WO2019212351A2

WO2019212351A2 - Mutant alcohol oxidases and use thereof in the conversion of diols and polyols

Info

Publication number: WO2019212351A2
Application number: PCT/NL2019/050264
Authority: WO
Inventors: Marco Wilhelmus Fraaije; Andrea Mattevi; Elvira ROMERO GUZMAN; Quoc-Thai NGUYEN
Original assignee: Rijksuniversiteit Groningen; Università Degli Studi Di Pavia
Priority date: 2018-05-03
Filing date: 2019-05-03
Publication date: 2019-11-07
Also published as: WO2019212351A3

Abstract

The invention relates to the field of enzyme engineering and biocatalysis, in particular to mutated alcohol oxidases (AOXs) and their application in the biocatalytic conversion of diols and polyols. Provided is mutant AOX enzyme having glycerol oxidase activity, said mutant AOX showing at least 50% sequence identity to the amino acid sequence of AOX from P. chrysosporium (PcAOX; SEQ ID NO:l), Gloeophyllum trabeum (GtAOX; SEQ ID NO:2), Candida, boidinii (CbAOX; SEQ ID NO:3), Pichia pastoris (PpAOX; SEQ ID NO:4), or Pichia angusta (PaAOX; SEQ ID NO:5), and comprising one or more of the following mutations: (i) the amino acid corresponding to Phe at position 101 of PcAOX is mutated to Gin, Asn, His or Ser; (ii) the amino acid corresponding to Met at position 103 of PcAOX is mutated to Ser, Ala, Gly, Pro or Cys; (iii) the amino acid corresponding to Leu at position 317 of PcAOX is mutated to Val, He, Ala or Met; (iv) the amino acid corresponding to Tyr at position 407 of PcAOX is mutated to Phe, Val, Leu, He or Met; (v) the amino acid corresponding to Trp at position 560 of PcAOX is mutated to Cys, Met, Ala, Val, Leu or Ile.

Description

Title: Mutant alcohol oxidases and use thereof in the conversion of diols and polyols.

The invention relates to the field of enzyme engineering and biocatalysis. In particular, it relates to mutated alcohol oxidases and their application in the biocatalytic conversion of diols and polyols, such as glycerol, and the production of added-value products thereof.

Glycerol comprises the major byproduct of today’s biodiesel production and although glycerol is used in the manufacture of foods, beverages, pharmaceuticals and cosmetics, the excess of glycerol is currently used as boiler fuel or as supplement for animal feed. This is because economic viable alternatives for glycerol management are currently lacking. However, glycerol is a promising building block chemical as its oxidation or reduction generates valuable intermediates ranging from glyceraldehyde and glyceric acid to hydroxypyruvic acid. These compounds are of interest for the production of e.g., fine chemicals, pharmaceuticals or amino acids J¹1 The need for innovative and sustainable glycerol conversion technologies is therefore of growing importance. However, the options for chemical conversion of glycerol are limited due to a lack of selectivity and yield.

Although the biocatalytic transformation of glycerol has emerged as a powerful alternative, its full exploitation is hampered by the lack of suitable enzymes. For example, several glycerol oxidases have been reported so far but these are from fungal sources and contain copper and/or heme as cofactors. ⁽²1 The presence of these cofactors ensures that these proteins are notoriously difficult to obtain in recombinant form from Escherichia coli, while heme and copper are also not preferred for industrial applications. On the other hand, the oxidation of glycerol can also be performed by alcohol dehydrogenases in combination with aldehyde dehydrogenases. However, these enzymes typically require expensive cofactors such as NAD⁺ and NADP⁺ as well as complex cofactor recycling systems. Flavin-dependent oxidases do not require cofactor recycling, which emphasizes the industrial potential of these enzymes. Alditol oxidase (AldO) is a FAD-containing carbohydrate oxidase from Streptomyces coelicolor and displays a weak activity towards glycerol. FJ Moreover, two engineered variants of AldO with an enhanced affinity towards glycerol were described in a study by

Gerstenbruch et a/. I’ I Although these results are potentially promising, it should be noted that AldO is not preferred for industrial applications.

Firstly, its heterologous expression in E. coli is problematic due to the high GC content of the gene (73.4%). Secondly, AldO suffers from a lack of robustness because it is readily inactivated at for example elevated temperatures. ^[f,l A thermostable AldO has been characterized, but it shows a more severe substrate inhibition by glycerol than in the case of the non- thermostable AldO. FI A robust glycerol oxidase suitable for potential industrial applications is still highly desired.

Recently, a novel alcohol oxidase (AOX) was found in the basidiomycete Phanerochaete chrysosporium (Figure l)4⁶l Sequence analysis of this enzyme revealed a conserved FAD binding-motif (Figure 2), strongly suggesting that it contains FAD as cofactor. Subsequent biochemical characterization showed that methanol is its preferred substrate, while also a moderate activity with glycerol was reported J^{6 7)} Inspired by these results, the present inventors obtained a synthetic gene encoding this enzyme and purified it from E. coli cells expressing the P. chrysosporium AOX (PcAOX). However, although a high activity with methanol could be confirmed, no conversion of glycerol was observed.

In search for novel enzymes showing an industrially applicable level of oxidase reactivity towards glycerol, the inventors set out to generate a panel of AOX mutants and test their activity towards methanol, glycerol, and other substrates. Wild-type AOX was included as a control in these experiments. It was surprisingly observed that the oxidase activity towards glycerol was enhanced in mutant enzymes comprising a mutation at the position corresponding to F101, M103, L317, Y407 and/or W560 in the PcAOX enzyme. For example, whereas wild-type PcAOX did not display any reactivity towards glycerol, conversion of glycerol was readily observed for mutants F101S, F101N, M103S, L317V, Y407F, W560C and various combinations thereof. The mutant enzymes retained significant activity with methanol, which is the preferred substrate for the wild-type PcAOX. The other substrates tested (ethanol, 1-propanol or (R)-(-)-l, 2-propanediol) were converted by wild-type PcAOX and its variants.

Accordingly, the invention relates to a mutated enzyme having an increased glycerol oxidase activity compared to the enzyme before mutation, comprising an amino acid sequence of a micro-organism derived alcohol oxidase wherein the mutated enzyme comprises one or more of the following mutations:

(i) the amino acid corresponding to Phe at position 101 is mutated to Gin, Asn, His or Ser;

(ii) the amino acid corresponding to Met at position 103 is mutated to Ser, Ala, Gly, Pro or Cys;

(iii) the amino acid corresponding to Leu at position 317 is mutated to Val, He, Ala or Met;

(iv) the amino acid corresponding to Tyr at position 407 is mutated to Phe, Val, Leu, He or Met;

(v) the amino acid corresponding to Trp at position 560 is mutated to Cys, Met, Ala, Val, Leu or He.

As used herein, each amino acid position is referred to as the residue present in the amino acid sequence of AOX from P. chrysosporium

(GenBank: HG425201.1, UniProtKB/TrEMBL: T2M2J4). See also Figure 1. More in particular, the invention provides a mutant alcohol oxidase (AOX) enzyme having glycerol oxidase activity, said mutant AOX showing at least 50% sequence identity to the amino acid sequence of AOX from P. chrysosporium (PcAOX; SEQ ID NO: l), AOX from Gloeophyllum trabeum (GtAOX; SEQ ID NO:2), AOX from Candida boidinii (CbAOX; SEQ ID NO:3), Pichia pastoris (PpAOX; SEQ ID NO:4), or AOX from Pichia angusta (PaAOX; SEQ ID NO:5), and comprising one or more of the following mutations:

(i) the amino acid corresponding to Phe at position 101 of PcAOX is mutated to Gin, Asn, His or Ser;

(ii) the amino acid corresponding to Met at position 103 of PcAOX is mutated to Ser, Ala, Gly, Pro or Cys;

(in) the amino acid corresponding to Leu at position 317 of PcAOX is mutated to Val, He, Ala or Met;

(iv) the amino acid corresponding to Tyr at position 407 of PcAOX is mutated to Phe, Val, Leu, He or Met;

(v) the amino acid corresponding to Trp at position 560 of PcAOX is mutated to Cys, Met, Ala, Val, Leu or He.

