WO2019209187A1

WO2019209187A1 - A luciferase reporter system and an assay for gene expression profiling using the same

Info

Publication number: WO2019209187A1
Application number: PCT/TH2018/000020
Authority: WO
Inventors: Pimchai CHAIYEN; Juthamas JAROENSUK; Cholpisit KIATTISEWEE; Jittima PHONBUPPHA; Thanyaporn WONGNATE; Ruchanok TINIKUL; Nattanon AKERATCHATAPAN
Original assignee: Vidyasirimedhi Institute Of Science And Technology
Priority date: 2018-04-25
Filing date: 2018-04-25
Publication date: 2019-10-31

Abstract

The present disclosure provides a luciferase reporter system applicable in a liquid medium having oxidized flavins and carboxylic acids as substrates. Particularly, the luciferase-based reporter system comprises a recombinant carboxylic reductase operable to convert one or more carboxylic acids into one or more fatty aldehydes; a catalytic reagent configured to generate reduced flavins from the oxidized flavins in the presence of reduced nicotinamide adenine dinucleotides (NADH) or reduced l-benzyl-1,4-dihydronicotinamides (BNAH); and a recombinant luciferase complex capable of yielding the carboxylic acids and emitting photons in the form of detectable light by reacting the fatty aldehydes with the reduced flavins. Preferably, the light is detected to compute a light emission profile being a function of detected light intensity over time.

Description

A LUCIFERASE REPORTER SYSTEM

AND AN ASSAY FOR GENE EXPRESSION PROFILING USING THE SAME

Technical Field

The present disclosure relates to a luciferase-based reporter system applicable for determining regulatory effects of genetic components such as a promoter sequence which can affect protein expression. More particularly, the disclosed system is a hybrid luciferase-based reporter system in which some components found in conventional luciferase reporter systems are replaced such that the disclosed system can be used in a substantially in vitro environment. The present disclosure also provides a method for assessing protein expression by the genetic component of interest using the disclosed reporter system.

Background

Bioluminescence is a phenomenon relating to light generation in a certain organism associated with a luciferase-mediated oxidation reaction. In view of the reaction involved and properties of the light produced, luciferase genes from various organisms have been commonly used as reporter systems for researchers to observe and study expression effect and/or regulatory power of different genetic components. For instance, a luciferase reporter system is disclosed to be used for evaluating osteogenic differentiation of adipose-derived stromal cells in China patent application no. 104152536. Likewise, China patent application no. 105802996 teaches to employ a dual-luciferase reporting system for verifying internal ribosome entry site (IRES) sequence activity. Luciferase can be extracted or expressed using various sources such as beetles, fish, bacteria, protozoa, mollusks, millipedes, flies, fungi, and worms. More specifically, these organisms possess the necessary luciferase to catalyze monooxygenations resulting in spontaneous release of free energy in the form of photons. More importantly, effort has long been put into modifying the enzymatic and/or physical characteristics of the luciferase of various origins such that the attained properties can be used to yield the desired outcome for the study of protein expression. For example, United States patent no. 6387675 discloses a beetle luciferase variant which produces light with color different from the light generated through the wild type luciferase. The referred patent claims that the luciferase variant can generate light with the wavelength of peak intensity being at least 1 nm different from that of the wild type. Gambhir et al. disclose also a luciferase variant from Cnidarian carrying modulated properties including better stability and enhanced light output. Like the beetle or Cnidarian luciferase, bacterial luciferase (LuxAB) can generate light based on its catalytic characteristics towards oxidation of reduced flavin (FMNH2) using aldehyde and molecular oxygen. The reaction of bacterial luciferase (LuxAB) generates blue-green light with the maximum absorption at 490 nm upon yielding of oxidized flavin (FMN), carboxylic acid and water as products from the oxygenation reaction (Fig. 1). The ability to emit light and utilize substrates that are readily available in cells made the bacterial luciferase (LuxAB) an ideal gene of report system. In addition, the bacterial luciferase is valuable as a tool for in vitro assays because all the consumable substrates or reagents are relatively inexpensive than substrates of other luciferases. However, a prime shortcoming of using in vitro assays of the bacterial luciferase is that aldehyde and FMNH2 are unstable molecules in the cellular environment and in vitro environment. This problem can be overcome if enzymatic reactions to generate aldehyde from acid and FMNH2 from oxidized FMN can be included in assay reactions. In native host cells, the reaction to generate aldehyde from acid is catalyzed by an enzyme fatty acid reductase complex (LuxCDE) and the reaction to generate FMNH2 from oxidized FMN is catalyzed by a flavin reductase (LuxG). However, the reach of recombinant enzymes of bacterial luciferase system has thus far been limited because the recombinant LuxCDE overexpressed in E. coli could not be obtained and isolated in active form either as a whole LuxCDE complex or as individual components. Such shortcomings render the bacterial luciferase system hard to be used for in vitro application or achieving low efficiency even it is used. Furthermore, LuxAB requires LuxG to be co-expressed as well in the native host cell for obtaining the needed reduced flavin for the bioluminescence reaction. Therefore, even for using the bacterial luciferase for the in vivo system, multiple luciferase genes must be transfected into the host cells and such tasks can be difficult to have multiple genes incorporated to work perfectly as designed. In the view of that, a solution to at least address some of the abovementioned deficiencies associated with bacterial luciferase system will be greatly desired.

Summary

The present disclosure aims to offer a bacterial luciferase-based reporter system usable for in vitro application for detecting expression of targeted polypeptides, proteins or regulatory genes. Particularly, the disclosed bacterial luciferase-based reporter system described herein after has some of the reagents employed in the conventional luciferase-based reporter system replaced or substituted. The replacing reagents allow enhanced and robust performance of the disclosed reporter system in a substantially, almost or entirely in vitro condition. Further object of the present disclosure is to provide a bacterial luciferase-based reporter system that the various catalytic components or reagents can be easily expressed. Specifically, the replacing reagents or components used in the present disclosure are of significantly lower number and/or gene size compared to the conventional bacterial luciferase-based reporter system.

Still another object of the present disclosure is directed to cater a bacterial luciferase reporter system capable of delivering light signal for an extended or prolong period. Several embodiments of the present disclosure utilize a novel reagent, reduced 1 -benzyl- 1,4- dihydronicotinamides (BNAH), for supplying the reduced flavin to the bioluminescence reaction in a constant manner. The implementation of BNAH in the disclosed system exhibits light signal generation for a prolong duration.

