNA or crRNA targeting at least one, two, three, or four or more of the Cas9 endonuclease binding sites present on the promoter region 2 of the SCN1A gene A combination of is provided.

In the present invention, a combination of gRNA and a combination of crRNA are provided which have any one, two, three or four of the sequences shown in SEQ ID NOs: 1 to 4 in the promoter region 1 as target sequences. The present invention also provides gRNA and crRNA that target any one, two, three, or four of the sequences shown in SEQ ID NOs: 5 to 8 in the promoter region 2. The present invention further provides gRNA and crRNA targeting any one of 1, 2, 3, 4, 5, 6, 7, or 8 of the sequences represented by SEQ ID NOs: 1 to 8 in the promoter region. Is done. Hereinafter, all the terms “sequence represented by SEQ ID NO: n” can be read as “sequence on the promoter region of the SCN1A gene corresponding to the sequence represented by SEQ ID NO: n” (where n is 1 to 8). One of the integers). And gRNA or crRNA having a base sequence that hybridizes in a physiological environment to “a sequence on the promoter region of the SCN1A gene corresponding to the sequence represented by SEQ ID NO: n” is also referred to as “SEQ ID NO: n One skilled in the art will understand that they can be used in the same manner as gRNA or crRNA having the “sequence shown”.

According to the present invention,
The RNA or RNA combination of any of [1A]-[3A] is provided below:
[1A] one RNA selected from the group consisting of the following (1A) to (4A) or a combination of 2 to 4 RNAs (particularly a combination of 4 RNAs),
[2A] 1 RNA selected from the group consisting of the following (5A) to (8A) or a combination of 2 to 4 RNA (particularly a combination of 4 RNAs), or [3A] and below (1A) to (8A) 2-8 RNA combinations selected from the group consisting of (especially combinations of 4 or more RNAs):
(1A) gRNA targeting the sequence represented by SEQ ID NO: 1,
(2A) gRNA targeting the sequence shown in SEQ ID NO: 2,
(3A) gRNA targeting the sequence shown in SEQ ID NO: 3,
(4A) gRNA targeting the sequence shown in SEQ ID NO: 4,
(5A) gRNA targeting the sequence shown in SEQ ID NO: 5,
(6A) gRNA targeting the sequence shown in SEQ ID NO: 6,
(7A) gRNA targeting the sequence represented by SEQ ID NO: 7, and (8A) gRNA targeting the sequence represented by SEQ ID NO: 8.

According to the present invention,
The RNA or RNA combination of any of [1B]-[3B] is provided below:
[1B] one RNA selected from the group consisting of the following (1B) to (4B) or a combination of 2 to 4 RNAs (particularly a combination of 4 RNAs),
[2B] 1 RNA selected from the group consisting of the following (5B) to (8B) or a combination of 2 to 4 RNA (particularly a combination of 4 RNAs), or [3B] and below (1B) to (8B) 2-8 RNA combinations selected from the group consisting of (especially combinations of 4 or more RNAs):
(1B) crRNA targeting the sequence represented by SEQ ID NO: 1,
(2B) crRNA targeting the sequence shown in SEQ ID NO: 2,
(3B) crRNA targeting the sequence shown in SEQ ID NO: 3,
(4B) crRNA targeting the sequence shown in SEQ ID NO: 4,
(5B) crRNA targeting the sequence shown in SEQ ID NO: 5,
(6B) crRNA targeting the sequence shown in SEQ ID NO: 6,
(7B) crRNA targeting the sequence represented by SEQ ID NO: 7, and (8B) crRNA targeting the sequence represented by SEQ ID NO: 8.

Hereinafter, any RNA or combination of RNAs from [1B ′] to [3B ′] is provided:
[1B ′] a combination of one RNA selected from the group consisting of the following (1B) to (4B) or a combination of 2 to 4 RNAs (particularly a combination of 4 RNAs) and a nucleic acid encoding tracrRNA;
[2B ′] a combination of one RNA selected from the group consisting of the following (5B) to (8B) or a combination of 2 to 4 RNAs (particularly a combination of 4 RNAs) and a nucleic acid encoding tracrRNA, or [ 3B ′] a combination of 2 to 8 RNAs selected from the group consisting of the following (1B) to (8B) (particularly a combination of 4 or more RNAs) and a nucleic acid encoding tracrRNA:
(1B) crRNA targeting the sequence represented by SEQ ID NO: 1,
(2B) crRNA targeting the sequence shown in SEQ ID NO: 2,
(3B) crRNA targeting the sequence shown in SEQ ID NO: 3,
(4B) crRNA targeting the sequence shown in SEQ ID NO: 4,
(5B) crRNA targeting the sequence shown in SEQ ID NO: 5,
(6B) crRNA targeting the sequence shown in SEQ ID NO: 6,
(7B) crRNA targeting the sequence represented by SEQ ID NO: 7, and (8B) crRNA targeting the sequence represented by SEQ ID NO: 8.

In the present invention, gRNA and crRNA may have an RNA sequence complementary to the target sequence or its complementary strand at the 5 'end. The RNA sequence complementary to the target sequence of gRNA and crRNA or its complementary strand can be designed based on the sequence of the target sequence or its complementary strand.

In the present invention, nucleic acids encoding the gRNA and crRNA of the present invention are provided. The present invention also provides a combination of nucleic acids encoding each of the plurality of gRNAs of the present invention and a combination of nucleic acids encoding each of the plurality of crRNAs. Here, the combination of nucleic acids means a combination of nucleic acids encoding each of a plurality of gRNAs.

That is, according to the present invention, a combination of nucleic acids encoding gRNAs targeting at least one, two, three, or four or more Cas9 endonuclease binding sites present on the promoter region of the SCN1A gene, or Nucleic acid combinations are provided that are nucleic acid combinations encoding each crRNA.

According to the present invention, each gRNA that targets at least one, two, three, or four or more Cas9 endonuclease binding sites present on promoter region 1 and / or promoter region 2 of the SCN1A gene is encoded. Nucleic acid combinations are provided which are nucleic acid combinations or nucleic acid encoding each crRNA.
According to the present invention, a nucleic acid combination encoding each gRNA targeting at least one, two, three, or four or more Cas9 endonuclease binding sites present on the promoter region 1 of the SCN1A gene, or Nucleic acid combinations are provided that are nucleic acid combinations encoding each crRNA.
According to the present invention, a nucleic acid combination encoding each gRNA targeting at least one, two, three, or four or more Cas9 endonuclease binding sites present on the promoter region 2 of the SCN1A gene, or Nucleic acid combinations are provided that are nucleic acid combinations encoding each crRNA.

According to the present invention,
Hereinafter, a nucleic acid or a combination of nucleic acids encoding each RNA of any of [1A] to [3A] is provided:
[1A] one RNA selected from the group consisting of the following (1A) to (4A) or a combination of 2 to 4 RNAs (particularly a combination of 4 RNAs),
[2A] 1 RNA selected from the group consisting of the following (5A) to (8A) or a combination of 2 to 4 RNA (particularly a combination of 4 RNAs), or [3A] and below (1A) to (8A) 2-8 RNA combinations selected from the group consisting of (especially combinations of 4 or more RNAs):
(1A) gRNA targeting the sequence represented by SEQ ID NO: 1,
(2A) gRNA targeting the sequence shown in SEQ ID NO: 2,
(3A) gRNA targeting the sequence shown in SEQ ID NO: 3,
(4A) gRNA targeting the sequence shown in SEQ ID NO: 4,
(5A) gRNA targeting the sequence shown in SEQ ID NO: 5,
(6A) gRNA targeting the sequence shown in SEQ ID NO: 6,
(7A) gRNA targeting the sequence represented by SEQ ID NO: 7, and (8A) gRNA targeting the sequence represented by SEQ ID NO: 8.

