WO2019224673A1 - Signature protein of mycobacterium tuberculosis and its methods of use - Google Patents

Abstract

The present invention provides a novel signature protein unique to Mycobacterium tuberculosis (M.tb). Further annotation and functional characterization of the signature protein Rv1509 demonstrate the protein binds DNA, is SAM-dependent DNA methyltransferase with anti-oxidant property and highly immunogenic eliciting pro-host immune response in immunized animal. The signature protein is useful as a serodiagnostic and DNA biomarker for M.tb infection. The said protein also serves as a drug target for M.tb treatment.

Description

Signature Protein of Mycobacterium tuberculosis and its Methods of Use

Related Application

This application is related and takes priority from Indian Provisional Application 201811018851 filed l9th May 2018, which is incorporated herein in its entirety.

Field of Invention

The present invention is related to a novel signature protein unique to Mycobacterium tuberculosis (M.tb) among the 13 species of Mycobacteria. The signature protein thus is used for serodiagnosis and DNA biomarker for M.tb infection. The said protein also serves as a drug target for M. tb treatment.

Background

Mycobacterium tuberculosis (M. tb) is one of the oldest pathogen in human history and biologist have completely failed to curb the deadly pathogen. As reported by World Health Organization in 2016, there were 1.4 million deaths caused by Tuberculosis (TB) in 2015, 0.4 million individuals among HIV positive people. There are 10.4 million new TB cases in 2015 of which 1.0 million among children, 3.5 million among women and 5.9 million were among men. The rapid emergence of drug resistant strains and co-infection with HIV poses a new threat to human race.

Summary of the Invention

The present study provides a unique protein herein termed as Rv1509 specific for M.tb. This protein is a resultant of a computational approach among 13 species of mycobacteria to identify proteins unique to M.tb. These identified unique proteins were analysed using different in-silico tools. Further annotation and functional characterization of the signature protein Rv1509 demonstrate the protein binds DNA, is SAM-dependent DNA methyltransferase with antioxidant property and highly immunogenic eliciting pro-host immune response in immunized mice.

The novel Rv1509 protein is useful for serodiagnosis and as a DNA biomarker for diagnosis of M.tb infection. Furthermore, Rv1509 being involved in mycobacterial persistence, survival, transcription and virulence, is a potential drug target for designing therapeutic to treat Mycobacterium tuberculosis- related disease.

Brief Description of Drawings

Figure 1: Bioinformatics workflow Schematic of comparative computational analysis of 13 Mycobacterial species.

Figure 2: Computational analysis of 25 unique proteins (a) Grand average of hydropathy of 25 proteins (b) Instability index of 25 unique proteins (c) Domain found in few unique proteins (d)prosite signature motifs present in unique proteins (e) Number of protein binding sites in disordered regions predicted by ANCHOR (f) Number of essential proteins in 25 unique proteins.

Figure 3: In-silico analysis of signature protein Rv1509 (a) RONN prediction of hypothetical protein Rv1509 predicting content of disordered in protein (b) Globplot analysis showing number of globular domains in hypothetical protein Rv1509 (c, d) Secondary structure prediction showing number of alpha-helix, beta sheets and coil content in protein (e) S- adenosylmethionine binding site and methyltransferase motif predicted by conserved domains blast search (f) DNA-binding leucine zipper motif predicted by Expasy-Prosite tool.

Figure 4: Purification and Methyl transferase activity of Rv1509 protein (a) SDS-PAGE image depicting the purity of Rv1509 protein (b) Western blot image of signature protein Rv1509. (c) Methyl transferase activity assay of purified Rv1509 protein. Different

concentrations of purified Rv1509 was used along with BSA (5mg) as negative control and positive was available from the kit. The absorbance maxima of controls and test proteins are shown in figure.

Figure 5: DNA protection assay from hydroxyl damage DNA protection assay from hydroxyl radical damage: Linear DNA (250ng) was used alone or incubated with different concentrations of signature protein Rv1509 (Lane 2 (4 mg), Lane 4 (2 mg), Lane 5 (4 mg), Lane 6 (6 mg) or BSA (Lane 7, 3 mg), Lane 8 (6mg)) for 60 minutes. Samples were treated for 10 minutes with

FeSO₄/H₂O₂ or left untreated as indicated in (a) Samples were analyzed on ethidium bromide stained 1.5% agarose gel. Lane 1, DNA; Lane 2, DNA + Signature Protein Rv1509; Lane 3, DNA + FeSO₄/H₂O_2; Lane 4, DNA + SP (2 mg) + FeSO₄/H₂O₂; Lane 5, DNA + SP (4mg) + FeSO₄/H₂O₂; Lane 6, DNA + SP (6 mg) + FeSO₄/H₂O₂; Lane 7, DNA + BSA (3 mg) +

FeSO₄/H₂O₂; Lane 8, DNA + BSA (6 mg) + FeSO₄/H₂O₂. (b) Equal concentration of pET28a plasmid was incubated with different concentrations of SP (Lane 2, 1 mg, Lane2, 2 mg and lane 3, 4 mg), lane 5 with control protein (4ug), Lane 6 with NFW and Lane 7 with protein storage buffer for 60 minutes followed by treatment with fenton generated hydroxyl radicals for 10 minutes. All the samples were analyzed on 1 % agarose gel electrophoresis and stained with EtBr.

Figure 6: DNA protection assay from DNase I digestion (a) Equal concentration of PCR amplified linear DNA amplicon (900bp) was incubated with different concentration of Signature protein and BSA equal concentrations for 60 minutes at room temperature. Reactions were treated with DNase I (0.5 units) for 10 minutes. Heat inactivation of the reaction was carried out at 65°C for 10 minutes. Lane 1, DNA; Lane 2, DNA + Signature Protein Rv1509; Lane 3, DNA + DNase I Lane 4, DNA + Signature Protein (2mg) + DNase I; Lane 5, DNA + Signature Protein (4 mg) + DNase I; Lane 6, DNA + Signature Protein (6mg) + DNase I; Lane 7, DNA + BSA (3 mg) + DNase I; Lane 8, DNA + BSA (6 mg) + DNase I. (b) Equal Concentration pET28a plasmid was incubated with different concentrations of Signature Protein(lane 1, 1 mg; Lane 2, 2 mg and lane 3 mg), lane 5 with control Protein (4ug), Lane 6 with NFW and Lane 7 with protein storage buffer for 60 minutes followed by treatment with DNase I (0.5 unit) for 10 minutes. Reaction was inactivated by heating at 65C for 10 minutes. All the samples were analyzed on 1 % agarose gel electrophoresis and stained with EtBr.

Figure 7; Iron Binding ability of signature protein Rv1509 (a) Fluorescence spectra depicts the decrease in the fluorescence intensities of signature protein with increase in the iron concentration. The position of the emission maxima as well as shape remains unaltered (b) Binding curve showing the change in fluorescence intensities ((DF/Fo) at 280nm as the

Iron/signature protein molar ratio was increased.

Figure 8: DNA binding assay of signature protein Rv1509 using Flouresence spectroscopy (a) Concentration dependent DNA Binding; Fluorescence spectra showing decrease in the fluorescence intensities of signature protein Rv1509 with increase in DNA concentration. There is slight decrease in the intensities of peaks indicating the weak binding of signature protein Rv1509 to DNA as compared to Iron (b) Steady emission spectra of signature protein Rv1509 in presence of DNA as a function of time. Data were collected at 23°C. Concentration of signature protein Rv1509 and DNA was 300 mg/ml and 200ng/ ml, respectively.

