WO2019214063A1

WO2019214063A1 - Method for detecting circulating tumor cells

Info

Publication number: WO2019214063A1
Application number: PCT/CN2018/095808
Authority: WO
Inventors: 孙奋勇; 潘秋辉; 江赐忠; 吴棋; 黄楠; 崔中奇
Original assignee: 上海市第十人民医院
Priority date: 2018-05-07
Filing date: 2018-07-16
Publication date: 2019-11-14
Also published as: CN110456034A; CN110456034B

Abstract

A method for detecting circulating tumor cells, comprising: collecting a human body fluid sample and fixing same with formaldehyde to improve the cell membrane permeability; adding cells to a plurality groups of PCR multi-tube strips, a reverse transcription primer carrying ID1 being added to each strip; after the cells are reverse-transcribed into cDNA molecules, collecting the cells, mixing same, and adding same to another group of PCR multi-tube strips, an extension primer carrying ID2 and having 3' terminus capable of specifically identifying 3' terminus of a cDNA molecule being added to each strip; performing an extension reaction after sequence complementation; collecting and lysing the cells; and pre-proliferating the extension product using a PCR primer. High-throughput sequencing is performed to analyze the combination of ID1:ID2. In addition, the reverse transcription and PCR proliferation for different markers can accurately identify circulating tumor cells and circulating tumor cells in which EMT occurs, and can be used in combination with other technologies to detect extremely few circulating tumor cells and other non-body fluid rare cells in a body fluid sample to the maximum extent.

Description

Method for detecting circulating tumor cells

Technical field

The invention relates to the technical field of cell detection, in particular to a method for efficiently detecting rare cells in a body fluid, in particular to a method for accurately detecting circulating tumor cells from blood, and the invention relates to a method for using tumors from tumors. A kit for detecting circulating tumor cells in peripheral blood of a patient, and an analytical method for circulating tumor cells and an application thereof.

Background technique

Malignant tumors are one of the major diseases that seriously endanger human life and health. Finding ways to diagnose early, predict metastasis and prognosis, and invasive methods is important to improve the survival rate of such patients. In recent years, with the development of molecular biology technology, people have gradually enriched the understanding of the molecular mechanism of tumor development, and have achieved clinical diagnosis and targeted therapy for tumors. Traditional histopathological examination is limited to the location of tumor growth, the size of specimens, and the heterogeneity of tumors. Therefore, tissue biopsy at a single site is difficult to reflect the genome of the tumor. In addition, due to invasive sampling, tissue biopsy not only causes greater trauma to the patient, but also cannot be repeated multiple times.

Circulating tumor cells (CTCs), as a new non-invasive diagnostic tool for real-time monitoring, can be regarded as liquid biopsy samples, opening up a new research field for early diagnosis, prognosis evaluation and therapeutic effect monitoring of malignant tumors. . Compared with tissue biopsy, CTCs have unique advantages such as convenience, non-invasiveness, and reproducibility. They can display the genome of the tumor and monitor the patient's disease progression and treatment process in real time.

1CTCs Overview

CTCs are tumor cells that are released into the peripheral blood circulation by in situ tumors or metastases and have similar properties to the primary lesions. Most of them are apoptotic or phagocytic after entering the peripheral blood. A few surviving CTCs are extremely strong. Adhesion and invasiveness are the main biological basis for the metastasis of malignant tumors. During tumor progression, tumor cells undergo genetic mutations or epigenetic changes to obtain more invasive biological phenotypes or stem cell characteristics, of which epithelial to mesenchymal transition (EMT) is recognized as promoting CTCs entry. One of the main mechanisms of the blood system. Existing studies have found that CTCs can be detected in lung cancer, colorectal cancer, breast cancer, prostate cancer, pancreatic cancer, etc., and it is present in patients with a lack of clear lymph nodes and distant metastasis, clinical stage is early, so CTCs The test can be used for early screening of the tumor, judging the prognosis and predicting the possibility of future metastasis and recurrence of the patient.

2CTCs detection method

The number of CTCs is rare in the peripheral blood of tumor patients, and there is only one CTC per 10 ⁶ -10 ⁷ mononuclear cells. Therefore, most methods separate and enrich CTCs before detection, and then identify and analyze them by various reliable means.

2.1CTCs separation and enrichment technology:

According to the immunological and physical characteristics of tumor cells, the commonly used methods for enriching CTCs are immunomagnetic beads separation (IMS) and isolation by size of epithelial tumor cells (ISET). IMS is based on the differential expression of certain cell surface molecular markers (such as dermal cell adhesion molecules, cytokeratin) between CTCs and blood cells, using magnetic beads coated with specific antibodies, and in the field of external magnetic fields. Enrichment of cells under the action. For example, the only one currently approved by the US Food and Drug Administration (FDA)

The CTC test kit is the most widely used method for combining CTCs capture and detection. The kit not only enriches CTCs with magnetic beads coated with epithelial cell adhesion molecule (EpCAM) antibody, but also sorts the enriched cells with fluorescein-labeled CK antibody and CD45 antibody, while using DAPI Nuclei were stained, and cells of CK+/CD45-/DAPI+ were identified as CTCs; captured cells were also photographed, analyzed, and counted automatically. The kit gives the number of CTCs with prognostic significance: in metastatic colorectal cancer, the number of CTCs is less than 3/7.5mL. Peripheral blood suggests a better prognosis; the number of CTCs in metastatic prostate cancer and breast cancer Less than 5 / 7.5mL peripheral blood suggests that the patient has a better prognosis. Recently, Elaine et al. established a low-cost, high-throughput CTCs enrichment device that significantly enhances CTCs by microcontacting EpCAM antibodies onto nanoporous silica substrates combined with microfluidic technology. The efficiency of the acquisition. However, this type of technology is limited to markers. For example, during metastasis, epithelial-derived tumor cells may not express or underexpress CK and EpCAM under exogenous stimulation or self-variation, resulting in inefficient capture of CTCs. In addition, due to the cross-antigen expression between tumor cells and normal cells, and the heterogeneity of tumor cells, CTCs in the same patient do not express consistent markers, so false positive or false negative results may occur.

The ISET technique is based on the fact that CTCs are larger than the blood cells and have high hardness. The CTCs are separated from the peripheral blood by a filter membrane with a pore size of 8 μm, and then detected by immunocytochemistry. The method can maintain the integrity of the cells for subsequent cytology and genomics research, and has the advantages of convenience, economy, and less time. Since ISET isolated CTCs are mainly through cell size rather than cell surface molecular markers, they are more suitable for heterogeneous malignant tumors such as gastric cancer, prostate cancer and lung cancer, which can greatly reduce false positive results caused by antigen cross-expression. However, the ISET method can only separate larger volumes of CTCs, and for those smaller CTCs that are easily filtered, false negative results may be obtained. In 2014, researchers developed a CTCs chip that combines filter channels and microfluidic channels. By testing peripheral blood samples from lung cancer patients, it was confirmed that this cell-based chip can be more resistant to antibody-mediated capture. Efficient separation of CTCs.

