WO2019209035A1 - Pharmaceutical composition for prevention or treatment of flavivirus infectious disease - Google Patents
Pharmaceutical composition for prevention or treatment of flavivirus infectious disease Download PDFInfo
- Publication number
- WO2019209035A1 WO2019209035A1 PCT/KR2019/004974 KR2019004974W WO2019209035A1 WO 2019209035 A1 WO2019209035 A1 WO 2019209035A1 KR 2019004974 W KR2019004974 W KR 2019004974W WO 2019209035 A1 WO2019209035 A1 WO 2019209035A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- virus
- sulfate
- flavivirus
- composition
- dengue
- Prior art date
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
- A61K31/47—Quinolines; Isoquinolines
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7008—Compounds having an amino group directly attached to a carbon atom of the saccharide radical, e.g. D-galactosamine, ranimustine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7028—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages
- A61K31/7034—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin
- A61K31/7036—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin having at least one amino group directly attached to the carbocyclic ring, e.g. streptomycin, gentamycin, amikacin, validamycin, fortimicins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Definitions
- the present invention relates to a pharmaceutical composition for preventing or treating flavivirus infection.
- Flaviviruses are small, coated, enveloped positive-strand RNA viruses, some of which are or are likely to present or threaten the health of humans worldwide today or in the future. Yellow fever viruses, for example, have been the cause of epidemics in certain jungles in sub-Saharan Africa or in parts of South Africa. Many yellow fever infections are not serious, but they can lead to serious, life-threatening illnesses.
- the condition of the disease has two phases. The early acute phase is characterized by high fever, chills, headache, back pain, myalgia, anorexia, nausea, and vomiting. After three to four days, these symptoms disappear. In some patients, these symptoms recur when the disease enters the so-called toxic phase.
- Dengue (DEN) viruses are another example of flaviviruses.
- the dengue virus is transmitted to humans by mosquitoes (primarily Aedes aegypti) and is causing an increasingly serious public health problem worldwide.
- About 50 out of 100 million seahorses are infected with the dengue virus
- four antigenic dengue viruses (Dengue types 1-4) are spread throughout the Caribbean, Asia and the Americas.
- Hemorrhagic Fever / Dengue Shock Syndrome (DHF / DSS)] is an immunopathological disease that occurs in individuals sequentially infected by DENs of different antigenic types: more than 3.6 million dengue hemorrahagic fevers and 58,000 people with DHF.
- Flaviviruses including yellow fever and dengue viruses, have two important biological characteristics responsible for the induction of disease in humans and animals.
- One of these two features is neurotropism, which refers to the tendency of a virus to infect and infect the host's nervous system.
- Nerve-friendly flavivirus infections can cause infection and injury of the brain and spinal cord (ie, encephalitis), unconsciousness, paralysis, and convulsions.
- a second feature of flavivirus infection is visceral organ affinity, ie the virus tends to invade and infect vital visceral organs including the liver, kidneys and heart.
- Visceral organ-friendly flavivirus infections result in infection and damage of the liver (hepatitis), kidney (nephritis), and heart muscle (myocarditis), preventing these organs from functioning normally. Neural tissue affinity and visceral organ affinity are judged to be distinct features of Flavivirus.
- flaviviruses are basically neuronal affinity (eg West Nile virus), others are visceral organ affinity (eg yellow fever virus and dengue virus), and others exhibit both properties. (Eg, Kyasanur Forest Disease Virus). However, both neural affinity and visceral organ affinity are present to some extent in all flaviviruses. Interactions between neural tissue affinity and visceral organ affinity appear to occur in the host because infection of the visceral organ occurs prior to the attack of the central nervous system. Neuronal affinity thus depends on the virus's ability to replicate in the extraneous organs (intestines). Such extraneural replication causes viremia and this viremia attacks the brain and spinal cord.
- a pharmaceutical composition for preventing or treating flavivirus infection is provided.
- the flavivirus infection is sanction virus ( acea virus), Aroa virus (Aroa virus), Bagaga virus (Bagaza virus), Ringzi virus (Banzi virus), Bouboui virus (Bouboui virus), Bucarasa bat virus, Cacipacore virus, Carey Island virus, Cowbone Ridge virus, Dakar bat virus, Dengue virus (Dengue virus, Edge Hill virus, Entebbe bat virus, Gadgets Gully virus, Ilheus virus, Israel turkey meningoencephalomyelitis virus, Japanese encephalitis virus, Jugra virus, Jutiapa virus, Kadam virus, Kedogai Kedougou virus, Kokobera virus, Kotango virus, Kyasanur Forest disease virus, Langat virus, Louping ill virus, Meaban virus, Modoc virus, Montana myotis leukoencephalitis virus, Murray Valley encephalitis virus, Ntaya virus , Omsk hemorrhagic fever virus, Phnom Penh bat virus, Powassan virus
- composition of 1 above, wherein the flavivirus infection is a dengue virus induced infection.
- composition 1 wherein the composition is tobramycin, trifluoroperazine 2HCl, amikacin hydrate, hydroxychloroquine sulfate, thiolidazine HCl, dihydrostreptomycin sulfate, gentamicin sulfate, netylmycin sulfate, capp At least one of leumycin sulfate, paromomycin sulfate, resminostat, montelukast, norfloxacin, nedaplatin, bleomycin, nystatin, cephalosin, mycafungin sodium, epavirenz and miltopesin; Or at least one of pharmaceutically acceptable salts thereof.
- the flavivirus is issus virus (AN), Aroa virus (Aroa virus), Bagaza virus (Bagaza virus), Ringzi virus (Banzi virus), Bouboui virus, Boo Carrasa bat virus, Cascipacore virus, Carey Island virus, Cowbone Ridge virus, Dakar bat virus, Dengue virus ( Dengue virus, Edge Hill virus, Entebbe bat virus, Gadgets Gully virus, Ilheus virus, Israel turkey meningoencephalomyelitis virus ), Japanese encephalitis virus, Jugra virus, Jutiapa virus, Kadam virus, Kedog virus ugou virus, Kokobera virus, Kotango virus, Kyasanur Forest disease virus, Langat virus, Louping ill virus, Miban virus (Meaban virus), Modoc virus, Montana myotis leukoencephalitis virus, Murray Valley encephalitis virus, Ntaya virus, Om Omsk hemorrhagic fever virus, Phnom Penh bat virus, Powassan virus
- composition of claim 5, wherein the flavivirus is a dengue virus.
- the composition is tobramycin, trifluoroperazine 2HCl, amikacin hydrate, hydroxychloroquine sulfate, thiolidazine HCl, dihydrostreptomycin sulfate, gentamicin sulfate, netylmycin sulfate, capp At least one of leumycin sulfate, paromomycin sulfate, resminostat, montelukast, norfloxacin, nedaplatin, bleomycin, nystatin, cephalosin, mycafungin sodium, epavirenz and miltopesin; Or at least one of pharmaceutically acceptable salts thereof.
- composition of the present invention is excellent in inhibiting the proliferation of viruses of the genus Flaviviruses and increasing the survival rate for these derived infections.
- Figure 4 shows the dengue virus helicase activity inhibitory effect.
- Figure 5 shows the effect of reducing dengue virus.
- Figure 7 shows the effect of inhibiting dengue virus growth and increase the survival rate of infection.
- the present invention relates to a pharmaceutical composition for preventing or treating flavivirus infection.
- Flavivirus is a genus of the togavirus family and has a common antigen in the genus due to its cohesion of erythrocytes.
- flavivirus refers to any species of virus known in the art to be included in the genus without limitation, and flavivirus infection refers to a disease or carrier condition caused by infection of the virus.
- the composition of the present invention can exhibit a killing, growth inhibitory effect on various species of the Flavivirus genus.
- Flavivirus genus For example, aba virus, Aroa virus, Bagaza virus, Banzi virus, Bouboui virus, Bucarasa bat virus , Cacipacore virus, Carey Island virus, Cowbone Ridge virus, Dakar bat virus, Dengue virus, Edge Hill virus Hill virus, Entebbe bat virus, Gadgets Gully virus, Ilheus virus, Israel turkey meningoencephalomyelitis virus, Japanese encephalitis virus ), Jugra virus, Jutiapa virus, Kadam virus, Kedougou virus, Cocovera virus kobera virus, Kotango virus, Kyasanur Forest disease virus, Langat virus, Louping ill virus, Meaban virus, blasphemy virus ( Modoc virus, Montana myotis leukoencephalitis virus, Murray Valley encephalitis virus, Ntaya virus, Omsk hemorrhagic fever virus
- Louis Encephalitis Virus (Saint Louis encephalitis virus), Sal Vieja virus, San Perlita virus, Saumarez leaf virus (Sauma) rez Reef virus, Sepik virus, Tembusu virus, Tick-borne encephalitis virus, Tyuleniy virus, Kenya S virus, Excellent Usutu virus, Wesselsbron virus, West Nile virus, Yaounde virus, Yellow fever virus, Yokose virus, Zika Virus (Zika virus), and the like, specifically, dengue virus, and more specifically, dengue virus serotype2, but are not limited thereto.
- the pharmaceutical composition of the present invention is gentamicin sulfate (Gentamicin Sulfate), netylmicin (Netilmicin), Tobramycin (Pabraomycin), Paromomycin (Amikacin), Capreomycin (Capreomycin), Triple Trifluoperazine, Dihydrostreptomycin, Hydrochlorochloroquine, Thiolidazine HCl, Efavirenz, Miltefosine, Nystatin, Nystatin, Micafungin, Bleomycin, Resminostat, Monteukast, Norfloxacin, Nedaplatin And at least one of cephalothin; Or at least one of their pharmaceutically acceptable salts.
- gentamicin sulfate (Gentamicin Sulfate), netylmicin (Netilmicin), tobramycin (Tobramycin), Paromomycin (Aromikacin), Capreomycin (Capreomycin), tripleru Trifluoperazine, Dihydrostreptomycin, Hydroxychloroquine, Thioridazine HCl, Resminostat, Montelukast, Norfloxacin and Norfloxacin At least one of daplatin; Or at least one of pharmaceutically acceptable salts thereof.