Figure 9: Signature protein Rv1509 shows higher affinity towards iron (a) Equal concentrations of linear DNA (250ng) were incubated with signature protein Rv1509 (6 mg) in lanes (4-6) and BSA (lane 7,8). In lane 3 (3.3 mM), lane 4 (0.8 mM), lane 5 (1.6mM), lane 6 (3.3mM) FeSo4 was incubated along with signature protein Rv1509 and DNA for 60 minutes. In lanes 7 and 8 (l.6mM), (3.3mM) of FeSO₄ was used and BSA was used as control instead of signature protein Rv1509. DNase I was added for 10 minutes (Lanes 2, 4-8) followed by inactivation with incubation at 65°C for 10 minutes. Samples were analyzed on 1.5% agarose gel. (b) Equal concentration of linear DNA (300ng) were incubated along with signature protein Rv1509 and BSA as control. In this experiment FeSO₄ was added half an hour post DNA and protein incubation (Signature protein and BSA). In lane 3 (0.8 mM), lane 4 (l.6mM), lane 5 (3.3mM) FeSO₄ was added. In lanes 6 and 7 (l.6mM), (3.3mM) of FeSO₄ was used and BSA was used as control instead of signature protein Rv1509. (c) Equal Concentration of plasmid DNA pET28a was incubated with Signature protein (4ug) lanes, 2, 3 4, 5, 6, 7,10 and Control protein (4ug), lane 8. In lanes 3, 4, 5, 6 iron sulphate of 3.3mM, 0.8mM, l.6mM, and 3.3mM, respectively were incubated simultaneously with Signature protein while in lanes 7, 10, Iron sulphate (concentration, l.6m and 3.3mM of FeSO₄) was added half an hour post Signature protein incubation. After lhour incubation with Signature protein, DNase I was added for 10 minutes followed by inactivation by incubation at 65°C for 10 minutes. Samples were analyzed on 1% agarose gel.

Figure 10: Signature protein Rv1509 protects E. coli B121 (DE3) from oxidative stress (a)

Protective ability of E. coli B121 (DE3) transformed with Rv1509 expressing gene and other control protein. Both cultures were exposed to different concentration of H₂O₂ and culture viability was analyzed through plating and colony counting after 1.5 hrs post stress exposure (b) Cell viability of E. coli B121 (DE3) transformed with Rv1509 expressing gene and other control protein after 3hr exposure to oxidative stress.

Figure 11: Signature protein Rv1509 protects Mycobacterium smegmatis me 155 from oxidative and nitrite stress (a) Western blot image showing the expression of Rv1509 in Mycobacterium smegmatis. (b) Growth comparison of Mycobacterium smegmatis transformed with Rv1509 (pST-KiT-Rv1509) and vector alone (pST-KiT) as control. Growth analysis was done at 0, 3, 6 and 9 hours post exposure.(c) Protective ability of Ms_Rv1509 in comparison to Ms_vec at 5mM H₂O₂ at different hours as shown in figure.(d) Protective ability of Ms_Rv1509 in comparison to Ms_vec at lOmM H₂O₂ at different hours, 0, 3, 6 and 9 hours post stress exposure.(e) Protective ability of Ms_Rv1509 in comparison to Ms_vec at l5mM H₂O₂ at different hours.(f) Protective ability of Ms_Rv1509 in comparison to Ms_vec at 30mM sodium nitrate 0, 3, 6 and 9 hours post stress exposure.

Figure 12: shows (a) Comparison of growth rate of Mycobacterium smegmatis transformed with Rv1509 (Ms_Rv1509) and vector alone (Ms_VC (b) Growth analysis was carried out as a function of time.

Figure 13: RAW264.7 cells were infected with Ms_VC+GFP (row a, b, c; first three panels) or Ms_Rv 1509+GFP (a, b, c; last three panels) and observed under light microscope (panels 2, 5), fluorescent microscopy (panels 1, 4) and merged together (panels 3, 6). The cells were visualized immediately after infection (0 hrs, row a), 24 hrs (row b) or 48 hrs (rowc) post infection. Note the reduced uptake of Ms_Rv1509 during early hours of infection (row A; compare panel 3 with 6) and enhanced survival of Ms_Rv1509 after 48 hrs post-infection (row c; compare panel 3 with

6). At 48 hrs post infection, we observed enhanced survival of Ms_Rv1509 inside RAW cells, compared to vector control (row c; compare panel 6 with 3).

(1) CFU comparison between (Ms_Rv1509) and (Ms_VC) immediately after infection.

(2) CFU comparison between (Ms_Rv1509) and (Ms_VC) post 24 hours infection.

(3)CFU comparison between (Ms_Rv1509) and (Ms_VC) post 48 hours infection.

Figure 14: Nitric Oxide (NO) production by RAW cells infected with Ms_VC or Ms_Rv1509 at 24 hours (a) and 48 hours (b) post infection showing significant difference between Ms_VC and Ms_Rv1509.

Figure 15: Fluorescence microscopic studies on RAW 264.7 cells infected with GFP-tagged Ms_Rv1509 show inhibition of phagolysosomal maturation as compared to the GFP-tagged Ms_VC. Bacteria inside phagolysosomes appear yellow whereas bacteria escaping phagolysosomal maturation appear green in color. Host macrophages infected with Ms_Rv1509 shows significantly lower levels of Rab 7 (late endosomal marker) as compared to the cells infected with Ms_VC suggesting the role of Rv1509 in inhibiting phagolysosomal maturation. Figure 16: RAW 264.7 cells infected with Ms_Rv1509 showed higher nuclear damage as compared to cells infected with Ms_VC (vector control) which indicates the spread of infection to uninfected host macrophages.

Figure 17: RAW 264.7 cells infected with Ms_Rv1509 showed higher cell enlargement as well as cell swelling compared to cells infected with Ms_VC (vector control).

Figure 18: RAW 264.7 infected with Ms_Rv1509 showed significantly higher number of cells undergoing necrosis(b) as compared to cells infected with Ms_VC (vector control), as suggested by levels of LDH(a) released by host cells. This further promotes higher bacterial replication (d) and dissemination in Ms_Rv1509 infected cells. The viability of Ms_Rv1509 infected RAW cells are very less compared to vector infected cells and results validated with MTT Assay(c).

Figure 19: Two dimensional (2D) gel electrophoresis analysis revealed differential expression of M. smegmatis proteins in Ms_Rv1509 and Ms_VC elucidating approximately 12 upregulated proteins and 28 downregulated proteins in Ms_Rv1509 as compared to the Ms_VC. It also shows expression of around 13 new proteins in Ms_Rv1509.

Figure 20: a)Representative hierarchical clustering and heatmap showing top 25 upregulated and downregulated genes each, between Ms_Rv1509 and Ms_VC. The colors blue and green represent upregulation while yellow and red colors represent downregulation. b)Further analysis of the total differentially regulated genes implies that majority of the upregulated genes are involved in transcriptional processes.

Detailed Description of Invention

The present invention provides a novel DNA and protein compositions with internal identifier rRv1509 and its method of use in diagnostic and treatment of Mycobacterium tuberculosis. The DNA sequence of rRv1509 of the invention is given by SEQ ID NO: 1 and is encoded by the protein of SEQ ID NO: 2.

SEQ ID NO: 1

SEQ ID NO: 2

The invention is based in part upon the discovery of a novel composition rRv1509 comprising nucleic acid sequence of SEQ ID NO. 1 that encodes a novel protein comprising sequence of SEQ ID NO. 2. These nucleic acids and proteins, as well as derivatives, homologs, analogs and fragments thereof, will hereinafter be collectively designated as " rRv1509" nucleic acid or protein sequences.