The negative enrichment strategy does not depend on tumor-specific surface antigens, and the CD45 is indirectly enriched by immunomagnetic beads method by effectively removing CD45(+) leukocytes or CD61(+) macrophages, platelets and other peripheral blood cells. +) or CD61 (+) negative rare cells, overcoming the shortcomings of the positive enrichment strategy. However, the product obtained by this negative enrichment strategy is low in purity, low in specificity, and the recovery rate needs to be improved.

2.2CTCs detection technology:

At present, commonly used detection techniques for CTCs include cytometry and nucleic acid detection methods such as flow cytometry, RT-PCR, and immunocytochemistry. Flow cytometry can quantitatively analyze cells in suspension, and the detection speed is fast, but the cell morphology cannot be observed. RT-PCR can detect the presence of CTCs in peripheral blood by detecting the expression levels of specific genes (oncogenes or tumor suppressor genes) in CTCs, such as EGFR and HER2. It is one of the effective methods for detecting CTCs. A small amount of RNA, but the cell count result cannot be obtained after the method extracts the nucleic acid. Immunocytochemistry mainly detects specific markers on the surface of CTCs, such as epithelial membrane antigen, cytokeratin (CK8, CK18, CK19) and EpCAM, which are often used for morphological analysis, but this method cannot exclude the contamination of epithelial cells in peripheral blood. A false positive result occurred. In addition, the obtained CTCs can also be studied at the cellular and molecular levels for cell culture, FISH, single cell sequencing, and the like.

On the whole, the traditional density gradient centrifugation method and cell size filtration method have fatal defects with low enrichment efficiency. The immunomagnetic bead positive enrichment method has many disadvantages such as cumbersome operation, inconvenient use and missed detection, and microfluidic chip technology exists. The disadvantages of high cost and high technical difficulty.

Summary of the invention

A first object of the present invention is to provide a method for detecting circulating tumor cells or other non-humoral rare cells from body fluids in view of the deficiencies of the prior art circulating tumor cell detection technique.

A second object of the present invention is to provide a kit for detecting circulating tumor cells.

A third object of the present invention is to provide a detection system for circulating tumor cells.

In order to achieve the above first object, the technical solution adopted by the present invention is: a method for detecting circulating tumor cells in a body fluid, the method comprising the following steps:

a. collecting human body fluid specimens;

b. Collecting nucleated cells in body fluids, fixing the cells, and treating the cells to increase cell membrane permeability;

c. The cells are evenly dispersed into a set of PCR multiple tubes, each tube is provided with a reverse transcription primer carrying a different recognition sequence ID1, and the cDNA molecule is obtained by reverse transcription, and the 5' end carries a specific ID1 sequence;

d. The collected cells are mixed and added to another set of PCR multi-tubes, each tube is provided with an extension primer carrying a different recognition sequence ID2, and the 3' end can specifically recognize the 3' end of the cDNA molecule, and the extension reaction is performed by complementing the sequence ;

e. Collect the combined cells, lyse the cells, and extend the product in 10-15 cycles of PCR pre-amplification d;

f. collecting PCR preamplification products and purifying;

g. High throughput sequencing of the PCR product;

h. Analysis of the combination of ID1:ID2 in each effective molecular sequence allows an assessment of the exact number of circulating tumor cells as well as other non-humoral rare cells.

As a preferred technical solution, the body fluid includes blood and other body fluid samples, and other body fluid samples include, urine, pleural effusion, ascites, cerebrospinal fluid, and digestive juice.

As a preferred technical solution, the circulating tumor cells include circulating tumor cells with or without epithelial-mesenchymal transition.

As a preferred technical solution, the reagent for immobilizing cells in step b is selected from any one or a combination of glutaraldehyde, formaldehyde, acetone, methanol, ethanol, acetic acid, acrolein, uranyl acetate, chromic acid, picric acid or a combination thereof.

As a preferred technical solution, the agent for increasing the membrane permeability in the step b is a nonionic surfactant. Preferably, the nonionic surfactant is Triton-X 100.

As a preferred technical solution, the number of PCR manifolds in step c is three or more.

As a preferred technical solution, ID1 includes two or more nucleic acid sequences in step c, and is combined into 16 or more unique recognition sequences by array, corresponding to each PCR tube containing cells.

As a preferred technical scheme, the ID1 sequence in step c is directly synthesized on the reverse transcription primer sequence, or is linked to the reverse transcription cDNA molecule by ligation, extension, and complementary pairing.

As a preferred technical solution, the number of PCR manifolds in step d is three or more.

As a preferred technical solution, ID2 in step d includes two or more nucleic acid sequences, and is combined into 16 or more unique recognition sequences by array, corresponding to each PCR tube containing cells.

As a preferred technical scheme, the ID2 sequence in step d is ligated to the complementary strand of the reverse transcribed cDNA molecule by ligation, extension, complementary pairing or PCR amplification.

As a preferred technical solution, the specifically recognized marker in step d is a marker of epithelial cells, a tumor-specific marker or an interstitial cell marker.

As a preferred technical solution, the epithelial cell marker is any one of CK18, CK19, EpCAM, KRT20, KRT19, KRT7, E-cadherin or a combination thereof.

As a preferred technical solution, the tumor-specific markers are CEA, SCC, CA125, CA50, CA19-9, CA242, CA724, CEA, CA125, ALP, AFP-L3, AFU, GP73, PSA, PCA3. Any one or a combination of TMPRSS2-ETS, PIVKA-II, NSE, CYFRA21-1, CEA, CA153, AFP.

As a preferred technical solution, the mesenchymal cell marker is any one of Vimentin, fibronectin, MMP9, N-cadherin, AKT2 or a combination thereof.

In order to achieve the above second object, the technical solution adopted by the present invention is: a kit for detecting circulating tumor cells, the kit comprising: 1) reverse transcription and amplification primers of epithelial cell specific markers; a reverse transcription and amplification primer for a tumor cell-specific marker; 3) a fixing reagent and a membrane permeabilizing reagent.

As a preferred technical solution, the reverse transcription and amplification primers of the epithelial cell-specific marker are used to detect circulating tumor cells or other non-humoral rare cells in a body fluid.