According to the present invention,
Hereinafter, a nucleic acid or a combination of nucleic acids encoding each RNA of any of [1B] to [3B] is provided:
[1B] one RNA selected from the group consisting of the following (1B) to (4B) or a combination of 2 to 4 RNAs (particularly a combination of 4 RNAs),
[2B] 1 RNA selected from the group consisting of the following (5B) to (8B) or a combination of 2 to 4 RNA (particularly a combination of 4 RNAs), or [3B] and below (1B) to (8B) 2-8 RNA combinations selected from the group consisting of (especially combinations of 4 or more RNAs):
(1B) crRNA targeting the sequence represented by SEQ ID NO: 1,
(2B) crRNA targeting the sequence shown in SEQ ID NO: 2,
(3B) crRNA targeting the sequence shown in SEQ ID NO: 3,
(4B) crRNA targeting the sequence shown in SEQ ID NO: 4,
(5B) crRNA targeting the sequence shown in SEQ ID NO: 5,
(6B) crRNA targeting the sequence shown in SEQ ID NO: 6,
(7B) crRNA targeting the sequence represented by SEQ ID NO: 7, and (8B) crRNA targeting the sequence represented by SEQ ID NO: 8.

The following provides a combination of nucleic acids encoding each RNA of any of [1B ′] to [3B ′]:
[1B ′] a combination of one RNA selected from the group consisting of the following (1B) to (4B) or a combination of 2 to 4 RNAs (particularly a combination of 4 RNAs) and a nucleic acid encoding tracrRNA;
[2B ′] a combination of one RNA selected from the group consisting of the following (5B) to (8B) or a combination of 2 to 4 RNAs (particularly a combination of 4 RNAs) and a nucleic acid encoding tracrRNA, or [ 3B ′] a combination of 2 to 8 RNAs selected from the group consisting of the following (1B) to (8B) (particularly a combination of 4 or more RNAs) and a nucleic acid encoding tracrRNA:
(1B) crRNA targeting the sequence represented by SEQ ID NO: 1,
(2B) crRNA targeting the sequence shown in SEQ ID NO: 2,
(3B) crRNA targeting the sequence shown in SEQ ID NO: 3,
(4B) crRNA targeting the sequence shown in SEQ ID NO: 4,
(5B) crRNA targeting the sequence shown in SEQ ID NO: 5,
(6B) crRNA targeting the sequence shown in SEQ ID NO: 6,
(7B) crRNA targeting the sequence represented by SEQ ID NO: 7, and (8B) crRNA targeting the sequence represented by SEQ ID NO: 8.

According to the present invention, there is provided an RNA expression vector that allows a cell to express the RNA or RNA combination of the present invention. On the RNA expression vector, a nucleic acid encoding gRNA or crRNA is operably linked to an RNA expression promoter. The RNA expression promoter is not particularly limited. For example, the RNA polymerase III promoter can be used, and for example, the U6 promoter can be used.
The RNA expression vector of the present invention can be a vector in which a plurality of nucleic acids can be expressed on one RNA expression vector so that the combination of RNAs of the present invention can be expressed.
In one embodiment, the plurality of RNA expression vectors is a combination of a plurality of RNA expression vectors, and may be a combination of vectors capable of expressing the combination of RNAs of the present invention by combining the plurality of RNA expression vectors. In this embodiment, each RNA expression vector may express one different RNA.

For example, the combination of RNAs defined in [1A] above may be incorporated on one RNA expression vector, or may be incorporated on a plurality of RNA expression vectors. It may be incorporated on the RNA expression vector.
For example, the RNA combination defined in [2A] above may be incorporated on one RNA expression vector, or may be incorporated separately on a plurality of RNA expression vectors, or each RNA May be incorporated on another RNA expression vector.
For example, the RNA combination defined in [3A] above may be incorporated on one RNA expression vector, or may be incorporated separately on a plurality of RNA expression vectors, or each RNA May be incorporated on another RNA expression vector. In the RNA combination defined in [3A] above, crRNA may be incorporated on one RNA expression vector and tracrRNA may be incorporated on another RNA expression vector.

According to the present invention, for example, the RNA expression vector encodes each gRNA that targets at least one, two, three, or four or more Cas9 endonuclease binding sites present on the promoter region of the SCN1A gene. A combination of nucleic acids, or a combination of nucleic acids encoding each crRNA.

According to the present invention, the RNA expression vector may be, for example, at least one, two, three, or four or more Cas9 endonuclease binding sites present on the promoter region 1 and / or the promoter region 2 of the SCN1A gene. A combination of nucleic acids that is a combination of nucleic acids encoding each of the gRNAs targeted to or a combination of nucleic acids that encode each of the crRNAs.
According to the present invention, the RNA expression vector also includes, for example, gRNAs targeting at least one, two, three, or four or more Cas9 endonuclease binding sites present on the promoter region 1 of the SCN1A gene. Or a combination of nucleic acids that is a combination of nucleic acids encoding each crRNA. The nucleic acid is contained in an RNA expression vector so that it can be expressed in eukaryotic cells.
In addition, according to the present invention, the RNA expression vector may be, for example, a gRNA that targets at least one, two, three, or four or more Cas9 endonuclease binding sites present on the promoter region 2 of the SCN1A gene. Or a combination of nucleic acids that is a combination of nucleic acids encoding each crRNA. The nucleic acid is contained in an RNA expression vector so that it can be expressed in eukaryotic cells.

According to the present invention, there is provided an RNA expression vector according to any of [4A] to [6A] below:
[4A] one RNA expression vector selected from the group consisting of the following (1A) to (4A) or a combination of two or more RNA expression vectors (particularly a combination of four RNA expression vectors),
[5A] One RNA expression vector selected from the group consisting of the following (5A) to (8A) or a combination of two or more RNA expression vectors (particularly a combination of four RNA expression vectors), or [6A] or less (1A ) To (8A) in combination of 2 to 8 RNA expression vectors selected from the group consisting of (in particular 4 or more RNA expression vectors):
(1A) an RNA expression vector comprising a gene encoding a gRNA that targets the sequence represented by SEQ ID NO: 1 so that it can be expressed;
(2A) an RNA expression vector comprising a gene encoding the gRNA targeting the sequence represented by SEQ ID NO: 2 so as to allow expression;
(3A) an RNA expression vector comprising a gene encoding a gRNA that targets the sequence represented by SEQ ID NO: 3 so as to allow expression;
(4A) an RNA expression vector comprising a gene encoding the gRNA targeting the sequence represented by SEQ ID NO: 4 in such a manner that it can be expressed;
(5A) an RNA expression vector comprising a gene encoding the gRNA targeting the sequence represented by SEQ ID NO: 5 so that it can be expressed;
(6A) an RNA expression vector comprising a gene encoding the gRNA targeting the sequence represented by SEQ ID NO: 6 so that it can be expressed;
(7A) an RNA expression vector comprising a gene encoding a gRNA that targets the sequence represented by SEQ ID NO: 7 so that it can be expressed; and (8A) encoding a gRNA that targets the sequence represented by SEQ ID NO: 8 so that it can be expressed. An RNA expression vector containing a gene.