Another object of the present disclosure targets to offer a bacterial luciferase-based reporter system with improved thermal stability by way of using a variant-type recombinant of a reductase component of p-hydroxyphenylacetate 3 -hydroxylase (or interchangeably referred as variant-type recombinant Ci reductase throughout this specification) in replacing LuxG for obtaining a stable supply of reduced flavin in situ. The variant Ci reductase employed in several embodiments of the present disclosure possesses at least 9 °C higher in thermostability or melting temperature compared to the wild type. This allows the disclosed system to carry out the expression detection in a condition where higher experimental temperature is required. Also, in some embodiments, wild type Ci reductase can be used.

At least one of the preceding objects is met, in whole or in part, by the present invention, in which one of the embodiments of the present disclosure relates to a luciferase reporter system applicable in a liquid medium having oxidized flavins and carboxylic acids comprising a recombinant carboxylic reductase operable to convert one or more carboxylic acids into one or more fatty aldehydes; a catalytic reagent configured to generate reduced flavins from oxidized flavins in the presence of reduced nicotinamide adenine dinucleotides (NADH) or reduced 1- benzyl-l,4-dihydronicotinamides (BNAH); a recombinant luciferase complex capable of yielding the carboxylic acids and emitting photons in the form of detectable light by reacting with the fatty aldehydes and the reduced flavins, wherein the light is detected to compute a light emission profile being a function of detected light intensity over time. According to a plurality of embodiments, the recombinant carboxylic reductase originated from Mycobacterium marinum, Nocardia iowemis, or Rhodococcus sp.

For several embodiments, the catalytic reagent is any one or combination of a variant recombinant Ci reductase, a wild-type recombinant Ci reductase and recombinant LuxG reductase, where the variant recombinant Ci reductase is expressed from a recombinant DNA sequence as setting forth in SEQ ID NO. 2. The variant recombinant Ci reductase has melting temperature of 52 °C and k_c K_m value of 5.17 pNf's ¹ in some of the embodiments.

In one or more embodiments, the recombinant luciferase complex is a fusion protein comprising a LuxA peptide and a LuxB peptide joined by a peptide linker having an amino acids sequence of VINIFEKJERD. Preferably, the LuxA and LuxB peptides are originated from Vibrio campbellii.

Also, in more embodiments, the presence of the BNAH provides the computed light emission profile with relatively higher detected light intensity over a prolong period compared to the presence of the NADH in the system.

Another aspect of the present disclosure discloses a method of determining regulatory effect of a genetic component towards protein expression in host cells using a luciferase reporter system. The method comprises steps of providing a liquid medium having a plurality of recombinant luciferase complex, oxidized flavins and carboxylic acids, the amount of the recombinant luciferase complex present in the liquid medium corresponding to the regulatory effect of the genetic component; converting the carboxylic acids into fatty aldehydes in situ using a plurality of recombinant carboxylic reductase; generating reduced flavins from the oxidized flavins through a plurality of catalytic agents in the presence of reduced nicotinamide adenine dinucleotides (NADH) or reduced 1 -benzyl- 1 ,4-dihydronicotinamides (BNAH); reacting the luciferase complex with the reduced flavin to yield carboxylic acids and emit photons in the form of detectable light thereby; and detecting the light to compute a light emission profile being a function of intensity of the detected determining regulatory effect of the genetic component based upon the computed light emission profile. Preferably the catalytic reagent used in the described method is any one or combination of a variant recombinant Ci reductase, a wild-type recombinant Ci reductase, and recombinant LuxG reductase. Preferably, in multiple embodiments, the variant recombinant Ci reductase is expressed from a recombinant DNA sequence as setting forth in SEQ ID NO. 2.

In accordance with several embodiments of the disclosed method, the recombinant luciferase complex is a fusion protein comprising a LuxA peptide and a LuxB peptide joined by a peptide linker having an amino acids sequence of VINIFEKERD.

For a number of embodiments, the presence of the BNAH provides the computed light emission profile with relatively higher detected light intensity over a prolong period compared to the presence of the NADH in the system.

Brief Description of the Drawings

Fig. 1 illustrates conventional reaction for photons generation using luciferase reporting system;

Fig. 2 illustrates one embodiment of the present disclosure for photons generation using modified or improved luciferase reporting system;

Fig. 3 shows SEQ NO. 1 setting forth the polynucleotide sequence encoding for the LuxAB polypeptide with a linker sequence;

Fig. 4 illustrates arrangement of various genetic elements in the vector pETl laLuxAB constructed for the expression of LuxAB proteins;

Fig. 5 illustrates arrangement of various genetic elements in the vector pETDuet- l_mmCARHis_Sfp constructed for the expression of CAR proteins;

Fig. 6 shows SEQ ID NO. 2 setting forth the polynucleotide sequence encoding for one embodiment of the variant Ci reductase polypeptide with improved thermal stability compared to wild type Ci reductase;

Fig. 7 illustrates arrangement of various genetic elements in the vector pETl 1 a-Ct constructed for the expression of mutated Ci reductase polypeptides; Fig. 8 is a graph summarizing bacterial luciferase activity assays in which photons were generated through bacterial luciferase (LuxAB) reaction using carboxylic acid reductase (mmCAR) as aldehyde producing entity;

Fig. 9 shows SDS-PAGE analysis of crude lysate of K coli cells with LuxCDE genes overexpressed. Proteins were separated in 12% (w/v) acrylamide gel and stained with Coomassie blue. Expected bands of recombinant LuxC, LuxD and LuxE proteins are marked with arrows and their theoretical molecular weights are indicated in brackets;

Fig. 10 shows no formation of aldehyde from in vitro reactions of LuxC using gas chromatography;

Fig. 11 shows SDS-PAGE analysis of crude lysate of E. coli cells with mmCAR gene overexpressed. Proteins were separated on 12% (w/v) acrylamide gel and stained with Comassie Blue; Lane A) and B) are crude lysate of E. coli BL21(DE3) without mmCAR expression, C) and D) are crude lysate of E. coli BL21(DE3) with mmCAR gene overexpressed, E) Protein markers from Enzmart Biotech. A position of recombinant mmCAR protein is marked with an arrow and its theoretical molecular weight is indicated in bracket;

Fig. 12 shows bioluminescence light production from a LuxAB reaction coupled to a reaction of Ci reductase with (A) being the result acquired using NADH as a reductant to supply FMNtfe to the luciferase reaction, and (B) being the results using BNAH to supply FMNH2 to the luciferase reaction.

Detailed Description

Hereinafter, the disclosure shall be described according to the preferred embodiments and by referring to the accompanying description and drawings. However, it is to be understood that referring the description to the preferred embodiments of the invention and to the drawings is merely to facilitate discussion of the various disclosed embodiments and it is envisioned that those skilled in the art may devise various modifications without departing from the scope of the appended claim. The term "polynucleotide" or "nucleic acid" as used herein designates mRNA, RNA, cRNA, cDNA or DNA. The term typically refers to oligonucleotides greater than 30 nucleotide residues in length.