- tobramycin trifluoroperazine 2HCl, amikacin hydrate, hydroxychloroquine sulfate, thiolidazine HCl, dihydrostreptomycin sulfate, gentamicin sulfate, netylmycin sulfate, capreomycin
- sulfate paromomycin sulfate, resminostat, montelukast, norfloxacin, nedaplatin, bleomycin, nystatin, cephalosin, mycafungin sodium, epavirenz and mittefosin; Or at least one of pharmaceutically acceptable salts thereof.
- Pharmaceutically acceptable salts include salts of acidic or basic groups which may be present in each of the above drugs (compounds).
- pharmaceutically acceptable salts may include, but are not limited to, sodium salts, calcium salts, potassium salts, hydrochlorides, sulfates, hydrates, and the like, and may be prepared through methods for preparing salts known in the art. .
- Such substances may act as enzyme inhibitors that inhibit the activity of helicase and RNA dependent RNA polymerase (RdRp), which are enzymes required for viral replication, for example, and may exhibit efficacy against flavivirus infection.
- RdRp RNA dependent RNA polymerase
- RNA-dependent RNA polymerase (RdRp) in the flavivirus genome is known to have a very high genetic preservation rate among various RNA virus families including Flavivirus at the gene level, and also has a high degree of conservation at the protein level (polypeptide motif level). Viruses. 2018 Feb; 10 (2): 76.),
- the pharmaceutical compositions of the present invention may show efficacy against various species of the genus Flavivirus.
- the amino acid sequences of the enzyme active sites are very similarly conserved in the flaviviruses, and these sequences are known to contribute to the recognition of viral RNA. It is known to have similar functions (contributing to hydrogen bonding, hydrophobic interactions, etc. with adjacent specific sequences) and to enzymatic activity. For example, the sites where dengue virus helicases and zika virus helicases bind to ssRNA substrates have been found to be very similar (12904-12920 Nucleic Acids Research, 2017, Vol. 45, No. 22).
- the pharmaceutical composition of the present invention may be formulated containing the above substances.
- compositions of the present invention may be formulated for delivery via any route of administration.
- Route of administration can refer to any route of administration known in the art including, but not limited to, aerosol, nasal, oral, transmucosal, transdermal, parenteral or intestine.
- the pharmaceutical composition of the present invention may also contain any pharmaceutically acceptable carrier.
- a "pharmaceutically acceptable carrier” is a pharmaceutical composition involved in the transport or transport of a compound of interest from one tissue, organ or part of the body to another tissue, organ or part of the body. It refers to acceptable materials, compositions or vehicles.
- the carrier may be a liquid or solid filler, diluent, excipient, solvent or encapsulating material or combinations thereof.
- Each component of the carrier must be “pharmaceutically acceptable", ie compatible with the other ingredients of the formulation. It should also be suitable for use when in contact with any tissue or organ to which it can be contacted, which should not involve the risk of any other complications that are too great than toxic, irritant, allergic reactions, immunogenicity or its therapeutic advantages. do.
- composition of the present invention may be administered to an individual who is trying to prevent a flavivirus infection or to an individual suffering from a flavivirus infection.
- the subject may be a mammal, including a human, and specifically a human.
- the pharmaceutical composition of the present invention may be delivered in a therapeutically effective amount.
- the exact therapeutically effective amount is that amount of the composition that produces the most effective result for therapeutic efficacy in a given subject. This amount includes the characteristics of the therapeutic compound (including activity, pharmacokinetics, pharmacodynamics and bioactivity), the physiological condition of the subject (age, sex, disease type and stage, general physical health, response to a given dosage and type of medicament) ), The nature of the pharmaceutically acceptable carrier or carriers in the formulation, and the route of administration, and will depend upon a number of factors. One skilled in the clinical and pharmacological arts will determine the therapeutically effective amount through routine experimentation, for example by monitoring the subject's response to administration of the compound and adjusting the dosage accordingly.
- the present invention also relates to a composition for inhibiting or killing flavivirus growth.
- composition of the present invention is a gentamicin sulfate (Gentamicin Sulfate), netylmicin (Netilmicin), Tobramycin (Pabraomycin), Paromomycin (Amikacin), Capreomycin (Capreomycin), Trifluoropera Trifluoperazine, Dihydrostreptomycin, Hydroxychloroquine, Thioridazine HCl, Efavirenz, Miltefosine, Nystatin, Nystatin (Micafungin), bleomycin, lesminostat, montelukast, norfloxacin, nedaplatin And at least one of cephalothin; Or at least one of their pharmaceutically acceptable salts.
- gentamicin sulfate (Gentamicin Sulfate), netylmicin (Netilmicin), tobramycin (Tobramycin), Paromomycin (Aromikacin), Capreomycin (Capreomycin), tripleru Trifluoperazine, Dihydrostreptomycin, Hydroxychloroquine, Thioridazine HCl, Resminostat, Montelukast, Norfloxacin and Norfloxacin At least one of daplatin; Or at least one of pharmaceutically acceptable salts thereof.
- tobramycin trifluoroperazine 2HCl, amikacin hydrate, hydroxychloroquine sulfate, thiolidazine HCl, dihydrostreptomycin sulfate, gentamicin sulfate, netylmycin sulfate, capreomycin
- sulfate paromomycin sulfate, resminostat, montelukast, norfloxacin, nedaplatin, bleomycin, nystatin, cephalosin, mycafungin sodium, epavirenz and mittefosin; Or at least one of pharmaceutically acceptable salts thereof.
- compositions of the present invention can inhibit or kill the growth of various species of the Flavivirus genus.
- Flavivirus genus For example, aba virus, Aroa virus, Bagaza virus, Banzi virus, Bouboui virus, Bucarasa bat virus , Cacipacore virus, Carey Island virus, Cowbone Ridge virus, Dakar bat virus, Dengue virus, Edge Hill virus Hill virus, Entebbe bat virus, Gadgets Gully virus, Ilheus virus, Israel turkey meningoencephalomyelitis virus, Japanese encephalitis virus ), Jugra virus, Jutiapa virus, Kadam virus, Kedougou virus, Cocovera virus kobera virus, Kotango virus, Kyasanur Forest disease virus, Langat virus, Louping ill virus, Meaban virus, blasphemy virus ( Modoc virus, Montana myotis leukoencephalitis virus, Murray Valley encephalitis virus, Ntaya virus, Omsk hemorrhagic fever virus ), Phnom Pen
- Louis Encephalitis Virus (Saint Louis encephalitis virus), Sal Vieja virus, San Perlita virus, Saumarez leaf virus (Sauma) rez Reef virus, Sepik virus, Tembusu virus, Tick-borne encephalitis virus, Tyuleniy virus, Kenya S virus, Excellent Usutu virus, Wesselsbron virus, West Nile virus, Yaounde virus, Yellow fever virus, Yokose virus, Zika Virus (Zika virus), and the like, specifically, dengue virus, and more specifically, dengue virus serotype2, but are not limited thereto.
- composition of the present invention may be formulated as the pharmaceutical composition illustrated above, but is not limited thereto.
- the present invention is a gentamicin sulfate (Gentamicin Sulfate), netylmicin (Netilmicin), Tobramycin (Tobramycin), Paromomycin (Aromikacin), Capreomycin (Capreomycin), Trifluoropera Trifluoperazine, Dihydrostreptomycin, Hydroxychloroquine, Thioridazine HCl, Efavirenz, Miltefosine, Nystatin, Nystatin (Micafungin), bleomycin, lesminostat, montelukast, norfloxacin, nedaplatin And at least one of cephalothin; Or at least one of pharmaceutically acceptable salts thereof; and relates to a use for the preparation of a composition for preventing or treating flavivirus infection.
- gentamicin sulfate (Gentamicin Sulfate), netylmicin (Netilmicin), tobramycin (Tobramycin), Paromomycin (Aromikacin), Capreomycin (Capreomycin), tripleru Trifluoperazine, Dihydrostreptomycin, Hydroxychloroquine, Thioridazine HCl, Resminostat, Montelukast, Norfloxacin and Norfloxacin At least one of daplatin; Or at least one of their pharmaceutically acceptable salts.
- tobramycin trifluoroperazine 2HCl, amikacin hydrate, hydroxychloroquine sulfate, thiolidazine HCl, dihydrostreptomycin sulfate, gentamicin sulfate, netylmycin sulfate, capreomycin
- sulfate paromomycin sulfate, resminostat, montelukast, norfloxacin, nedaplatin, bleomycin, nystatin, cephalosin, mycafungin sodium, epavirenz and mittefosin; Or at least one of their pharmaceutically acceptable salts.
- Flavivirus infections in the use of the present invention may be caused by the aforementioned viruses.
- the compounds (drugs) or pharmaceutically acceptable salts thereof may exhibit excellent flavivirus growth inhibition and killing effects, and thus may be used in the preparation of a composition for preventing or treating flavivirus infection.
- the present invention is a gentamicin sulfate (Gentamicin Sulfate), netylmicin (Netilmicin), Tobramycin (Tobramycin), Paromomycin (Aromikacin), Capreomycin (Capreomycin), Trifluoropera Trifluoperazine, Dihydrostreptomycin, Hydroxychloroquine, Thioridazine HCl, Efavirenz, Miltefosine, Nystatin, Nystatin (Micafungin), bleomycin, lesminostat, montelukast, norfloxacin, nedaplatin And at least one of cephalothin; Or at least one of pharmaceutically acceptable salts thereof; and a method for preventing or treating flavivirus infection.
- gentamicin sulfate (Gentamicin Sulfate), netylmicin (Netilmicin), tobramycin (Tobramycin), Paromomycin (Aromikacin), Capreomycin (Capreomycin), tripleru Trifluoperazine, Dihydrostreptomycin, Hydroxychloroquine, Thioridazine HCl, Resminostat, Montelukast, Norfloxacin and Norfloxacin At least one of daplatin; Or at least one of their pharmaceutically acceptable salts.