According to the present invention, there is provided an RNA expression vector or a combination of RNA expression vectors described in any of [4B] to [6B] below:
[4B] one RNA expression vector selected from the group consisting of the following (1B) to (4B) or a combination of two or more RNA expression vectors (particularly a combination of four RNA expression vectors),
[5B] One RNA expression vector selected from the group consisting of the following (5B) to (8B) or a combination of two or more RNA expression vectors (particularly a combination of four RNA expression vectors), or [6B] or less (1B ) To (8B) in combination of 2 to 8 RNA expression vectors selected from the group consisting of (in particular 4 or more RNA expression vectors):
(1B) an RNA expression vector comprising a gene encoding a crRNA that targets the sequence represented by SEQ ID NO: 1 so that it can be expressed;
(2B) an RNA expression vector comprising a gene encoding a crRNA that targets the sequence represented by SEQ ID NO: 2 so that it can be expressed;
(3B) an RNA expression vector comprising a gene encoding a crRNA that targets the sequence represented by SEQ ID NO: 3 so that it can be expressed;
(4B) an RNA expression vector comprising a gene encoding a crRNA that targets the sequence represented by SEQ ID NO: 4 so that it can be expressed;
(5B) an RNA expression vector comprising a gene encoding a crRNA that targets the sequence represented by SEQ ID NO: 5 so that it can be expressed;
(6B) an RNA expression vector comprising a gene encoding a crRNA that targets the sequence represented by SEQ ID NO: 6 so that it can be expressed;
(7B) an RNA expression vector comprising a gene encoding a crRNA targeting the sequence represented by SEQ ID NO: 7 so that it can be expressed; and (8B) encoding a crRNA targeting the sequence represented by SEQ ID NO: 8 so that it can be expressed. An RNA expression vector containing a gene.

According to the present invention, there is provided an RNA expression vector or a combination of RNA expression vectors described in any of [4C] to [6C] below:
[4C] one RNA expression vector selected from the group consisting of the following (1C) to (4C) or a combination of two or more RNA expression vectors (particularly a combination of four RNA expression vectors),
[5C] One RNA expression vector selected from the group consisting of (5C) to (8C) or a combination of two or more RNA expression vectors (particularly a combination of four RNA expression vectors), or [6C] or less (1C ) To (8C) in combination of 2 to 8 RNA expression vectors selected from the group consisting of (in particular 4 or more RNA expression vectors):
(1C) an RNA expression vector comprising a gene encoding crRNA and tracrRNA that target the sequence represented by SEQ ID NO: 1 in such a manner that it can be expressed;
(2C) an RNA expression vector comprising a gene encoding crRNA and tracrRNA that target the sequence represented by SEQ ID NO: 2 so that it can be expressed;
(3C) an RNA expression vector comprising a gene encoding crRNA and tracrRNA that target the sequence represented by SEQ ID NO: 3 so that it can be expressed;
(4C) an RNA expression vector comprising a gene encoding crRNA and tracrRNA that target the sequence represented by SEQ ID NO: 4 so that it can be expressed;
(5C) an RNA expression vector comprising a gene encoding crRNA and tracrRNA that target the sequence represented by SEQ ID NO: 5 so that it can be expressed;
(6C) an RNA expression vector comprising a gene encoding crRNA and tracrRNA that target the sequence represented by SEQ ID NO: 6 so that it can be expressed;
(7C) an RNA expression vector comprising a gene encoding crRNA and tracrRNA that target the sequence shown in SEQ ID NO: 7 so that it can be expressed; and (8C) crRNA and tracrRNA targeting the sequence shown in SEQ ID NO: 8; An RNA expression vector comprising a gene encoding such that it can be expressed.

According to the present invention, there is provided an RNA expression vector or a combination of RNA expression vectors described in any of [4D] to [6D] below and a combination of an expression vector that expresses tracrRNA:
[4D] one RNA expression vector selected from the group consisting of the following (1D) to (4D) or a combination of two or more RNA expression vectors (particularly a combination of four RNA expression vectors),
[5D] One RNA expression vector selected from the group consisting of (5D) to (8D) or a combination of two or more RNA expression vectors (particularly a combination of four RNA expression vectors), or [6D] or less (1D ) To (8D) in combination of 2 to 8 RNA expression vectors selected from the group consisting of (in particular 4 or more RNA expression vectors):
(1D) an RNA expression vector comprising a gene encoding a crRNA that targets the sequence represented by SEQ ID NO: 1 so that it can be expressed;
(2D) an RNA expression vector comprising a gene encoding a crRNA that targets the sequence represented by SEQ ID NO: 2 so that it can be expressed;
(3D) an RNA expression vector comprising a gene encoding a crRNA that targets the sequence represented by SEQ ID NO: 3 so that it can be expressed;
(4D) an RNA expression vector comprising a gene encoding a crRNA that targets the sequence represented by SEQ ID NO: 4 so that it can be expressed;
(5D) an RNA expression vector comprising a gene encoding a crRNA that targets the sequence represented by SEQ ID NO: 5 so as to allow expression;
(6D) an RNA expression vector comprising a gene encoding a crRNA that targets the sequence represented by SEQ ID NO: 6 so that it can be expressed;
(7D) an RNA expression vector comprising a gene encoding a crRNA that targets the sequence represented by SEQ ID NO: 7 so that it can be expressed; and (8D) encoding a crRNA that targets the sequence represented by SEQ ID NO: 8 so that it can be expressed. An RNA expression vector containing a gene.

According to the present invention, the RNA expression vector can be, for example, a plasmid vector or a viral vector. As a viral vector, vectors capable of introducing various genes such as a lentiviral vector, measles virus vector, Sendai virus vector and the like can be used. A person skilled in the art can appropriately select a vector and construct a vector that expresses the gRNA and crRNA of the present invention.

According to the present invention, there is provided a combination medicament comprising the gRNA or combination of gRNAs of the present invention or a combination of crRNA or crRNA. In the present invention, the combination medicine may be a medicine containing each of a plurality of gRNAs or crRNAs in a separate form, that is, a combination of pharmaceutical compositions, or a single medicine containing a plurality of gRNAs or crRNAs in a mixed form. It may be a medicine, i.e. a pharmaceutical composition.

In the present invention, a medicine or combination medicine containing the RNA expression vector of the present invention is provided. In the present invention, the combination medicine may be a medicine containing a plurality of RNA expression vectors expressing gRNA or crRNA in separate forms, that is, a combination of pharmaceutical compositions, or express each of a plurality of gRNA or crRNA. It is also possible to use a single medicine, that is, a pharmaceutical composition, containing a plurality of RNA expression vectors in a mixed form.

In the present invention, the pharmaceutical composition may further comprise a pharmaceutically acceptable excipient, carrier or diluent.
“Pharmaceutically acceptable” has the meaning normally used in the pharmaceutical industry and, in some cases, a molecular entity or composition that does not cause allergic or similar adverse reactions when administered to humans. It is possible to use such as. Typically, such compositions are prepared as liquid solutions or suspensions as injections, and solid dosage forms suitable for dissolution or suspension in liquid prior to injection can also be prepared. The preparation can also be emulsified.
Excipients, carriers or diluents include, for example, any solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions. Suspensions, colloids, etc. are included. Phosphate, citrate, and other organic acid salt buffers; antioxidants including ascorbic acid; low molecular weight (less than about 10 amino acid residues) polypeptide; protein (eg, serum albumin, gelatin, or immunoglobulin) Hydrophobic polymers (eg polyvinylpyrrolidone); amino acids (eg glycine, glutamine, asparagine, arginine or lysine); monosaccharides, disaccharides and other carbohydrates including glucose, mannose or dextran; chelating agents such as EDTA; Examples include sugar alcohols such as sorbitol; salt-forming counterions such as sodium; and / or nonionic surfactants (eg, polyoxyalkylenes). The use of such media and materials for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or substance is incompatible with the active ingredient, its use in the therapeutic composition is envisioned. Supplementary active ingredients can also be incorporated into the compositions.
In the pharmaceutical composition of the present invention, various surfactants used in the preparation may be used. The type of the surfactant is not particularly limited, and examples thereof include nonionic surfactants, cationic surfactants, anionic surfactants, and amphoteric surfactants. Among these, nonionic surfactants are preferable. Nonionic surfactants include, for example, polyoxyalkylene nonionic surfactants such as polyoxyethylene monoalkyl ether or polyoxyethylene monoaryl ether; higher fatty acid esters of polyhydric alcohols (eg, sorbitan, sorbitol); and And those obtained by polymerizing and adding ethylene oxide to a higher fatty acid ester of a polyhydric alcohol.