The term "polypeptides" used herein throughout the disclosure refers to a chain of amino acids linked together by peptide bonds but with a lower molecular weight than protein. Polypeptides can be obtained by synthesis or hydrolysis of proteins. Few polypeptides can be joined together by any known method in the art to form a functional unit.

The term "primer" used herein throughout the specification refers to an oligonucleotide which, when paired with a strand of DNA, is capable of initiating the synthesis of a primer extension product in the presence of a suitable polymerizing agent. The primer is preferably single- stranded for maximum efficiency in amplification but can alternatively be double-stranded. A primer must be sufficiently long to prime the synthesis of extension products in the presence of the polymerization agent. Primers can be "substantially complementary" to the sequence on the template to which it is designed to hybridize and serve as a site for the initiation of synthesis. By "substantially complementary", it is meant that the primer is sufficiently complementary to hybridize with a target polynucleotide.

The term "flavin" used herein throughout this specification refers to a group of organic compounds generally derived from tricyclic heterocycle isoalloxazine usable in the disclosed system to attain the desired light profiling results. The representative examples of flavin is flavin mononucleotide (FMN), flavin adenine dinucleotide (FAD), riboflavin and derivative compounds of FMN, FAD and riboflavin.

As used herein, the phrase "in embodiments" means in some embodiments but not necessarily in all embodiments.

As used herein, the terms "approximately" or "about", in the context of concentrations of components, conditions, other measurement values, etc., means +/- 5% of the stated value, or +/- 4% of the stated value, or +/- 3% of the stated value, or +/- 2% of the stated value, or +/- 1% of the stated value, or +/- 0.5% of the stated value, or +/- 0% of the stated value. According to the present disclosure, a luciferase reporter system applicable in a liquid medium is disclosed. Preferably, the liquid medium is an aqueous solution within a pH range favoring the catalytic reaction of the bacterial luciferase and other catalysts/reagents. The liquid medium may essentially include oxidized flavins and carboxylic acids as substrates to react with the bacterial luciferase and other catalytic reagents for the occurrence of bioluminescence and light signal generation. The liquid medium is preferably aerobic containing sufficient amount of oxygen for the luciferase and other catalytic reagent to reach their full or almost full enzymatic potential throughout the bioluminescence reaction. The disclosed reporter system particularly comprises a recombinant carboxylic reductase operable to convert one or more carboxylic acids into one or more fatty aldehydes; a catalytic reagent configured to generate reduced flavins from the oxidized flavins in the presence of reduced nicotinamide adenine dinucleotides (NADH) or reduced l-benzyl-l,4-dihydronicotinamides (BN AH); and a recombinant luciferase complex capable of yielding the carboxylic acids and emitting photons in the form of detectable light by reacting with fatty aldehydes and reduced flavins, wherein the light are detected to compute a light emission profile being a function of detected light intensity over time.

It is important to note that the recombinant carboxylic reductase (CAR) can be originated from Mycobacterium marinum, Nocardia iowensis, or Rhodococcus sp. The gene of the referred organisms encoding for the CAR is amplified and transformed into a host cell for expression of CAR into an amount enough for in vitro application. The gene may be carried by a vector such as plasmid, as shown in Fig. 5, for CAR expression. CAR is a metabolic platform used in the present disclosure to replace the role of LuxCDE in the conventional bacterial-based luciferase reporter system. Like LuxCDE, CAR is able to produce aldehydes from varieties of carboxylic acids or, more preferably, fatty acids. In the presence of ATP and NADPH in the liquid medium, CAR converts supplied carboxylic acid into aldehyde via multistep mechanisms via different reactive sites of its protein structure. In some embodiments of the disclosed system, CAR from Mycobacterium marinum was expressed and used. It was found by inventors of the present disclosure that CAR from Mycobacterium exhibits excellent reactivity to produce fatty aldehyde, without formation of any coenzyme A intermediates, at the desired rate adequate to generate good light signal detectable for computing the light emission profile even the reaction was performed in a substantially, almost, or nearly in vitro environment. Compared to LuxCDE as shown in some experimental examples provided hereinafter, CAR can be easily expressed or preferably overexpressed in the host cells to arrive at a volume or amount necessarily required for the bioluminescence reaction. This can be attributed to the single gene nature of CAR while formation of the LuxCDE involves expression of three different peptides from three different genes respectively. More importantly, expressed CAR shows no or low deterioration upon being extracted from the host cells, kept in the cold storage for a reasonable duration and subsequently applied in the liquid medium to react with the fatty acids for producing the aldehyde needed for the bioluminescence reaction. In contrast, inventors of the present disclosure found that the lowly expressed LuxCDE (not shown) exhibited no catalytic reactivity when it was extracted from the host cells and utilized for bioluminescence reaction under in vitro testing.

For a number of preferred embodiments, the disclosed system uses carboxylic acids as the substrates to be used by the CAR to generate in situ aldehydes which can further react with LuxAB to again be oxidized back to the acid form. The carboxylic acids are preferably fatty acids. The fatty acids used in the present disclosure can be any one or the combination of decanoic acid, dodecanoic acid, tetradecanoic acid, hexadecanoic acid, and octadecanoic acid. For those embodiments in which a mixture of different fatty acids is administrated, each fatty acid type may be added according to a predetermined proportion to result in the desired light emission profile.

In accordance with few embodiments, the catalytic reagent of the disclosed system is recombinant LuxG reductase. Like other catalytic reagents, LuxG reductase in the present disclosure can be acquired through any known recombinant approaches in the field by way of cloning the gene encoding for the LuxG protein into the suitable host cells and culture the transformed host cells in a culture medium to yield the LuxG reductase within the host cells. The LuxG reductase expressed in the host cells are subsequently extracted and stored for later use in the disclosed system. For more embodiments, the disclosed system has the LuxG reductase replaced or substituted by a recombinant variant Ci reductase. More specifically, the recombinant variant Ci reductase is preferably expressed using C -hpah gene isolated from a strain of Acinetobacter baumannii. It is important to note that the recombinant variant Ci reductase exhibits at least 9 °C higher in thermostability compared to the wild type. With the improved thermostability, the variant Ci reductase becomes more suitable to work with the disclosed system as it can be extracted and stored for an extended duration before being utilized for the in vitro application without any substantial denaturation. The improved thermostability of the variant Ci reductase also ensures robustness of the disclosed system for in vitro application. Particularly, the disclosed system can be employed as a tool for determining protein expression in a condition where the experimental temperature is relatively high. The nucleotides sequence encoding for the variant Ci reductase is set forth in SEQ ID NO. 2 of Fig. 6. Furthermore, the variant recombinant Ci reductase has a melting temperature of 52 °C and kcat/Km value of 5.17 pM^'V¹.