- tobramycin trifluoroperazine 2HCl, amikacin hydrate, hydroxychloroquine sulfate, thiolidazine HCl, dihydrostreptomycin sulfate, gentamicin sulfate, netylmycin sulfate, capreomycin
- sulfate paromomycin sulfate, resminostat, montelukast, norfloxacin, nedaplatin, bleomycin, nystatin, cephalosin, mycafungin sodium, epavirenz and mittefosin; Or at least one of their pharmaceutically acceptable salts.
- the individual may be any individual that may be infected with Flavivirus infection, and specifically, may be a mammal including a human, more specifically a human, but is not limited thereto.
- Flavivirus infections may be caused by the viruses described above.
- CCK-8 analysis was performed according to the manufacturer's instructions.
- VeroE6 cells Prior to the experiment, VeroE6 cells were seeded at densities of 10.5 ⁇ 10 4 cells / cm 2 and 7.0 ⁇ 10 4 cells / cm 2 , respectively. After 24 hours of incubation at 37 ° C., 5% CO 2 , montelukast was treated at a continuously diluted concentration for 48 hours. CCK-8 reagents were treated in each group at a concentration of 10% v / v and incubated for 1-4 hours at normal cell culture conditions. Quantitative analysis of changes in colorimetric intensity was performed by measuring the optical density of formazan salt at 450 nm using a microplate reader (Molecular Devices, Inc., USA). The experiment was performed in triplicate with data represented as mean ⁇ SEM.
- VeroE6 cells were seeded at densities of 10.5 ⁇ 10 4 cells / cm 2 and 7.0 ⁇ 10 4 cells / cm 2 , respectively.
- dengue virus serotype2 was inoculated into each cell culture with MOI of 0.1, 0.5 and 2.5, respectively, in serum-free medium for 2 hours.
- the culture plate was shaken gently every 30 minutes to evenly distribute the virus in the cells.
- Montelukast solutions were prepared at serially diluted concentrations in each complete culture medium containing 0.75% methyl cellulose. After incubation, virus medium was removed and cells were washed once with sterile PBS and then treated with compound solution.
- the cells were incubated for 48 hours under the culture chamber. After incubation, each group was prepared for focal formation assay (FFA) and relative viral RNA expression analysis.
- FFA focal formation assay
- the compound solution was removed and the cells washed once with sterile PBS and then fixed with 4% paraform aldehyde. Cells were washed with TRIZOL for viral RNA expression analysis and stored at ⁇ 70 ° C. for further analysis.
- FFA was performed on NS1 protein of DV serotype2. 4% paraformaldehyde fixed cells were washed three times with PBS. The blocking solution was treated for 1 hour at room temperature. After washing with PBS, the primary antibody (Mouse anti-Flavivirus NS1, 1: 2000) was treated in each group for 2 hours at room temperature or overnight at 4 ° C. After washing with PBS, a secondary antibody (anti-mouse IgG-FITC, 1: 500) was applied to each group for 1 hour at room temperature. After rinsing, PBS containing 10 ⁇ g / ml HOECHST 33342 was treated in each group for nuclear staining. Fluorescent stained viral focus forming units were observed and analyzed under a microscope (Olympus, Japan).
- AG129 mice (10-12 weeks) were inoculated by intraperitoneal injection of various viral titers of 10 6 , 5 ⁇ 10 6 and 10 7 FFU.
- To assess the antivirality of montelukast AG129 mice (10-12 weeks) were injected with 10 7 FFU (IP) and then 200 ⁇ l of montelukast (IP, 10 mg / kg / day) or PBS. Medication was performed once a day.
- Negative controls (uninfected group) received 300 ⁇ l of PBS (IP) instead of virus.
- 200 ⁇ l of montelukast (IP, 10 mg / kg / day) was administered alone to uninfected AG129 mice.
- Weight loss and mortality status were monitored daily. In the survival analysis, euthanized mice with severe disease-related symptoms or rapid weight loss were recorded as current deaths after the war. Each body weight was analyzed as a relative percentage of 0 days.
- each primer was designed taking into account the overlap between two exons of the target gene with a GC content of less than 50% and an expected amplicon size of about 100 bps. Primer sequences were identified as shown in Table 2. Quantitative real time PCR (qRT-PCR) was performed to quantify viral RNA. Each reaction was performed in 20 ⁇ L volume using SYBR green master mix. Quantstudio3 TM (Applied Biosystems Inc., USA) was used for this study in the two step amplification process. For the analysis of viremia, a linear correlation standard curve was established between the viral titer (FFU / mL) and the corresponding threshold cycle (CT) value.
- FFU titer
- CT threshold cycle
- Virus in plasma was calculated according to the equation of the standard curve. Standard curves were derived for serially diluted virus titers. For cell-based group and mouse organ samples (including whole blood), semi-quantitative viral RNA was analyzed for GAPDH, an endogenous control.
- Organ samples fixed with 4% paraformaldehyde were subjected to a series of procedures such as paraffin insertion, sectioning and staining with hematoxylin and eosin.
- the degree of inhibition of dengue virus helicase activity was confirmed according to the concentrations of the six compounds (IC 50 values presented, FIG. 4).
- the dengue infection model (AG129 mouse) was used to confirm DENV viremia reduction in mouse blood after drug treatment (FIG. 5).
- Micafungin sodium was injected with I.P. (Intraperitoneal) injection, Miltefosine was injected with Oral injection, and Vechicle control was injected with PBS.
- the montelukast-administered group has a low weight loss, high survival rate, and low blood pressure.
- Relative dengue virus RNA expression was measured from each tissue sample and is shown in FIG. 8.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Veterinary Medicine (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Epidemiology (AREA)
- Molecular Biology (AREA)
- Virology (AREA)
- Communicable Diseases (AREA)
- Oncology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Organic Chemistry (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The present invention relates to a pharmaceutical composition comprising at least one of gentamicin sulfate, netilmicin, tobramycin, paromomycin, amikacin, capreomycin, trifluoperazine, dihydrostreptomycin, hydroxychloroquine, thioridazine HCl, efavirenz, miltefosine, nystatin, micafungin, bleomycin, resminostat, montelukast, norfloxacin, nedaplatin, and cephalothin, which can exhibit excellent growth inhibition and killing effects on various viruses in the family Flaviviridae.
Description
본 발명은 플라비바이러스 감염증의 예방 또는 치료용 약학적 조성물에 관한 것이다.The present invention relates to a pharmaceutical composition for preventing or treating flavivirus infection.
플라비바이러스는 소형의, 피복된, 양성-가닥 (enveloped positive-strand) RNA 바이러스로, 이들중 일부는 현재 또는 장래에 전세계 인류의 건강에 위협이 되거나 될 가능성이 있다. 예컨대 황열병 바이러스는 아프리카의 사하라 사막 이남의 특정 정글 지대 또는 남아프리카의 일부 지역에서 전염병의 원인이 되어 왔다. 다수의 황열병 감염은 심각한 것은 아니지만, 이러한 질병은 심각한, 생명을 위협하는 병을 초래할 수도 있다. 질병의 상태는 두 단계(phase)를 갖는다. 초기의 급성 단계(acute phase)는 고열, 오한, 두통, 요통, 근육통, 식욕 부진, 오심, 및 구토를 특징으로 한다. 3일 내지 4일 후, 이러한 증상들은 사라진다. 일부 환자의 경우에, 질병이 소위 발병력 단계(toxic phase)로 진입하게 되면, 이러한 증상들이 재발하기도 한다. 발병력 단계 중에는, 고열이 다시 나타나고 쇼크, 출혈 (예컨대, 입, 코, 눈, 및/또는 위로부터의 출혈), 신부전(kidney failure), 및 간부전(liver failure)이 초래될 수 있다. 실제로, 간부전은 피부가 황색으로 변하고 눈이 하얗게 되는 황달을 초래하기 때문에, "황열"이라는 이름으로 불리운다. 발병력 단계로 진입한 환자 중 절반은 10일 내지 14일 이내에 사망한다. 그러나, 황열병으로부터 회복된 사람들은 평생 재감염에 대해서 면역된다. 지난 20년간 황열병 바이러스에 감염된 사람의 숫자는 점점 증가해 왔는데, 현재 황열병 감염 사례는 연간 약 200,000건이고, 해마다 약 30,000명이 사망에 이르고 있다. 따라서 황열병 바이러스의 재출현은 공중 보건에 심각한 위협이 된다.Flaviviruses are small, coated, enveloped positive-strand RNA viruses, some of which are or are likely to present or threaten the health of humans worldwide today or in the future. Yellow fever viruses, for example, have been the cause of epidemics in certain jungles in sub-Saharan Africa or in parts of South Africa. Many yellow fever infections are not serious, but they can lead to serious, life-threatening illnesses. The condition of the disease has two phases. The early acute phase is characterized by high fever, chills, headache, back pain, myalgia, anorexia, nausea, and vomiting. After three to four days, these symptoms disappear. In some patients, these symptoms recur when the disease enters the so-called toxic phase. During the pathogenesis phase, high fever reappears and can result in shock, bleeding (eg, bleeding from the mouth, nose, eyes, and / or stomach), kidney failure, and liver failure. In fact, hepatic failure is called "yellow fever" because it causes jaundice, which causes the skin to turn yellow and become white. Half of patients entering the pathogenesis die within 10 to 14 days. However, people who recover from yellow fever are immune to lifelong reinfection. The number of people infected with yellow fever virus has increased over the past two decades, with about 200,000 cases of yellow fever infections annually, with about 30,000 deaths annually. Thus, the re-emergence of yellow fever virus poses a serious threat to public health.