The combination medicament of the present invention may further contain a fusion protein of dCas9 and a transcriptional activation protein or an expression vector of a fusion protein of dCas9 and a transcriptional activation protein in separate forms or mixed forms. . The combination medicament of the present invention may further contain tracrRNA or an expression vector of tracrRNA in a separate form or a mixed form so that crRNA forms a complex with the fusion protein.

The RNA combination of the present invention may be provided in combination with a fusion protein of dCas9 and a transcription activation protein. Therefore, the present invention provides a combination of the RNA combination of the present invention and a fusion protein of dCas9 and a transcription activation protein.
The DNA combination and RNA expression vector combination of the present invention may be provided in combination with a nucleic acid encoding a fusion protein of dCas9 and a transcription activation protein or an expression vector expressing the nucleic acid. Accordingly, the present invention provides a combination of a DNA combination or RNA expression vector combination of the present invention and a nucleic acid encoding a fusion protein of dCas9 and a transcription activation protein or an expression vector expressing the nucleic acid.

The RNA combination, DNA combination, and RNA expression vector of the present invention may be provided as a CRISPR-on system containing them. The CRISPR-on system can include, for example, a fusion protein of dCas9 and a transcription activation protein in addition to the RNA combination, DNA combination, and RNA expression vector of the present invention.

The expression level of the SCN1A gene can be determined by an expression level measurement method well known to those skilled in the art. For example, gene expression can be confirmed by various methods such as quantitative PCR, Northern blotting, ELISA using anti-SCN1A protein antibody, Western blotting, immunohistological staining, and the like. Whether or not the expression level of the SCN1A gene has increased can be determined by comparing the expression level before and after the introduction of the SCN1A gene. If desired, cells known to express the SCN1A gene (for example, healthy subjects) In comparison with other cells).

In the present invention, when the gRNA of the present invention or a combination of gRNA is introduced into a cell in combination with a fusion protein of dCas9 and a transcription activation protein, a complex of gRNA and the fusion protein is formed. The formed complex is guided to a target sequence on the genomic DNA in the cell and activates transcription of the SCN1A gene.

In the present invention, the crRNA or crRNA combination of the present invention forms a complex of crRNA, tracrRNA and fusion protein when introduced into a cell in combination with a fusion protein of tracrRNA and dCas9 and a transcriptional activation protein. . The formed complex is guided to a target sequence on the genomic DNA in the cell and activates transcription of the SCN1A gene.

In the present invention, the DNA or DNA combination of the present invention can be used, for example, to obtain the gRNA or crRNA of the present invention or to amplify the DNA or DNA combination of the present invention. For example, the DNA or DNA combination of the invention can be operably linked to a suitable promoter and used to produce the gRNA or crRNA of the invention in vitro or in a cell. For example, the DNA or DNA combination of the present invention can be cloned into a plasmid having an origin of replication that amplifies in E. coli and amplified in E. coli. Also, the DNA or DNA combination of the present invention can be amplified by PCR.

In the present invention, the gRNA expression vector of the present invention can be used in combination with an expression vector that expresses a fusion protein of dCas9 and a transcription activation protein. The crRNA expression vector of the present invention can be used in combination with a tracrRNA RNA expression vector and an expression vector that expresses a fusion protein of dCas9 and a transcription activation protein.

In order to cleave genomic DNA in a cell, an expression vector can be introduced into the cell. Introduction of the expression vector into the cell can be performed by a person skilled in the art by a well-known technique. For example, plasmid vectors can be introduced into cells by methods such as electroporation, calcium phosphate, lipofection, and shotgun methods. In addition, when introduced into a mammal individual, it is administered by various administration methods such as intravenous administration, intramuscular administration, subcutaneous administration, intraperitoneal administration, and intraventricular administration using a viral vector that infects the mammal. be able to. The expression vector introduced into the cell expresses the gRNA, crRNA and tracrRNA of the present invention in the cell, and the expression vector expressing the fusion protein expresses the fusion protein and binds to the target sequence of the genome in the cell. Then, the transcription of the SCN1A gene is activated. The cell that enhances the expression of the SCN1A gene is preferably a human nerve cell, preferably a human inhibitory nerve cell, more preferably a parvalbumin positive inhibitory nerve cell. For example, by using a promoter of a vesicle-type inhibitory neurotransmitter transporter (Vgat) or a promoter of parvalbumin (PV), the SCN1A gene can be expressed in human inhibitory neurons, more preferably in parvalbumin positive inhibitory neurons. The expression level can be improved.

In the present invention, eukaryotic cells (especially human neurons, preferably human inhibitory neurons, more preferably parvalbumin positive inhibitory neurons) that stably express the RNA or RNA combination of the present invention and the cells are used. A cell preparation comprising is provided. In the eukaryotic cell and cell preparation of the present invention, the eukaryotic cell may further stably express a fusion protein of dCas9 and a transcription activation protein. Methods for stably expressing RNA in eukaryotic cells are well known to those skilled in the art. Here, the cell preparation means a pharmaceutical composition containing cells as a therapeutically active ingredient.

According to the present invention,
Hereinafter, eukaryotic cells stably expressing any one of RNAs or combinations of RNAs [1A] to [3A] (particularly human neurons, preferably human inhibitory neurons, more preferably parvalbumin positive inhibitory neurons). And a cell preparation comprising the eukaryotic cell {wherein the eukaryotic cell may further stably express a fusion protein of dCas9 and a transcriptional activation protein}:
[1A] one RNA selected from the group consisting of the following (1A) to (4A) or a combination of 2 to 4 RNAs (particularly a combination of 4 RNAs),
[2A] 1 RNA selected from the group consisting of the following (5A) to (8A) or a combination of 2 to 4 RNA (particularly a combination of 4 RNAs), or [3A] and below (1A) to (8A) 2-8 RNA combinations selected from the group consisting of (especially combinations of 4 or more RNAs):
(1A) gRNA targeting the sequence represented by SEQ ID NO: 1,
(2A) gRNA targeting the sequence shown in SEQ ID NO: 2,
(3A) gRNA targeting the sequence shown in SEQ ID NO: 3,
(4A) gRNA targeting the sequence shown in SEQ ID NO: 4,
(5A) gRNA targeting the sequence shown in SEQ ID NO: 5,
(6A) gRNA targeting the sequence shown in SEQ ID NO: 6,
(7A) gRNA targeting the sequence represented by SEQ ID NO: 7, and (8A) gRNA targeting the sequence represented by SEQ ID NO: 8.