As a preferred technical solution, the reverse transcription and amplification primers of the tumor cell-specific marker are used to detect circulating tumor cells in a body fluid.

As a preferred technical solution, the fixing reagent is selected from any one or a combination of glutaraldehyde, formaldehyde, acetone, methanol, ethanol, acetic acid, acrolein, uranyl acetate, chromic acid, picric acid or a combination thereof.

As a preferred technical solution, the permeation reagent is a nonionic surfactant. Preferably, the nonionic surfactant is Triton-X 100.

As a preferred technical solution, the kit further includes instructions for describing the above method.

In order to achieve the above third object, the technical solution adopted by the present invention is: a detection system for circulating tumor cells, the detection system being capable of performing the above method, and/or capable of processing a sample to be detected using the above kit.

As a preferred technical solution, the detection system is an automation system.

The advantages of the invention are:

The invention adopts a "non-selective enrichment" technical solution. Traditional CTC enrichment methods, whether based on cell physics or biochemical markers, or based on negative enrichment or positive enrichment methods, may have different degrees of loss of CTC cells. The method adopted by the invention can theoretically detect all CTC cells by using PCR technology combined with deep sequencing, greatly improving the detection sensitivity, and fundamentally solving the drawbacks of all current detection methods. In addition, the two-step method of enrichment-identification is combined into a one-step detection method, which has greater practicability.

At present, there are many reports that CTC cells can be combined with single-cell sequencing after enrichment, and CTC can be deeply analyzed at both the genome and expression groups, but the number of CTCs cannot be identified and cannot be directly used as a clinical feature of tumors. landmark. On the other hand, if the current mainstream single-cell sequencing method is directly adopted, it is extremely expensive to consider the existence of millions of nucleated cells per milliliter of blood. The invention only recognizes CTC-related cells, and combines the PCR technology to pre-amplify the CTC signal, and then analyzes with high-throughput sequencing, which can completely restore the true quantity of CTC in the blood.

In the blood of tumor patients, in addition to white blood cells, there are also a small number of endothelial cells, fibroblasts, variant CTC, and CTCs that occur in EMT, which may affect the recognition of CTC. In order to improve the accuracy of identification, we must consider several Indicators are jointly identified. The technology used in the present invention is an open platform, and various cell identifications can be completed through different index combinations, which has great application value.

The invention can also conveniently combine the other existing CTC enrichment techniques to improve the sensitivity and specificity of the detection technology.

By designing different primer sequences, the number of different cell types in the blood can be detected, such as fibroblasts, endothelial cells, and tumor-associated macrophages.

Once tumor cells leave their native environment, many degenerative processes include hemolysis, platelet activation, cytokines, and oxidative bursts, and the formation of extracellular trapping networks of neutrophils introduces indirect damage to intact blood specimens. The extremely rare and fragile nature of circulating tumor cells exacerbates these problems, not only because target cells are difficult to extract in this unfavorable environment, but also because of impaired blood cells, extracellular DNA, and changes in cell morphology and marker expression. The cell sorting mechanism has also suffered damage. A controlled study using tumor cells added to the blood confirmed that the number of circulating tumor cells decreased by more than 60% within 5 hours after blood collection, and RNA was also significantly degraded within 2–4 hours. In clinical studies where specimens typically require 3-4 hours of short-term storage, nearly 40% of isolated single-cell RNA quality control was found to be unacceptable; within 12 hours, 79% of cells had RNA degradation. However, the method of the present invention can prevent cell rupture and RNA degradation by adding a fixed reagent as soon as possible after collecting blood.

DRAWINGS

Figure 1 is a circulating tumor cell detection strategy.

Figure 2 is a flow of analysis of sequencing information.

Figure 3 is a quality test of sequencing results. Above: Base quality score distribution at each position of the resulting sequence. Bottom panel: Distribution of the resulting sequence over the entire gene region, indicating that the RNA is not degraded.

Figure 4 is the result of tumor cell recovery experiments.

detailed description

The present invention will be further described below in conjunction with the embodiments and with reference to the accompanying drawings.

definition:

Non-humoral rare nuclear cells: circulating tumor cells having epithelial origin or no epithelial origin and circulating vascular endothelial cells, tumor stem cells, stem cells, fetal cells in blood, and some rare cells such as immune cells.

Circulating Tumor Cells (CTC): Tumor cells that enter human peripheral blood are usually referred to as circulating tumor cells. Circulating tumor cells are one type of non-humoral rare nucleated cells.

Circulating Endothelia Cells (CEC): Vascular endothelial cells that have fallen into the blood are called circulating endothelial cells. Circulating endothelial cells are also a type of non-humoral rare nucleated cells.

Circulating Fibroblast Cells (CFC): Fibroblasts that have fallen into the blood are called circulating fibroblasts. Circulating fibroblasts are also a type of non-humoral rare nucleated cells.

Endothelial-Mesenchymal Transformation (EMT): refers to the biological process by which epithelial cells are transformed into mesenchymal phenotype cells by a specific procedure. It plays an important role in embryonic development, chronic inflammation, tissue remodeling, cancer metastasis, and various fibrotic diseases. Its main features are decreased expression of cell adhesion molecules (such as E-cadherin) and cytokeratin cytoskeletal transformation. It is a cytoskeleton mainly composed of vimentin and has the characteristics of mesenchymal cells in morphology.

Single tube recognition sequence (Identity, ID): A nucleic acid recognition sequence, which is mainly used in the present invention to encode a reverse transcription molecule of a cellular RNA molecule in a different tube.

Gene Specific Sequence (GSS): A specific recognition sequence designed for a target gene, and is mainly used for reverse transcription and PCR amplification in the present invention.

The sample to be tested in the present invention is usually a sample of nucleated cells collected from a body fluid.

The body fluid may be peripheral blood, cord blood, urine, spinal cord and pleural effusion, ascites, semen, bone marrow, amniotic fluid, sputum, and the like.

A nucleated cell, which contains immune cells, endothelial cells, fibroblasts, and circulating tumor cells, undergoes mesenchymal-epithelial conversion of circulating tumor cells.

The sample is collected, and after the reagent is fixed or permeabilized, the expression of the protein, the transcription of the RNA, and the like are fixed, and the sample can be stored at 4 ° C or stored at -20 ° C for a long time.

Pre-treatment of the sample includes:

The red blood cell lysate was added to the shaker for 8-12 min, and after centrifugation for 5-10 min, a mixture of white blood cells and tumor cells was obtained. This method was a "non-selective" collection, which was able to ensure the maximum collection of nucleated cells in the body fluid.