뎅기(DEN) 바이러스는 플라비바이러스의 다른 예이다. 뎅기 바이러스는 모기(주로 아에데스아에집티(Aedes aegypti)에 의해 사람에게 전염되고 전세계적으로 점점 심각한 공중 보건 문제의 원인이 되고 있다. 해마마 1억명 중에 50명 정도가 뎅기 바이러스에 감염되고 있고 일부 지역에서는 6%나 되는 높은 감염율이 관찰되기도 하였다. 4가지 항원형의 뎅기 바이러스(뎅기 타입 1-4)들이 카리브해, 아시아 및 아메리카 지역에 퍼져 있다. 심각하게 치명적일 가능성이 있는 DEN 감염[뎅기 출혈열/뎅기 쇼크 증후군(DHF/DSS)]은 서로 상이한 항원형의 DEN에 의해 순차적으로 감염된 개인에게서 발병되는 면역병리학적 질병이다. 3백6십만 이상의 DHF(dengue hemorrahagic fever) 및 DHF에 의한 58,000명의 사망자가 1980년과 1995년 사이에 보고되었다. DHF/DSS의 병원성 때문에, 최적의 뎅기 백신은 네 가지 항원형 모두에 대해 동시에 면역을 제공하고 오래 지속되는 면역성을 부여할 필요가 있는 것으로 생각되어 왔다. 세계 제 2 차 대전 이래로 효과적인 뎅기 백신을 개발하기 위해 활발한 노력이 경주되어 왔지만, 현재 이용가능한 인가된 뎅기 백신은 존재하지 않는다.Dengue (DEN) viruses are another example of flaviviruses. The dengue virus is transmitted to humans by mosquitoes (primarily Aedes aegypti) and is causing an increasingly serious public health problem worldwide. About 50 out of 100 million seahorses are infected with the dengue virus In some areas, as much as 6% infection rates have been observed, four antigenic dengue viruses (Dengue types 1-4) are spread throughout the Caribbean, Asia and the Americas. Hemorrhagic Fever / Dengue Shock Syndrome (DHF / DSS)] is an immunopathological disease that occurs in individuals sequentially infected by DENs of different antigenic types: more than 3.6 million dengue hemorrahagic fevers and 58,000 people with DHF. Deaths were reported between 1980 and 1995. Because of the pathogenicity of DHF / DSS, optimal dengue vaccines are immune to all four antigens simultaneously. There has been a need to provide and confer long lasting immunity Active efforts have been made to develop effective dengue vaccines since World War II, but there are currently no approved dengue vaccines available.
황열별 바이러스와 뎅기 바이러스를 포함하는 플라비바이러스는 사람 및 동물에서 질병의 유도를 담당하는 두 가지 중요한 생물학적 특징들을 갖는다. 이러한 두 가지 특징 가운데 하나는 신경조직친화성(neurotropism)으로, 신경조직친화성이란 바이러스가 숙주의 신경 조직에 침투해서 감염시키는 경향을 의미한다. 신경조직친화성 플라비바이러스 감염은 뇌와 척수의 감염 및 손상(즉, 뇌염), 의식 불명, 마비, 경련을 야기할 수 있다. 플라비바이러스 감염의 두 번째 특징은 내장기관친화성, 즉, 바이러스가 간, 신장 및 심장을 포함하는 중요한 내장 기관에 침입해서 감염시키는 경향이다. 내장기관친화성 플라비바이러스 감염은 간(간염), 신장(신장염), 및 심장 근육(심근염)의 감염 및 손상을 초래하여, 이들 기관이 정상적으로 기능하지 못하게 한다. 신경조직친화성과 내장기관친화성은 플라비바이러스의 서로 상이한 별개의 특징으로 판단된다.Flaviviruses, including yellow fever and dengue viruses, have two important biological characteristics responsible for the induction of disease in humans and animals. One of these two features is neurotropism, which refers to the tendency of a virus to infect and infect the host's nervous system. Nerve-friendly flavivirus infections can cause infection and injury of the brain and spinal cord (ie, encephalitis), unconsciousness, paralysis, and convulsions. A second feature of flavivirus infection is visceral organ affinity, ie the virus tends to invade and infect vital visceral organs including the liver, kidneys and heart. Visceral organ-friendly flavivirus infections result in infection and damage of the liver (hepatitis), kidney (nephritis), and heart muscle (myocarditis), preventing these organs from functioning normally. Neural tissue affinity and visceral organ affinity are judged to be distinct features of Flavivirus.
일부 플라비바이러스는 기본적으로 신경조직친화성(예컨대, 웨스트 나일 바이러스)이고, 나머지는 기본적으로 내장기관친화성(예컨대, 황열병 바이러스 및 뎅기 바이러스)이며, 또 다른 나머지는 두 가지 특성을 모두 시현한다(예컨대, 키아사누르 포레스트(Kyasanur Forest) 질병 바이러스). 그러나, 신경조직친화성 및 내장기관친화성 양자는 모든 플라비바이러스에서 어느 정도 존재한다. 숙주 내에서 신경조직친화성과 내장기관친화성 사이의 상호작용이 일어나는 것으로 보이는데, 이는 내장 기관의 감염은 중추신경계의 공격 이전에 일어나기 때문이다. 따라서 신경조직친화성은 바이러스의 신경외 기관(내장)에서의 복제 능력에 의존한다. 이러한 신경외 복제(extraneural replication)는 바이러스혈증을 일으키고 이러한 바이러스혈증은 뇌 및 척수를 공격한다. Some flaviviruses are basically neuronal affinity (eg West Nile virus), others are visceral organ affinity (eg yellow fever virus and dengue virus), and others exhibit both properties. (Eg, Kyasanur Forest Disease Virus). However, both neural affinity and visceral organ affinity are present to some extent in all flaviviruses. Interactions between neural tissue affinity and visceral organ affinity appear to occur in the host because infection of the visceral organ occurs prior to the attack of the central nervous system. Neuronal affinity thus depends on the virus's ability to replicate in the extraneous organs (intestines). Such extraneural replication causes viremia and this viremia attacks the brain and spinal cord.
플라비바이러스에 대한 백신을 개발하기 위한 하나의 시도는 그들의 발병력 특성(virulence properties)을 변화시켜, 백신 바이러스가 사람 및 동물에 대한 그의 신경조직친화성 및 내장기관친화성을 상실하도록 하는 것이었다. 황열병 바이러스의 경우에, 두 가지 백신 (황열병 17D 및 프렌치 신경조직친화성 백신)이 개발되었다. 황열병 17D 백신은 계배아 조직에서의 연속 접종(serial passage)에 의해 신경조직친화성과 내장기관친화성이 현저하게 감소한 바이러스를 수득함으로써 개발되었다. 프렌치 신경조직친화성 백신은 마우스 뇌 조직에서의 연속 접종에 의해 신경조직친화성은 잔류하지만 내장기관친화성을 완전히 제거하여 개발되었다. 프렌치 백신의 사용시 높은 발생률의 신경계 사고(예방접종후 뇌염)가 수반되었다. 다른 여러 바이러스들 중에 뎅기, 웨스트 나일, 옴스크 출혈열 바이러스와 같은 내장기관친화성을 갖는 임상적으로 중요한 플라비바이러스에 대한 인가된 백신으로 현재 시판되는 것은 없다.One attempt to develop a vaccine against flaviviruses has been to change their virulence properties so that the vaccine virus loses its neuronal and visceral organ affinity for humans and animals. In the case of yellow fever virus, two vaccines have been developed: yellow fever 17D and French neuro-tissue affinity vaccine. A yellow fever 17D vaccine was developed by obtaining a virus that significantly reduced neuronal and visceral organ affinity by serial passage in embryonic tissue. French neural tissue affinity vaccine was developed by continuous inoculation in mouse brain tissues, but the neural tissue affinity remained but completely removed visceral organ affinity. The use of French vaccines involved a high incidence of nervous system accidents (encephalitis after vaccination). None of the other viruses is currently available as an approved vaccine against clinically important flaviviruses with visceral organ affinity such as Dengue, West Nile, Omsk Hemorrhagic Fever Virus.
본 발명은 다양한 플라비바이러스에 대해 효과적인 플라비바이러스 감염증의 예방 또는 치료용 조성물을 제공하는 것을 목적으로 한다.It is an object of the present invention to provide a composition for the prevention or treatment of flavivirus infections effective against various flaviviruses.
본 발명은 다양한 플라비바이러스를 생육 저해 또는 사멸시킬 수 있는 조성물을 제공하는 것을 목적으로 한다.It is an object of the present invention to provide a composition capable of inhibiting or killing various flaviviruses.
1. 겐타마이신 설페이트(Gentamicin Sulfate), 네틸마이신(Netilmicin), 토브라마이신(Tobramycin), 파로모마이신(Paromomycin), 아미카신(Amikacin), 카프레오마이신(Capreomycin), 트리플루오페라진(Trifluoperazine), 디하이드로스트렙토마이신(Dihydrostreptomycin), 히드록시클로로퀸(Hydroxychloroquine), 티오리다진 HCl(Thioridazine HCl), 에파비렌즈(Efavirenz), 밀테포신(Miltefosine), 니스타틴(Nystatin), 미카펀진(Micafungin), 블레오마이신(Bleomycin), 레스미노스타트(Resminostat), 몬테루카스트(Montelukast), 노르플록사신(Norfloxacin), 네다플라틴(Nedaplatin)
및 세팔로신(Cephalothin) 중 적어도 하나; 또는 이들의 약학적으로 허용되는 염 중 적어도 하나;를 포함하는 플라비바이러스 감염증의 예방 또는 치료용 약학적 조성물.Gentamicin Sulfate, Netilmicin, Tobramycin, Paromomycin, Amikacin, Capreomycin, Trifluoperazine ), Dihydrostreptomycin, Hydroxychloroquine, Thioridazine HCl, Thiavirazine, Miltefosine, Nystatin, Micafungin , Bleomycin, Resminostat, Montelukast, Norfloxacin, Nedaplatin And at least one of cephalothin; Or at least one of pharmaceutically acceptable salts thereof. A pharmaceutical composition for preventing or treating flavivirus infection.