According to the present invention,
Hereinafter, eukaryotic cells stably expressing any one of RNAs or combinations of RNAs [1B] to [3B] (particularly human neurons, preferably human inhibitory neurons, more preferably parvalbumin positive inhibitory neurons). And a cell preparation comprising the eukaryotic cell {wherein the eukaryotic cell may further stably express a fusion protein of dCas9 and a transcriptional activation protein}:
[1B] one RNA selected from the group consisting of the following (1B) to (4B) or a combination of 2 to 4 RNAs (particularly a combination of 4 RNAs),
[2B] 1 RNA selected from the group consisting of the following (5B) to (8B) or a combination of 2 to 4 RNA (particularly a combination of 4 RNAs), or [3B] and below (1B) to (8B) 2-8 RNA combinations selected from the group consisting of (especially combinations of 4 or more RNAs):
(1B) crRNA targeting the sequence represented by SEQ ID NO: 1,
(2B) crRNA targeting the sequence shown in SEQ ID NO: 2,
(3B) crRNA targeting the sequence shown in SEQ ID NO: 3,
(4B) crRNA targeting the sequence shown in SEQ ID NO: 4,
(5B) crRNA targeting the sequence shown in SEQ ID NO: 5,
(6B) crRNA targeting the sequence shown in SEQ ID NO: 6,
(7B) crRNA targeting the sequence represented by SEQ ID NO: 7, and (8B) crRNA targeting the sequence represented by SEQ ID NO: 8.

Hereinafter, a eukaryotic cell (in particular, a human neuron, preferably a human inhibitory neuron, more preferably a parvalbumin positive inhibitory neuron that stably expresses any RNA or combination of RNAs of [1B ′] to [3B ′]. Cell) and a cell preparation containing the eukaryotic cell {wherein the eukaryotic cell may further stably express a fusion protein of dCas9 and a transcription activation protein}:
[1B ′] a combination of one RNA selected from the group consisting of the following (1B) to (4B) or a combination of 2 to 4 RNAs (particularly a combination of 4 RNAs) and a nucleic acid encoding tracrRNA;
[2B ′] a combination of one RNA selected from the group consisting of the following (5B) to (8B) or a combination of 2 to 4 RNAs (particularly a combination of 4 RNAs) and a nucleic acid encoding tracrRNA, or [ 3B ′] a combination of 2 to 8 RNAs selected from the group consisting of the following (1B) to (8B) (particularly a combination of 4 or more RNAs) and a nucleic acid encoding tracrRNA:
(1B) crRNA targeting the sequence represented by SEQ ID NO: 1,
(2B) crRNA targeting the sequence shown in SEQ ID NO: 2,
(3B) crRNA targeting the sequence shown in SEQ ID NO: 3,
(4B) crRNA targeting the sequence shown in SEQ ID NO: 4,
(5B) crRNA targeting the sequence shown in SEQ ID NO: 5,
(6B) crRNA targeting the sequence shown in SEQ ID NO: 6,
(7B) crRNA targeting the sequence represented by SEQ ID NO: 7, and (8B) crRNA targeting the sequence represented by SEQ ID NO: 8.

In the present invention, a method for increasing the expression of an SCN1A gene, which targets at least one, two, three, or four or more Cas9 endonuclease binding sites present on the promoter region of the SCN1A gene Alternatively, a method is provided comprising activating transcription of the SCN1A gene using crRNA.

In the present invention, a method for treating a disease in a subject in need thereof, which targets at least one, two, three, or four or more of the Cas9 endonuclease binding sites present on the promoter region of the SCN1A gene A method is provided comprising activating transcription of the SCN1A gene using a gRNA or crRNA as defined above.

In the pharmaceutical composition, the combination drug, the cell preparation, and the method of treating of the present invention, in one embodiment, the target disease may be a disease caused by a decrease in the expression level of the SCN1A gene, and the expression level of the SCN1A gene is decreased. The subject may have a disease caused by. In the pharmaceutical compositions, combination medicaments, cell preparations and methods of treating of the present invention, in certain embodiments, the disease to be treated can be epilepsy. In certain embodiments, the disease to be treated can be Drave syndrome. In certain embodiments, the disease being treated can be febrile convulsions +. In certain embodiments, the disease to be treated can be social behavioral abnormalities such as autism. In certain embodiments, the disease to be treated can be epilepsy in Alzheimer's disease. In the present invention, a subject can be a subject having a functional SCN1A and a mutant SNC1A (eg, nonsense mutation and frameshift mutation). In one aspect, the mutation SNC1A is S103G, T112I, G177fs, G265W, R712X, Q732fs, R946fs, R952X, R946fs, D958fs, M960V, N985I, R1204X, R1213X, S1231R, W1284W, X8, 1685 F1765fs, 1807delMFYE, W1812G, F1831S, R1892X, and Q1904fs. Here, X represents a nonsense mutation, and fs represents a frameshift mutation. S103G represents that the 103rd S (serine) in the amino acid sequence is mutated to G (glycine).

In one aspect of the invention, the medicament, combination medicament and cell preparation of the invention are for use in treating febrile convulsions +, for use in treating epilepsy, for use in treating epilepsy. Pharmaceuticals, combination pharmaceuticals for use in treating diseases caused by decreased activity and / or expression of the SCN1A gene, for use in treating social behavioral abnormalities such as autism And can be cell preparations.

In the present invention, for use in treating epilepsy, for use in treating Drave syndrome, for use in treating febrile seizure +, or to treat social behavioral abnormalities such as autism The RNA or RNA of the invention for the manufacture of a medicament, combination medicament and cell preparation for use in treating a disease caused by a decrease in the activity and / or expression of the SCN1A gene Or the use of DNA or a combination of DNAs or expression vectors.

Example 1: Design and production of gRNA In this example, a gRNA targeting the promoter region of the Scn1a gene was designed and produced.

The human genome sequence was the sequence of GRCh37 / hg19 data set from UCSC Genome Browser. As the sequence of the promoter region of the mouse Scn1a gene, the genomic DNA sequence of C57BL / 6J strain was used. In this example, 5′-NGG-3 ′ (Proto-spacer Adjacent Motif (PAM) sequence of CAS9 protein) existing in the region of about 600 bp to 850 bp upstream of the major translation initiation site in the promoter region. The target sequence of gRNA was selected from the 20-bp side. Specifically, a total of 18 gRNA sequences were designed in 4 places (hSC1U1-4, hSC1D1-4) for humans and 5 places (mSC1U1-5, mSC1D1-5) for mice. The target specificity of the selected sequence was confirmed by homology search using the NCBI nucleotide sequence database and the BLAST program to be a sequence that does not completely match other regions in the human or mouse genomic sequence. Furthermore, in principle, a sequence that does not have a continuous homologous base sequence of 17 bp or more, has a small number of homologous partial sequences, and is not located at the 3'-end even if the homologous partial sequence is 17 bp or less is selected.

In the promoters of the human and mouse SCN1A genes, the sites where gRNAs were designed were roughly divided into upstream promoters and downstream promoters, which were used in the following description (see FIGS. 1 and 2). Correspondence between the position of the target sequence of the designed gRNA on the promoter, the name, and the sequence number was as shown in FIGS. 1 and 2, Tables 1 and 2, and Chemical Formulas 1 to 4.

In the above chemical formula, the transfer start point was 1.

Next, plasmid DNA was prepared. As a gRNA expression vector, a vector (MLM3636, addgene: Plasmmid # 43860) that expresses gRNA with the U6 promoter was obtained from Addgene. Similar to the production method of Maeder ML et al., Nat Methods., 10 (10): 977-93, 2013, 20 bases with a 4 base overhanging end complementary to the cleavage site of the restriction enzyme BsmBI of the vector were added. A double-stranded DNA fragment was prepared by synthesizing the target sequence and its complementary strand, and incorporated into an MLM3636 vector cleaved with restriction enzyme BsmBI using DNA-Ligation-kit-Ver2.1 (Takara Bio Inc.). For the dCAS9-VPR gene, an expression vector (SP-dCas9-VPR, addgene: lasPlasmid # 63798) using a CMV promoter was obtained from Addgene. The plasmid DNAs of the gRNA expression vector and the dCAS9-VPR gene expression vector were purified using Qiagen Hispeed Plasmid Midi Kit. Note that dCAS9 is a mutant in which the enzymatic functions of the two DNA endonuclease domains of wild-type CAS9 are both destroyed and DNA cannot be cleaved.