Leukocytes are less dense than other body fluids/blood components and can therefore be separated according to differences in density gradients. With a density gradient, the vast majority of white blood cells in the blood can be separated from other components. This method can remove most white blood cells and facilitate subsequent detection, but it will cause the loss of circulating tumor cells or affect the state of the cells.

The principle of immunomagnetic beads is that the cell surface antigen molecule can be combined with a specific monoclonal antibody to which magnetic beads are attached. Under the action of an external magnetic field, cells connected to the magnetic beads by the antibody are attracted and remain in the magnetic field, while other cells Because it is magnetic, it cannot stay in the magnetic field, so that the cells can be separated. Immunological-based enrichment methods are classified into negative and positive. Immuno-negative enrichment can remove leukocytes from the blood with anti-CD45 antibodies or anti-CD61 antibodies. Although this method can remove most white blood cells and facilitate subsequent detection, it can also cause loss or state change of circulating tumor cells.

For the collected nucleated cell fixation and transmembrane treatment methods:

The cells were resuspended by adding 1 mL of pre-chilled PBSi buffer (1 x PBS + 0.05 U/μL RNase inhibitor). The cell suspension was collected in a 15 mL centrifuge tube. 3 mL of pre-cooled 1.33% formaldehyde solution (1×PBS) was added to 1 mL of cell suspension, fixed for 10 min, and then 160 μL of 5% Triton X-100 permeable cells were added for 3 min.

The method can increase the stability of RNA molecules and proteins in cells by immobilizing nucleated cells in body fluids. The membrane-penetrating treatment is to facilitate the subsequent reaction of the reverse transcription and nucleic acid extension reaction system into the cells for in situ reaction, and to ensure the subsequent nucleic acid encoding process. At the same time, by optimizing the fixation and transmembrane conditions, it is ensured that the RNA and cDNA molecules in the cells do not penetrate the cells.

Intracellular reverse transcription:

The fixed and transfected cells were separately added to several PCR manifolds, each containing a specific reverse transcription primer: including the GSS+ID1+G_R sequence, followed by reverse transcription.

The number of PCR manifolds can be three or more, depending on the expected number of circulating tumor cells, and a 24-well PCR reaction tube is commonly used.

ID1 refers to a specific recognition sequence per tube, which is composed of two or more nucleic acids, and is combined into 16 or more unique sequences by array, corresponding to each tube containing cells.

The sequence composition of the reverse transcription primer includes: Gene Specific Sequence (GSS) + reaction tube recognition sequence 1 (ID1) + linkage sequence (linker1), wherein the role of linker1 is mainly complementary to the second round of coding ID2 sequence To facilitate sequence extension reactions.

In the reverse transcription primer sequence, GSS is a gene-specific sequence for anchoring specific marker mRNA molecules, ID1 is a specific coding sequence, G_R (General Reverse Primer) is a universal reverse amplification sequence, and GSS length can be 2 Or a longer sequence, either a trans-intron sequence or a contiguous sequence (taking into account the effects of genomic DNA), can be applied to any region of the detection gene, and can be followed by a polydT sequence to form an anchor sequence, for most RNAs. Reverse transcription.

Preferably, one or more epithelial and/or tumor-specific marker-encoding gene transcription products are subjected to targeted reverse transcription, mainly considering the presence of various types of rare cells in the body fluid, and the circulating tumor cells also have various forms. Alternatively, the nature of the change, the simultaneous reverse transcription of a variety of marker gene transcription products can facilitate the identification of subsequent cell types.

Preferably, the marker of epithelial cells refers to a marker protein peculiar to such cells, which may be a cell membrane surface protein, a cytoplasmic protein, or a nuclear protein. Includes: EpCAM, CK8, CK18, and/or CK19, and combinations of the above indicators.

Preferably, the tumor-specific marker is a marker protein unique to various tumor cells, and may be a cell membrane surface protein, a cytoplasmic protein, a nuclear protein, or even a mutant protein.

Various tumors refer to common malignant tumors such as breast cancer, lung cancer, liver cancer, colon cancer, stomach cancer, brain cancer, and pancreatic cancer.

Intracellular extension reaction:

The cells subjected to reverse transcription were collected and added again to a PCR 8-tube, each well containing 12 μM of different coding strands (GSS+ID2+G_F), and a Taq enzyme mixture was added for extension reaction.

Wherein GSS is a sequence capable of specifically recognizing a downstream of a cDNA molecule, and ID2 is a recognition sequence specific to each tube, consisting of two or more nucleic acids, and is arranged into 16 or more unique sequences by alignment, corresponding to Each well contains cells.

G_F (General Forward Primer) refers to a universal upstream primer for the amplification of a marker reverse transcription cDNA molecule.

Preferably, the 3' end of the extension primer is linked to a biotin-labeled magnetic bead to facilitate automation of purification of the late PCR product.

The extension reaction may be carried out using a Klenow fragment, T4 DNA polymerase, DNA polymerase I (E. coli), Bsu DNA polymerase large fragment, Taq DNA polymerase, and various other forms of DNA polymerase.

Preferably, the present invention employs Taq DNA polymerase for the extension reaction.

The coding sequence for intracellular extension includes GSS+ID2+G_F, and the extension primer method can also be ligated to the reverse transcription cDNA molecule by ligation reaction, PCR amplification or the like. The ligation reaction may be a blunt end or a cohesive end connection, or may be a ligation reaction after the PCR product.

Cell lysis:

All of the above reaction systems were collected and incorporated into a 15 ml centrifuge tube, which was then centrifuged at 1000 g for 5 min at 4 ° C to remove the supernatant. Then, 4 mL of a washing solution (4 mL of 1×PBS, 40 μL of 10% Triton X-100) was added, and the mixture was centrifuged at 1000 g for 5 min at 4° C., and the supernatant was removed, and washed with 50 μL of PBS. Proteinase K solution (20 mg/mL) was added and incubated at 55 ° C for 2 h while shaking to reverse the cross-linking effect of formaldehyde.

Preferably, the cell lysis reagent is Triton X-100, and other types of nonionic surfactants can generally be used.

cDNA purification:

40 μL of Dynabeads MyOne Streptavidin C1 magnetic beads (ThermoFisher) was prepared, washed 3 times with 1×B&W buffer (containing 0.05% Tween-20), and resuspended magnetic beads with 100 μL of 2×B&W. 100 μL of the magnetic bead suspension was added to the above cell lysate, and left at room temperature for 60 min to allow the magnetic beads to bind to the cDNA. The beads were washed twice with 1 x B&W buffer, and 10 mM Tris was washed once with 0.1% Tween-20, and each wash was gently shaken.

cDNA purification refers to the process of removing proteins, RNA, various ions and impurities. There are a variety of techniques and kits available for DNA purification on the market. Preferably, the present invention uses magnetic bead purification in a manner that is primarily considered to facilitate automated operation.