Hence, the invention relates to point mutants having only one of the above defined mutations as well as to mutants having two or more of the above defined mutations. In addition to the defined mutation(s) that enhance the activity towards diols and polyols, in particular to glycerol, the enzyme may contain further conservative or non-conservative mutations as long as the desired oxidase activity is maintained or even further enhanced.

The homology of amino acid sequences can be preferably determined by the Lipman-Pearson method.!⁸¹“Amino acid residues located at positions corresponding to the positions . . .” can be identified by comparing amino acid sequences of alcohol oxidases by means of a known algorithm such as the Lipman-Pearson method, to thereby assign maximum homology to conserved amino acid residues present in the amino acid sequences. When the amino acid sequences of AOXs are aligned by means of such method, regardless of insertion or deletion occurred in the amino acid sequences, the positions of the homologous amino acid residues can be determined in each of the enzymes. Conceivably, homologous amino acid residues are located at the same positions in the three-dimensional structure of AOX, whereby analogous effects are obtained in terms of specific functions of the intended alcohol oxidase.

In one embodiment, the amino acid corresponding to Phe at position 101 of PcAOX is mutated to Asn or Ser, preferably to Ser. Alternatively or additionally, the amino acid corresponding to Met at position 103 of PcAOX is mutated to Ser, Ala, Gly, Pro or Cys, preferably to Ser. Alternatively or additionally, the amino acid corresponding to Leu at position 317 of PcAOX is mutated to Val, He, Ala or Met, preferably to Val. Alternatively or additionally, the amino acid corresponding to Tyr at position 407 of PcAOX is mutated to Phe, Val, Leu, He or Met, preferably to Phe. Alternatively or additionally, the amino acid corresponding to Trp at position 560 of PcAOX is mutated to Cys, Met, Ala, Val, Leu or He, preferably to Cys.

In one aspect, the invention provides a mutant AOX wherein position 101 of PcAOX comprises Asn or Ser, preferably Ser, in combination with one or more of the above mutation(s) at positions 103, 317, 407 and/or 560. Particularly preferred mutants include those comprising the mutation F101S, L317V, Y407F and/or W560C. In one embodiment, the invention provides the single mutant L317V. In another embodiment, the invention provides the single mutant F101S.

Whereas the invention is exemplified by mutant AOX enzymes based on the AOX sequence obtained from P. chrysosporium, a person skilled in the art will appreciate that the invention can also be put into practice by introducing the corresponding mutation(s) in an AOX sequence from other organisms, herein referred to as“homologous alcohol oxidase”. Preferably, the mutant enzyme is derived from a yeast or mold AOX. For example, the mutated enzyme is a mutant AOX from G. trabeum (GtAOX; SEQ ID NO:2), C. boidinii (CbAOX; SEQ ID NO:3), P. pastoris (PpAOX; SEQ ID NO:4), or P. angusta (PaAOX; SEQ ID NO:5) (Figure 2). I

As is exemplified herein below, the AOX enzyme from Pichia angusta (PaAOX) was produced and purified. This enzyme shows 49% sequence identity to PcAOX. Also, mutant F99S PaAOX was produced and purified, which is equivalent to mutant F101S of PcAOX. Glycerol oxidase activity was measured for both wild-type and mutant PaAOX using glycerol as substrate. As expected, the activity of wild-type PaAOX was significantly increased upon introduction of the F99S mutation. These data demonstrate that, based on the present teaching, AOX mutants homologous to the exemplified PcAOX can readily be engineered in order to boost the glycerol oxidase activity.

In one embodiment, the mutant enzyme displays at least 55%, more preferably at least 60%, like 65% or more, 70% or more, or 80% or more, sequence identity to that of SEQ ID NO:l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, or SEQ ID NO: 5. Preferably, the mutant enzyme is at least 85%, and more preferably at least 95%, especially 98% or 99% identical thereto. In specific aspect, the mutant AOX enzyme having glycerol oxidase activity shows at least 50% sequence identity to the amino acid sequence of PcAOX (SEQ ID NO: l), AOX from G. trabeum (SEQ ID NO:2), C. boidinii (SEQ ID NO:3), or P. pastoris (SEQ ID NO:4).

The mutant enzyme preferably displays at least 50%, more preferably at least 60%, like 65% or more, 70% or more, or 80% or more, sequence identity to that of AOX from yeast (e.g., SEQ ID NO: 3, SEQ ID NO:4, or SEQ ID NO: 5). In one embodiment, the mutant enzyme has at least 60%, more preferably at least 65%, like 70% or more, 80% or more, 85% or more sequence identity to the amino acid sequence of the PcAOX (SEQ ID NO: l) or G. trabeum (SEQ ID NO: 2).

In one embodiment, the enzyme is a mutant AOX from G. trabeum. In another embodiment, the enzyme is a mutant AOX from either Pichia sp. or Candida sp. There are a number of different AOX isozymes that are adapted to different environmental methanol concentrations. do^j The number and type of AOX isozymes present in different methylotrophic yeasts vary between species do^j Pichia methanolica has nine AOX isozymes, which are octamers containing different proportions of two different subunits. Only two AOX isozymes, AOX1 and AOX2, have been found in P. pastoris.

Although AOX1 and AOX2 share 97 % identity in amino acid sequence, expression of AOX1 and AOX2 in P. pastoris is controlled by different promoters. dd AOX1 constitutes the majority of AOX protein in the cell and is the main contributor to methanol metabolism. Catalytic properties and stability may be different for each AOX isozyme do^] Therefore, a specific AOX isozyme may be selected before carrying out the mutations to improve its ability to convert diols or polyols.

In a preferred aspect, the invention provides a mutant fungal AOX comprising an amino acid sequence having at least 70%, preferably at least 80%, more preferably at least 85% sequence identity to the amino acid sequence of Figure 1. When the mutant AOX is from a yeast, the sequence identity may be at least 40-50%.

In one embodiment, the mutated AOX enzyme having glycerol oxidase activity comprises or consists of an amino acid sequence showing at least 70%, preferably at least 80%, more preferably at least 85% sequence identity to the amino acid sequence of PcAOX.

For example, the enzyme has at least 85% sequence identity to the amino acid sequence of PcAOX, wherein (i) the amino acid corresponding to Phe at position 101 of PcAOX is mutated to Gin, Asn, His or Ser; (ii) the amino acid corresponding to Met at position 103 of PcAOX is mutated to Ser, Ala, Gly, Pro or Cys; (iii) the amino acid corresponding to Leu at position 317 of PcAOX is mutated to Val, He, Ala or Met; (iv) the amino acid corresponding to Tyr at position 407 of PcAOX is mutated to Phe, Val, Leu, He or Met; and/or (v) the amino acid corresponding to Trp at position 560 of PcAOX is mutated to Cys, Met, Ala, Val, Leu or He.

Specific embodiments of the invention include mutant F101S PcAOX, F101 G. trabeum AOX, F98S P. pastoris AOX, F98S C. boidinii AOX, and F99S PaAOX.