As mentioned in the foregoing, the catalytic reagent comprising a variant Ci reductase or LuxG reductase serves to generate reduced flavins from the oxidized flavins in the presence of reduced nicotinamide adenine dinucleotides (NADH) or reduced 1 -benzyl- 1,4- dihydronicotinamides (BNAH). Both NADH and BNAH can provide the needed H to the variant Ci reductase or LuxG reductase to reduce the flavins which subsequently oxidize aldehyde to carboxylic acid and water while concurrently releasing energy in the form of photons. Nonetheless, the use of BNAH in the disclosed system offers another interesting feature which cannot be achieved through the conventional bacterial-based luciferase reporter system. Specifically, using BNAH as the flavin reducing agent in the disclosed reporter system somehow results in higher and prolong or extended light signal emission throughout the assay of bioluminescence, as shown in part of the examples described below, though the cause of such observation is yet determined by the inventors of the present disclosure. Based upon the observation made, the prolong or extended light emission are likely due to relatively slow decay of light emitting species of the luciferase reaction when BNAH was used compared to flavin reduction by NADH thus leading to extended period of light generation and extended light emission profile. Another plausible reason giving rise to the extended period of light generation associated with the use of BNAH may be due to the nature of luciferase with multiple turnovers having BNAH reacted with the oxidized flavin on the luciferase and then proceeded to other reaction cycles. Therefore, some embodiments of the disclosed system are fashioned to provide the computed light emission profile with relatively higher detected light intensity over a prolong period in the presence of the BNAH compared to the presence of the NADH in the system.

Pursuant to more preferred embodiments, the recombinant luciferase complex is a fusion protein comprising a Lux A peptide and a LuxB peptide joined by a peptide linker having an amino acids sequence of VINIFEKERD. The linker interposes between the LuxA peptide and LuxB peptide joining the C-terminus of LuxA to N-terminus of LuxB to retain the reactivity of the formed luciferase complex. Preferably, the LuxA and LuxB peptides are originated from Vibrio campbellii, Photobacterium leiognathi, or any combination derived thereof. Like setting forth in the early description, the recombinant luciferase complex is capable of yielding the carboxylic acids and emitting photons in the form of detectable light by reacting the fatty aldehydes with the reduced flavins and oxygen provided in the liquid medium that the light is detected by any sensor or sensing means known in the field to compute a light emission profile being a function of detected light intensity over time. The light emission profile contains all the information about the light or photons emitted from the conducted bioluminescence assay over a predetermined period that the function of peak light intensity or total photons produced over a given period can be used to calculate the amount of the expressed target protein or the regulatory power of the promoter sequence of interest.

In accordance with several embodiments, the molar ratio of the catalytic reagent: luciferase complex: CAR is preferably within the range of 1 :420:50 in order to produce the desired results. Likewise, the preferred molar ratio for CAR and carboxylic acid substrates is 1 :650. Also, the preferred molar ratio for the catalytic reagents and flavins in the disclosed system is 1 :300- 3000.

Another major aspect of the present disclosure involves a method of determining regulatory effect of a genetic component towards protein expression in host cells using the luciferase reporter system disclosed in the foregoing description. The method comprises steps of providing a liquid medium having a plurality of recombinant luciferase complex, oxidized flavins and carboxylic acids, the amount of the recombinant luciferase complex present in the liquid medium corresponding to the regulatory effect of the genetic component; converting the carboxylic acids into fatty aldehydes in situ using a plurality of recombinant carboxylic reductase; generating reduced flavins from the oxidized flavins through a plurality of catalytic agents in the presence of reduced nicotinamide adenine dinucleotides (NADH) or reduced 1- benzyl-l,4-dihydronicotinamides (BN AH); reacting the luciferase complex with the reduced flavin and oxygen (from the liquid medium) to yield carboxylic acids and emit photons in the form of detectable light thereby; and detecting the light to compute a light emission profile being a function of intensity of the detected; determining regulatory effect of the genetic component based upon the computed light emission profile. Accordingly, the recombinant carboxylic reductase (CAR) can be originated from Mycobacterium marinum, Nocardia iowensis, or Rhodococcus sp. The gene of the referred organisms encoding for the CAR is amplified and transformed into a host cells for protein expression into an amount enough for in vitro application. The gene may be carried by a vector such as a plasmid, as shown in Fig. 5, for CAR expression. The disclosed method uses CAR to replace the role of LuxCDE in the conventional bacterial-based luciferase reporter system. Like LuxCDE, CAR produces aldehyde from varieties of carboxylic acid or, more preferably, fatty acids. In few preferred embodiments, CAR from Mycobacterium marinum is expressed and used in the described method. It was found by inventors of the present disclosure that CAR from Mycobacterium exhibit excellent reactivity to produce fatty aldehyde, without formation of any coenzyme A intermediates when the bioluminescence reaction was performed in a substantially, almost, or nearly in vitro environment. CAR can be easily expressed or preferably overexpressed in the host cells to arrive at a volume or amount necessarily required for the bioluminescence reaction compared to LuxCDE. Particularly, the nucleotide sequence encoding for CAR that being used to prepare expression of CAR is 3.5 kb in size.

In few embodiments, the catalytic reagent referred in the present method can be recombinant LuxG reductase. Like other catalytic reagents, LuxG reductase in the present disclosure can be acquired through any known recombinant approaches in the field by way of cloning the gene encoding for the LuxG reductase into suitable host cells and culturing the transformed host cells in a culture medium to yield the LuxG proteins within the host cells. The LuxG reductase expressed in the host cells are subsequently harvested and stored until being used for the disclosed method. For more embodiments, the disclosed method has the LuxG reductase replaced or substituted by a recombinant variant Ci reductase. More specifically, the recombinant variant Ci reductase is preferably expressed using Ci-hpah gene isolated from a strain of Acinetobacter baumannii. The recombinant variant Ci reductase exhibits at least 9 °C higher in thermostability or melting temperature compared to the wild type. The nucleotides sequence encoding for the variant Ci reductase is set forth in SEQ ID NO. 2 of Fig. 6. Furthermore, the variant recombinant Ci reductase has a melting temperature of 52 °C and kc K_m value of 5.17 pM^s ¹.