PCR:

The magnetic beads were resuspended with 110 μL of 2×Kapa HiFi HotStart Master Mix (Kapa Biosystems), 8.8 μL of 10 μM Gene Universal Upstream Primer G_F and Universal Downstream Primer G_R with 92.4 μL of water. The PCR reaction was as follows: 95 ° C for 3 min, then denaturation at 98 ° C for 20 s, annealing at 65 ° C for 45 s, and extension at 72 ° C for 3 min for a total of 10 cycles.

Considering that in body fluids, circulating tumor cells are rare cells, especially in the blood, there are a lot of white blood cell interference. In order to improve the detection sensitivity, pre-amplification of the reverse-transcribed cDNA molecules is considered to facilitate subsequent high-throughput sequencing.

The number of pre-amplification cycles is 2 or more, and the present invention preferentially uses 10-15 cycles.

Preferably, the 5' end of the gene-specific upstream primer G_F and the universal downstream primer G_R are labeled with biotin to facilitate magnetic bead purification of subsequent PCR products.

High-throughput sequencing:

The samples were subjected to high throughput sequencing using a 150 nucleotide kit and double end sequencing. Read1 covers the specific marker gene sequence, and Read2 covers the ID1+ID2 sequence.

Bioinformatics analysis:

First, quality control analysis is performed according to the analysis of high-throughput sequencing, and low-quality sequence data is deleted, and then different CTC types are obtained according to the characteristic sequence analysis of the detection index.

The combination of the above-mentioned various types of cells ID1+ID2 is counted, and the number of various types of cells is obtained.

The overall strategy is shown in Figure 1 and Figure 2.

Compared with the existing commercial detection methods on the market, the method adopts the “non-enrichment” method to minimize the loss of circulating tumor cells, and the combined PCR pre-amplification and high-throughput sequencing technologies are greatly improved. The sensitivity of the detection theoretically ensures that every circulating cell can be detected. At the same time, combined with a variety of epithelial cells and tumor-specific indicators through bioinformatics analysis can distinguish various rare cells in body fluids, including epithelial cells, tumor cells, epithelial-mesenchymal transition tumor cells, tumor stem cells. The method of the present invention can serve as a gold standard to fill the gap in the field of standard solutions.

Example 1 Detection and Analysis of Simulated Samples of Peripheral Blood Incorporating Tumor Cell Lines in Healthy People

In this embodiment, the HepG2 cells diluted in the peripheral blood of a healthy person are mixed and analyzed as a simulated sample, and the efficiency of detecting the tumor by the method, that is, the recovery performance of the method, is evaluated as follows:

(1) Sample preparation

The HepG2 cells in the culture dish were digested and made into a single cell suspension, which was counted by a red blood cell counting plate, diluted to a suitable concentration with PBS, and carefully sucked a certain number of tumor cells with a pipette, and added anticoagulated 5 ml healthy person. In the peripheral blood, ensure the accuracy of the quantity.

(2) Specimen collection and pretreatment

After adding buffer to the above human peripheral blood sample, the plasma was removed by centrifugation for 5-10 minutes, then the red blood cell lysate was added and shaken in a shaker for 8-12 min, and after centrifugation for 5-10 min, a mixture of leukocytes and tumor cells was obtained.

(3) Fixed cells

The above sample was resuspended by adding 1 mL of pre-chilled PBSi buffer (1 x PBS + 0.05 U/μL RNase inhibitor). The cell suspension was collected in a 15 mL centrifuge tube. 3 mL of pre-cooled 1.33% formaldehyde solution (1×PBS) was added to 1 mL of cell suspension, fixed for 10 min, and then 160 μL of 5% Triton X-100 permeable cells were added for 3 min. The cells were centrifuged at 500 g for 3 min at 4 ° C, the supernatant was discarded, and the cells were resuspended by adding 500 μL of PBSi buffer and 500 μL of pre-cooled 100 mM Tris-HCl (pH=8.0) buffer solution. After centrifugation at 500 g for 3 min, 300 μL of pre-cooled PBSi was resuspended.

(4) Intracellular reverse transcription (gene-specific reverse transcription, while introducing ID1 for the first round of nucleic acid coding)

The above cells were separately added to several (recommended 3) PCR occluders, each well containing a specific reverse transcription primer RTp (GSS+ID1+linker1), and 18 μL of a reverse transcription mixture was added to each well. The PCR tube was placed in a PCR machine and cycled three times according to the reaction conditions of 50 ° C, 10 min; 8 ° C, 12 s; 15 ° C, 45 s; 20 ° C, 45 s; 30 ° C, 30 s; 42 ° C, 2 min; 50 ° C, 3 min. Incubate for 10 min at the last 50 °C. The reaction system was collected, transferred to a 15 mL centrifuge tube, added with 9.6 μL of 10% Triton X-100, centrifuged at 500 g for 3 min at 4 ° C, the supernatant was discarded, and the cells were resuspended by adding 2 mL of 1×NEB 3.1 buffer and 20 μL of RNase inhibitor.

(5) intracellular extension (introduction of ID2 for the second round of nucleic acid coding)

The cells obtained in the previous step were again added to three PCR-8 tubes, each well containing 12 μM different coding strands (GSS+ID2+G_F), and 18 μL LTaq enzyme mixture was added, and the extension reaction conditions were 95 ° C, 3 min, 60 ° C, 1 min, 72 ° C, 5 min. The reaction system was collected and transferred to a 15 ml centrifuge tube.

(6) Cell lysis

All of the above reaction systems were collected and incorporated into a 15 ml centrifuge tube, which was then centrifuged at 1000 g for 5 min at 4 ° C to remove the supernatant. Then, 4 mL of the washing solution (4 mL of 1×PBS, 40 μL of 10% Triton X-100) was added, and the mixture was centrifuged at 1000 g for 5 min at 4° C., the supernatant was removed, and washed with 50 μL of PBS. According to the situation of the detection indicators, it is divided into several tubes. Add 1 × PBS to each well to make up the volume to 50 μL, then add 50 μL of 2× lysate (20 mM Tris (pH 8.0), 400 mM NaCl, 100 mM EDTA (pH 8.0), 4.4% SDS), 10 μL of Proteinase K solution (20 mg/mL) Incubate at 55 ° C for 2 h while shaking, reverse the cross-linking effect of formaldehyde, and store at -80 ° C.