In one embodiment, the mutant enzyme contains one or more stretches that are conserved among the AOX enzymes from various organisms (see Figure 2). For instance, it comprises the ADP-binding bab-fold motif that is conserved among the FAD- and NAD(P)H-binding proteins, and/or it comprises the GMC oxred 2 sequence(s) (PROSITE signature PS00624),H^2] that is characteristic for GMC oxidoreductases. In a further aspect, it comprises the GMC oxred 1 sequence (PROSITE signature PS00623), that is also characteristic for GMC oxidoreductases, provided that the Phe at position 101 and/or the Met at position 103 may be mutated as herein defined above.

The mutated enzyme of the invention may contain additional amino acid residues or polypeptide motifs. The additions may be N-terminal, C- terminal and/or insertions within the enzyme sequence. For example, it is a fusion protein comprising an enzyme moiety having glycerol oxidase activity and one or more elements (e.g., protein tag) allowing for the enhanced expression, solubihzation, isolation and/or purification of the enzyme. In one embodiment, the fusion tag enhances expression and solubility of the mutated enzyme in a (bacterial) host cell. For example, the enzyme moiety is fused to the C-terminus of maltose-binding protein (MBP), glutathione S- transferase (GST), thioredoxin (TRX), N-utilizing substance A (NusA), ubiquitin (Ub), or small ubiquitin-related modifier (SUMO) tag. The fusion protein may also include a purification tag (e.g., His-tag) for ease of isolation. If desired, the additional element(s) can be removed, for example by protease treatment, prior to application in the biocatalytic conversion of polyols, such as glycerol or other substrate(s) of interest.

A mutant AOX of the present invention may be obtained through, for example, the following steps. Briefly, a cloned gene encoding a‘parent alcohol oxidase” e.g., a naturally occurring AOX enzyme, is mutated, and by use of the thus-mutated gene an appropriate host bacterium is transformed, followed by culturing of the recombinant host bacterium and collecting the mutant alcohol oxidase of the invention from the bacterial cells. Cloning of the gene encoding the parent alcohol oxidase may be carried out through a generally employed gene recombination technique.

Means for carrying out site-directed mutagenesis of the gene encoding the parent alcohol oxidase are well known in the field. More specifically, mutagenesis of the gene may be carried out by use of, for example, the QuikChange^® mutagenesis method (Agilent Technologies). Alternatively, by means of recombinant PCR (polymerase chain reaction), f¹³l an arbitrary sequence of the gene can be replaced by the arbitrary sequence of another gene.

Accordingly, the invention also provides a nucleic acid sequence encoding a mutated enzyme according to the invention. Preferably, the nucleic acid sequence is codon optimized for expression in a bacterial, fungal, or yeast host cell. Further embodiments relate to an expression vector comprising a nucleic acid sequence according to the invention, and a non-human host cell comprising the vector. For example, the host cell is a fungal, yeast, or bacterial cell.

Production of the alcohol oxidase of the present invention by use of the thus-obtained mutant gene may suitably be carried out, for example, by ligating the mutated gene to a DNA vector capable of stably amplifying the gene, to thereby transform a host. Alternatively, the mutant gene may be introduced into chromosomal DNA of a host capable of stably maintaining the gene. Therefore, the invention provides a method for preparing a recombinant mutated enzyme according to the invention, comprising culturing a host cell comprising a DNA sequence encoding said mutant enzyme under conditions allowing for expression of the encoded enzyme, and isolating the mutated enzyme from the host cell or from the culture medium.

Examples of the host cell which satisfies these requirements include bacteria (e.g., Bacillus sp., E. coli, actinomycetes), mold (e.g., Aspergillus sp., Thermothelomyces thermophile, Trichoderma reesei), and yeast (e.g, Pichia sp., Saccharomyces sp.). Any of these microorganisms is inoculated into a culture medium containing an assimilable carbon source, nitrogen source, and other essential nutrients, and culturing is carried out according to a customary method.

From the thus-obtained culture, mutant alcohol oxidase may be collected and purified by means of customary methods for collecting and purifying enzymes. For example, the culture is subjected to centrifugation or filtration to thereby obtain the cells. After cell lysis and subsequent centrifugation, the enzyme of interest is obtained from the resulting supernatant by means of a routine purification technique. The thus- obtained enzyme solution may be employed as is. If necessary, the enzyme solution may further be subjected to crystallization, powdering, or

granulation, any of which may be carried out according to a known method. Alternatively, either whole cells or cell lysate containing AOX may be used for hydroxyl-containing compounds conversion instead of purified enzyme. Another option is extracellular AOX expression by using an in-frame fusion of a secretion signal (e.g., S. cerevisiae a-mating factor prepro signal sequence) and the AOX in an appropiate host (e.g., S. cerevisiae, Pichia sp., T. reesei ). The advantage for the latter approach is that cell lysis is not needed and less protein contaminants may be present in the initial sample. Biocatalytic alternatives for the conversion of glycerol into value-added intermediates are of great importance. Whereas prior to the invention the number of suitable enzymes was very limited, the AOX mutants provided herein fulfil the unmet need for a robust biocatalyst for the oxidation of glycerol. Our data show that glycerol is oxidized by the mutated enzyme into glyceric acid through glycer aldehyde. Glyceric acid is an important building block for fine chemicals and pharmaceuticals, while its polymerization can result in valuable polymers.

In a further embodiment, the invention provides a method for oxidizing a diol or polyol, which are compounds carrying two or more hydroxyl moieties, respectively. The method comprises contacting a composition including the diol or polyol (or both diol and polyol) with a mutated enzyme of the invention under conditions allowing for the oxidation reaction.

Preferably, the polyol or diol is glycerol or 1,2 -propane diol. More preferably, a method of the invention comprises contacting a composition comprising glycerol, which composition is for instance a by-product of the production of biodiesel or soap, with a mutated enzyme of the invention under conditions allowing for glycerol oxidation.

With the rapid increase in biodiesel production and the massive availability of its by-product glycerol, effective (bio)catalysts that can convert glycerol into value-added products are in demand. f¹⁴J Among these, oxidases of the invention which can oxidize glycerol are highly advantageous because such biocatalysts have the potential to produce enantiomerically pure glyceraldehyde or glyceric acid without requiring expensive cofactors (e.g., NADPH). Herewith, the invention provides an efficient glycerol oxidase that allows for conversion of glycerol into valuable building blocks while the concomitantly produced hydrogen peroxide may also be of value.

The invention thus also relates to the use of a mutated AOX enzyme, e.g., as isolated enzyme or comprised in a host cell, as biocatalyst. As is shown in Table 2, enzymes of the invention having oxidase activity towards diols and polyols exhibit a melting temperature (T_m) of above 50 °C over a wide range of pH values. This is of great relevance for its application as biocatalyst.

Interestingly, glyceraldehyde can be used to produce valuable polyhydroxy-a-keto acids in reactions catalysed by an aldolase using pyruvate, hydroxypyruvate or an other nucleophilic substrate.0^5] The present invention provides a novel mutant AOX-aldolase cascade. This cascade allows for the conversion of glycerol (e.g. obtained from biomass) into glyceraldehyde and the subsequent aldol reaction between this compound and pyruvate according to Scheme 1.

Scheme 1: Transesterification of fatty acids with methanol yielding biodiesel and the AOX substrate glycerol. Oxidation of glycerol catalyzed by mutant AOX results in glyceraldehyde and glyceric acid formation.

Pyruvate-dependent aldolase acts on glyceraldehyde to form a p oly hydroxy - «-keto acid.