In some embodiments, the recombinant luciferase complex used in the method is a fusion protein comprising a Lux A peptide and a LuxB peptide joined by a peptide linker having an amino acids sequence of VINIFEKERD. The linker joins the C -terminus of LuxA to N- terminus of LuxB to retain the reactivity of the formed luciferase complex. Preferably, the luxA and luxB peptides are originated from Vibrio campbellii, Photobacterium leiognathi, or any combination derived thereof. The recombinant luciferase complex is capable of yielding the carboxylic acids and emitting photons in the form of detectable light by reacting the fatty aldehydes with the reduced flavins and oxygen provided in the liquid medium. The light discharged is detected and recorded through sensors disposed around, adjacent or inside the liquid medium to compute a light emission profile which is a function of detected light intensity over time. The light emission profile acquired in the described method contains all the information about the light or photons emitted from the conducted bioluminescence assay over a predetermined period that the function of peak light intensity or total photons produced over a given period can be used to calculate the amount of the expressed target protein or the regulatory power of the promoter sequence of interest.

In accordance with several embodiments, the molar ratio of the catalytic reagent: luciferase complex: CAR is preferably within the range of 1 :420:50 in order to produce the desired results. Likewise, the preferred molar ratio for CAR and carboxylic acid substrates is 1 :650. Also, the preferred molar ratio for the catalytic reagents and flavins in the disclosed system is 1:300- 3000.

The following example is intended to further illustrate the invention, without any intent for the invention to be limited to the specific embodiments described therein.

Example 1

The luxAB gene used in the present disclosure was isolated from a strain of Vibrio campbellii. Forward primer (5XA/G)TIGTI(C/T)TI(C/A)GIAA(C/T)TT(C/T)TA(C/T)CA-3’) corresponding to the luxD gene and Reverse primer (5’- A(A/G)I(G/C)(A/T)IATIAC(A/G)TA(C/T)TT(A/G)AACCA-3’) corresponding to the luxE gene were designed to amplify luxAB gene from DNA of Vibrio campbellii. The 2.5 kb PCR product was subcloned into a T-A cloning vector (pGEM-T) for analyzing and confirming the sequence of the amplified PCR products.

The identified luxAB was PCR amplified from V campbellii genomic DNA using primer 5’- AGGAAATCATATGAAATTTGGAA-3’ and 5’ -CCTTC AGGATCCGTTAAACGTTACG- 3’. The luxAB PCR fragment was then digested and cloned into pETl la vector at MCS using restriction sites Nde I and BamHl, generating pETl la-LuxAB plasmid. The arrangement of the luxAB gene within the pETl la-LuxAB plasmid is illustrated in Fig. 4. The resulting plasmid was transformed into competent cell XL-1 Blue. Grown colonies were investigated by colony- PCR, restriction cut-check, and sequencing, respectively.

The pETl la-LuxAB plasmid harboring wild type luxAB gene was transformed into E. coli BL21(DE3) strain. Single colony was inoculated in a ZY starter medium having 5 mM Na₂S0₄, 2 mM MgS0₄, 0.05% Glucose, IX MPS (1.25 M Na₂HP0 , 1.25 M KH₂P0₄, and 2.5 M NKUC1) and supplied with 50 pg/mL ampicillin. The inoculated ZY starter medium was subsequently incubated at 37 °C for 16 hours. Then, 1% ZY starter was inoculated in ZY rich media that consisted of 5 mM Na₂S0₄, 2 mM MgS0₄, IX 5052 (25% w/v glycerol, 10% w/v alpha-lactose and 2.5% w/v D-glucose), IX MPS and supplied with 50 pg/mL ampicillin. Cells were grown in 37 °C until ODeoo react 1.0. Then, temperature was changed to 25 °C in order to induce wild-type LuxAB expression for 16 hr. Finally, cell pellet was collected by high speed centrifuge at 8000 rpm for 8 min and stored in -80 °C for further processes.

Cell pellet was resuspended in 50 mM sodium phosphate buffer pH 7.0, containing 60 pM PMSF, 0.5 mM EDTA, and 1 mM DTT. Cells were disrupted by sonication at 75% amplitude for 15 min: 1.30 min of pulse on 5 seconds, pulse off 9 seconds x 10 times and maintained at temperature below 10 °C. Protein supernatant was centrifuged at 15000 rpm for 30 min to obtain a clear supernatant. The supernatant was added ammonium sulfate to 30% saturation and the suspension was centrifuged to discard the resulting protein pellet and keep the supernatant. The supernatant was further added ammonium sulfate to 60% saturation and then centrifuged. The resulting protein pellet which contained the desired LuxAB was resuspended in 50 mM sodium phosphate buffer of pH 7.0 before loading onto a DEAE sepharose column which was pre-equilibrated with 10 mM sodium phosphate buffer pH 6.2 containing 100 mM sodium chloride. A similar buffer was used for washing unbound protein on the DEAE sepharose column. Protein was eluted with a 2 L gradient from the buffer of 100 to 300 mM sodium chloride. Protein fractions were collected and analyzed for LuxAB by measuring absorbance at 280 nm and SDS-PAGE electrophoresis. LuxAB fractions were pooled and concentrated before changing buffer to 30 mM MOPs buffer of pH 7.0 using a G25 gel filtration column. Finally, LuxAB was collected and kept at -80 °C until used. Example 2

Sfp gene was cut from pUC57_Sfp with NdeVSmal restriction enzymes in CutSmart® buffer and gel-purified. pETDuet-1 plasmid was digested using restriction enzymes Ndel/EcoRV and ligated with the isolated Sfp. The Sfp-ligated plasmid was later transformed into competent cells E. coli XL-1 Blue. Grown colonies were investigated by colony-PCR, digested by restriction enzymes, and analyzed their DNA sequences. pETDuet-1 Sfp plasmid was extracted from the transformed cells for further incorporation of mmCARHis. Particularly, mmCARHis was PCR amplified with designed primers, 5’- CACCCCATGGGCCCGATC ACCCGTG-3’ and 5’-

GCCTGAATTCTTAATGATGATGATGATGATGCAGCAGACCCAGCAGACG-3’, containing Ncol cut-site on 5’ -end tagged with 6XHis and EcoRl cut-site on 3’ -end from pUC57_mmCAR. Ncol/ EcoRl mmCARHis was ligated into pETDuet-l_Sfp digested with the same restriction enzymes and transformed into E. coli XL-1 Blue. Grown colonies were investigated, grown and extracted for further usage. The arrangement of the CAR gene in relation to other genetic elements in the pETDUET-l-mmCARHis-Sfp is shown in Fig. 5. pETDuet-l mmCARHis Sfp was later transformed into E. coli BL21 (DE3). Single colony was inoculated into a starting LB medium and incubated at 37 °C for 16 hours. The starting medium was sub-cultured into an LB medium with 1% ratio of inoculum and incubated at 37 °C until OD6oo turned 0.5-1.0. Then, IPTG was added to obtain a final concentration of 0.5 mM and incubated further at 30 °C for 4 hours. Cells were pelleted and stored in -80 °C for further processes.