2. 위 1에 있어서, 상기 플라비바이러스 감염증은 아포이 바이러스(Apoi virus), 아로아 바이러스(Aroa virus), 바가자 바이러스(Bagaza virus), 반지 바이러스(Banzi virus), 보우부이 바이러스(Bouboui virus), 부카라사 배트 바이러스(Bukalasa bat virus), 카시파코레 바이러스(Cacipacore virus), 캐리섬 바이러스(Carey Island virus), 카우본 릿지 바이러스(Cowbone Ridge virus), 다카르 배트 바이러스(Dakar bat virus), 뎅기 바이러스(Dengue virus), 엣지 힐 바이러스(Edge Hill virus), 엔데뻬 배트 바이러스(Entebbe bat virus), 가젯 굴리 바이러스(Gadgets Gully virus), 일헤우스 바이러스(Ilheus virus), 이스라엘 터키 뇌수막척수염 바이러스(Israel turkey meningoencephalomyelitis virus), 일본 뇌염 바이러스(Japanese encephalitis virus), 주그라 바이러스(Jugra virus), 주티아파 바이러스(Jutiapa virus), 카담 바이러스(Kadam virus), 케도구 바이러스(Kedougou virus), 코코베라 바이러스(Kokobera virus), 코탱고 바이러스(Koutango virus), 캬사누 포레스트 질병 바이러스(Kyasanur Forest disease virus), 란갓 바이러스(Langat virus), 도약병 바이러스(Louping ill virus), 미반 바이러스(Meaban virus), 모독 바이러스(Modoc virus), 몬타나 미오티스 류코엔세팔리티스 바이러스(Montana myotis leukoencephalitis virus), 머레이 밸리 엔세팔리티스 바이러스(Murray Valley encephalitis virus), 은타야 바이러스(Ntaya virus), 옴스크 출혈열 바이러스(Omsk hemorrhagic fever virus), 프놈펜 배트 바이러스(Phnom Penh bat virus), 포와산 바이러스(Powassan virus), 리오 브라보 바이러스(Rio Bravo virus), 로얄 팜 바이러스(Royal Farm virus), 사보야 바이러스(Saboya virus), 세인트루이스 엔세팔리티스 바이러스(Saint Louis encephalitis virus), 살 비에야 바이러스(Sal Vieja virus), 산 퍼리타 바이러스(San Perlita virus), 사우마레즈 잎 바이러스(Saumarez Reef virus), 세픽 바이러스(Sepik virus), 템부수 바이러스(Tembusu virus), 진드기 매개 뇌염 바이러스(Tick-borne encephalitis virus), 튤레니 바이러스(Tyuleniy virus), 우간다 S 바이러스(Uganda S virus), 우수투 바이러스(Usutu virus), 웨셀스브론 바이러스(Wesselsbron virus), 웨스트 나일 바이러스(West Nile virus), 야오운데 바이러스(Yaounde virus), 황열 바이러스(Yellow fever virus), 요코세 바이러스(Yokose virus) 또는 지카 바이러스(Zika virus) 유발 감염증인 조성물.2. In the above 1, the flavivirus infection is apoi virus (Apoi virus), Aroa virus (Aroa virus), Bagaga virus (Bagaza virus), Ringzi virus (Banzi virus), Bouboui virus (Bouboui virus), Bucarasa bat virus, Cacipacore virus, Carey Island virus, Cowbone Ridge virus, Dakar bat virus, Dengue virus (Dengue virus, Edge Hill virus, Entebbe bat virus, Gadgets Gully virus, Ilheus virus, Israel turkey meningoencephalomyelitis virus, Japanese encephalitis virus, Jugra virus, Jutiapa virus, Kadam virus, Kedogai Kedougou virus, Kokobera virus, Kotango virus, Kyasanur Forest disease virus, Langat virus, Louping ill virus, Meaban virus, Modoc virus, Montana myotis leukoencephalitis virus, Murray Valley encephalitis virus, Ntaya virus , Omsk hemorrhagic fever virus, Phnom Penh bat virus, Powassan virus, Rio Bravo virus, Royal Farm virus, Savoya Virus (Saboya virus), Saint Louis encephalitis virus, Sal Vieja virus, San Perita virus (San Perita virus) lita virus, Saumarez Reef virus, Sepik virus, Tembusu virus, Tick-borne encephalitis virus, Tuleniy virus, Uganda S virus, Usutu virus, Wesselsbron virus, West Nile virus, Yaounde virus, Yellow fever virus , Yokose virus or Zika virus induced infection.
3. 위 1에 있어서, 상기 플라비바이러스 감염증은 뎅기바이러스 유발 감염증인 조성물.3. The composition of 1 above, wherein the flavivirus infection is a dengue virus induced infection.
4. 위 1에 있어서, 상기 조성물은 토브라마이신, 트리플루오페라진 2HCl, 아미카이신 수화물, 히드록시클로로퀸 황산염, 티오리다진 HCl, 디하이드로스트렙토마이신 황산염, 겐타마이신 황산염, 네틸마이신 황산염, 카프레오마이신 황산염, 파로모마이신 황산염, 레스미노스타트, 몬테루카스트, 노르플록사신, 네다플라틴, 블레오마이신, 니스타틴, 세팔로신, 미카펀진 나트륨, 에파비렌즈 및 밀테포신 중 적어도 하나; 또는 이들의 약학적으로 허용되는 염 중 적어도 하나;를 포함하는 조성물.4. The above composition 1, wherein the composition is tobramycin, trifluoroperazine 2HCl, amikacin hydrate, hydroxychloroquine sulfate, thiolidazine HCl, dihydrostreptomycin sulfate, gentamicin sulfate, netylmycin sulfate, capp At least one of leumycin sulfate, paromomycin sulfate, resminostat, montelukast, norfloxacin, nedaplatin, bleomycin, nystatin, cephalosin, mycafungin sodium, epavirenz and miltopesin; Or at least one of pharmaceutically acceptable salts thereof.
5. 겐타마이신 설페이트(Gentamicin Sulfate), 네틸마이신(Netilmicin), 토브라마이신(Tobramycin), 파로모마이신(Paromomycin), 아미카신(Amikacin), 카프레오마이신(Capreomycin), 트리플루오페라진(Trifluoperazine), 디하이드로스트렙토마이신(Dihydrostreptomycin), 히드록시클로로퀸(Hydroxychloroquine), 티오리다진 HCl(Thioridazine HCl), 에파비렌즈(Efavirenz), 밀테포신(Miltefosine), 니스타틴(Nystatin), 미카펀진(Micafungin), 블레오마이신(Bleomycin), 레스미노스타트(Resminostat), 몬테루카스트(Montelukast), 노르플록사신(Norfloxacin), 네다플라틴(Nedaplatin)
및 세팔로신(Cephalothin) 중 적어도 하나; 또는 이들의 약학적으로 허용되는 염 중 적어도 하나;를 포함하는 플라비바이러스 생육 저해 또는 사멸용 조성물.5. Gentamicin Sulfate, Netilmicin, Tobramycin, Paromomycin, Amikacin, Capreomycin, Trifluoperazine ), Dihydrostreptomycin, Hydroxychloroquine, Thioridazine HCl, Thiavirazine, Miltefosine, Nystatin, Micafungin , Bleomycin, Resminostat, Montelukast, Norfloxacin, Nedaplatin And at least one of cephalothin; Or at least one of pharmaceutically acceptable salts thereof; and a composition for inhibiting or killing flavivirus growth.
6. 위 5에 있어서, 상기 플라비바이러스는 아포이 바이러스(Apoi virus), 아로아 바이러스(Aroa virus), 바가자 바이러스(Bagaza virus), 반지 바이러스(Banzi virus), 보우부이 바이러스(Bouboui virus), 부카라사 배트 바이러스(Bukalasa bat virus), 카시파코레 바이러스(Cacipacore virus), 캐리섬 바이러스(Carey Island virus), 카우본 릿지 바이러스(Cowbone Ridge virus), 다카르 배트 바이러스(Dakar bat virus), 뎅기 바이러스(Dengue virus), 엣지 힐 바이러스(Edge Hill virus), 엔데뻬 배트 바이러스(Entebbe bat virus), 가젯 굴리 바이러스(Gadgets Gully virus), 일헤우스 바이러스(Ilheus virus), 이스라엘 터키 뇌수막척수염 바이러스(Israel turkey meningoencephalomyelitis virus), 일본 뇌염 바이러스(Japanese encephalitis virus), 주그라 바이러스(Jugra virus), 주티아파 바이러스(Jutiapa virus), 카담 바이러스(Kadam virus), 케도구 바이러스(Kedougou virus), 코코베라 바이러스(Kokobera virus), 코탱고 바이러스(Koutango virus), 캬사누 포레스트 질병 바이러스(Kyasanur Forest disease virus), 란갓 바이러스(Langat virus), 도약병 바이러스(Louping ill virus), 미반 바이러스(Meaban virus), 모독 바이러스(Modoc virus), 몬타나 미오티스 류코엔세팔리티스 바이러스(Montana myotis leukoencephalitis virus), 머레이 밸리 엔세팔리티스 바이러스(Murray Valley encephalitis virus), 은타야 바이러스(Ntaya virus), 옴스크 출혈열 바이러스(Omsk hemorrhagic fever virus), 프놈펜 배트 바이러스(Phnom Penh bat virus), 포와산 바이러스(Powassan virus), 리오 브라보 바이러스(Rio Bravo virus), 로얄 팜 바이러스(Royal Farm virus), 사보야 바이러스(Saboya virus), 세인트루이스 엔세팔리티스 바이러스(Saint Louis encephalitis virus), 살 비에야 바이러스(Sal Vieja virus), 산 퍼리타 바이러스(San Perlita virus), 사우마레즈 잎 바이러스(Saumarez Reef virus), 세픽 바이러스(Sepik virus), 템부수 바이러스(Tembusu virus), 진드기 매개 뇌염 바이러스(Tick-borne encephalitis virus), 튤레니 바이러스(Tyuleniy virus), 우간다 S 바이러스(Uganda S virus), 우수투 바이러스(Usutu virus), 웨셀스브론 바이러스(Wesselsbron virus), 웨스트 나일 바이러스(West Nile virus), 야오운데 바이러스(Yaounde virus), 황열 바이러스(Yellow fever virus), 요코세 바이러스(Yokose virus) 또는 지카 바이러스(Zika virus)인 조성물.6. In the above 5, the flavivirus is Apoi virus (Apoi virus), Aroa virus (Aroa virus), Bagaza virus (Bagaza virus), Ringzi virus (Banzi virus), Bouboui virus, Boo Carrasa bat virus, Cascipacore virus, Carey Island virus, Cowbone Ridge virus, Dakar bat virus, Dengue virus ( Dengue virus, Edge Hill virus, Entebbe bat virus, Gadgets Gully virus, Ilheus virus, Israel turkey meningoencephalomyelitis virus ), Japanese encephalitis virus, Jugra virus, Jutiapa virus, Kadam virus, Kedog virus ugou virus, Kokobera virus, Kotango virus, Kyasanur Forest disease virus, Langat virus, Louping ill virus, Miban virus (Meaban virus), Modoc virus, Montana myotis leukoencephalitis virus, Murray Valley encephalitis virus, Ntaya virus, Om Omsk hemorrhagic fever virus, Phnom Penh bat virus, Powassan virus, Rio Bravo virus, Royal Farm virus, Savoya virus ( Saboya virus, Saint Louis encephalitis virus, Sal Vieja virus, San Perlita virus ), Saumarez Reef virus, Sepik virus, Tembusu virus, Tick-borne encephalitis virus, Tyuleniy virus, Uganda S Virus (Uganda S virus), Usutu virus, Wesselsbron virus, West Nile virus, Yaounde virus, Yellow fever virus, Yoko Compositions that are Yokose virus or Zika virus.