Accordingly, in a further embodiment the invention provides a method for conversion of glycerol to a polyhydroxy-a-keto acid, comprising

contacting a composition comprising glycerol with a mutant AOX enzyme according to the invention in the presence of an aldolase (EC 4.1.2.x) and an appropriate nucleophile under conditions allowing for production of a polyhydroxy-a-keto acid.

Suitable nucleophiles include pyruvic acid, 2-ketobutyric acid, 4- hydroxypyruvic acid, fluoropyruvic acid, phenylpyruvic acid, 2-oxoglutaric acid and methyl pyruvic acid. In one embodiment, pyruvic acid is used as nucleophile for the production of 4,5,6-trihydroxy-2-oxohexanoic acid.

Also provided is an AOX/aldolase cascade reaction mixture comprising glycerol, an appropriate nucleophile, a mutant AOX enzyme as herein disclosed and an aldolase.

Typically, the aldolase for use in an AOX/aldolase cascade reaction of the invention is an enzyme able to form a C-C bond between glyceraldehyde and the nucleophile. In a preferred aspect, the aldolase is a type II (Class II) aldolase. Class-II aldolases [PMID: 1412694], mainly found in prokaryotes and fungi, are homodimeric enzymes, which require a divalent metal ion, generally zinc, for their activity. Preferred aldolase enzymes are those having a T_m of 50 °C or higher over a wide range of pH values. This is of great relevance for its application as biocatalyst. In one embodiment, the aldolase is 5-keto-4-deoxy-D-glucarate aldolase from Escherichia coli (GarL; EC 4.1.2.20). In a preferred embodiment, it is 2-keto-3-deoxy-L-rhamnonate aldolase from Escherichia coli strain K12 (RhmA; EC 4.1.2.53).

LEGEND TO THE FIGURES

Figure 1. Amino acid sequence of wild-type PcAOX (SEQ ID NO:l).

Figure 2. Multiple sequence alignment of PcAOX and AOX from G.

trabeum (GtAOX; SEQ ID NO:2), C. boidinii (CbAOX; SEQ ID NO:3), P. pastoris (PpAOX; SEQ ID NO:4), and P. angusta (PaAOX; SEQ ID NO: 5) (GenBank: HG425201.1, ABI 14440.1, AAB57849.1, AAA34321.1,

XM_018356154.1, respectively). ADP-binding bab-ΐoΐά motif is conserved among the FAD- and NAD (P)H -bin ding proteins, while GMC oxred 1 and 2 (PROSITE signatures PS00623 and PS00624, respectively) 0²1 are

characteristic for GMC oxidoreductases. Residues targeted in this work (corresponding to F101, M103, L317, Y407 and W560 in PcAOX) are indicated in bold. Symbols below the residues represent: i) an asterisk denotes positions with a fully conserved residue; ii) a colon indicates conservation between groups of strongly similar properties; and iii) a period indicates conservation between groups of weakly similar properties. Clustal Omegal¹⁶! was used to obtain the alignment.

Figure 3. Effect of pH on methanol oxidation. The reaction contains 40 mM Britton-Robinson buffer, 100 nM PcAOX, 25 mM methanol, and activity was monitored by following dioxygen consumption for 5 min at 23 °C using a Hansatech Oxygraph instrument.

Figure 4. Michaelis-Menten plots obtained to determine the steady-state kinetic parameters shown in Table 3.

Figure 5. Activity on glycerol of wild-type and mutants PcAOX based on a HRP-coupled assay. Assays were carried out in duplicate (rows A and B in the 96-well microplate) as specified in the Experimental Section. Figure 6. Standard curves obtained using ECD for HPLC. 100 mM stocks were prepared in 100 mM potassium phosphate buffer pH 8.0 and

appropriate serial dilutions were carried out. Figure 7. Chromatograms for standards obtained using ECD for HPLC. In the case of glyceraldehyde, three peaks were detected and the total area was used to perform the standard curve.

Figure 8. Conversion yield for glycerol biotransformations catalyzed by F101S PcAOX at various pH values. Conversion yield (conv.) for AOX reactions was calculated based on the area observed for the peak

corresponding to glycerol compared to that for the control samples without enzyme. All reactions were assayed in duplicate. Figure 9. Enhanced glycerol conversion in a cascade reaction comprising mutant PcAOX, GarL or RhmA aldolase and pyruvate. For details see Example 8.

EXPERIMENTAL SECTION

Cloning of wild-type AOX

The open reading frame for AOX from P. chrysosporium (GenBank: HG425201.1, UniProtKB/TrEMBL: T2M2J4) was purchased from GenScript (Pistacaway, NJ, USA) with optimized codons for protein expression in E. coli. The aoxl gene was amplified from the delivered plasmid using Phusion High-Fidelity DNA polymerase (Thermo Scientific) and the corresponding pairs of primers: forward 5 -ATGGGTCATCCGGAAGAAGTTG-3' and reverse 5 -TTAGCGGACTTGTTGCGTAGCC-3'. The purified PCR products (100-200 ng) were incubated with 0.5 U Taq polymerase (Roche) and 0.75 mM dATP at 72 °C for 15 min to introduce the 3'-A overhangs. The resulting DNA fragments were ligated into the pET-SUMO vector according to the instruction manual of the Champion pET SUMO expression system

(Invitrogen). A pBAD-SUMO-AOX vector was also prepared by Golden Gate assembly involving restriction reactions containing Bsal. In both pET- SUMO-AOX or pBAD-SUMO-AOX constructs, the gene encoding wild-type PcAOX is fused to the C-terminus of small ubiquitin-like modifier (SUMO). SUMO carries a His-tag at the N-terminus.

The construct pHIPH4_PaAOX_His, containing the open reading fra e for AOX from P. angusta (GenBank: XM_018356154.1), was provided by Dr. Chris Williams (Groningen University). Next, the construct

pBSYAOX_bluntl-AOX2int-AOXl_PaAOX_His was prepared by Gibson assembly. The latter construct was used for intracellular expression of PaAOX in P. pastoris strain BSYBGl l (genus currently named

Komagataella phaffii). Both the vector and host were provided by Dr. Anton Glieder (Graz University of Technology). After digesting the expression construct with Swal (25 °C) or Smil (37 °C), the open reading frame for PaAOX was integrated into AOX2 locus using a previously reported protocol.!¹ ^ Expression was achieved using the AOX1 promoter (methanol inducible). Two E. coli aldolases named «-dehydro-/i-deoxy-D-glucarate aldolase (EC 4.1.2.53, GarL, GenBank: NC_000913.3) and 2-keto-3-deoxy-L- rhamnonate aldolase (EC 4.1.2.53, RhmA = yfaU = KDR, GenBank:

NC_000913.3) were cloned and overexpressed. For this, we designed primers based on the corresponding sequence available in GenBank. PCR reactions were carried out using the genome of E. coli NEB 10/? as a template. Golden Gate cloning was performed to insert the respective genes in the His-SUMO- pBAD plasmid.

Generation of mutants

The construction of the PcAOX mutants F101S, F101N, M103S, M103N, T315S, L317V, F101S/L317V, F101S/T315S, and

F101S/T315S/L317V was done by using the QuikChange^® mutagenesis method. Either pET-SUMO-AOX or pBAD-SUMO-AOX plasmids including the PcAOX gene were used as a template (Invitrogen vectors with the AOX gene). To generate the saturation mutagenesis libraries, the pBAD-SUMO- AOX construct was used as a template. Site saturation mutagenesis was performed using NNK codons instead of single codons (N= A/C/G/T; K= G/T). Each primer contained two degenerated sites. Similarly, the QuikChange^® mutagenesis method was used to prepare the F99S PaAOX variant. In this case, the pHIPH4_PaAOX_His plasmid was used as a template

(https://www.addgene.org/117685/). All primers are shown in Table 1. All mutations were confirmed by sequencing.