Example 2: Evaluation of gene expression In this example, gene expression was controlled using the prepared plasmid.

Using cell culture and Dulbecco's modified Eagle's medium (DMEM) containing 10% of transgenic fetal bovine serum (FBS), HEK293FT cells (human) or Neuro2a cells (mouse) were cultured at 37 ° C. with a carbon dioxide concentration of 5%. Cultured under. In order to introduce plasmid DNA, the cultured cells are seeded at a density of 5 × 10 ⁴ cells / mL for HEK293FT cells and 1 × 10 ⁵ cells / mL for Neuro2a cells on a 6-well plate, and proliferated to a density of approximately 80%. I let you. Plasmid DNA was introduced using Lipofectamine LTX (Life Technologies). For each well, 500 ng of gRNA plasmid (500 ng if one gRNA was used, and 100 ng each was used if five gRNAs) and 2000 ng of dCAS9-VPR plasmid DNA were used. In 12 hours after the start of gene transfer, the medium was replaced with a DMEM medium containing 10% fresh FBS, and the culture was continued until 48 hours later.

Purification and quantification of RNA from cells and brain tissue RNAiso Plus (Takara Bio) was used to recover total RNA from cultured cells and mouse brain tissue. Cells cultured in 6-well plates were washed twice with phosphate buffered saline (PBS), and RNA was collected from the cells with 400 μL of RNAiso Plus per well. In the case of mouse brain, a 4-week-old C57BL / 6J strain mouse was anesthetized, the brain was removed, 2 ml of RNAiso Plus (Takara Bio Inc.) was added, and the tissue was disrupted with a glass dounce homogenizer to collect RNA. .

Detection of transcripts by RT-PCR To compare the amount of transcripts of genes, total RNA was purified from cultured cells using the Takara Bio PrimeScript ^™ RT reagent Kit with gDNA Eraser (Perfect Real Time). MRNA was amplified from total RNA by PCR using the method. The primer sets used were as follows.

(Primer set used to detect each gene)
The primers used to amplify the human SCN1A gene are
hSCN1A_F: 5'-TGGGGAGTGGATAGAGACCA-3 '(SEQ ID NO: 23)
hSCN1A_R: 5'-GAAAGAGATTCAGGACCACTAGG-3 '(SEQ ID NO: 24)
Primers used to amplify the β-actin gene are
hACTB_F: 5'-CATGTACGTTGCTATCCAGGC-3 '(SEQ ID NO: 25)
hACTB_R: 5'-CTCCTTAATGTCACGCACGAT-3 '(SEQ ID NO: 26)
The primers used to amplify the mouse Scn1a gene are
mScn1A_F: 5'-AGCCTATCCCTCGACCTGGA-3 '(SEQ ID NO: 27)
mScn1A_R: 5'-CTGGTCATCCGTTTCCACCA-3 '(SEQ ID NO: 28)
The primers used to amplify the mouse G3pdh gene are
mG3pdh-F: 5'-TCAAGAAGGTGGTGAAGCAG-3 '(SEQ ID NO: 29)
mG3pdh-R: 5'-ATTGTGAGGGAGATGCTCAG-3 '(SEQ ID NO: 30)

Amplification of human SCN1A gene and β-actin gene is 98 ° C, 5 minutes once, 98 ° C, 15 seconds, 55 ° C, 5 seconds, 72 ° C, 30 seconds 25 times or 30 temperature cycles. went. In the PCR method of mouse Scn1a gene and G3pdh gene, a temperature cycle of 98 ° C., 5 minutes once, 98 ° C., 15 seconds, 56 ° C., 5 seconds, 72 ° C., 20 seconds was performed 27 times or 30 times. .

Detection of Transcript by Northern Hybridization Purified total RNA was electrophoresed on a formaldehyde-denatured 1% agarose gel and then transferred to a nylon membrane. The total RNA amount per lane migrated was 5 μg for cultured cells and 20 μg for total RNA purified from mouse brain tissue. The labeling and hybridization of the RNA probe, and the detection of the transcript were performed according to the method of DIG Northern Starter Kit of Roche Life Science. The probe used was a 615 base sequence (mScn1a 3′UTR615; SEQ ID NO: 31) in the 3 ′ untranslated region of the mouse Scn1a gene. The probe was prepared by cloning a DNA fragment amplified by PCR with a pBluescript vector and digoxigenin RNA labeling using the T7 promoter.

The results were as shown in FIGS.

As shown in FIG. 3, although the total amount of the introduced gRNA was the same, the gene expression of SCN1A was improved in the combination of 4 types of gRNA by one type of gRNA. This tendency was commonly observed for both upstream and downstream promoters.

As shown in FIG. 4, although the total amount of the introduced gRNA was the same, the gene expression of Scn1a was improved in the combination of 5 types of gRNA by one type of gRNA. This tendency was commonly observed for both upstream and downstream promoters.

Thus, in both the human SCN1A gene and the mouse Scn1a gene, when this promoter was targeted, the combination of 4 types of gRNA and the combination of 5 types of gRNA showed significant gene expression enhancement, respectively. .

Further, in FIG. 5, the gene whose expression has been enhanced in this way is compared with the endogenous gene expression in the brain tissue. The band exceeding 8 kb indicated by the arrow in FIG. 5 is a band of mRNA transcribed from the mouse Scn1a gene.

As shown in FIG. 5, almost no expression is observed in the negative control (NC), whereas the expression of 4 gRNA combinations of the upstream promoter (mouse) and 5 gRNA combinations (mouse). When increased, the expression level was significantly increased. From this result, in both human SCN1A gene and mouse Scn1a gene, when this promoter is targeted, the combination of 4 types of gRNA and the combination of 5 types of gRNA, respectively, greatly enhance / increase the expression of SCN1A gene. Succeeded in achieving.

Example 3 Treatment of Drave Syndrome In this example, Dravet syndrome was treated by improving the expression level of endogenous functional Scn1a gene using a model animal of Drave syndrome.

In many Drave syndromes, the Scn1a gene is dysfunctional due to various nonsense or frameshifts. In this example, a model animal in which one side allele of the Scn1a gene has a nonsense mutation of R1407X and the other allele is a functional gene, more specifically, a mouse (that is, Scn1a ^{R1407X / +} ) has Drave syndrome. Used as a model animal. The treatment experiment of this example is a system for improving the expression of a functional Scn1a gene by dCas-VPR (as an example of a fusion protein of dCas and a transcription activation protein VPR), and in particular, suppressing the improvement of the expression of the Scn1a gene. It is a system that triggers in nerve cells.
Therefore, in this example, a Scn1a ^{R1407X / +} mouse that specifically expresses dCas9-VPR is produced, and a guide RNA targeting the promoter region of Scn1a is introduced to suppress it. Enhanced expression of the Scn1a gene specifically in sex neurons. Mice expressing dCas9-VPR specifically for inhibitory neurons were generated using Vgat-Cre and flox-dCas9-VPR.
In this model, dCas9-VPR is introduced into an animal by knock-in and administered only by guide RNA, but a fusion protein of dCas9 such as dCas9-VPR and a transcriptional activation protein or a functional fragment thereof is used as a virus or the like. It is clear that similar results can be obtained even if the vector is transiently or constitutively expressed in this vector.
Specifically, it is as follows.