Carboxylic Acid Reductase from Mycobacterium marinum (mmCAR) was overexpressed and analyzed by SDS-PAGE with the results shown below in Fig. 10.

Cell pellet containing mmCARHis was resuspended in a lysis buffer (100 mM Tris-HCl, 10 mM Imidazole, pH 7.5) with 0.1 mM PMSF and exposed to ultrasonication at 60% amplitude for 10 minutes with 5 seconds on and 9 seconds off. Cell lysate was centrifuged, and the supernatant was loaded onto a Nickel-affinity column for purification. A washing buffer used contained 100 mM Tris-HCl and 10 mM Imidazole while an elution buffer comprised 100 mM Tris-HCl and 500 mM Imidazole. Fractions were analyzed by SDS-PAGE. Then the fractions containing purified CARHis (127.8 kDa) were pooled, concentrated and kept at -80 °C for further usage. Example 3

The Ci reductase ( Ci-hpah ) gene used in the present disclosure was isolated from a strain of Acinetobacter baumannii. Forward primer 5’-

ATGGA(A/G)AA(T/C)ACIGTI(T/C)T(A/G/T/C)AA(T/C)(T/C)T-3’corresponding to residues 1-8 of C2 (a neighboring gene of Ci) and reverse primer 5’- GCCATIGG(A/G)TC(A/G/T)AT(A/T/G/C)AC(T/C)TC(T/C)TT-3’ corresponding to residues 10-17 of Ci were designed to amplify full-length gene of C2-hpah and Ci-hpah from gDNA of Acinetobacter baumannii. The 1.5 kb PCR product of the Ci reductase was further sub-cloned into a cloning vector and analyzed for its sequence.

The full-length Ci reductase was further PCR amplified from A. baumannii genomic DNA using primers 5’-ATATGAACCATATGAATCAATTAA-3’ and 5’- ATGAAGGGTGGATCCCCTTCATTT-3’. The Ci reductase PCR fragment was then digested and cloned into pETl la vector at MCS restriction sites Nde I and BamHl , generating pETl la- Ci plasmid. The arrangement of the Ci reductase gene within the plasmid is illustrated in Fig. 7. The resulting plasmid was transformed into competent cell XL-1 Blue. Grown colonies were investigated by colony-PCR, restriction cut-check, and sequencing, respectively.

A variant Ci reductase as the sequence forth in the SEQ ID. NO. 2 was constructed using the PCR protocol and primers 5’ - AAT AC AGCT ATT GT AAGG AAAG AAGT GATT G AC-3’ and 5’ -GTC AATC ACTTCTTTCCTTAC AATAGCTGTATT-3’ to amplify the Ci wild-type gene in pETl la plasmid to generate a single site mutation. Dpnl was added to the resulting PCR products to remove the template plasmid. pETl la harboring the mutated Ci reductase gene was transformed into E. coli BL21(DE3) cells. Single colony was inoculated into an LB starter medium supplied with 50 pg/mL ampicillin. The LB starter was incubated at 37 °C for 16 hours. Then, 1% of the LB starter was inoculated into an LB medium supplied with 50 pg/mL ampicillin. Cells were grown at 37 °C until OD₆oo reached 1.0. The temperature was changed to 25 °C and added 0.5 mM IPTG in order to induce protein expression for 16 hours. Finally, cell pellet was collected by high speed centrifuge at 8000 rpm for 8 min.

Cell pellet was resuspended in 50 mM sodium phosphate buffer pH 7.0, containing 60 pM PMSF, 0.5 mM EDTA, and 1 mM DTT. Cells were disrupted by sonication at 75% amplitude for 15 min:1.30 min of pulse on 5 seconds, pulse off 9 seconds x 10 times and kept at a temperature below 10 °C. Protein supernatant was separated by high speed centrifugation at 15000 rpm for 30 min. DNA and DNA binding proteins were removed by 1% (w/v) polyethyleneimine (PEI). Supernatant was collected by high speed centrifugation at 15000 rpm for 30 min. Impurities were removed by 0-20% Ammonium sulfate precipitation. Supernatant was then collected by high speed centrifugation at 15000 rpm for 30 min before being precipitated with 20-80% ammonium sulfate. Protein pellet was collected by high speed centrifugation at 15000 rpm for 30 min. Protein pellet was resuspended in 10 mM sodium phosphate buffer pH 7.0 containing 1 mM DTT and 0.5 mM EDTA before loading onto a DEAE sepharose column that was pre-equilibrated with 10 mM sodium phosphate buffer pH 7.0 consisting of 1 mM DTT and 0.5 mM EDTA. Sodium phosphate buffer (10 mM) pH 7.0 containing 1 mM DTT and 0.5 mM EDTA was used for washing unbound proteins from the DEAE sepharose column. Protein was eluted with a 2 L gradient from 0 to 250 mM sodium chloride in 10 mM sodium phosphate buffer pH 7.0 containing 1 mM DTT and 0.5 mM EDTA. Protein fractions were collected and analyzed for variant Ci reductase by measuring absorbance at 280 nm and 458 nm and using SDS-PAGE analysis. Variant Ci reductase fractions were pooled, concentrated and precipitated with 80% ammonium sulfate before loading onto a phenyl sepharose column that was pre-equilibrated with 15% (w/v) ammonium sulfate in 50 mM sodium phosphate buffer pH 7.0 containing 1 mM DTT and 0.5 mM EDTA. A 50 mM sodium phosphate buffer pH 7.0 containing 15% (w/v) ammonium sulfate in 1 mM DTT and 0.5 mM EDTA was used for washing unbound proteins from the phenyl sepharose column. Proteins were eluted with a 1 L gradient from 15% (w/v) ammonium sulfate and 0% (v/v) ethylene glycol to 15% (w/v) ammonium sulfate and 40% (v/v) ethylene glycol in 50 mM sodium phosphate buffer pH 7.0 containing 1 mM DTT and 0.5 mM EDTA. Protein fractions were collected and analyzed for variant Ci reductase by measuring absorbance at 280 nm and 458 nm, and using SDS-PAGE analysis. Variant Ci reductase fractions were pooled, concentrated and changed to 30 mM MOPs buffer pH 7.0 using a G25 gel filtration column. Finally, the variant Ci reductase was collected and stored at -80 °C until being used.