Table 1. List of primers used in this study⁸

AOX Forward primer (5 -3') Reverse primer (5'-3') mutant

F101S GGGCGGTGGCAGTTCCATTAA CGGGTATACATCTGACTATTAA

TAGTCAGATGTATACCCG TGGAACTGCCACCGCCC

F101N GGGCGGTGGCAGTTCCATTAA CGGGTATACATCTGATTATTAA

TAATCAGATGTATACCCG TGGAACTGCCACCGCCC

M103S GGCAGTTCCATTAATTTTCAGA AGCTGATGCGCGGGTATAGCT

GCTATACCCGCGCATCAGCT CTGAAAATTAATGGAACTGCC

M103N GGCAGTTCCATTAATTTTCAGA AGCTGATGCGCGGGTATAATT

ATTATACCCGCGCATCAGCT CTGAAAATTAATGGAACTGCC

T315S CATTACAGCACGCTGAGTATT CAGCGTGCTGTAATGGTCTTG

TATCGTGTCAGCAACG ATACTGTTCACCAACGC

L317V ACCACGGTGAGTATTTATCGT AATACTCACCGTGGTGTAATG

GTCAGCAACG GTCTTGATACTGTTC

T315NNK/ CAAGACCATTACNNKACGNNK CGATAAATACTMNN CGTMNN

L317NNK AGTATTTATCG GTAATGGTCTTG

F399NNK/ GNNKGGTAGCATTGTGGCGGG GCMNNGGCGCCCGCCACAAT

Y407NNK CGCCNNKGC GCTACCMNN C

T559NNK/ CATGTC GAAAC CNNKNNKCAC C C AGAGAGTGMNNMNN GGTT

W560NNK TCTCTGG TCGACATG

F99S Pa ATCAACTCTCTGATGTACACCA CATCAGAGAGTTGATCGACGA

GAGCCTCTGCTTC GCCGCCTCC

a The mutation sites are underlined. Only for F99S Pa primers, PaAOX gene was used as a PCR template (PcAOX gene for the rest).

Protein expression and purification

The PcAOX gene contained in pET-SUMO vector was expressed in E. coli BL21(DE3), grown in Terrific Broth containing 50 pg/mL kanamycin,

1% (w/v) glucose at 37 °C. Protein expression was induced when the cells reached ODeoo ~0.7-0.8 by adding 1 mM isopropyl b-Ώ-1- thiogalactopyranoside. The cells were grown at 24 °C until late stationary phase and harvested by centrifugation at 4600 x g for 10 min (Beckman- Coulter JA-10 rotor, 4 °C). The cell pellet was stored at -20 °C. Same protocol was used to express either the AOX or aldolases genes contained in pBAD-SUMO vector with the following modifications: i) E. coli NEB 10/3 was used; ii) expression was induced with 0.02% L-arabinose; and in) ampicillin was added to the cultures. To produce PaAOX using P. pastoris as a host, previously reported protocols were used. I¹»^]

Cells were resuspended in lysis buffer (50 mM potassium phosphate pH 7.8, 400 mM NaCl, 100 mM KC1, 20 mM imidazole, 10 mM FAD) and mechanically disrupted by sonication using a VCX130 Vibra-Cell (Sonics & Materials, Inc., Newtown, USA) at 4 °C (5 sec on, 10 sec off, 70% amplitude, total of 5 min). After removal of unbroken bacteria and cellular debris by centrifugation (20000 x g, Beckman-Coulter JA-25.5 rotor, 4 °C, 45 min), the supernatant was loaded onto a 5 mL HisTrap HP column (GE

Healthcare) pre-equilibrated in the same buffer. The elution of the recombinant enzyme with the His-SUMO tag was facilitated by a 20-500 mM imidazole gradient. Fractions containing the pure enzyme as indicated by SDS-PAGE were pooled, desalted, and concentrated into buffer containing 50 mM potassium phosphate pH 7.5 using a 30-kDa MWCO

Am icon (Milipore) centrifugal filter unit. To obtain the native enzyme, the His-SUMO tag was cleaved by incubating with 10% (mol/mol) SUMO protease (Invitrogen) overnight at 4 °C in lysis buffer supplemented with 1 M urea. The native enzyme was purified from the cleavage mixture by gel- permeation using a Superdex 200 10/300 GL (GE Healthcare) column in 10 mM Tris-HCl pH 7.5 with 100 mM NaCl.

Screening of mutants in 96-well microplates

All cultures and reactions were prepared in 2 mL deep 96-square well plates (Waters) covered by adhesive seals (AeraSeal film, Excel Scientific). Incubations were carried out at 1200 rpm (Titramax 1000 incubator, Heidolph), unless otherwise specified. Single E. coli colonies harboring the plasmids encoding the AOX mutants were picked and grown in 200 pL Luria-Bertani medium containing 50 pg/ml ampicillin. After 14 h at 37 °C, 20 pL of the culture was mixed with 180 pL Terrific Broth containing 0.02% (w/v) L-arabinose and 50 pg/ml ampicillin. After 31 h of incubation at 24 °C, the plates were centrifuged (2250 x g, 30 min, 4 °C) and the supernatant was discarded. Subsequently, cells in each well were resuspended in 100 pL of 100 mM potassium phosphate pH 8.0 containing lysozyme (0.2 mg/mL) and phenylmethanesulfonyl fluoride (PMSF, 0.5 mM) and then incubated for 1 h at 37 °C. Next, cells were subjected to freezing and thawing (-20 and 37 °C, respectively). Finally, 100 pL of 100 mM potassium phosphate pH 8.0 containing glycerol (50 mM), HRP (20 U), and (2,2'-azino-bis(3- ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS, 1.5 mM) were added (final concentrations/U are indicated). Reactions were incubated at 25 °C and visualized every 10 minutes during the first hour, and then at 24 and 72 h. Glycerol oxidase activity was evidenced by the appearance of green color, since oxidation of glycerol catalyzed by PcAOX results in hydrogen peroxide formation. This by-product is used by HRP to oxide ABTS forming a green radical cation.

Biochemical characterization

The UV-Vis spectrum of His-SUMO-AOX was recorded from 250 to 650 nm in 50 mM Tris-HCl pH 7.0 before and after addition of 0.1% (w/v) sodium dodecyl sulfate (SDS). The extinction coefficient of PcAOX was determined based on that of free FAD as described before. I ^l!)l

The pH optimum for enzyme activity was determined based on dioxygen consumption rates using methanol as substrate. The reaction contains 40 mM Britton-Robinson buffer at various pH values, l²°^] 100 nM enzyme, 25 mM methanol in a final volume of 1 mL, and activity was monitored for 5 min at 23 °C using a Hansatech Oxy graph instrument (Hansatech Instruments Ltd., Norfolk, UK). Prior to the measurements, the zero dioxygen level was calibrated by complete reduction using sodium dithionite. AOX thermostability was determined based on the apparent melting temperature (T_m) of the enzyme using the ThermoFAD protocol as previously described!²¹! with a MiniOpticon real-time PCR detection system and 48-well RT-PCR plates (Biorad Laboratories, Hercules, CA, USA). Each well had a final volume of 20 pL containing 2.0 pL of 100 pM AOX stock (in 50 mM potassium phosphate pH 7.5) diluted in the tested buffers (in duplicate).