(7) cDNA purification

5 μL of 100 μM PMSF was added to the above cell lysate, and incubated at room temperature for 10 min to sufficiently inhibit the activity of proteinase K. At the same time, 40 μL of Dynabeads MyOne Streptavidin C1 magnetic beads (ThermoFisher) was prepared, washed 3 times with 1×B&W buffer (containing 0.05% Tween-20), and resuspended magnetic beads with 100 μL of 2×B&W. 100 μL of the magnetic bead suspension was added to the above cell lysate, and left at room temperature for 60 min to allow the magnetic beads to bind to the cDNA. The beads were washed twice with 1 x B&W buffer, and 10 mM Tris was washed once with 0.1% Tween-20, and each wash was gently shaken.

(8) PCR preamplification

The mixture was mixed with 92.4 μL of water with 110 μL of 2×Kapa HiFi HotStart Master Mix (Kapa Biosystems), 8.8 μL of 10 μM Gene Universal Upstream Primer G_F and Universal Downstream Primer G_R. The PCR reaction was as follows: 95 ° C for 3 min, then denaturation at 98 ° C for 20 s, annealing at 65 ° C for 45 s, and extension at 72 ° C for 3 min for a total of 10 cycles.

(9) High-throughput sequencing

The above amplification products were constructed using a standard Illumina library kit. RNA sequencing was performed using Illumina's MiSeq sequencing platform. The sequencing protocol is a 150 nucleotide kit and a double end sequencing method. Read1 covers the specific marker gene sequence, and Read2 covers the ID1+ID2 sequence.

(10) Bioinformatics analysis

First, the sequence obtained by sequencing is subjected to quality control analysis to delete low-quality sequence data. Then, only the sequences containing ID1 and ID2 were retained, and the ID1, ID2, and linker sequences on these sequences were removed, and then the sequence was compared with the human reference genome by HiSat2 software to calculate the expression level of the tumor marker gene. The number of circulating cells is obtained by counting the combination of ID1 + ID2. Tumor cells can be typed based on the detection of different tumor marker genes by these cells.

Quality testing of sequencing results indicated that the sequencing quality was qualified (Figure 3).

As a result of the present example, it was found that the recovery rate of the tumor cells within 30 cells after addition was 100%, and the addition of 50 cells lost 2 cells. It is fully demonstrated that the method of the present invention has excellent specific recovery ability for tumor cells, can effectively remove background interference of blood cells, and has a reliable recovery rate for low cell numbers.

Example 2 CTC detection of clinical liver cancer blood samples

(1) Sample preparation

A total of 83 cases of clinical diagnosis of liver cancer were diagnosed in this group, of which 52 cases were obtained by histological diagnosis. A total of 124 peripheral blood samples were collected.

(2) Sample testing

7.5 ml of the above blood sample was gently inverted and mixed several times, and then the number of circulating tumor cells was measured according to the procedure in Example 1. We chose AFP as a specific marker for liver cancer, and designed the primer sequences as follows:

Liver cancer AFP

GSS_F sequence (3'-5'): CCGTCGTAAAGAGGTTGTCC (SEQ ID NO: 1)

GSS_R sequence (3'-5'): CGACGAAACCCTCAAATT (SEQ ID NO: 2)

ID1 (3'-5'): ATCATG (SEQ ID NO: 3)

ID2(3'-5'): TCTGAC (SEQ ID NO: 4)

G_R(3'-5'): GGCGACTTGGCGCACA (SEQ ID NO: 5)

G_F(3'-5'): GGTTACTGGGCTGCCT (SEQ ID NO: 6)

(3) Analysis of test results

a. Detection results of peripheral blood CTCs in liver cancer

The detection rate of CTCs in peripheral blood was 63.85% (53/83) in all patients with liver cancer, and the number of CTCs was 0-208, with an average of 1.96/ml. The results are shown in Table 1.

Table 1 Inspection of all specimens CTCs

b. The value of CTCs predicting metastasis before surgery

The presence of tumor cells in the peripheral blood of the patient means that the chance of metastasis will increase. However, whether the detection of CTCs before surgery can accurately predict tumor metastasis is a clinical concern. Fifteen patients in this group could not be evaluated because of incomplete data. The remaining 67 patients were considered to have metastases in the distant metastasis and postoperative pathology as the study group, and the remaining cases were the control group. The value of predicting tumor metastasis by CTCs was evaluated. The results are shown in Table 2. The evaluation criteria include sensitivity, specificity, positive likelihood ratio, negative likelihood ratio, crude coincidence rate, and adjustment consistency. The results are shown in Table 3. The results showed that preoperative detection of CTCs was accurate in determining whether tumors were metastasized; when the number of CTCs exceeded 11/7.5 ml, the sensitivity and specificity of CTCs for predicting metastasis were higher, as shown in Table 4.

Table 2 CTCs' forecast of transfer

Table 3 Prediction of the number of CTCs

Table 4 Accuracy of CTCs as diagnostic experiments

c. Relationship between CTCs and pathological features, tumor stage

Tumor pathological features and staging are the basis of tumor adjuvant therapy and prognosis. Therefore, judging the relationship between CTCs and the two will evaluate its clinical guiding significance. According to the BCLC staging of 52 patients with hepatocellular carcinoma diagnosed by this group, the number of CTCs in each stage was calculated. The results are shown in Table 5. The detection rate of peripheral blood CTCs in stage 0 liver cancer patients was 50% (1/2), stage A liver cancer. The detection rate of peripheral blood in patients was 44.4% (4/9), the detection rate of peripheral blood in patients with stage B liver cancer was 75.0% (6/8), and the detection rate of peripheral blood in patients with stage C liver cancer was 75.7% (25/33). (See Table 5).

Table 5 Relationship between the number of CTCs and pathological stage

To summarize the important pathological features of liver cancer including tumor size, portal vein tumor thrombus, Child-Pugh, cirrhosis and lymph node metastasis. The relationship between pathological features and CTCs is shown in Table 6. The statistical results showed that tumor size, portal tumor thrombus, lymph node metastasis and CTCs were correlated (P=0.028, P=0.006 and P=0.009), see Table 6. To determine the correlation between various factors and CTCs, logistic regression analysis was used to analyze the factors that may affect CTCs. The results are shown in Table 7. The results showed that factors affecting CTCs included only lymph node metastasis (P=0.027).