7. 위 5에 있어서, 상기 플라비바이러스는 뎅기바이러스인 조성물.7. The composition of claim 5, wherein the flavivirus is a dengue virus.
8. 위 5에 있어서, 상기 조성물은 토브라마이신, 트리플루오페라진 2HCl, 아미카이신 수화물, 히드록시클로로퀸 황산염, 티오리다진 HCl, 디하이드로스트렙토마이신 황산염, 겐타마이신 황산염, 네틸마이신 황산염, 카프레오마이신 황산염, 파로모마이신 황산염, 레스미노스타트, 몬테루카스트, 노르플록사신, 네다플라틴, 블레오마이신, 니스타틴, 세팔로신, 미카펀진 나트륨, 에파비렌즈 및 밀테포신 중 적어도 하나; 또는 이들의 약학적으로 허용되는 염 중 적어도 하나;를 포함하는 조성물.8. according to the above 5, the composition is tobramycin, trifluoroperazine 2HCl, amikacin hydrate, hydroxychloroquine sulfate, thiolidazine HCl, dihydrostreptomycin sulfate, gentamicin sulfate, netylmycin sulfate, capp At least one of leumycin sulfate, paromomycin sulfate, resminostat, montelukast, norfloxacin, nedaplatin, bleomycin, nystatin, cephalosin, mycafungin sodium, epavirenz and miltopesin; Or at least one of pharmaceutically acceptable salts thereof.
본 발명의 조성물은 플라비바이러스속의 바이러스의 증식 억제 및 이들 유래 감염증에 대한 생존율 증가 효과가 우수하다.The composition of the present invention is excellent in inhibiting the proliferation of viruses of the genus Flaviviruses and increasing the survival rate for these derived infections.
도 1 내지 3은 뎅기바이러스 RdRp 활성 저해 효과를 나타낸 것이다.1 to 3 show the dengue virus RdRp activity inhibitory effect.
도 4는 뎅기바이러스 헬리케이즈 활성 저해 효과를 나타낸 것이다.Figure 4 shows the dengue virus helicase activity inhibitory effect.
도 5는 뎅기바이러스 혈증 감소 효과를 나타낸 것이다.Figure 5 shows the effect of reducing dengue virus.
도 6은 뎅기바이러스 감소 효과를 나타낸 FFA 결과이다.6 is a FFA result showing a dengue virus reduction effect.
도 7은 뎅기바이러스 증식 억제 및 감염증 생존율 증가 효과를 나타낸 것이다.Figure 7 shows the effect of inhibiting dengue virus growth and increase the survival rate of infection.
도 8은 조직특이적 항 뎅기바이러스 효과를 나타낸 것이다.8 shows a tissue specific anti-dengue virus effect.
도 9는 바이러스 증식 억제 효과를 조직학적 분석으로 확인한 것이다.9 confirms the effect of virus growth inhibition by histological analysis.
이하 본 발명을 상세히 설명한다.Hereinafter, the present invention will be described in detail.
본 발명은 플라비바이러스 감염증의 예방 또는 치료용 약학적 조성물에 관한 것이다.The present invention relates to a pharmaceutical composition for preventing or treating flavivirus infection.
플라비바이러스(Flavivirus)는 토가바이러스과의 1속으로서, 적혈구 응집성이 있어 속내 공통항원을 갖는다.Flavivirus is a genus of the togavirus family and has a common antigen in the genus due to its cohesion of erythrocytes.
본 명세서에서 플라비바이러스는 해당 속에 포함되는 당 분야에 알려진 모든 종의 바이러스를 제한 없이 일컫는 것이고, 플라비바이러스 감염증은 해당 바이러스의 감염에 의해 발생하는 질병 또는 보균 상태를 의미한다.As used herein, flavivirus refers to any species of virus known in the art to be included in the genus without limitation, and flavivirus infection refers to a disease or carrier condition caused by infection of the virus.
본 발명의 조성물은 플라비바이러스 속의 다양한 종에 대해 사멸, 생육 저해 효과를 나타낼 수 있다. 예를 들면 아포이 바이러스(Apoi virus), 아로아 바이러스(Aroa virus), 바가자 바이러스(Bagaza virus), 반지 바이러스(Banzi virus), 보우부이 바이러스(Bouboui virus), 부카라사 배트 바이러스(Bukalasa bat virus), 카시파코레 바이러스(Cacipacore virus), 캐리섬 바이러스(Carey Island virus), 카우본 릿지 바이러스(Cowbone Ridge virus), 다카르 배트 바이러스(Dakar bat virus), 뎅기 바이러스(Dengue virus), 엣지 힐 바이러스(Edge Hill virus), 엔데뻬 배트 바이러스(Entebbe bat virus), 가젯 굴리 바이러스(Gadgets Gully virus), 일헤우스 바이러스(Ilheus virus), 이스라엘 터키 뇌수막척수염 바이러스(Israel turkey meningoencephalomyelitis virus), 일본 뇌염 바이러스(Japanese encephalitis virus), 주그라 바이러스(Jugra virus), 주티아파 바이러스(Jutiapa virus), 카담 바이러스(Kadam virus), 케도구 바이러스(Kedougou virus), 코코베라 바이러스(Kokobera virus), 코탱고 바이러스(Koutango virus), 캬사누 포레스트 질병 바이러스(Kyasanur Forest disease virus), 란갓 바이러스(Langat virus), 도약병 바이러스(Louping ill virus), 미반 바이러스(Meaban virus), 모독 바이러스(Modoc virus), 몬타나 미오티스 류코엔세팔리티스 바이러스(Montana myotis leukoencephalitis virus), 머레이 밸리 엔세팔리티스 바이러스(Murray Valley encephalitis virus), 은타야 바이러스(Ntaya virus), 옴스크 출혈열 바이러스(Omsk hemorrhagic fever virus), 프놈펜 배트 바이러스(Phnom Penh bat virus), 포와산 바이러스(Powassan virus), 리오 브라보 바이러스(Rio Bravo virus), 로얄 팜 바이러스(Royal Farm virus), 사보야 바이러스(Saboya virus), 세인트루이스 엔세팔리티스 바이러스(Saint Louis encephalitis virus), 살 비에야 바이러스(Sal Vieja virus), 산 퍼리타 바이러스(San Perlita virus), 사우마레즈 잎 바이러스(Saumarez Reef virus), 세픽 바이러스(Sepik virus), 템부수 바이러스(Tembusu virus), 진드기 매개 뇌염 바이러스(Tick-borne encephalitis virus), 튤레니 바이러스(Tyuleniy virus), 우간다 S 바이러스(Uganda S virus), 우수투 바이러스(Usutu virus), 웨셀스브론 바이러스(Wesselsbron virus), 웨스트 나일 바이러스(West Nile virus), 야오운데 바이러스(Yaounde virus), 황열 바이러스(Yellow fever virus), 요코세 바이러스(Yokose virus), 지카 바이러스(Zika virus) 등일 수 있으며, 구체적으로는 뎅기바이러스일 수 있고, 보다 구체적으로는 뎅기바이러스 serotype2일 수 있으나, 이에 제한되는 것은 아니다.The composition of the present invention can exhibit a killing, growth inhibitory effect on various species of the Flavivirus genus. For example, Apoi virus, Aroa virus, Bagaza virus, Banzi virus, Bouboui virus, Bucarasa bat virus , Cacipacore virus, Carey Island virus, Cowbone Ridge virus, Dakar bat virus, Dengue virus, Edge Hill virus Hill virus, Entebbe bat virus, Gadgets Gully virus, Ilheus virus, Israel turkey meningoencephalomyelitis virus, Japanese encephalitis virus ), Jugra virus, Jutiapa virus, Kadam virus, Kedougou virus, Cocovera virus kobera virus, Kotango virus, Kyasanur Forest disease virus, Langat virus, Louping ill virus, Meaban virus, blasphemy virus ( Modoc virus, Montana myotis leukoencephalitis virus, Murray Valley encephalitis virus, Ntaya virus, Omsk hemorrhagic fever virus ), Phnom Penh bat virus, Powassan virus, Rio Bravo virus, Royal Farm virus, Saboya virus, St. Louis Encephalitis Virus (Saint Louis encephalitis virus), Sal Vieja virus, San Perlita virus, Saumarez leaf virus (Sauma) rez Reef virus, Sepik virus, Tembusu virus, Tick-borne encephalitis virus, Tyuleniy virus, Uganda S virus, Excellent Usutu virus, Wesselsbron virus, West Nile virus, Yaounde virus, Yellow fever virus, Yokose virus, Zika Virus (Zika virus), and the like, specifically, dengue virus, and more specifically, dengue virus serotype2, but are not limited thereto.