In one aspect, the invention provides an isolated rRv1509 nucleic acid molecule encoding a rRv1509 protein that includes a nucleic acid sequence that has identity to the nucleic acids disclosed in SEQ ID NO: 1. In some embodiments, the rRv1509 nucleic acid molecule will hybridize under stringent conditions to a nucleic acid sequence complementary to a nucleic acid molecule that includes a protein-coding sequence of a rRv1509 nucleic acid sequence. The invention also includes an isolated nucleic acid that encodes a rRv1509 protein, or a fragment, homolog, analog or derivative thereof. For example, the nucleic acid can encode a protein at least 80% identical to a protein comprising the amino acid sequence of SEQ ID NO:2. The nucleic acid can be, for example, a genomic DNA fragment or a cDNA molecule that includes the nucleic acid sequence of any of SEQ ID NO:1. Also included in the invention is an oligonucleotide, e.g., an oligonucleotide which includes at least 6 contiguous nucleotides of a rRv1509 nucleic acid (e.g., SEQ ID NO: 1) or a complement of said oligonucleotide. Also included in the invention are substantially purified rRv1509 proteins (SEQ ID NO:2). In certain embodiments, the rRv1509 proteins include an amino acid sequence that is substantially identical to the amino acid sequence of a human rRv1509 protein.

The invention also features antibodies that immunoselectively bind to rRv1509 proteins, or fragments, homologs, analogs or derivatives thereof. In another aspect, the invention includes pharmaceutical compositions that include

therapeutically- or prophylactically-effective amounts of a therapeutic and a pharmaceutically- acceptable carrier. The therapeutic can be, e.g., a rRv1509 nucleic acid, a rRv1509 protein, or an antibody specific for a rRv1509 protein. In a further aspect, the invention includes, in one or more containers, a therapeutically- or prophylactically-effective amount of this pharmaceutical composition.

In a further aspect, the invention includes a method of producing a protein by culturing a cell that includes a rRv1509 nucleic acid, under conditions allowing for expression of the rRv1509 protein encoded by the DNA. If desired, the rRv1509 protein can then be recovered.

In another aspect, the invention includes a method of detecting the presence of a rRv1509 protein in a sample. In the method, a sample is contacted with a compound that selectively binds to the protein under conditions allowing for formation of a complex between the protein and the compound. The complex is detected, if present, thereby identifying the rRv1509 protein within the sample.

The invention also includes methods to identify specific cell or tissue types based on their expression of a rRv1509. Also included in the invention is a method of detecting the presence of a rRv1509 nucleic acid molecule in a sample by contacting the sample with a rRv1509 nucleic acid probe or primer, and detecting whether the nucleic acid probe or primer bound to a rRv1509 nucleic acid molecule in the sample.

In a further aspect, the invention provides a method for modulating the activity of a rRv1509 protein by contacting a cell sample that includes the rRv1509 protein with a compound that binds to the rRv1509 protein in an amount sufficient to modulate the activity of said protein. The compound can be, e.g., a small molecule, such as a nucleic acid, peptide, protein,

peptidomimetic, carbohydrate, lipid or other organic (carbon containing) or inorganic molecule, as further described herein.

Uses

The novel Rv1509 protein is useful for serodiagnosis and as a DNA biomarker for M.tb infection. Furthermore, Rv1509 being involved in mycobacterial persistence, survival, transcription and virulence, is a potential drug target to treat Mycobacterium tuberculosis- related disease. Rv1509 protein, found to be an essential protein is a SAM-dependent DNA methyltransferase and protects DNA from DNA damage and oxidative stress. The expression of Rv 1509 in M. smegmatis changes morphology and growth kinetics of M. smegmatis. The recombinant M. smegmatis expressing Rv1509 protein shows higher intracellular survival and virulence inside host macrophages as compared to the wild-type M. smegmatis (data in Examples). The expression of Rv 1509 protein in M. smegmatis enables the bacteria to induces necrosis, which eventually culminates in enhanced bacterial dissemination. The recombinant M.

smegmatis reduces the secretion of host bactericidal factors such as nitric oxide, favoring survival of the bacteria inside the host. The Rv1509 gene being an essential gene

in Mycobacterium tuberculosis and the recombinant M. smegmatis expressing Rv1509 deploying multiple strategies to evade the host defense system, suggests that Rv1509 could be a potential drug target for Mycobacterium tuberculosis. Together, Rv1509 being involved in mycobacterial persistence, survival, transcription and virulence, is a potential drug target to

treat Mycobacterium tuberculosis- related disease. For example, the compositions of the present invention will have efficacy for treatment of patients suffering from the diseases and disorders disclosed above and/or other pathologies and disorders of the like. The proteins can be used as immunogens to produce antibodies specific for the invention, and as vaccines. They can also be used to screen for potential agonist and antagonist compounds. For example, a cDNA encoding rRv1509 may be useful in gene therapy, and rRv1509 may be useful when administered to a subject in need thereof. By way of non limiting example, the compositions of the present invention will have efficacy for treatment of patients suffering from the diseases and disorders disclosed above and/or other pathologies and disorders of the like.

The therapeutic can be, e.g., a rRv1509 nucleic acid, a rRv1509 protein, or a rRv1509-specific antibody, or biologically-active derivatives or fragments thereof.

The invention further includes a method for screening for a modulator of disorders or syndromes including, e.g., the diseases and disorders disclosed above and/or other pathologies and disorders of the like. The method includes contacting a test compound with a rRv1509 protein and determining if the test compound binds to said rRv1509 protein. Binding of the test compound to the rRv1509 protein indicates the test compound is a modulator of activity, or of latency or predisposition to the aforementioned disorders or syndromes.

Also within the scope of the invention is a method for screening for a modulator of activity, or of latency or predisposition to disorders or syndromes including, e.g., the diseases and disorders disclosed above and/or other pathologies and disorders of the like by administering a test compound to a test animal at increased risk for the aforementioned disorders or syndromes. The test animal expresses a recombinant protein encoded by a rRv1509 nucleic acid. Expression or activity of rRv1509 protein is then measured in the test animal, as is expression or activity of the protein in a control animal which recombinantly-expresses rRv1509 protein and is not at increased risk for the disorder or syndrome. Next, the expression of rRv1509 protein in both the test animal and the control animal is compared. A change in the activity of rRv1509 protein in the test animal relative to the control animal indicates the test compound is a modulator of latency of the disorder or syndrome. In yet another aspect, the invention includes a method for determining the presence of or predisposition to a disease associated with altered levels of a rRv1509 protein, a rRv1509 nucleic acid, or both, in a subject (e.g., a human subject). The method includes measuring the amount of the rRv1509 protein in a test sample from the subject and comparing the amount of the protein in the test sample to the amount of the rRv1509 protein present in a control sample. An alteration in the level of the rRv1509 protein in the test sample as compared to the control sample indicates the presence of or predisposition to a disease in the subject. Preferably, the predisposition includes, e.g., the diseases and disorders disclosed above and/or other pathologies and disorders of the like. Also, the expression levels of the new proteins of the invention can be used in a method to screen for various cancers as well as to determine the stage of cancers.