Table 6 Effect of pathological factors on CTCs

Table 7 Logistic regression analysis of the influence of pathological factors on CTCs

Example 3 Prostate cancer CTC cells undergoing EMT transformation

Studies have found that CTCs can undergo epithelial mesenchymal transition (EMT) behavior. EMT causes CTCs to lose the phenotype of epithelial cells, obtain the phenotype of some mesenchymal cells, exhibit stronger deformation and motility, and thus have the ability to invade the surrounding basement membrane, causing the cells to lose intercellular adhesion and assist CTCs. Into the blood system, these highly viable, highly metastatic tumor cells survive in the circulatory system, accumulate to form tiny tumor thrombi, and develop into metastases under certain conditions. Researchers believe that 2.5% of CTCs can cause micrometastases, which ultimately lead to cancer recurrence and even death. However, the number of such CTC cells is extremely small and difficult to capture.

(1) Sample preparation

A total of 150 prostate patients were collected in this patent, and 10 ml blood samples were collected from each patient.

(2) Sample testing

The above blood samples were gently inverted and mixed several times, and then the number of circulating tumor cells was measured according to the procedure in Example 1. We chose PSA as a tumor-specific index, EpCAM as an epithelial marker, and Vimentin as an interstitial marker. The primer sequences were designed as follows. Perform high-throughput sequencing.

Prostate cancer marker PSA

GSS_F sequence (3'-5'): CGTGTACCAAGTGACGGGGT (SEQ ID NO: 7)

GSS_R sequence (3'-5'): TAGCACCGGTTGGGGACT (SEQ ID NO: 8)

ID1 (3'-5'): TGAGAC (SEQ ID NO: 9)

ID2 (3'-5'): TTTTTA (SEQ ID NO: 10)

Epithelial marker CK18

GSS_F sequence (3'-5'): CTACCAAACGTACCTCAACG (SEQ ID NO: 11)

GSS_R sequence (3'-5'): TTTCAAGTCCGATAT (SEQ ID NO: 12)

ID1 (3'-5'): CCCTAG (SEQ ID NO: 13)

ID2 (3'-5'): GCCCCT (SEQ ID NO: 14)

Epithelial marker CK19

GSS_F sequence (3'-5'): GGACGAGGTCGGCGCTGAAC (SEQ ID NO: 15)

GSS_R sequence (3'-5'): CGGAGGTTCCAGGAGACT (SEQ ID NO: 16)

ID1 (3'-5'): TGATAC (SEQ ID NO: 17)

ID2(3'-5'): ATAGCT (SEQ ID NO: 18)

Epithelial marker EpCAM

GSS_F sequence (3'-5'): ACCTTTATTGGTCGTGTTGT (SEQ ID NO: 19)

GSS_R sequence (3'-5'): TCCCTTGAGTTACGTATT (SEQ ID NO: 20)

ID1 (3'-5'): CTAATT (SEQ ID NO: 21)

ID2 (3'-5'): ACTGAG (SEQ ID NO: 22)

Epithelial marker KRT20

GSS_F sequence (3'-5'): CACCTTCTTTTATAGATT (SEQ ID NO: 23)

GSS_R sequence (3'-5'): CGTGCAAGAAGTAGTGGATG (SEQ ID NO: 24)

ID1 (3'-5'): AAAGTC (SEQ ID NO: 25)

ID2(3'-5'): TGACAG (SEQ ID NO: 26)

Epithelial marker KRT19

GSS_F sequence (3'-5'): ACGGAGGTTCCAGGAGAC (SEQ ID NO: 27)

GSS_R sequence (3'-5'): CTCGAGGGACAGGAAGA (SEQ ID NO: 28)

ID1 (3'-5'): ACGAGG (SEQ ID NO: 29)

ID2 (3'-5'): GGTATG (SEQ ID NO: 30)

Epithelial marker KRT7

GSS_F sequence (3'-5'): TCCTCACGGGCGCTGACT (SEQ ID NO: 31)

GSS_R sequence (3'-5'): TCCAGCAGTGCGGGTCCTG (SEQ ID NO: 32)

ID1 (3'-5'): AGCCGA (SEQ ID NO: 33)

ID2 (3'-5'): ATGCGT (SEQ ID NO: 34)

Epithelial marker E-cadherin

GSS_F sequence (3'-5'): GAGGGACGGTAAAAAATT (SEQ ID NO: 35)

GSS_R sequence (3'-5'): ATCTTGGCCTCCCAGAGTAT (SEQ ID NO: 36)

ID1 (3'-5'): GCTTGG (SEQ ID NO: 37)

ID2 (3'-5'): CGTTGG (SEQ ID NO: 38)

EMT marker N-cadherin

GSS_F sequence (3'-5'): CCACCTCCACTACTGACT (SEQ ID NO: 39)

GSS_R sequence (3'-5'): AGTGGTGGTGAGCAGGACTATGA (SEQ ID NO: 40)

ID1 (3'-5'): ATTGGC (SEQ ID NO: 41)

ID2(3'-5'): GTATTC (SEQ ID NO: 42)

EMT marker vimentin

GSS_F sequence (3'-5'): GTGCTACTGGAACTTATT (SEQ ID NO: 43)

GSS_R sequence (3'-5'): AGATGGACAGGTTATCAACG (SEQ ID NO: 44)

ID1 (3'-5'): TACATC (SEQ ID NO: 45)

ID2(3'-5'): TAGGCG (SEQ ID NO: 46)

EMT marker fibronectin

GSS_F sequence (3'-5'): CTTCTAAGGGCTCTCATT (SEQ ID NO: 47)

GSS_R sequence (3'-5'): AGATGACAGGGCTGACA (SEQ ID NO: 48)

ID1 (3'-5'): GAGAGC (SEQ ID NO: 49)

ID2 (3'-5'): AGCGGT (SEQ ID NO: 50)

EMT marker MMP9

GSS_F sequence (3'-5'): GTCACGGGACTCCTGATC (SEQ ID NO: 51)

GSS_R sequence (3'-5'): TACGTGACCTATGACATCCTG (SEQ ID NO: 52)

ID1 (3'-5'): GCCCCA (SEQ ID NO: 53)

ID2(3'-5'): ATTGTC (SEQ ID NO: 54)

EMT marker AKT2

GSS_F sequence (3'-5'): CGGTCGTAGGCGCTCACT (SEQ ID NO: 55)

GSS_R sequence (3'-5'): GGAGCTGGACCAGCGGACCC (SEQ ID NO: 56)

ID1 (3'-5'): ACTCAG (SEQ ID NO: 57)

ID2(3'-5'): ATACAA (SEQ ID NO: 58)

(3) Analysis of test results

Of the 150 patients with prostate disease, 94% (141/150) of the patients detected CTCs in 7.5 ml of peripheral blood samples, and each detected CTC was classified into epithelial CTCs according to different types of markers (PSA ⁺ EpCAM ⁺ Vimentin ^- ), interstitial CTCs (PSA ⁺ Vimentin ⁺ EpCAM ^- ) and mixed CTCs (PSA ⁺ EpCAM ⁺ Vimentin ⁺ ).

a. Relationship between TNM staging and distribution of peripheral blood CTC subtypes

By comparing with the clinicopathological features of patients, the TNM stage was different, and the distribution of CTC subtype from epithelial to interstitial type was statistically significant (Z=39.723, P<0.001, such as Table 8 shows). The interstitial CTCs detected in patients in stage II (41.5%) and stage III (43.4%) were significantly higher than those in stage I (29.0%).