본 발명의 약학적 조성물은 겐타마이신 설페이트(Gentamicin Sulfate), 네틸마이신(Netilmicin), 토브라마이신(Tobramycin), 파로모마이신(Paromomycin), 아미카신(Amikacin), 카프레오마이신(Capreomycin), 트리플루오페라진(Trifluoperazine), 디하이드로스트렙토마이신(Dihydrostreptomycin), 히드록시클로로퀸(Hydroxychloroquine), 티오리다진 HCl(Thioridazine HCl), 에파비렌즈(Efavirenz), 밀테포신(Miltefosine), 니스타틴(Nystatin), 미카펀진(Micafungin), 블레오마이신(Bleomycin), 레스미노스타트(Resminostat), 몬테루카스트(Montelukast), 노르플록사신(Norfloxacin), 네다플라틴(Nedaplatin)
및 세팔로신(Cephalothin) 중 적어도 하나; 또는 이들의 약학적으로 허용되는 염 중 적어도 하나;를 포함한다.The pharmaceutical composition of the present invention is gentamicin sulfate (Gentamicin Sulfate), netylmicin (Netilmicin), Tobramycin (Pabraomycin), Paromomycin (Amikacin), Capreomycin (Capreomycin), Triple Trifluoperazine, Dihydrostreptomycin, Hydrochlorochloroquine, Thiolidazine HCl, Efavirenz, Miltefosine, Nystatin, Nystatin, Micafungin, Bleomycin, Resminostat, Monteukast, Norfloxacin, Nedaplatin And at least one of cephalothin; Or at least one of their pharmaceutically acceptable salts.
구체적인 일 구현예에 따르면 겐타마이신 설페이트(Gentamicin Sulfate), 네틸마이신(Netilmicin), 토브라마이신(Tobramycin), 파로모마이신(Paromomycin), 아미카신(Amikacin), 카프레오마이신(Capreomycin), 트리플루오페라진(Trifluoperazine), 디하이드로스트렙토마이신(Dihydrostreptomycin), 히드록시클로로퀸(Hydroxychloroquine), 티오리다진 HCl(Thioridazine HCl), 레스미노스타트(Resminostat), 몬테루카스트(Montelukast), 노르플록사신(Norfloxacin) 및 네다플라틴(Nedaplatin) 중 적어도 하나; 또는 이들의 약학적으로 허용되는 염 중 적어도 하나;를 포함할 수 있다.According to a specific embodiment, gentamicin sulfate (Gentamicin Sulfate), netylmicin (Netilmicin), tobramycin (Tobramycin), Paromomycin (Aromikacin), Capreomycin (Capreomycin), tripleru Trifluoperazine, Dihydrostreptomycin, Hydroxychloroquine, Thioridazine HCl, Resminostat, Montelukast, Norfloxacin and Norfloxacin At least one of daplatin; Or at least one of pharmaceutically acceptable salts thereof.
또한, 구체적인 일 구현예에 따르면 에파비렌즈(Efavirenz), 밀테포신(Miltefosine), 니스타틴(Nystatin), 미카펀진(Micafungin), 블레오마이신(Bleomycin) 및 세팔로신(Cephalothin) 중 적어도 하나; 또는 이들의 약학적으로 허용되는 염 중 적어도 하나;를 포함할 수 있다.Further, according to a specific embodiment, at least one of Efavirenz, Miltefosine, Milstatin, Nystatin, Micafungin, Bleomycin, and Cephalothin; Or at least one of pharmaceutically acceptable salts thereof.
또한, 구체적인 일 구현예에 따르면 토브라마이신, 트리플루오페라진 2HCl, 아미카이신 수화물, 히드록시클로로퀸 황산염, 티오리다진 HCl, 디하이드로스트렙토마이신 황산염, 겐타마이신 황산염, 네틸마이신 황산염, 카프레오마이신 황산염, 파로모마이신 황산염, 레스미노스타트, 몬테루카스트, 노르플록사신, 네다플라틴, 블레오마이신, 니스타틴, 세팔로신, 미카펀진 나트륨, 에파비렌즈 및 밀테포신 중 적어도 하나; 또는 이들의 약학적으로 허용되는 염 중 적어도 하나;를 포함할 수 있다.Further, according to one specific embodiment, tobramycin, trifluoroperazine 2HCl, amikacin hydrate, hydroxychloroquine sulfate, thiolidazine HCl, dihydrostreptomycin sulfate, gentamicin sulfate, netylmycin sulfate, capreomycin At least one of sulfate, paromomycin sulfate, resminostat, montelukast, norfloxacin, nedaplatin, bleomycin, nystatin, cephalosin, mycafungin sodium, epavirenz and mittefosin; Or at least one of pharmaceutically acceptable salts thereof.
약학적으로 허용되는 염은 상기 각 약물(화합물)에 존재할 수 있는 산성 또는 염기성기의 염을 포함한다. 예를 들어, 약학적으로 허용가능한 염으로는 나트륨염, 칼슘염, 칼륨염, 염산염, 황산염, 수화물 등이 포함될 수 있으나 이에 제한되는 것은 아니고, 당업계에 알려진 염의 제조 방법을 통하여 제조될 수 있다.Pharmaceutically acceptable salts include salts of acidic or basic groups which may be present in each of the above drugs (compounds). For example, pharmaceutically acceptable salts may include, but are not limited to, sodium salts, calcium salts, potassium salts, hydrochlorides, sulfates, hydrates, and the like, and may be prepared through methods for preparing salts known in the art. .
상기 각 약물의 기존 적응증, 플라비바이러스에서 저해하는 타겟 효소 및 IC
50은 하기 표와 같을 수 있으나, 이에 제한되는 것은 아니다.Existing indications of each drug, the target enzyme and IC 50 inhibiting in Flavivirus may be as shown in the following table, but is not limited thereto.
상기 물질들은 기FDA 승인받은 약물들로서, 플라비바이러스 감염증에 대해 사용된 바는 없다.These substances are pre-FDA approved drugs and have not been used for flavivirus infection.
상기 물질들은 예를 들어 바이러스의 복제에 필요한 효소인 헬리케이즈(helicase)와 RNA dependent RNA polymerase (RdRp)의 활성을 억제하는 효소 저해제로서 작용하여 플라비바이러스 감염증에 대한 약효를 나타낼 수 있다.Such substances may act as enzyme inhibitors that inhibit the activity of helicase and RNA dependent RNA polymerase (RdRp), which are enzymes required for viral replication, for example, and may exhibit efficacy against flavivirus infection.
플라비바이러스 속의 RNA-dependent RNA polymerase(RdRp)는 유전자 수준에서 Flavivirus 를 포함한 다양한 RNA virus family 간에 유전적으로 보존된 비율이 매우 높다고 알려져 있고, 단백질 수준(polypeptide motif 수준)에서도 높은 보존도를 보이고 있어(Viruses. 2018 Feb; 10(2): 76.), 본 발명의 약학적 조성물은 플라비바이러스 속의 다양한 종에 대해 약효를 나타낼 수 있다.RNA-dependent RNA polymerase (RdRp) in the flavivirus genome is known to have a very high genetic preservation rate among various RNA virus families including Flavivirus at the gene level, and also has a high degree of conservation at the protein level (polypeptide motif level). Viruses. 2018 Feb; 10 (2): 76.), The pharmaceutical compositions of the present invention may show efficacy against various species of the genus Flavivirus.
그리고 헬리케이즈의 경우도, 효소 활성부위의 아미노산 서열이 플라비바이러스 내에서 굉장히 유사하게 보존되어 있으며, 이들 서열이 바이러스 RNA를 인지하는 데 기여한다고 알려져 있고, 이들 보존된 서열은 전 플라비바이러스에 걸쳐 유사한 기능(인접 특정 서열과의 수소 결합, 소수성 상호 작용 등에 기여)을 갖고 효소 활성에 기여하는 것으로 알려져 있다. 한 예로, 뎅기바이러스 헬리케이즈와 지카바이러스 헬리케이즈가 ssRNA substrate와 결합하는 부위가 굉장히 유사한 것으로 밝혀져 있다(12904-12920 Nucleic Acids Research, 2017, Vol. 45, No. 22).In the case of helicases, the amino acid sequences of the enzyme active sites are very similarly conserved in the flaviviruses, and these sequences are known to contribute to the recognition of viral RNA. It is known to have similar functions (contributing to hydrogen bonding, hydrophobic interactions, etc. with adjacent specific sequences) and to enzymatic activity. For example, the sites where dengue virus helicases and zika virus helicases bind to ssRNA substrates have been found to be very similar (12904-12920 Nucleic Acids Research, 2017, Vol. 45, No. 22).
본 발명의 약학적 조성물은 상기 물질들을 포함하여 제형화된 것일 수 있다.The pharmaceutical composition of the present invention may be formulated containing the above substances.
본 발명의 약학적 조성물은 임의의 투여 경로를 통한 전달을 위해 제형화될 수 있다. "투여 경로"는 에어로졸, 비강, 경구, 경점막, 경피, 비경구 또는 장을 포함하지만, 이들로 제한되지 않는 당업계에 공지된 임의의 투여 경로를 지칭할 수 있다.The pharmaceutical compositions of the present invention may be formulated for delivery via any route of administration. "Route of administration" can refer to any route of administration known in the art including, but not limited to, aerosol, nasal, oral, transmucosal, transdermal, parenteral or intestine.