In a further aspect, the invention includes a method of treating or preventing a pathological condition associated with a disorder in a mammal by administering to the subject a rRv1509 protein, a rRv1509 nucleic acid, or a rRv1509-specific antibody to a subject (e.g., a human subject), in an amount sufficient to alleviate or prevent the pathological condition. In preferred embodiments, the disorder, includes, e.g., the diseases and disorders disclosed above and/or other pathologies and disorders of the like. In yet another aspect, the invention can be used in a method to identity the cellular receptors and downstream effectors of the invention by any one of a number of techniques commonly employed in the art. These include but are not limited to the two-hybrid system, affinity purification, co-precipitation with antibodies or other specific-interacting molecules. rRv1509 nucleic acids and proteins are further useful in the generation of antibodies that bind immuno-specifically to the novel rRv1509 substances for use in therapeutic or diagnostic methods. These rRv1509 antibodies may be generated according to methods known in the art, using prediction from hydrophobicity charts, as described in the "Anti- rRv1509 Antibodies" section below. The disclosed rRv1509 proteins have multiple hydrophilic regions, each of which can be used as an immunogen. These rRv1509 proteins can be used in assay systems for functional analysis of various human disorders, which will help in understanding of pathology of the disease and development of new drug targets for various disorders.

The rRv1509 nucleic acids and proteins identified here may be useful in potential therapeutic applications implicated in (but not limited to) various pathologies and disorders as indicated below. The potential therapeutic applications for this invention include, but are not limited to: protein therapeutic, small molecule drug target, antibody target (therapeutic, diagnostic, drug targeting/cytotoxic antibody), diagnostic and/or prognostic marker, gene therapy (gene delivery/gene ablation), research tools, tissue regeneration in vivo and in vitro of all tissues and cell types composing (but not limited to) those defined here.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In the case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting. Other features and advantages of the invention will be apparent from the following detailed description and claims.

The Examples provided below enumerate the functionality of rRv1509 as well as its mechanism of action. These Examples are illustrative for better understanding of the composition but in no way should be construed as limiting the composition and its functional potential.

Example 1. Comparative proteomic analysis of 13 Mycobacterium species

BlastP (http://blast.ncbi.nlm.nih.gov/Blast.cgi) of all 13 Mycobacterium species proteome versus all 13 Mycobacterium species (Table 1) was done using sequence identity cut-off of 20% and e- value cut-off of 0.0001. The BLastP results were used to create list of protein sequences unique to M. tb.

Table 1:Different species of Mycobacteria used for computational analysis

Nucleotide BLAST of 25 unique proteins

BlastN of nucleotide

sequences of shortlisted 25 unique proteins with all in NCBI.

In-silico structural and functional analyses of 25 unique proteins

Different computational tools were used to understand the possible function of shortlisted unique hypothetical proteins. The tools used for analysis include many available mlatforms, for ex: Expasy-Protparam for protein sequence

analysis, Expasy-Prosite

and so on all of which are available in public domains.

The results of the above in-silico analysis showed the following as presented below:

Unique proteins of M. tb

Comparative proteomic analyses of 13 Mycobacterium species (Figure. 1) revealed 25 protein sequences unique to Mycobacterium tuberculosis which include, 9 from toxin-anti-toxin category, 9 of which are hypothetical proteins, 3 as possible prophages, 2 as acid and phagosome regulated proteins and 2 belonging to PE_PGRS family of proteins (Table 2). Nucleotide BLASTn of the 25 selected target nucleotide sequences showed that 19 have their homologs in M. bovis BCG. Only 6 were found to be unique to Mycobacterium tuberculosis at both nucleotide and proteins sequence level. Among the 6 signature proteins (Table 3), 3 are from prophage category and one is found to be deleted in some clinical strains. BLASTp with all in the NCBI showed that two of these proteins, Rvl507A and Rv1509 are unique to Mycobacterium tuberculosis and were therefore given the name signature proteins of M. tb.

Table 2: Unique proteins identified from comparative proteomic analysis of 13 species

Table 3: Proteins which are unique to M. tb at both protein and nucleotide level.

Nucleotides sequences of unique proteins which show more than 90% similarity in BCG or unique to M. tb

Unique hypothetical protein Rv1509 and Rvl507A is signature to Mycobacterium tuberculosis

BLASTp of unique protein Rv1509 and Rvl507A with all in the database revealed that hypothetical protein Rv1509 shares 100% identity and similarity with only one homolog in M. bovis B27505 strain. It also shares 95% coverage and 67% identity with M. rhodesae.

Moreover, there is not a single protein in the database which shares more than 50% identity and 100% coverage with Rv1509 signature protein.

In-silico analysis of 25 unique proteins

In order to understand the possible function of identified unique proteins, bioinformatics analysis was performed. A search for conserved domains, prosite signatures, essentiality of proteins and protein binding sites in these 25 unique proteins was done (Figure. 2). In this regard, grand average of hydropathy showed that proteins with negative value of hydropathy (Figure. 2a) and instability index are more unstable and non-polar (Figure. 2b). A search against domain database and prosite signature motif revealed presence of number of domains and signatures in few proteins (Figure. 2c, d). Structural studies found that these proteins are highly structured and few have protein binding sites in disordered regions (Figure. 2e). Only one protein was found to be essential among all from tuberculist database analysis (Figure. 2 f).

In-silico structural and functional analysis of signature protein Rv1509

In depth analysis of signature protein Rv1509 showed that the protein is highly ordered, enriched with alpha-helix and beta sheets with very less disorder content, just around 8.87% (Figure. 3a- d). Analysis also revealed the presence of S-adenosyl methionine binding site (Figure. 3e), methyltransferase motif and DNA binding leucine zipper (Figure. 3f) expanding from 51-72 aa in the protein sequence of Rv 1509. Amino acid sequence analysis shows isoelectric point 8.89, arginine content 8.9% and cysteine content of 1.7% in the protein sequence. Signature protein Rv1509 is positively charged with the total of 34 negatively charged residues in the sequence and 38 positively charged residues.

Example 2. Cloning, expression and purification of signature protein Rv1509:

Rv1509 hypothetical gene was PCR-amplified from Mycobacterium tuberculosis DNA using following gene specific primers, F: 5’ TTAAGCTTGTAATGGTGTTTG CGTTGAG 3’ (SEQ ID NO: 3) and Rv1509 R: 5’ ATCTCGAGTTACCTCTTCGTTAGCCGCAC 3’ (SEQ ID NO:

4). PCR amplified product was ligated into the expression vector pET28a using BamHl and Hindlll restriction sites. Protein expression was done in E. coli BL21(DE3) expression strain and purification by Ni-NTA Chromatography using N-lauryl-sarcosine a mild denaturant as solubilising agent. Purified protein was refolded and desalted using dialysis by snake skin membrane (thermoscientific) in buffer pH 7.8, lx PBS, 10% glycerol. Protein was concentrated using 3kda cut off centricons. Protein confirmation was done using SDS-PAGE and western blotting using anti-His antibody. Protein estimation was done using BCA protein estimation kit from Thermo Scientific.

Generation of polyclonal antibodies to Rv1509

Polyclonal antibodies against Rv1509 were generated in rabbits by methods known in the art. The antibody titer in the serum was determined by dot-blot technique 2 weeks after final immunization.

Example 3. DNA-methyltranferase activity assay of signature protein Rv1509

S-adenosyl methionine (SAM) dependent DNA methyltransferase activity of signature protein Rv1509 was estimated using colorimetric EpiQuik™ DNMT Activity/Inhibition Assay Ultra Kit using the manufacture’s protocol.