To determine the steady-state kinetics parameters, AOX activity was measured at 25 °C in 50 mM potassium phosphate pH 7.5 using a Carry 100 Bio UV-Visible spectrophotometer (Varian Inc., USA). Hydrogen peroxide generated by the oxidase (40-0.5 mM AOX) is used by HRP (20 U/mL,

Sigma) to catalyze the oxidative coupling reaction of 4-aminoantipyrine (0.1 mM) and 3,5-dichloro-2-hydroxybenzenesulfonic acid (1 mM). This assay results in the formation of a pink to purple quinoid product, which can be monitored at 515 nm ( 515 = 26 mM⁴ cm ().l² l

Glycerol biotransformation

F101S PcAOX (20 pM) was reacted with glycerol (1 M) in 100 mM potassium phosphate buffer with 7.5 mM NaCl, at pH 6.5-8.0, 30 °C, and 80 rpm (200 pL reactions in 20 mL vials). After a 5 days incubation, 10 pL 85% orthophosphoric acid were added to the reactions. Next, samples were centrifuged (20000 x g, 10 min, 25 °C) and the resulting supernatants were analyzed using electrochemical detection (ECD) for high-performance liquid chromatography (HPLC) as described below.

ECD for HPLC

Glycerol, glycer aldehyde, and glyceric acid were detected using ECD (DECADE Elite, Antec Scientific) for HPLC (Jasco). A Dionex CarboPac PA10 column and pulsed amperometric detection (PAD) were used at 60 °C. Mobile phases were 100 mM NaOH (A) and 1M sodium acetate in 100 mM NaOH (B). Compounds were eluted using a linear gradient from 93 to 80% A over 30 min at 0.1 niL/min. Example 1: Expression and purification of PcAOX wild-type and variants

The production of soluble PcAOX, a fungal protein, was facilitated by codon optimization for E. coli expression and by the fusion to His-tagged SUMO at the N-terminus of the protein. The SUMO fusion is known to enhance the expression level and solubility of partially insoluble proteins, which were often encountered with enzymes of eukaryotic origin that are expressed in E. coli. From one liter of culture, around 600 mg of purified yellow-colored His-SUMO-PcAOX could be obtained after one step of purification. The purified enzyme displayed a typical flavoprotein UV-Vis absorbance spectrum, with two absorbance maxima at 385 and 455 nm (data not shown). Upon unfolding the enzyme with 0.1% (w/v) SDS, the absorbance spectrum of the released flavin was recorded and used to determine the extinction coefficient of the enzyme (e.155 = 10.3 mM ¹ cm ¹).

The native PcAOX was obtained by cleaving the N-terminal His-SUMO tag from the fusion enzyme by proteolytic treatment with SUMO protease. The UV-Vis absorbance spectrum of native PcAOX is essentially identical to that of the fusion enzyme. The apparent catalytic rates, measured with the substrate ethanol, were also comparable for both forms of PcAOX. These results indicated that the SUMO fusion at the N-terminus has no significant effects either on the microenvironment around the flavin cofactor or the enzyme activity. Nevertheless, the native PcAOX precipitated shortly upon storage at 4 °C, impheating that the His-SUMO fusion is crucial for maintaining the protein stability. For this reason, His-SUMO-PcAOX was used for the rest of this study.

Example 2: pH optimum and thermostability of PcAOX

To evaluate the optimal pH for PcAOX activity, methanol oxidation rates were measured between pH 3.0-10 in Britton-Robinson buffer. The enzyme displayed a clear preference for neutral to basic conditions (Figure 3), with an optimal pH value of 9.0. The oxidase retained >75% of its activity between pH 7.0 and pH 10.0. Beyond pH 6.0 and pH 11.0, the activity dropped sharply below 50% of that at pH 9.0. This is in good agreement with the pH profile reported for native AOX isolated from P. chrysosporium . I-^:!I The melting temperatures of PcAOX determined by the ThermoFAD method at various buffers indicated that the enzyme is highly thermostable (Table 2). Over a wide range of pH values from pH 5.0 to pH 8.0, the T_m is > 50 °C. The enzyme is less thermotolerant at pH 5.0 and pH 9.0. Addition of NaCl has virtually no effect on the enzyme thermostability. However, we noticed that in the absence of salt, concentrated enzyme in 50 mM

potassium phosphate at pH 7.5 tended to precipitate at room temperature. Contrarily, the enzyme is stable in the absence of salts when 100 mM potassium phosphate at pH 7.5 is used as a buffer.

Table 2. Unfolding temperatures of PcAOX in different buffers determined by the ThermoFAD method. B-R, Britton-Robinson buffer.

Condition

(°C) <°C)

5 mM KPi pH 7.5 58 B-R buffer pH 9.0 43

50 mM KPi pH 7.5 57 B-R buffer pH 10.0 35

50 mM Tris/HCl 58 B-R buffer pH 11.0 31 pH 7.5

50 mM HEPES pH 61 100 mM NaCl, 50 mM KPi pH 56

7.5 7.5

B-R buffer pH 3.0 31 500 mM NaCl, 50 mM KPi pH 55

7.5

B-R buffer pH 4.0 47 1 M glycerol, 50 mM KPi pH 58

7.5

B-R buffer pH 5.0 62 5 M glycerol, 50 mM KPi pH 58

7.5

B-R buffer pH 6.0 62 20 mM MeOH, 50 mM KPi 55 Condition 7m Condition Tm

(°C) <°C)

pH 7.5

B-R buffer pH 7.0 57 500 mM MeOH, 50 mM KPi 57 pH 7.5

B-R buffer pH 8.0 53 100 mM EtOH, 50 mM KPi 58 pH 7.5

The ThermoFAD experiments suggest that PcAOX tolerates various water-miscible solvents such as methanol (0.5 M), ethanol (0.1 M), and glycerol (5 M), as judged by their minor influence on the T_m values. All the generated PcAOX mutants had melting temperatures similar to that of the wild-type enzyme (data not shown).

Example 4: Steady-state kinetics

To determine the steady-state kinetics of PcAOX, a HRP-coupled assay was used to probe the hydrogen peroxide production rates upon oxidation of the model substrates methanol and ethanol. The initial reaction rates were recorded and could be fitted well using the Michealis-Menten kinetic model (Table 3 and Figure 4). The determined K_m values for methanol and ethanol of PcAOX (2 and 15 mM, respectively) differ somewhat from previously reported values (37 and 23 mM, respectively), t²³l most probably due to the assay conditions such as temperature and buffer used. The k_an values for both substrates were found to be similar, around 18 s k The k_cat and K_m values of PcAOX are in close agreement with the kinetic parameters of AOX1 from P. pastoris (k_r»t and K_m for methanol are 0.6 mM and 5.7 s , respectively). r⁹¹ l As observed for other AOXs, methanol also represents the best substrate for PcAOX with a catalytic efficiency value of 7.2 ^c 10 ^s M ¹ s ^T, which is very similar to P. pastoris AOX1 (9.5 x 10^:Ϊ M ¹ S ¹). In contrast to the results from Linke et we invariably observed only a very low activity when using glycerol as a substrate. At extremely high substrate concentrations (1.0-4.0 M), the observed rate varied between 0.1-0.2 s , which is too low to be catalytically relevant for physiological conditions or industrial applications.

Among the mutants tested, M103N virtually lost activity completely, with /¾_bs values lower than 0.1 s’ for all substrates tested. Surprisingly, both mutants F101S and F 10 IN exhibit an improved activity towards glycerol. F101S is the most potent mutant enzyme with the k_cat of 3 s ¹ (>10- fold compared with the wild-type enzyme), while the thermostability is maintained based on the corresponding T_m values (Example 2).