Example 4

Light emission from the bacterial luciferase (LuxAB) reaction was assayed in the presence of CAR and the variant Ci reductase. The variant Ci reductase and CAR were used for generating the reduced FMN and aldehyde, respectively, serving as substrates of the light-emitting reaction catalyzed by the luciferase. The intensity of light emission was monitored using a luminometer. Assays were performed in 50 mM sodium phosphate buffer pH 7.0 containing 250 mM tetradecanoic acid, 500 mM ATP, 5 mM MgSC>4, 80 mM NADPH, 100 mM NADH, 25 mM FMN, 0.008 mM variant Ci reductase, 3.35 mM LuxAB, 0.383 mM CAR. The reaction was started by pre-incubating 150 pL of 50 mM sodium phosphate buffer pH7.0 containing LuxAB, variant Ci reductase, CAR, NADPH, ATP, MgS0₄, and tetradecanoic acid at 30 °C for 1, 5, 10, and 20 min and followed by injecting 150 pL of 50 mM sodium phosphate buffer pH 7.0 containing FMN and NADH. Total photon emission was measured for 10 seconds and calculated for total light intensity by integration the peak area of the emission trace. The chemical solutions used in the assay reaction were prepared as described below:

1. 50 mM sodium phosphate buffer pH 7.0: dissolve 13.8 g of NaH2P04.H20 in 900 mL distilled water, adjust pH to 7.0, and then adjust a volume to 1000 mL.

2. Tetradecanoic acid: make up as 50 mM tetradecanoic acid in CH3OH.

3. ATP solution: make up as 100 mM ATP in 50 mM sodium phosphate buffer pH 7.0.

4. MgSC>4 solution: make up as 450 mM MgSC>4 in distilled water.

5. NADPH solution: make up as 4 mM NADPH in 10 mM Tris-Base buffer.

6. NADH solution: make up as 4 mM NADH in 10 mM Tris-Base buffer.

7. FMN solution: make up as 2 mM FMN in 50 mM sodium phosphate buffer pH 7.0.

8. Variant Ci reductase solution from Acinetobacter baumannii : freshly prepare a solution of 400 nM of variant Ci reductase in 50 mM sodium phosphate buffer pH 7.0, store at 4 °C and use within a day.

9. LuxAB solution from Vibrio campbellii: freshly prepare a solution of 100 mM of LuxAB enzyme in 50 mM sodium phosphate buffer pH 7.0, store at 4 °C and use within a day.

10. CAR solution from Mycobacterium marinum : freshly prepare 380 mM of CAR enzyme in 50 mM sodium phosphate buffer pH 7.0, store at 4 °C and use within a day.

The results of the assay conducted are illustrated in Fig. 8. Specifically, coupled reactions of carboxylic acid reductase (mmCAR), Ci reductase, and bacterial luciferase (LuxAB) emitted light which was detected using a luminometer. The data from the coupled assays were demonstrated in Fig. 8. The bars in the chart respectively represent a complete reaction set (CAR-Bac Lux), a control reaction without ATP and a control reaction without NADPH.

Example 5

E. coli BL21 (DE3) strain carrying pET17b-LuxCDE was used to inoculate a seed culture in a ZY starter medium and incubated in a shaker set at 220 rpm, 37 °C overnight. A 1% volume of starter was inoculated into 650 mL of ZY autoinduction medium and incubated in a shaker set at 220 rpm, 37 °C overnight. When OD₆oo reached 0.8, the culture temperature was changed to either 25 °C or 16 °C for induction of enzyme expression for 16 hours. SDS-PAGE was carried out for detection of recombinant LuxCDE, LuxC, LuxD and LuxE proteins (Fig. 9).

Only LuxC (MW, 55 kDa) and LuxE (MW, 43 kDa) could be overexpressed in E. coli. The difference between protein expression level of induced cells and non-induced cells at MW around 55 kDa and 43 kDa could be noted. These are likely expression of LuxC and LuxE components. Inventors of the present disclosure could not observe any expression of LuxD (MW, 34 kDa) in E. coli because there was no difference between protein expression level of induced and non-induced cells at MW around 34 kDa (Fig. 9).

The harvested cells (50 g, from 8 L of cultures) were resuspended in 40 mL lysis buffer and disrupted using ultra-sonication. Cells slurry was separated into cell free lysate and cell debris by centrifugation at 12,000 rpm for 30 min at 4 °C. The resulted cell free lysate was mixed with 50 mM NaH₂P0₄ pH 7.0 and precipitated with 0.1% PEI to remove genomic DNA. The insoluble debris was removed by centrifugation at 12,000 rpm for 30 min at 4 °C, and the supernatant was applied onto a DEAE column equilibrated with 50 mM NaH₂P0₄ pH 7.0 and washed with 50 mM NaH₂P0₄ pH 7.0 for 5 column volume. The LuxC protein bound to DEAE resin was eluted with a gradient of 30-300 mM NaCl in 50 mM NaH₂P0₄ pH 7.0. SDS-PAGE analysis was subsequently carried out for detection of recombinant LuxC protein. To remove the protein impurities, DEAE fractions containing LuxC was pooled, concentrated, and loaded onto a phenyl sepharose column equilibrated with 15% (NH₄) S0₄ in 50 mM NaH₂P0₄ pH 7.0. The column was washed with 50 mM NaH₂P0₄ pH 7.0 for 5 column volume. The LuxC protein bound to phenyl sepharose resin was eluted with a gradient of 0-40% ethylene glycol (v/v) in 50 mM NaH₂P0₄ pH 7.0. SDS-PAGE was subsequently carried out for detection of recombinant LuxC protein.

Example 6

Activity of the purified LuxC protein was monitored by detecting formation of aldehyde product using gas chromatography. The purified LuxC in 500 uL of 50 mM sodium phosphate buffer pH 7.0 containing 200 mM NaCl and 30 mM DTT was incubated at 25 °C for 1 hour with 100 mM NADPH and 12 mM tetradecanoyl-CoA. The reaction mixture was later terminated and extracted for any product formed by addition of ethyl acetate. The organic phase was then subjected to gas chromatography analysis in comparison with the standard Myristaldehyde. The purified LuxC did not show any aldehyde product forming activities (Fig. 10).