The results of assay showed the presence of DNA-binding leucine zipper and methyltransferase motif from computational analysis pointed to the likelyhood of the unique signature protein Rv1509 being a DNA methyltransferase. To characterize the methyltransferase activity, the recombinant protein was purified to high degree of purity (Figure. 4a) and confirmed through western blotting (Figure. 4b). Methyltransferase activity was assayed using colorimetric assay for methylation to the universal substrate coated to wells. As the protein has been purified using N-lauryl sarcosine, a mild denaturant, different and higher concentration of purified and refolded protein was used expecting its low activity for the assay. BSA was used as test negative control. The colorimetric method confirmed the SAM-dependent methyltransferase activity of signature protein (Figure. 4c).

Example 4. DNA protection against reactive oxygen species

In-vitro assay against DNA protection was carried out using PCR amplified 893bp linear DNA. In order to validate anti-oxidant property of signature protein Rv1509, equal concentration of PCR amplified 893 -bp fragment of DNA was incubated with different concentrations of signature protein Rv1509 and BSA protein as control. After subsequent treatment with fenton reaction generated free radicals (FeSO₄/H₂O₂). DNA in control samples was completely degraded as compared to signature protein treated DNA samples (Figure. 5a). Similar results were obtained when a plasmid DNA pET28a was incubated in-vitro with H₂O₂ and

Fe(II)(FeSO₄) in the presence or absence of purified recombinant signature protein or a BSA as control protein. The DNA was completely degraded by FeSO₄/H₂O₂ treatment and substantial protection was conferred by pre-treatment with recombinant signature protein. In contrast, pretreatment with equivalent concentration of BSA did not result in any protection (Figure. 5b).

Example 5. DNA protection against DNase I digestion

To find out DNA binding ability, DNA protection assay against DNasesI digestion by signature protein Rv1509 was carried out. DNA protection against DNase I was assessed in-vitro using 400ng of 843-bp PCR amplified linear DNA amplicon or 900ng pET28a plasmid DNA. Both linear and plasmid DNA were allowed to interact with signature protein Rv1509. Control protein was used in case of plasmid DNA and BSA was used for linear DNA in equal concentration for 60 minutes at RT. DNase I was then added and the treatment was carried out for 10 min at 37°C. The reaction was terminated by incubating the reaction mix at 65°C for 10 min. DNA samples in reactions which were treated with signature protein Rv1509 were found to be intact after DNase I treatment as compared to control proteins (Figure. 6). This experiment depicts the DNA binding and protection ability of signature protein Rv1509. Example 6. Signature protein iron binding assay using fluorescence spectroscopy

In order to get further insights on anti-oxidant property of signature protein Rv1509 and to ascertain if this signature protein has role in regulating the production of free radicals by sequestering iron ions, fluorescence spectroscopy was used. Fluorescence spectroscopy results showed strong affinity of signature protein towards iron. Different concentrations of iron sulphate were used to check the shift in the absorbance maxima. The fluorescence intensities of signature protein decreased gradually with the increase in concentration of iron although the positions of emission maxima as well as the shape of the peaks remains unaltered (Figure. 7a). The observed fluorescence data were used for calculating the fluorescence quenching (Q= (F_o- F)/F_o, where F is the measured fluorescence and F_o is the fluorescence in the absence of iron). Plots of graph of Q (%) against the molar ratios of ligand/protein were prepared. As seen from (Figure. 7b), iron binding was seen as smooth rising curves. The least squares fit of the fluorescence intensity changes for the iron binding curves were obtained by Sigma Plot 8.0. The R values for the fit curves of the binding of iron were found to be 0.92. The error bars on the experimental points were estimated from the average of values that were obtained by repeating each experiment 3 times.

Example 7. Signature protein Rv1509 binding to DNA

Non-specific DNA binding ability of signature protein was analyzed using fluorescence spectroscopy in both concentration and time dependent experiments. The spectra measured in presence of different concentrations of DNA decreased relative to the spectrum collected in the absence of DNA as shown in (Figure. 8a). The spectra obtained at different time points 5, 10 and 15 minutes post DNA addition at single concentration showed greater shift or decrease in fluorescence compared to spectrum in absence of DNA (Figure. 8b).

Example 8. Signature proteins Rv1509 binding with DNA under low iron conditions

The binding of signature protein Rv1509 to DNA under stress and low iron conditions was carried out by incubating equal concentrations of plasmid DNA with signature protein Rv1509 and control protein BSA along with different concentrations of FeSO₄ for 60 minutes. In one more experiment, signature protein Rv1509 was added half an hour prior to FeSO₄ in same concentrations of DNA and protein as in other reactions. After 60 minutes of incubation at RT, DNase I was added and incubated for 10 minutes. Lastly, the samples were analysed on 1% agarose gel and stained with ethidium bromide.

From the data presented above, it became clear that hypothetical signature proteins binds strongly to iron and protects DNA from oxidative stress and therefore, it was tempting to investigate whether this protein belongs to Dps family of proteins in Mycobacterium

tuberculosis. Results (Figure. 9) show that with the increase in the iron concentration (FeSO₄), DNase I protection ability of signature protein decreases indicating availability of signature protein for DNA binding decreases so is its ability for protection.

Example 9. Rescue of E. coli BL21(DE3) cells from oxidative stress by signature proteins Rv1509

The IPTG induced E. coli BL21(DE3) cells transformed with pET28a-Rv1509 protein construct and pET28a-control protein construct were incubated at 37°C for lhr post-induction. Both control protein and Rv1509 expressing culture were treated with 50mM, 100mM and 150mM H₂O₂ stress and survivability was analysed 1.5 hr and 3 hr post-treatment through colony counting.

After I hr induction with lmM IPTG, the cultures were exposed to different concentrations of H₂O₂. Culture from Rv1509 expressing cells and control were diluted to 1: 1500 dilution before stress and 10 ml from each sample were plated on Kan⁺ plates. After 1.5hrs post stress (Figure. 10a), cultures from each tube were again collected and diluted in 1:1500, 10 ml from dilution were plated as before followed by another collection and dilution in a similar manner after 3hrs (Figure. 10b). It could be seen that E. coli Bl(DE3) cells expressing signature protein Rv1509 survived better in oxidative stress at all three different concentrations (50mM, 100mM and l50mM H₂O₂), as compared to control (Figure. 10).

Example 10. Development of recombinant Mycobacterium smegmatis strain of Rv1509

Mycobacterial expression vector pST-Kitwas used to sub-clone Rv1509 gene. Rv1509 gene was obtained from pET28a construct using BamHl and Hindlll restriction sites. Rv1509-pST-KiT construct was electroporated into Mycobacterium smegmatis using the standard protocol. The recombinant Mycobacterium smegmatis strains were selected on MB7H10 medium containing 50 mg/ml kanamycin (Kan). The constructs harboring Rv1509 gene were confirmed by PCR amplification, and the positive recombinant strains were stored with sterile 20% glycerol at -80°C for further use.

Detection of expression of Rvll509 in Mycobacterium smegmatis

The recombinant Mycobacterium smegmatis strains harboring His-tagged Rv1509 (Ms_Rv1509) and vector pST-KiT (Ms_Vec) were cultured in MB 7H9 broth medium supplemented with 50 mg/ml Kan. At the OD600 -value of 0.5, the recombinant strains were subjected to 20mM anhydro tetracycline for protein expression. The recombinants including Ms_Vec and

Ms_Rv1509 were harvested after 48 hour anhydrotetracycline induction using centrifugation at the speed of 3000 x g for 10 min, 4°C. The collected cells were washed. The cell pellet was dissolved in SDS-PAGE loading dye and heated at 90°C for 30 minutes. The lysed fractions were loaded to SDS-PAGE and further detected by Western blot analysis using specific anti-Rv1509 antibody generated in rabbit. The blots were formed when incubation with IgG-HRP, an anti rabbit IgG monoclonal antibody labeled with horseradish peroxidase.