Preparation of dCAS9-VPR gene-introduced (transgenic) mouse A dCAS9-VPR gene-introduced mouse was prepared. In order to stably express the transgene, we inserted the Rosa26 locus on mouse chromosome 5 as the target site. A targeting vector was prepared by modifying Ai9 (Addgene: 22799) used in the preparation of Cre-dependent CAS9 gene expressing mice by Platt RJ et al., (Cell. 2014 159 (2): 440-455). The attB1 sequence (23bp) from the dCAS9-VPR gene (SP-dCas9-VPR plasmid (Addgene: 63798) included in the dCAS9-VPR gene (SPgene) A targeting vector (hereinafter referred to as “Ai-VPR”) in which the IRES sequence and the mRFP gene were linked) was obtained (see FIG. 6).
It was confirmed using Neuro2A that Ai-VPR expresses dCAS9-VPR gene and mRFP gene in a Cre-dependent manner. CRISPR / CAS9 genome editing targeting the Rosa26 locus was used to integrate Ai-VPR into cells. PX330-U6-Chimeric_BB-CBh-hSpCas9 (incorporating the Rosa26-1 gRNA sequence (Chu et al., BMC Biotechnology 2016 16 (4)) and the gRNA sequence targeting the Dta gene (5'-GAAAACTTTTCTTCGTACCA-3 ') Addgene: 42230) was lipofected simultaneously with Ai-VPR, and after drug selection with G418, Cre recombinase gene was transiently introduced into the cells to observe the expression of mRFP (see FIG. 7). In addition, in the cells expressing mRFP, the amount of mRNA of the endogenous Scn1a gene increased only by introducing four kinds of gRNAs targeting the Scn1a gene (see FIG. 8).
Ai-VPR was integrated into the Rosa26 locus by editing the CRISPR / CAS9 genome into mouse ES cells (CMTI-2) as in the case of Neuro2a cells (see FIG. 9). The electroporation method was used for introducing the plasmid DNA. By screening using G418 and PCR, 4 strains of ES cells in which Ai-VPR was integrated into the Rosa26 locus were obtained (clone: 5D, 5E, 7H, 9G; see FIG. 10). 5 'end of Ai-VPR is a product amplified by the following R26F3 primer and Ai9-CAGp5end_R2 primer.

(Gene amplification primer)
R26F3 primer: CTGCCCGAGCGGAAACGCCACTGAC (SEQ ID NO: 31)
Ai9-CAGp5end_R2 primer: GTAAGTTATGTAACGCGGAAC (SEQ ID NO: 32)
dCAS9-VPR forward primer: TGATATCAACGCGTCAAGTCG (SEQ ID NO: 33)
dCAS9-VPR reverse primer: GTATCTGGCCAGCCACTATG (SEQ ID NO: 34)
When chimeric mice were prepared using these four strains of ES cells, chimeric mice were obtained in 5D and 9G. However, in backcrossing with B6J mice (N1), only 9G was obtained with the dCAS9-VPR gene (FIGS. 11 and 12).

(Gene amplification primer)
mRFP forward primer:
AAAAAGCAGGCTTCGAAGGAGATAGAaccATGGCCTCCTCCGAGGACGTCATCAAGGAGTTCATG (SEQ ID NO: 35)
mRFP reverse primer:
AGAAAGCTGGGTCctaGTGGCGGCCCTCGGCGCGCTCGTAC (SEQ ID NO: 36)
Wt Rosa26 forward primer: AAGGGAGCTGCAGTGGAGTA (SEQ ID NO: 37)
Wt Rosa26 reverse primer: CCGAAAATCTGTGGGAAGTC (SEQ ID NO: 38)

Confirmation of Cre-dependent expression of dCAS9-VPR gene In the prepared dCAS9-VPR gene-introduced mice, transcription of the dCAS9-VPR gene by the CAG promoter is suppressed by three polyA signal sequences surrounded by loxP sequences (Fig. 13). Therefore, dCAS9-VPR is not expressed in vivo in the absence of Cre. The dCAS9-VPR mice, both heterozygous and homozygous, showed normal growth and reproduction with no apparent abnormalities. In order to confirm the expression of dCAS9-VPR by Cre, dCAS9-VPR KI hetero mice were mated with EIIa-Cre mice or Vgat-Cre mice. In the first generation (F1) of dCAS9-VPR hetero / EIIa-Cre mice that express dCAS9-VPR systemically, recombination at the loxP site showed mosaicism, but the second generation (F2) had a recombination rate. 100% of individuals were born (see FIG. 14). In addition, dCAS9-VPR hetero / Vgat-Cre mice that express dCAS9-VPR only in inhibitory neurons grew and propagated normally (> 10 mice).

(Gene amplification primer)
cCAG-F primer: GGTTCGGCTTCTGGCGTGTGACC (SEQ ID NO: 39)
dCAS9 791-770: TGTTTGTGCCGATAGCGAGC (SEQ ID NO: 40)
Cre amplification forward primer: AGGTTCGTTCACTCATGGA (SEQ ID NO: 41)
Cre amplification reverse primer: TCGACCAGTTTAGTTACCC (SEQ ID NO: 42)

It was investigated by Western blotting and immunohistochemical staining that dCAS9-VPR KI hetero / Vgat-Cre mice expressed dCAS9-VPR in a Cre-dependent manner. Western blotting using anti-Cas9 antibodies (mAb clone: 7A9-3A3, Active motif) detected a protein corresponding to the expected molecular weight of dCAS9-VPR (220 kDa) only in dCAS9-VPR KI hetero / Vgat-Cre mice (See FIG. 15). In addition, immunohistochemical staining revealed dCAS9-VPR positive cells in the olfactory bulb, cerebral cortex, hippocampus, striatum, and cerebellum in the mouse brain (FIG. 16). The gene expression in each of these regions closely matches the expression pattern of the Vgat gene, indicating that the prepared dCAS9-VPR KI mice expressed dCAS9-VPR in vivo in a Cre-dependent manner.