Table 8 Differences in the distribution of CTC subtypes in peripheral blood of patients with different TNM stages

b. Whether the relationship between the invasion of the capsule and the distribution of CTC subtypes in peripheral blood

The tumors were divided into two groups according to the presence or absence of tumor invasion. The distribution of CTC subtypes between the two groups was statistically significant (Z=-8.85, P). <0.001, as shown in Table 9). The proportion of epithelial CTCs detected in peripheral blood of patients with capsule invasion was smaller than that of patients without capsule invasion (14.5% vs 21.4%), while the proportion of interstitial CTCs was greater than that of patients without capsule invasion. (46.6% vs 30.4%).

Table 9 Differences in the distribution of CTC subtypes in peripheral blood of patients with tumor invasion

c. Relationship between pathological grade and distribution of CTC subtypes in peripheral blood

There were statistically significant differences in the distribution of CTC subtypes from epithelial to interstitial (G=24.684, P<0.001, as shown in Table 10) according to the pathological grades of Gx, G1, G2, G3, and G4. As the degree of malignancy continues to increase, the proportion of intermediate-type CTCs in the peripheral blood of patients gradually increases.

Table 10 Differences in the distribution of CTC subtypes in peripheral blood of patients with different pathological grades

The above description is only a preferred embodiment of the present invention, and it should be noted that those skilled in the art can make several improvements and additions without departing from the method of the present invention. These improvements and additions should also be considered. It is the scope of protection of the present invention.

Claims

A method for detecting circulating tumor cells in a body fluid, characterized in that the method comprises the following steps:

a. collecting human body fluid specimens;

b. Collecting nucleated cells in body fluids, fixing the cells, and treating the cells to increase cell membrane permeability;

c. The cells are evenly dispersed into a set of PCR multiple tubes, each tube is provided with a reverse transcription primer carrying a different recognition sequence ID1, and the cDNA molecule is obtained by reverse transcription, and the 5' end carries a specific ID1 sequence;

d. The collected cells are mixed and added to another set of PCR multi-tubes, each tube is provided with an extension primer carrying a different recognition sequence ID2, and the 3' end can specifically recognize the 3' end of the cDNA molecule, and the extension reaction is performed by complementing the sequence ;

e. Collect the combined cells, lyse the cells, and extend the product in 10-15 cycles of PCR pre-amplification d;

f. collecting PCR preamplification products and purifying;

g. High throughput sequencing of the PCR product;

h. Analysis of the combination of ID1:ID2 in each effective molecular sequence allows an assessment of the exact number of circulating tumor cells as well as other non-humoral rare cells.
The method according to claim 1, wherein the body fluid comprises blood, urine, pleural effusion, ascites, cerebrospinal fluid, and digestive juice.
The method according to claim 1, wherein the reagent for immobilizing cells in step b is selected from any one selected from the group consisting of glutaraldehyde, formaldehyde, acetone, methanol, ethanol, acetic acid, acrolein, uranyl acetate, chromic acid, and picric acid. Kind or a combination thereof.
The method of claim 1 wherein the agent for increasing membrane permeability in step b is a nonionic surfactant.
The method of claim 4 wherein said nonionic surfactant is Triton-X 100.
The method according to claim 1, wherein the number of PCR manifolds in step c and/or step d is three or more.
The method according to claim 1, wherein in step c, ID1 comprises two or more nucleic acid sequences, and 16 or more unique recognition sequences are combined by arrangement, corresponding to each cell-containing PCR. Tube; ID2 includes two or more nucleic acid sequences in step d, and is combined into 16 or more unique recognition sequences by array, corresponding to each PCR tube containing cells.
The method according to claim 1, wherein the sequence of ID1 is directly synthesized on the reverse transcription primer sequence in step c, or is linked to the reverse transcription cDNA molecule by ligation, extension or complementary pairing.
The method according to claim 1, wherein the ID2 sequence in step d is linked to the complementary strand of the reverse transcribed cDNA molecule by ligation, extension, complementary pairing or PCR amplification.
The method according to claim 1, wherein the specifically recognized marker in step d is a marker of epithelial cells, a tumor-specific marker or an interstitial cell marker.
The method according to claim 10, wherein the marker of the epithelial cell is any one of CK18, CK19, EpCAM, KRT20, KRT19, KRT7, E-cadherin or a combination thereof; The markers are CEA, SCC, CA125, CA50, CA19-9, CA242, CA724, CEA, CA125, ALP, AFP-L3, AFU, GP73, PSA, PCA3, TMPRSS2-ETS, PIVKA-II, NSE, CYFRA21- 1. Any one or a combination of CEA, CA153, AFP; the mesenchymal cell marker is any one of Vimentin, fibronectin, MMP9, N-cadherin, AKT2, or a combination thereof.
The method of claim 1 wherein the method is for non-disease diagnostic or therapeutic use.
A kit for detecting circulating tumor cells, characterized in that: the kit comprises: 1) reverse transcription and amplification primers of epithelial cell specific markers; 2) reverse transcription and amplification of tumor cell specific markers Primer; 3) Fixing reagent and membrane permeable reagent.
The kit according to claim 13, wherein the reverse transcription and amplification primers of the epithelial cell-specific marker are used to detect circulating tumor cells or other non-humoral rare cells in body fluids.
The kit according to claim 13, wherein the reverse transcription and amplification primers of the tumor cell-specific marker are used to detect circulating tumor cells in a body fluid.
The kit according to claim 13, wherein the fixing reagent is selected from any one of glutaraldehyde, formaldehyde, acetone, methanol, ethanol, acetic acid, acrolein, uranyl acetate, chromic acid, and picric acid. Or a combination thereof.
The kit according to claim 13, wherein the kit further includes instructions for describing the method according to any one of claims 1 to 12.
A detection system for circulating tumor cells, characterized in that the detection system is capable of performing the method according to any one of claims 1 to 12, and/or capable of treating a sample to be detected using the kit according to any one of claims 13 to .
The detection system of claim 18 wherein said detection system is an automated system.