In-Vitro growth Assay

Liquid culture of Mycobacterium smegmatis me 155 (Ms_Rv1509) and vector transformed Mycobacterium smegmatis me 155 cells were grown at 37 C in supplemented 7H9 broth containing sterile ADC enrichment and 0.05 % Tween 80. The cultures were grown till saturation at 37°C and then diluted to equal the OD_600nm in 7H9 broth supplemented with ADC, Tween 80 and protein expression inducer anhydrotetracycline. The diluted cultures were seeded in 96 well plates with equal OD_600nm in triplicates. Growth was monitored at OD_600nm every 3 h for 9 hrs in kinetic growth reader with constant shaking. The data so obtained were plotted using Graph Pad Prism 5 software.

Stress Challenge experiments on recombinant Mycobacterium smegmatis mc²155

To study the effect of oxidative and nitrite stress, liquid culture of Mycobacterium smegmatis me 155 (Ms_Rv1509) and vector transformed Mycobacterium smegmatis me 155 cells were grown at 37°C in supplemented 7H9 broth containing sterile ADC enrichment and 0.05 %

Tween 80. The cultures were grown till saturation at 37°C and then diluted to equal the OD in 7H9 broth supplemented with OADC, Tween 80 and protein expression inducer

anhydrotetracycline and different concentrations of H₂O₂ (5mM, lOmM and15mM) and sodium nitrite (lOmM, 20mM and 30mM). The diluted cultures were seeded in 96 well plates with equal OD_600nm in triplicates. Growth was monitored at OD_600nm every 3 hr for 9 hrs. In kinetic growth reader with constant shaking. The data so obtained were plotted using GraphPad Prism 5 software.

To mimic the M.tb conditions we transformed Mycobacterial smegmatis with Rv1509 clone, which is widely used model to study Mycobacterium tuberculosis proteins. Rv1509 protein expression was analysed by western blotting using anti-Rv1509 antibody developed in rabbit (Figure. 11a). We tried to evaluate the growth difference between recombinant Ms_Rv1509 and Ms_Vec. There is a drastic decrease in growth pattern of recombinant Mycobacterium smegmatisexpressing Rv1509 compared to control (Figure. 11b). As the Ms_Rv1509 was growing slowly compared to the growth of control, it was difficult to compare the effect of oxidative stress on the growth of recombinant and control Mycobacterium smegmatisstrains . To test for resistance to reactive oxygen and nitrogen speciesofMs_Rv 1509 and Ms_Vec. Ex-vivo cultures were grown with equal starting OD and incubated with different concentrations of H₂O₂ and sodium nitrite, OD_600nm was recorded at different time points before and after exposure. Our results as shown in (Figure. 11c, d, e) confirmed that signature protein provides resistance to reactive oxygen and nitrogen species during intial hours. However, with 30mM sodium nitrite concentration resistance ability of Ms_Rv1509 was found and showing similar pattern as that of H₂O₂ resistance (Figure. Ilf). Example 11. Growth Curve Assay: The recombinant Mycobacterium smegmatis me 155 expressing Rv1509 gene (Ms_Rv1509) and Mycobacterium smegmatis me 155 vector control (Ms_VC) cells were grown in 7H9 broth supplemented with 10% OADC, 0.5% glycerol and

0.05 % Tween 80 at 37°C and 200 rpm. The growth of bacterial cultures were monitored at OD₆₀₀ every 3hours for 120 hours to measure the growth kinetics of wild-type M.smeg, Ms_VC and Ms_Rv 1509.

The expression of Rv 1509 in Mycobacterium smegmatis mc2 155 modulates the growth of M. smegmatis. M.smegmatis transformed with Rv1509 (Ms_Rv1509) gene exhibits growth retardation as compared to the vector control (Ms_VC) (Figure 12a). Growth curves of Ms_VC, Ms_Rv1509 and wild type M.smegmatis(Ms-WT)grown in 7H9 medium under aerobic conditions (Figure 12b). The doubling time as calculated for the vector control M.smegmatis (~4 hours) was significantly lower as compared to the recombinant M.smegmatis(~12 hours)as estimated from the growth curve. Since most of the pathogenic mycobacterium strains are slow growers, these data suggest that presence of Rv1509 protein might play a key role in regulating virulence and pathogenicity of recombinant M. smegmatis. Example 12. Enhanced survival of Ms_Rv1509 inside RAW cells

Ms_Rv1509 and Ms_VC were transformed with green fluorescent protein (GFP) expressing vector (pSC30l). RAW 264.7 cells (3x10⁵ cells/well) were seeded in 12 well plates and cells were infected with GFP expressing Ms_Rv1509 or GFP-expressingMs_VC at multiplicity of infection [MOI] 1:10. After 4 hours of infection, cells were washed thrice with IX PBS to remove any extracellular bacteria and fresh growth media was added to the cells. Live cell imaging at 40X using EVOS FL Auto2.0 was performed to identify the bacteria inside the macrophages. Images were taken at 0 hrs, 24 hrs and 48 hrs post infection.

For colony forming units (CFU) assay, RAW 264.7 cells were lysed and 100 ml of sample was plated on 7H10 plates containing Kanamycin (50ug/ml) and Hygromycin (lOOug/ml) as selection markers. The samples were plated at Ohr, 24hr and 48 hours post-infection and CFU were estimated.

In order to study the association between Rv1509 and virulence, experiments to determine the intracellular survivability of recombinant bacteria and the wild type bacteria inside the host macrophages were performed. Using fluorescence microscope, it was observed that there was a significantly reduced uptake of Ms_Rv1509 compared to that of the Ms_VC by the macrophages inspite of infecting the macrophages with equal number of bacteria (Figures 13a-c). One possible explanation for low infectivity could be the longer length of the recombinant M.

smegmatis compared to the vector control M. smegmatis. Interestingly, inspite of initial reduced uptake, Ms_Rv1509 showed enhanced survival inside RAW264.7 cells as compared to the Ms_VC post 48 hours infection. This data suggests that recombinant M. smegmatis expressing Rv1509 enhances survival in murine macrophage cell line, indicating a potential role of Rv1509 in bacterial persistence. Infection of RAW264.7 cells with Ms_Rv1509 exhibits increased survival inside host macrophages as compared to cells infected with vector control as estimated by colony formation unit (CFU) assay indicating Rv1509-mediated enhanced survival of M. smegmatis inside the macrophages (Figure 13, 1-3). Example 13. Nitric Oxide Production

RAW264.7 cells were infected with Ms_Rv1509 or Ms_VC. Post 24 and 48 hours infection, cell culture supernatants were collected and NO levels were estimated using Griess reagent.

Nitric Oxide, a key anti-mycobacterial molecule has a significantrole in regulating cellular signaling and innate immune responses during mycobacterial infection.

(a,b) RAW264.7 cells infected with Ms_Rv1509 exhibit lower Nitric Oxide levels for both 24 hours and 48 hours post infection as compared to the cells infected with Ms_VC suggesting decreased bactericidal effect in the presence of Rv 1509 gene (Figures 14a and b). This suggests that lower levels of NO might be helpful in enhanced survival of recombinant bacteria inside macrophages than that of vector control as inhibition of NO levels is an important survival strategy by M.tuberculosis inside the host macrophages.