In vivo CRISPR-ON suppresses (normalizes) the increased sensitivity to heat seizures (pathological condition) in Scn1a-R1407X mutant mice
In order to investigate the effect of treatment to increase the expression level of Scn1a gene by CRISPR-ON specific to inhibitory neurons using Drave syndrome model mouse, dCAS9-VPR / Scn1aR1407X mouse and Vgat-Cre mouse were mated by artificial insemination (See FIG. 17). Since F1 mice with the R1407X mutation in Scn1a suddenly die from epileptic seizures around 14 days after birth, the survival rate of dCAS9-VPR / Scn1aR1407X / Vgat-Cre, dCAS9-VPR / Scn1aR1407X, and Scn1aR1407X after 30 days Were 37.5%, 66.7%, and 83.3%, respectively (see FIG. 18). Four-week-old mice after epileptic onset were pAAV-MCS in which four gRNA genes (mSC1U1, mSC1U2, hSC1U3, and mSC1U4) targeting the upstream promoter of the Scn1a gene were viralized using AAV-PHP.eB CRISPR-ON was allowed to act by delivery into the brain (1.75 × 10 ¹¹ vg / mouse) from the tail vein with a vector (FIG. 19). The susceptibility to heat-induced seizures was investigated at 6 weeks of age. While measuring the rectal temperature of the mice, the temperature at the time of inducing hyperthermia by raising the temperature and recording a generalized seizure was recorded (see FIG. 20). Wild type (n = 6) and non-Scn1a mutation (R1407X) genotype (dCAS9-VPR / Vgat-Cre + 4gRNA: n = 3, dCAS9-VPR / Vgat-Cre + Vehicle: n = 5) No seizures occurred at 44 ° C. or lower (see FIG. 21). In addition, at the 6th week, inhibitory neuron-specific dCAS9-VPR expression model (dCAS9-VPR / Scn1aR1407X / Vgat-Cre + 4gRNA, n = 3) and comparison group (dCAS9-VPR / Scn1aR1407X + 4gRNA: n = 5, dCAS9-VPR / Scn1aR1407X + Vehicle: n = 6, and Scn1aR1407X: n = 6), there was no statistically significant difference in resistance between each genotype. However, the resistance of 1 out of 3 of the inhibitory neuron-specific dCAS9-VPR expression model showed a temperature (43.3 ° C.) that the Scn1aR1407X mouse could not reach (see FIG. 21). The susceptibility to heat-induced seizures at 10 and 12 weeks of age was investigated (see FIG. 22). In the four measurements, the highest seizure body temperatures of the three animals of the inhibitory neuron-specific dCAS9-VPR expression model were 43.3 ° C, 43.5 ° C, and 42.8 ° C, respectively. Two-way analysis of variance between genotype and age showed significant differences between genotypes (F (2,8) = 14.99, p <0.01). Multiple comparisons by Bonferroni's method showed that the inhibitory neuron-specific dCAS9-VPR expression model (n = 3 seizure body temperature (average 42.1 ° C) and comparison group ((dCAS9-VPR / Scn1aR1407X + 4gRNA: n = 3 and Scn1aR1407X : n = 5) showed a statistically significant difference (MSe = 0.5137, p <.05, alpha '= 0.0167) in the body temperature at stroke (average 41.0 ℃ and 40.69 ℃). We show that the ON system can restore the expression level of the Scn1a gene in inhibitory nerves, and that resistance to heat-induced seizures in Dravet syndrome mice can be restored even after the onset of epilepsy. The gene transfer efficiency in the central nervous system of mice by AAV-PHP.eB used in the experiment is 69% of neurons in the cerebral cortex and 81% in inhibitory neurons (Chan KY et al., Nature Neuroscience 2017 20 (8) Therefore, in this system, CRISPR-ON did not act on all inhibitory nerves in AAV-treated mice. This is thought to be one reason why the therapeutic effect on febrile seizures is not perfect, and another reason is that the pathological neural circuit established by the onset of epilepsy weakens the recovery effect. However, the clear therapeutic effect obtained by this system is that sufficient expression level of the Scn1a gene is obtained in each cell on which CRISPR-ON has acted. It also suggests that a higher therapeutic effect can be expected by increasing the introduction efficiency of the CRISPR-ON system into cells.
Previous mutant mouse studies have shown that there are multiple modifiers in the Scn1a mutation phenotype, and the frequency, mortality, and fever of spontaneous epileptic seizures between mouse strains with different genetic backgrounds. Susceptibility to induced seizures varies. Under normal rearing conditions, 129 strains do not cause sudden death due to spontaneous epilepsy, while B6J strains exhibit higher spontaneous epilepsy frequency and mortality, and sensitivity to heat-induced seizures. In recent years, experimental treatments (Table 3) of 4 Scn1a mutant mice have been reported, but 3 (GS967, CBD, SGE-516) started treatment immediately before onset, 2 of them (GS967, SGE-516) is difficult to compare because it uses 129 and B6J hybrid systems. The seizure threshold of febrile seizures increased with SGE-516 and CUR-1901, with no recovery effect for GS967. Compared with CUR-1901 (action group: n = 4, 41.42 ° C vs. control group: n = 6, 40.15 ° C, difference 1.27 ° C), which are close to the experimental conditions, CRISPR-ON recovery effect (action) Group: n = 3, 42.11 ° C vs. control group: n = 5, 40.69 ° C, difference 1.42 ° C). The method of the present invention can achieve even higher effects by changing gRNA design, vector administration schedule, and the like.

Claims (19)

1. RNA combination which is a combination of gRNA or crRNA targeting at least one Cas9 endonuclease binding site present on the promoter region of the SCN1A gene.
2. The RNA combination according to claim 1, which is a combination of gRNA or crRNA targeting at least four Cas9 endonuclease binding sites present on the promoter region of the SCN1A gene.
3. A combination of RNAs according to claim 1 or 2,
   [1] One RNA selected from the group consisting of the following (1) to (4) or a combination of 2 to 4 RNAs:
   [2] One RNA selected from the group consisting of the following (5) to (8) or a combination of two to four RNAs, or [3] 2 selected from the group consisting of the following (1) to (8) ~ 8 RNA combinations:
   (1) gRNA or crRNA targeting the sequence represented by SEQ ID NO: 1,
   (2) gRNA or crRNA targeting the sequence represented by SEQ ID NO: 2,
   (3) gRNA or crRNA targeting the sequence represented by SEQ ID NO: 3,
   (4) gRNA or crRNA targeting the sequence represented by SEQ ID NO: 4,
   (5) gRNA or crRNA targeting the sequence represented by SEQ ID NO: 5,
   (6) gRNA or crRNA targeting the sequence represented by SEQ ID NO: 6,
   (7) gRNA or crRNA targeting the sequence represented by SEQ ID NO: 7, and (8) gRNA or crRNA targeting the sequence represented by SEQ ID NO: 8.
4. The combination of RNA according to claim 3, which is a combination of RNA according to [1].
5. The RNA combination according to claim 4, comprising all gRNAs according to (1) to (4), or comprising all crRNAs according to (1) to (4).
6. The combination of RNA according to claim 3, which is a combination of RNA according to [2].
7. The combination of RNAs according to claim 5, comprising all the gRNAs according to (5) to (8), or all the crRNAs according to (5) to (8).
8. The combination of RNAs according to [3], which is a combination of four or more gRNAs or a combination of crRNAs selected from the group consisting of (1) to (8) .
9. The combination of RNAs according to any one of claims 1 to 8, wherein each RNA is gRNA.
10. A combination of nucleic acids encoding each RNA contained in the combination of RNAs according to any one of claims 1 to 9.
11. An RNA expression vector comprising the nucleic acids contained in the nucleic acid combination according to claim 10 so that each of the nucleic acids can be expressed.
12. A medicine or combination medicine comprising the RNA or the combination of RNAs according to any one of claims 1 to 9.
13. A medicine or combination medicine comprising the RNA expression vector according to claim 11.
14. A eukaryotic cell that stably expresses the RNA or the combination of RNAs according to any one of claims 1 to 9.
15. A cell preparation comprising the eukaryotic cell according to claim 14.
16. A combination of claims 1 to 10, an RNA expression vector according to claim 11, or a eukaryotic cell according to claim 14 for use in treating a disease caused by a decrease in the expression level of the SCN1A gene. , Medicine.
17. The medicine or combination medicine according to claim 12 or 13, or the cell preparation according to claim 15, for use in treating a disease caused by a decrease in the expression level of the SCN1A gene.
18. The disease resulting from a decrease in the expression level of the SCN1A gene is any one disease selected from the group consisting of Drave syndrome, febrile convulsions plus, autism, intellectual disability, and epilepsy in Alzheimer's disease. 16. The medicine according to claim 16, or the medicine, combination medicine or cell preparation according to claim 17.
19. The medicament, combination drug or cell preparation according to claim 18, wherein the disease caused by a decrease in the expression level of the SCN1A gene is a decrease in the expression level of the functional SCN1A gene due to a nonsense mutation or a frameshift mutation of the SCN1A gene.

Images