Example 7

Cells containing overexpressed LuxE (50 g, from 4 L of cultures) were resuspended in 40 mL lysis buffer and disrupted using ultrasonication. Cells slurry was separated into cell free lysate and cell debris through centrifugation at 12,000 rpm for 30 min at 4 °C. The resulting cell free lysate was mixed with 100 mM NaEbPC^ pH 7.0 and precipitated with 20-60% (NH₄)2S0₄. The insoluble protein was centrifuged at 12,000 rpm for 30 min at 4 °C, and the resulting protein pellet was gently resuspended in 30 mL 100 mM NaH2P0₄ pH 7.0. The soluble protein was then loaded onto a DEAE column equilibrated with 50 mM NaCl in 100 mM NaH₂P0₄ pH 7.0 and washed with 50 mM NaCl in 100 mM NaH2P0₄ pH 7.0 for 5 column volume. The LuxE protein bound to DEAE resin was eluted with a gradient of 50-300 mM NaCl in 100 mM NaH2P0₄ pH 7.0. SDS-PAGE was carried out for detection of recombinant LuxE protein. DEAE fractions containing LuxE was pooled, concentrated, and loaded onto a second column, a phenyl sepharose equilibrated with 5% (NH₄)2S0₄ in 100 mM NaH₂P0₄ pH 7.0. The column was washed with 5% (NH₄)₂S0₄ in 100 mM NaH2P0₄ pH 7.0 for 5 column volume. The LuxE protein bounded onto phenyl sepharose resin was eluted with a gradient of 20-70% ethylene glycol (v/v) in 100 mM NaH₂P0₄ pH 7.0. SDS-PAGE was carried out for detection of recombinant LuxE protein.

Example 8

The activity of purified LuxE protein was tested using an enzyme coupled to a firefly luciferase assay to detect consumption of ATP. Active LuxE should demonstrate an activity to utilize ATP in the presence of fatty acid. Particularly, LuxE protein in 50 pL of 50 mM NaH₂P0₄ buffer pH 7.0 was incubated with all substrates 500 mM ATP, 250 mM D-luciferin, 200 mM CoA, 30 mM MgS0₄, and 12 mM tetradecanoic acid at 25 °C for 30 min. A constant amount of firefly luciferase (800 ng) was added to the assay mixture at the end of reaction and light intensity generated from the reaction was measured for determining the activity of LuxE. LuxE was purified using two steps chromatography, DEAE and phenyl sepharose. However, only the freshly purified enzyme from the first column (DEAE) showed activity in in vitro assay. However, the purified LuxE from the first column is not stable and loss activity after storage at -80 °C for 1 week. Purified LuxE from phenyl sepharose showed no activity in in vitro assay (data not shown). These results indicate that LuxE could not be obtained as an active purified enzyme form.

Example 9

Ability of BNAH to prolong light generated was investigated using coupled reactions of luciferase and Ci reductase. BNAH or NADH was used as a reductant by Ci reductase to generate and supply reduced FMN for the luciferase reaction. Reactions consisted of 20 mM FMN, 40 mM dodecanal, 2 mM purified LuxAB, 2 mM Ci reductase and 100 mM NADH or 100 mM BNAH. The reaction was initiated by adding BNAH or NADH. The bioluminescence signal was detected by a spectrofluorometer using bio/chemi-luminescence mode. The results acquired are shown in Fig. 12. The present disclosure may be embodied in other specific forms without departing from its structures, methods, or other essential characteristics as broadly described herein and claimed hereinafter. The described embodiments are to be considered in all respects only as illustrative, and not restrictive. The scope of the disclosure is, therefore, indicated by the appended claims, rather than by the foregoing description. All changes that come within the meaning and range of equivalency of the claims are to be embraced within their scope.

Claims

1. A luciferase reporter system applicable in a liquid medium having oxidized flavins and carboxylic acids comprising:

a recombinant carboxylic reductase operable to convert one or more carboxylic acids into one or more fatty aldehydes;

a catalytic reagent configured to generate reduced flavins from the oxidized flavins in the presence of reduced nicotinamide adenine dinucleotides (NADH) or reduced 1 -benzyl- 1,4- dihydronicotinamides (BNAH);

a recombinant luciferase complex capable of yielding the carboxylic acids and emitting photons in the form of detectable light by reacting the fatty aldehydes with the reduced flavins, wherein the light is detected to compute a light emission profile being a function of detected light intensity over time.

2. The reporter system of claim 1, wherein the recombinant carboxylic reductase originated from Mycobacterium marinum, Nocardia iowensis, or Rhodococcus sp.

3. The reporter system of claim 1 , wherein the catalytic reagent is any one or combination of a variant-type recombinant Ci reductase, a wild-type recombinant Ci reductase, and recombinant LuxG reductase.

4. The reporter system of claim 3, wherein the variant-type recombinant Ci reductase is expressed from a recombinant DNA sequence as setting forth in SEQ ID NO. 2.

5. The reporter system of claim 3, wherein the variant-type recombinant Ci reductase has a melting temperature of 52 °C and k_c K_m value of 5.17 plVT's^"1.

6. The reporter system of claim 1, wherein the recombinant luciferase complex is a fusion protein comprising a LuxA peptide and a LuxB peptide joined by a peptide linker having an amino acids sequence of VINIFEKERD.

7. The reporter system of claim 4, wherein the LuxA and LuxB peptides are originated from Vibrio campbellii or Photobacterium leiognathi.

8. The reporter system of claim 1, wherein the presence of the BNAH provides the computed light emission profile with relatively higher detected light intensity over a prolong period compared to the presence of the NADH in the system.

9. A method of determining regulatory effect of a genetic component towards protein expression in host cells using a luciferase reporter system comprising:

providing a liquid medium having a plurality of recombinant luciferase complex, oxidized flavins and carboxylic acids, the amount of the recombinant luciferase complex present in the liquid medium corresponding to the regulatory effect of the genetic component; converting the carboxylic acids into fatty aldehydes in situ using a plurality of recombinant carboxylic reductase;

generating reduced flavins from the oxidized flavins through a plurality of catalytic agents in the presence of reduced nicotinamide adenine dinucleotides (NADH) or reduced 1- benzyl-1 ,4-dihydronicotinamides (BNAH);

reacting the luciferase complex with the reduced flavin and fatty aldehyde to yield carboxylic acids and emit photons in the form of detectable light thereby;

detecting the light to compute a light emission profile being a function of intensity of the detected; and

determining regulatory effect of the genetic component based upon the computed light emission profile.

10. The method of claim 9, wherein the recombinant carboxylic reductase originated from Mycobacterium marinum, Nocardia iowensis, or Rhodococcus sp.

11. The method of claim 9, wherein the catalytic reagent is any one or combination of a variant-type recombinant variant Ci reductase, a wild-type recombinant Ci reductase, and recombinant LuxG reductase.

12. The method of claim 11, wherein the variant-type recombinant Ci reductase is expressed from a recombinant DNA sequence as setting forth in SEQ ID NO. 2.

13. The method of claim 9, wherein the variant-type recombinant Ci reductase has a melting temperature of 52 °C and h Km value of 5.17 pM V.

14. The method of claim 9, wherein the recombinant luciferase complex is a fusion protein comprising a LuxA peptide and a LuxB peptide joined by a peptide linker having an amino acids sequence of VINIFEKERD.

15. The method of claim 9, wherein the presence of the BNAH provides the computed light emission profile with relatively higher detected light intensity over a prolong period compared to the presence of the NADH in the system.