Example 14. Phagolysosomal Maturation

Macrophage (RAW264.7) cells were seeded (2x10⁵/ well) on coverslip in 24 well plate. The macrophages were then infected with Ms_Rv1509 or Ms_VC at MOI of 1:10 for 4 hours followed by washing and addition of complete growth media supplemented with 50ug/ml Gentamycin. The cells were fixed using 4% formaldehyde at different time points. After fixation, cells were incubated with anti-rabbit LAMP1 antibody (1:250 dilution in PBS) for 2 hours at room temperature. The cells were then washed with IX PBS thrice, followed by the adding secondary anti-rabbit IgG (Alexaflour 594, 1:1000 dilution) along with DAPI for 1 hour 30 min at room temperature. The cells were then washed and mounted with 100% glycerol and incubated over night at room temperature and next day images were acquired using ZEISS Fluorescence microscope. For estimation of Rab7 levels, we performed western blotting using primary anti-rabbit Rab7 antibody (1:1000) and secondary anti-rabbit IgG HRP-conjugated antibody. The images for western blot was captured using Biorad Chemidoc system.

Following are the results as shown in Figure 15a and Figure 15b.

a) Fluorescence microscopic studies on RAW 264.7 cells infected with GFP-tagged

Ms_Rv1509 show inhibition of phagolysosomal maturation as compared to the GFP- tagged Ms_VC. Bacteria inside phagolysosomes appear yellow because of

superimposition whereas bacteria escaping phagolysosomal maturation appear green in colour. b) Host macrophages infected with Ms_Rv1509 shows significantly lower levels of Rab 7 (late endosomal marker) as compared to the cells infected with Ms_VC suggesting the role of Rv1509 in inhibiting phagolysosomal maturation.

Collectively, these results suggest that recombinant M. smegmatis expressing Rv1509 escapes entry into phagolysosome, thereby exhibiting augmented survival inside the host macrophages.

Example 15. Nuclear damage

The protocol for assaying host nuclear damage in the presence and absence of Rv1509 was performed as per standard protocols (Example 14) . RAW 264.7 cells infected with Ms_Rv1509 showed higher nuclear damage as compared to cells infected with Ms_VC (vector control). The nucleus stained with DAPI(Blue) showed severe DNA damage and leakage of DNA into the cytosol (Figure 16) which indicates towards the spread of infection to uninfected host macrophages, pointing to increased virulence mediated by Rv1509 in recombinant M.

smegmatis.

Example 16. Bacterial virulence and pathogenecity

The protocol for assaying host cell and nuclear enlargement in the presence and absence of Rv1509 was performed as described earlier for Example 14. The only change for this assay was that the microscopic images were taken at 40X.

RAW 264.7 cells infected with Ms_Rv1509 showed enlarged cell membrane as well as enlarged nucleus compared to cells infected with Ms_VC (vector control). After 72 hours post infection, the recombinant M. smegmatis expressing Rv1509 disseminates and spreads the infection to the uninfected macrophages whereas cells infected with vector control gets cleared from the host cells. This data suggests an important role of Rv 1509 protein in bacterial virulence and pathogenicity (Figure 17).

Example 17. Necrosis and microbial survival

RAW 264.7 cells (macrophages) were infected with Ms_Rv1509 orMs_VC at MOI of 1:10. Post 24, 48 and 72 hours infection, the supernatants from the macrophages infected with Ms_Rv1509 or Ms_VC were collected and were assayed for LDH levels using Pierce™ LDH cytotoxicity Assay Kit. For MTT assay, cells infected with Ms_VC or Ms_Rv1509 were incubated with MTT for 4 hours. Post 4 hours, the formazan crystals were dissolved using DMSO. The absorbance was recorded at 590nm.

Necrosis is a mechanism known to benefit the survival of M.tb inside macrophages. To determine whether necrosis of macrophages helps in increased intracellular survival of recombinant M. smeg, RAW 264.7 cells were Ms_RVl509 or Ms_VC. It was found that RAW 264.7 cells infected with Ms_Rv1509 showed significantly higher number of cells undergoing necrosis (Figure 18b) as compared to cells infected with Ms_VC (vector control), as suggested by levels of LDH (Figure 18a) released by RAW 264.7 cells. This suggests that presence of Rv1509 proteinpromotes higher bacterial replication (Figure 18d) and dissemination in

Ms_Rv1509 infected cells as compared to vector control. The viability of Ms_Rv1509 infected RAW cells was significantly lower as compared to vector infected cells as assessed using MTT assay (Figure 18c).

Example 18. Proteomic Profile

Ms_Rv1509 and Ms_VCcultures were harvested and the culture pellets were dissolved in lysis buffer and sonicated for 10 minutes.This was followed by centrifugation at 13,000rpm for 25minutes at 4°C to separate the pellet and supernatant. The supernatant was subjected to Trichloro Acetic acid (TCA) precipitation in order to remove the salts from the protein sample. The purified protein was dissolved in Rehydration buffer, and the protein concentration was estimated using Bradford assay. Equal concentration of protein samples were loaded on to 5-8 IPG strips. After two hours, the proteins were applied on the IPG strips by adding mineral oil and incubated at room temperature for overnight. Next day, the Iso Electric Focusing was done according to the standard protocol. After this, the samples were stored at -80°C overnight. The SDS gels of stored IPG strips were run and protein spots were visualized by staining with Coomassie Brilliant Blue stain. The protein spots on the 2D gel were analyzed using the software PD QUEST.

Since recombinant M. smegmatis expressing Rv1509 protein showed enhanced survival inside host macrophages, the proteomic profile of recombinant M. smegmatis and wild type

M.smegmatis was compared to elucidate the role of bacterial proteins in promoting enhanced survival inside macrophages and escaping host immune responses. Two dimensional (2D) gel electrophoresis analysis revealed differential expression of M.smegmatis proteins in Ms_Rv1509 and Ms_VC elucidating approximately 12 upregulated proteins and 28 downregulated proteins in Ms_Rv1509 as compared to the Ms_VC (Figure 19). It also shows expression of around 13 new proteins in Ms_Rv1509. It is possible that the bacterial proteins showing differential regulation between recombinant and wild-type M. smegmatis have important role(s) in escaping host immune response.

Example 19. Clustering and Heatmap

The high quality reads were mapped to Reference Mycobacterium smegmatis genome using HISAT2 to create alignment in BAM format for each sample. Prior to mapping, the index of reference genome was built using hisat-build (HISAT2 specific indexer program). Then the input reads, in FASTQ format, were given to HISAT2 aligner along with the reference genome index. StringTie was run wherein the BAM files, having alignments of reads, and the reference GTF file is given as input. StringTie first groups the aligned reads into distinct loci and then assembles each loci into as many isoforms as required to explain the data. Following this StringTie simultaneously assembles and quantifies the final transcripts by using flow network algorithm and starting from most highly abundant transcripts. The GTF(Gene transfer format) annotation files, containing genes, are then used to annotate the assembled transcripts and quantify the expression of known genes as well derived clues if a novel transcript has been found in the sample. A total of 7.8 Gb high quality data were generated on Illumina platform for Ms_WT and Ms_Rv1509 (Supplementary Table 8). These were then analyzed using new tuxedo pipeline. The HQ reads from each sample were mapped to Mycobacterium smegmatis version l500vl using HISAT2 at an alignment rate of 95.53% in Ms_Rv1509 and 88.12% in Ms_VC (Supplementary Table 9). The alignment was used along with Mycobacterium smegmatis genome gene annotation to assemble 6853 known genes through StringTie. The functional annotation of known genes was done through gene ontology