Interestingly, the F101N variant is able to efficiently convert 1,2- propanediol with a k_cat of 13 s ¹ (Figure 4 and Table 3).

Example 5: Identification of additional mutants

Saturation mutagenesis was performed to identify additional PcAOX mutants showing higher activity on diols or polyols as compared to the wild- type enzyme. Saturation mutagenesis is a random mutagenesis technique, in which a single codon or set of codons is randomized to produce all possible amino acids at the position.

Hundred E. coli colonies were screened per randomization site using NNK codon degeneracy. A colorimetric assay, containing HRP, ABTS, and glycerol, was used for this task. Three hits, showing an improvement in the desired activity in comparison to the wild-type enzyme, were found:

T315S/L317V, Y407F, and W560C. Next, the single mutants T315S and L317V were prepared. The latter mutations were also combined with F101S mutation.

Based on the colorimetric assay, several mutant enzymes were found to possess significant glycerol oxidase activity. These included L317V, Y407F and W560C (Table 4 and Figure 5). The highest activity was found for the single mutant L317V. The mutants F101S/L317V and F101S/T315S/L317V did not show an increased activity on glycerol when compared to the L317V mutant.

Table 4. Observed oxidase activities on glycerol of wild-type and mutant PcAOX based on a colorimetric assay. Activity was scored as -, + , or ++ (no, significant, or good observed activity, respectively) by visual assessment of the amount of color produced.

Example 6: Analyses of glycerol bioconversions

A method to analyze the reactions of PcAOX with glycerol has been developed. It involves the implementation of ECD for HPLC. The

compounds glycerol, glycer aldehyde, and glyceric acid were detected using this approach. The corresponding standards curves and chromatograms are shown in Figure 6 and 7. In the case of glyceraldehyde, three peaks were observed. This fact may due to hydratation, enolization, and/or dimerization of glyceraldehyde J²⁴J

When reactions containing F101S AOX (20 miM) and glycerol (1 M) were analyzed by ECD-HPLC, a conversion yield of 20-30% was calculated at pH 6.5-8.0 (Figure 8). The low conversion yield observed so far for the AOX reactions hampers the product identification. Nevertheless, it has been confirmed using the HRP-coupled assay that F101S PcAOX efficiently oxidizes L-glyceraldehyde. Specifically, F101S PcAOX exhibits a K_m a, glyceraldehyde) 32-fi ld lower than Am (glycerol), while ?cat.(L-glyceraldehyde) IS Only 3.5- fold lower than k_c at (glycerol)· Contrarily, a very low kd value was determined for F101S PcAOX using saturating concentrations of D-glyceraldehyde as a substrate [30-fold lower than the kcat (L-glyceraldeh de) ]. Therefore, F101S PcAOX is enantioselective strongly preferring L-glyceraldehyde over D- glycer aldehyde.

Example 7: Expression of PaAOX in yeast

Constructs to express wild-type and F99S PaAOX in P. pastoris were prepared. This mutant is equivalent to F101S PcAOX, the best single mutant for glycerol conversion. A methanol inducible promoter was selected for these cases, but other types of promoters may be satisfactory implemented. Initial trials in 96-square well plates resulted in high expression levels for wild-type PaAOX and the F99S variant.

Next, a scale up to 1 L cultures was carried out to express both enzymes. Subsequent PaAOX purification was facilitated by a His-tag. By using the HRP-coupled assay and glycerol as a substrate (4.5 M), the glycerol oxidase activity was measured for both purified PaAOX enzymes. While wild-type PaAOX showed a low activity (0.09 s ¹), the F99S PaAOX variant displayed a significantly higher activity (0.28 s ¹). This shows that sequence-related AOXs can be engineered in a similar manner to boost the glycerol oxidase activity. In addition, it confirms that yeast is a valid host system for AOX expression.

Example 8: Implementation of AOX variant-aldolase cascades for the production of polyhydroxy-cr-keto acids

This example describes the development of an AOX-aldolase cascade. It allows for the conversion of glycerol into glyceraldehyde,and the subsequent aldol reaction between this compound and pyruvate (see Scheme 1 herein above). The validity of this method was shown using F101S PcAOX and either GarL or RhmA. GarL and RhmA are type II aldolases, which require a divalent metal-ion cofactor to promote pyruvate enolization. Similarly, other aldolases may be implemented for the same purpose.

A reaction mixture containing 100 mM glycerol, 10 mM F101S PcAOX, 70 mM aldolase, 250 mM pyruvic acid, 1 mM MnS0₄, and 100 mM potassium phosphate pH 7.5 was incubated at 28 °C and 200 rpm for 72 h. Reactions at 35 °C also exhibit satisfactory results requiring shorter incubation times.

Reaction products were analysed on a Dionex CarboPac PA10 HPLC column, an electrochemical flow cell (SenCell 2 mm Au HyREF, Antec), and pulsed amperometric detection (PAD) was used at 60 °C. ECD settings: 200 pA range, MaxComp = 2.5 mA, 0.01 Hz filter, Offs = +0%, El = +0.80 V, E2 = +1.80 V, E3 = -2.00 V, tl = 400 ms, t2 = 200 ms, t3 = 200 ms, ts = 20 ms, t = 890 ms, E4 = +0.50V, E5 = -0.30V, t4 = 70 ms, t5 = 20 ms. Mobile phase: 100 mM NaOH, 20 min. Flow: 0.5 niL/min.

The results are shown in Figure 9, which demonstrates the full conversion of glycerol in the presence of RhmA and F101S PcAOX. Similar results were obtaining using GarL. The reaction products have been observed by NMR. Besides pyruvate, other nucleophiles may suitably be used, such as 2-ketobutyric acid, 4-hydroxypyruvic acid, fluoropyruvic acid, phenylpyruvic acid, 2-oxoglutaric acid, or methyl pyruvic acid. REFERENCES

[1] D. T. Johnson, K. A. Taconi, Environ. Prog. 2007, 26, 338-348.

[2] a) S.-F. Lin, C.-M. Chiou, Y.-C. Tsai, Enzyme Mi crob. Technol. 1996, 18, 383-387; b) T. Uwajima, Y. Shimizu, O. Terada, J. Biol. Chem, 1984, 259, 2748- 2753.

[3] a) D. P. H. M. Heuts, E. W. van Hellemond, D. B. Janssen, M. W. Fraaije,

J. Biol. Chern. 2007, 282, 20283-20291; b) E. W. van Hellemond, L. Vermote, W. Koolen, T. Sonke, E. Zandvoort, D. P. H. M. Heuts, D. B. Janssen, M. W. Fraaije, Adv. Synth. Cat.al. 2009, 351, 1523-1530.

[4] S. Gerstenbruch, H. Wulf, N. MuBmann, T. O’Connell, K.-H. Maurer, U. T. Bornscheuer, Appl. Microbiol. Biotechnol, 2012, 96, 1243-1252.

[5] R. T. Winter, D. P. H. M. Heuts, E. M. A. Rijpkema, E. van Bloois, H. J. Wijma, M. W. Fraaije, Appl. Microbiol. Biotechnol. 2012, 95, 389-403.

[6] D. Linke, N. Lehnert, M. Nimtz, R. G. Berger, Enzyme and microbial technology 2014, 61-62, 7-12.

[7] T. Weber, N. MuBmann, M. Merkel, I. Prtiser, T. O'Connell, D. Linke, R.

G. Berger, Vol. WO/ 2014/ 195214 HENKEL AG & CO. KGAA, 2014.

[8] D. J. Lipman, W. R. Pearson, Science 1985, 227, 1435-1441.