(http://www.geneontology.org/)andKEGGpathwaydatabases

(https://www.genome.jp/kegg/pathway.html). Gene ontologyassignments were used to classify the functions of predicted CDS. The GO mapping also provides ontology of defined terms representing gene product properties that were grouped into three main domains: Cellular component, molecular function and biological process. The output consists of assembled gene/transcript GTF and a FPKM file. Following this, the sample 1 (Ms_VC) on the left was considered denominator (or control) and sample 2 (Ms_Rv1509) on the right was considered numerator (or treated). Thereby fold change was calculated as sample 2/sample 1 and next these fold change values were transformed to logarithmic base 2 values. The negative value represents down-regulated genes and positive values represent up-regulation or no change in expression genes. The annotation of the known genes was done from two databases viz The Gene Ontology and KEGG pathway database. For Gene Ontology (GO) annotation, a gene list was created from reference GTF file and then this gene list was uploaded to Uniprot KB Webserver

(https://www.uniprot.org/help/uniprotkb) in Uniprot ID/mapping program. The known gene IDs were mapped to gene IDs available in uniprotKB for Mycobacterium smegmatis bacteria, thereby, giving us all associated GO ID, term and definition. In the next step, Pathway annotation was done based on reciprocal blast hit of known cDNA sequences of Mycobacterium smegmatis to database sequences of KEGG. To facilitate this step, the cDNA sequences were downloaded from ensembl (JA: is this correct spelling or without‘e’) then uploaded these sequences to KAAS server and chosen "prokaryotic" gene set for annotation. As the

gene/transcript abundance file was obtained from the StringTie, the FPKM count for each gene in each sample was considered for Differential Gene Expression (DGE). A in-house perl script was used to bring together the FPKM values of same gene in two samples of the concerned combination.

Figure 20a provides a representative hierarchical clustering and heatmap showing top 25 upregulated and downregulated genes each, between Ms_Rv1509 and Ms_VC. The colours blue and green represent upregulation while yellow and red colours represent downregulation. Further analysis of the total differentially regulated genes implies that majority of the upregulated genes are involved in transcriptional processes (Figure 20b). This indicates that elucidation of role of these differentially regulated bacterial genes in the presence or absence of Rv1509 protein can improve our understanding of functional role(s) of Rv1509 in M.tb.

Furthermore, Table 4 shows a list of top 11 upregulated genes in Ms_Rv1509 involved in transcriptional regulation. This suggests that Rv1509 could be a master transcriptional regulator, modulating expression of several transcriptional regulator genes.

Table 4. Transcriptional regulators which are up regulated by expression of Rv1509 in Mycobacterium smegmatis

Claims

Claims We claim:

1. An isolated protein comprising an amino acid sequence selected from the group consisting of : (a) a mature form of an amino acid sequence consisting of SEQ ID NO: 2 (b) a variant of a mature form of an amino acid sequence consisting of SEQ ID NO: 2, wherein one or more amino acid residues in said variant differs from the amino acid sequence of said mature form, provided that said variant differs in no more than 15% of the amino acid residues from the amino acid sequence of said mature form; (c) an amino acid sequence selected from the group consisting of SEQ ID NO:2; and (d) a variant of an amino acid sequence selected from the group consisting of SEQ ID NO:2, wherein one or more amino acid residues in said variant differs from the amino acid sequence of said mature form, provided that said variant differs in no more than 15% of amino acid residues from said amino acid sequence.

2. The protein as claimed in claim 1, wherein said protein comprises the amino acid sequence of a naturally-occurring allelic variant of an amino acid sequence selected from the group consisting of SEQ ID NO:2.

3. The protein as claimed in claim 2, wherein said allelic variant comprises an amino acid sequence that is the translation of a nucleic acid sequence differing by a single nucleotide from a nucleic acid sequence consisting of SEQ ID NO:1.

4. The protein as claimed in claim 1, wherein the amino acid sequence of said variant comprises a conservative amino acid substitution.

5. An isolated nucleic acid molecule comprising a nucleic acid sequence encoding a protein comprising an amino acid consisting of: (a) a mature form of an amino acid sequence consisting of SEQ ID NO:2; (b) a variant of a mature form of an amino acid sequence consisting of SEQ ID NO:2 wherein one or more amino acid residues in said variant differs from the amino acid sequence of said mature form, provided that said variant differs in no more than 15% of the amino acid residues from the amino acid sequence of said mature form; (c) an amino acid sequence consisting of SEQ ID NO:2; (d) a variant of an amino acid sequence consisting of SEQ ID NO:2 wherein one or more amino acid residues in said variant differs from the amino acid sequence of said mature form, provided that said variant differs in no more than 15% of amino acid residues from said amino acid sequence; (e) a nucleic acid fragment encoding at least a portion of a protein comprising an amino acid sequence consisting of SEQ ID NO:2 or a variant of said protein, wherein one or more amino acid residues in said variant differs from the amino acid sequence of said mature form, provided that said variant differs in no more than 15% of amino acid residues from said amino acid sequence; and (f) a nucleic acid molecule comprising the complement of (a), (b), (c), (d) or (e).

6. The nucleic acid molecule of claim 5, wherein said nucleic acid molecule comprises a nucleotide sequence consisting of (a) a nucleotide sequence consisting of SEQ ID NO:1; (b) a nucleotide sequence differing by one or more nucleotides from a nucleotide sequence consisting of SEQ ID NO: 1, provided that no more than 20% of the nucleotides differ from said nucleotide sequence; (c) a nucleic acid fragment of (a); and (d) a nucleic acid fragment of (b).

7. The nucleic acid molecule of claim 5, wherein said nucleic acid molecule hybridizes under stringent conditions to a nucleotide sequence consisting of SEQ ID NO: 1, or a complement of said nucleotide sequence.

8. The nucleic acid molecule of claim 5, wherein the nucleic acid molecule comprises a nucleotide sequence selected from the group consisting of (a) a first nucleotide sequence comprising a coding sequence differing by one or more nucleotide sequences from a coding sequence encoding said amino acid sequence, provided that no more than 20% of the nucleotides in the coding sequence in said first nucleotide sequence differ from said coding sequence; (b) an isolated second polynucleotide that is a complement of the first polynucleotide; and (c) a nucleic acid fragment of (a) or (b).

9. A vector comprising the nucleic acid molecule of claim 8.

10. The vector of claim 9, further comprising a promoter operably-linked to said nucleic acid molecule.

11. A cell comprising the vector of claim 9.

12. An antibody that immunospecifically-binds to the protein of claim 1.

13. The antibody of claim 12, wherein said antibody is a polyclonal antibody, monoclonal antibody, human antibody or a humanized antibody.

14. A pharmaceutical composition comprising the protein of claim 1 and a pharmaceutically- acceptable carrier.

15. A pharmaceutical composition comprising the nucleic acid molecule of claim 5 and a pharmaceutically-acceptable carrier.

16. A pharmaceutical composition comprising the antibody of claim 12 and a pharmaceutically- acceptable carrier.

17. A pharmaceutical composition comprising the protein of claim 1 useful for serodiagnosis of Mycobacterial tuberculosis infection.

18. A pharmaceutical composition comprising the protein of claim 1 useful as a DNA biomarker for diagnosis of Mycobacterial tuberculosis infection.

19. A pharmaceutical composition comprising the protein of claim 1 useful as a drug target for designing therapeutic for treatment of Mycobacterium tuberculosis- related disease.