[9] a) G. Daniel, J. Vole, L. Filonova, O. Plihal, E. Kubatova, P. Halada,

Appl. Environ, Microbiol, 2007, 73, 6241-6253; b) C. Koch, P. Neumann, O.

Valerius, I. Feussner, R, Ficner, PLoS ONE 2016, 11, e0149846; c) Y. Sakai, Y. Tani, Gene 1992, 114, 67-73.

[10] T. I to, S. Fujimura, M. Uchino, N. Tanaka, Y. Matsufuji, T. Miyaji, K. Takano, T. Nakagawa, N. Tomizuka, Yeast 2007, 24, 523-532.

[11] J. M. Cregg, K. R. Madden, K. J. Barringer, G. P. Thill, C. A. Stillman, Mol, Cell, Biol, 1989, 9, 1316-1323.

[12] C. J. A. Sigrist, E. de Castro, L. Cerutti, B. A. Cuche, N. Hulo, A. Bridge, L. Bougueleret, I. Xenarios, Nucleic Acids Res. 2013, 41, D344-D347.

[13] PCR protocols: a guide to methods and applications, Academic Press,

New York, 1990.

[14] a) D. T. Johnson, K. A. Taconi, Environ Ih og. 2007, 26, 338-348; b) M.

Pagliaro, R. Ciriminna, H. Kimura, M. Rossi, C. Della Pina, Angew. Chem hit Ed. 2007, 46, 4434-4440; c) C.-H. Zhou, J. N. Beltramini, Y.-X. Fan, G. Q. Lu, Che Soc. Rev. 2008, 37, 527-549. [15] V. De Berardinis, C. Guerard-Helaine, E. Darii, K. Bastard, V. Helaine, A. Manage, J.-L. Petit, N. Poupard, I. Sanchez-Moreno, M. Siam, Green Che.rn. 2017, 19, 519-526.

[16] F. Sievers, A. Wilm, D. Dineen, T. J. Gibson, K. Karplus, W. Li, R. Lopez, H. McWilliam, M. Remmert, J. Soding, J. D. Thompson, D. G. Higgins, Mol. Syst. Biol 2011, 7, 1-6.

[17] J. Lin- Cere ghino, W. W. Wong, S. Xiong, W. Giang, L. T. Luong, J. Vu, S. D. Johnson, G. P. Lin- Cere ghino, BioTechniques 2005, 38, 44-48.

[18] R. Weis, R. Luiten, W. Skranc, H. Schwab, M. Wubbolts, A. Glieder, FEMS Yeast Res. 2004, 5, 179-189.

[19] P. Macheroux, in Flavoprotein protocols (Eds.: S. K. Chapman, G. A. Reid), Humana Press, New Jersey, USA, 1999, pp. 1-7.

[20] H. T. S. Britton, R. A. Robinson, J. Chern. Soc. 1931, 1456-1462.

[21] F. Forneris, R. Orru, D. Bonivento, L. R. Chiarelli, A. Mattevi, FEBS J. 2009, 276, 2833-2840.

[22] R. Federico, R. Angelini, L. Ercolini, G. Venturini, A. Mattevi, P. Ascenzi, Biochem. Biophys. Res. Cornmun. 1997, 240, 150-152.

[23] D. Linke, N. Lehnert, M. Nimtz, R. G. Berger, Enzyme Microb. Technol. 2014, 61-62, 7-12.

[24] V. A. Yaylayan, S. Harty-Majors, A. A. Ismail, Carbohydr. Res. 1999,

318, 20-25.

Claims

1. A mutant alcohol oxidase (AOX) enzyme having glycerol oxidase activity, said mutant AOX showing at least 50% sequence identity to the amino acid sequence of AOX from Phanerochaete chrysosporium (PcAOX; SEQ ID NO: l), Gloeophyllum trabeum (GtAOX; SEQ ID NO:2), Candida boidinii (CbAOX; SEQ ID NO:3), Pichia pastoris (PpAOX; SEQ ID NO:4), or Pichia angusta (PaAOX; SEQ ID NO:5), and comprising one or more of the following mutations:

2. Mutant AOX enzyme according to claim 1, wherein the amino acid corresponding to Phe at position 101 of PcAOX is mutated to Asn or Ser, preferably Ser.

3. Mutant AOX enzyme according to claim 1 or 2, wherein the amino acid corresponding to Met at position 103 of PcAOX is mutated to Ser.

4. Mutant AOX enzyme according to any one of claims 1-3, wherein the amino acid corresponding to Leu at position 317 of PcAOX is mutated to Val

5. Mutant AOX enzyme according to any one of claims 1-4, wherein the amino acid corresponding to Tyr at position 407 of PcAOX is mutated to Phe.

6. Mutant AOX enzyme according to any one of claims 1-5, wherein the amino acid corresponding to Trp at position 560 of PcAOX is mutated to Cys.

7. Mutant AOX enzyme according to any one of the preceding claims, having an amino acid sequence showing at least 70%, preferably at least 80%, more preferably at least 85% sequence identity to the amino acid sequence of PcAOX (SEQ ID NO: l) GtAOX (SEQ ID NO:2), CbAOX (SEQ ID NO:3), PpAOX (SEQ ID NO:4), or PaAOX (SEQ ID NO:5).

8. Mutant AOX enzyme according to any one of the preceding claims, comprising one or more of the following conserved elements among AOX enzymes:

(i) ADP-binding bab-ΐoΐά motif

(ii) the GMC oxred 2 sequence(s) (PROSITE signature PS00624)

(iii) the GMC oxred 1 sequence (PROSITE signature PS00623), provided that the Phe at position 101 and/or the Met at position 103 may be mutated as herein defined above.

9. Mutant AOX enzyme according to any one of the preceding claims, wherein the polypeptide comprises a protein tag allowing for the enhanced expression, solubihzation, isolation and/or purification of the polypeptide.

10. A nucleic acid sequence encoding a mutant AOX enzyme

according to any one claims 1-9, preferably wherein the nucleic acid sequence is codon optimized for expression in a bacterial, fungal, or yeast host cell.

11. A vector comprising a nucleic acid sequence according to claim 10.

12. A non-human host cell comprising a vector according to claim 11, preferably being a fungal, yeast, or bacterial cell.

13. A method for preparing a recombinant mutant AOX enzyme according to any one of claims 1-9, comprising culturing a host cell according to claim 12 under conditions allowing for expression of the encoded enzyme, and isolating the mutated enzyme from the host cell or from the culture medium.

14. A method for oxidizing a diol or polyol, comprising contacting a composition comprising a diol or polyol with a mutant AOX enzyme according to any one of claims 1-9 under conditions allowing for diol or polyol oxidation.

15. The method according to claim 14, wherein the diol or polyol is glycerol or 1,2-propanediol.

16. Method according to claim 15, wherein the polyol is glycerol, preferably wherein the glycerol is a by-product of the production of biodiesel or soap.

17. Method according to claim 16, comprising contacting glycerol with said mutant AOX enzyme in the presence of an aldolase (EC 4.1.2.x) and an appropriate nucleophile under conditions allowing for production of a polyhydroxy-«-keto acid.

18. Method according to claim 17, wherein the nucleophile is pyruvic acid, 4-hydroxypyruvic acid, or 2-ketobutyric acid.

19. Method according to claim 17 or 18, wherein the aldolase is a type II aldolase, preferably 5-keto-4-deoxy-D-glucarate aldolase from Escherichia coli (GarL; EC 4.1.2.20) or 2-keto-3-deoxy-L-rhamnonate aldolase from Escherichia coli strain K12 (RhmA; EC 4.1.2.53).

20. The use of a mutant AOX enzyme according to any one of claims 1-9 as biocatalyst.