본 발명의 약학적 조성물은 또한 임의의 약제학적으로 허용가능한 담체를 함유할 수 있다. 본 명세서에 사용된 바와 같은 "약제학적으로 허용가능한 담체"는 하나의 조직, 기관 또는 신체의 부분으로부터 다른 조직, 기관 또는 신체의 일부까지 관심 대상의 화합물을 운반하거나 또는 수송하는데 수반되는 약제학적으로 허용가능한 물질, 조성물 또는 비히클을 지칭한다. 예를 들어, 담체는 액체 또는 고체 충전제, 희석제, 부형제, 용매 또는 캡슐화 물질 또는 이들의 조합물일 수 있다. 담체의 각각의 구성성분은 "약제학적으로 허용가능"하여야 하며, 즉, 제형의 다른 성분과 양립가능하여야 한다. 또한 그것이 접촉될 수 있는 임의의 조직 또는 기관과 접촉 시 사용에 적합하여야 하는데, 이는 그것이 독성, 자극, 알레르기 반응, 면역원성 또는 그의 치료적 이점보다 지나치게 더 큰 임의의 다른 합병증의 위험을 수반하지 않아야 한다.The pharmaceutical composition of the present invention may also contain any pharmaceutically acceptable carrier. As used herein, a "pharmaceutically acceptable carrier" is a pharmaceutical composition involved in the transport or transport of a compound of interest from one tissue, organ or part of the body to another tissue, organ or part of the body. It refers to acceptable materials, compositions or vehicles. For example, the carrier may be a liquid or solid filler, diluent, excipient, solvent or encapsulating material or combinations thereof. Each component of the carrier must be "pharmaceutically acceptable", ie compatible with the other ingredients of the formulation. It should also be suitable for use when in contact with any tissue or organ to which it can be contacted, which should not involve the risk of any other complications that are too great than toxic, irritant, allergic reactions, immunogenicity or its therapeutic advantages. do.
본 발명의 조성물은 플라비바이러스 감염증을 예방하고자 하는 개체 또는 플라비바이러스 감염증을 겪는 개체에게 투여될 수 있다. 상기 개체는 인간을 포함한 포유류일 수 있고, 구체적으로는 인간일 수 있다.The composition of the present invention may be administered to an individual who is trying to prevent a flavivirus infection or to an individual suffering from a flavivirus infection. The subject may be a mammal, including a human, and specifically a human.
본 발명의 약학적 조성물은 치료적 유효량으로 전달될 수 있다. 정확한 치료적 유효량은 주어진 대상체에서 치료 효능에 대해 가장 효과적인 결과를 수득하는 조성물의 해당량이다. 이 양은 치료 화합물의 특징(활성, 약동학, 약력학 및 생체활성을 포함), 대상체의 생리적 조건(연령, 성별, 질환 유형 및 병기, 일반적 신체 건강상태, 주어진 투약량에 대한 반응 및 의약의 유형을 포함함), 제형 내 약제학적으로 허용가능한 담체 또는 담체들의 특성, 및 투여 경로를 포함하지만, 이들로 제한되지 않는 다수의 인자에 따라서 다를 것이다. 임상 및 약리학 분야에서 당업자는, 예를 들어 화합물의 투여에 대한 대상체의 반응을 모니터링하고 그에 따라 투약량을 조절함으로써 일상적인 실험을 통해 치료적 유효량을 결정할 것이다.The pharmaceutical composition of the present invention may be delivered in a therapeutically effective amount. The exact therapeutically effective amount is that amount of the composition that produces the most effective result for therapeutic efficacy in a given subject. This amount includes the characteristics of the therapeutic compound (including activity, pharmacokinetics, pharmacodynamics and bioactivity), the physiological condition of the subject (age, sex, disease type and stage, general physical health, response to a given dosage and type of medicament) ), The nature of the pharmaceutically acceptable carrier or carriers in the formulation, and the route of administration, and will depend upon a number of factors. One skilled in the clinical and pharmacological arts will determine the therapeutically effective amount through routine experimentation, for example by monitoring the subject's response to administration of the compound and adjusting the dosage accordingly.
또한, 본 발명은 플라비바이러스 생육 저해 또는 사멸용 조성물에 관한 것이다.The present invention also relates to a composition for inhibiting or killing flavivirus growth.
본 발명의 조성물은 겐타마이신 설페이트(Gentamicin Sulfate), 네틸마이신(Netilmicin), 토브라마이신(Tobramycin), 파로모마이신(Paromomycin), 아미카신(Amikacin), 카프레오마이신(Capreomycin), 트리플루오페라진(Trifluoperazine), 디하이드로스트렙토마이신(Dihydrostreptomycin), 히드록시클로로퀸(Hydroxychloroquine), 티오리다진 HCl(Thioridazine HCl), 에파비렌즈(Efavirenz), 밀테포신(Miltefosine), 니스타틴(Nystatin), 미카펀진(Micafungin), 블레오마이신(Bleomycin), 레스미노스타트(Resminostat), 몬테루카스트(Montelukast), 노르플록사신(Norfloxacin), 네다플라틴(Nedaplatin)
및 세팔로신(Cephalothin) 중 적어도 하나; 또는 이들의 약학적으로 허용되는 염 중 적어도 하나;를 포함한다.The composition of the present invention is a gentamicin sulfate (Gentamicin Sulfate), netylmicin (Netilmicin), Tobramycin (Pabraomycin), Paromomycin (Amikacin), Capreomycin (Capreomycin), Trifluoropera Trifluoperazine, Dihydrostreptomycin, Hydroxychloroquine, Thioridazine HCl, Efavirenz, Miltefosine, Nystatin, Nystatin (Micafungin), bleomycin, lesminostat, montelukast, norfloxacin, nedaplatin And at least one of cephalothin; Or at least one of their pharmaceutically acceptable salts.
구체적인 일 구현예에 따르면 겐타마이신 설페이트(Gentamicin Sulfate), 네틸마이신(Netilmicin), 토브라마이신(Tobramycin), 파로모마이신(Paromomycin), 아미카신(Amikacin), 카프레오마이신(Capreomycin), 트리플루오페라진(Trifluoperazine), 디하이드로스트렙토마이신(Dihydrostreptomycin), 히드록시클로로퀸(Hydroxychloroquine), 티오리다진 HCl(Thioridazine HCl), 레스미노스타트(Resminostat), 몬테루카스트(Montelukast), 노르플록사신(Norfloxacin) 및 네다플라틴(Nedaplatin) 중 적어도 하나; 또는 이들의 약학적으로 허용되는 염 중 적어도 하나;를 포함할 수 있다.According to a specific embodiment, gentamicin sulfate (Gentamicin Sulfate), netylmicin (Netilmicin), tobramycin (Tobramycin), Paromomycin (Aromikacin), Capreomycin (Capreomycin), tripleru Trifluoperazine, Dihydrostreptomycin, Hydroxychloroquine, Thioridazine HCl, Resminostat, Montelukast, Norfloxacin and Norfloxacin At least one of daplatin; Or at least one of pharmaceutically acceptable salts thereof.
또한, 구체적인 일 구현예에 따르면 에파비렌즈(Efavirenz), 밀테포신(Miltefosine), 니스타틴(Nystatin), 미카펀진(Micafungin), 블레오마이신(Bleomycin) 및 세팔로신(Cephalothin) 중 적어도 하나; 또는 이들의 약학적으로 허용되는 염 중 적어도 하나;를 포함할 수 있다.Further, according to a specific embodiment, at least one of Efavirenz, Miltefosine, Milstatin, Nystatin, Micafungin, Bleomycin, and Cephalothin; Or at least one of pharmaceutically acceptable salts thereof.
또한, 구체적인 일 구현예에 따르면 토브라마이신, 트리플루오페라진 2HCl, 아미카이신 수화물, 히드록시클로로퀸 황산염, 티오리다진 HCl, 디하이드로스트렙토마이신 황산염, 겐타마이신 황산염, 네틸마이신 황산염, 카프레오마이신 황산염, 파로모마이신 황산염, 레스미노스타트, 몬테루카스트, 노르플록사신, 네다플라틴, 블레오마이신, 니스타틴, 세팔로신, 미카펀진 나트륨, 에파비렌즈 및 밀테포신 중 적어도 하나; 또는 이들의 약학적으로 허용되는 염 중 적어도 하나;를 포함할 수 있다.Further, according to one specific embodiment, tobramycin, trifluoroperazine 2HCl, amikacin hydrate, hydroxychloroquine sulfate, thiolidazine HCl, dihydrostreptomycin sulfate, gentamicin sulfate, netylmycin sulfate, capreomycin At least one of sulfate, paromomycin sulfate, resminostat, montelukast, norfloxacin, nedaplatin, bleomycin, nystatin, cephalosin, mycafungin sodium, epavirenz and mittefosin; Or at least one of pharmaceutically acceptable salts thereof.
본 발명의 조성물은 플라비바이러스 속의 다양한 종의 생육을 저해시키거나 사멸시킬 수 있다. 예를 들면 아포이 바이러스(Apoi virus), 아로아 바이러스(Aroa virus), 바가자 바이러스(Bagaza virus), 반지 바이러스(Banzi virus), 보우부이 바이러스(Bouboui virus), 부카라사 배트 바이러스(Bukalasa bat virus), 카시파코레 바이러스(Cacipacore virus), 캐리섬 바이러스(Carey Island virus), 카우본 릿지 바이러스(Cowbone Ridge virus), 다카르 배트 바이러스(Dakar bat virus), 뎅기 바이러스(Dengue virus), 엣지 힐 바이러스(Edge Hill virus), 엔데뻬 배트 바이러스(Entebbe bat virus), 가젯 굴리 바이러스(Gadgets Gully virus), 일헤우스 바이러스(Ilheus virus), 이스라엘 터키 뇌수막척수염 바이러스(Israel turkey meningoencephalomyelitis virus), 일본 뇌염 바이러스(Japanese encephalitis virus), 주그라 바이러스(Jugra virus), 주티아파 바이러스(Jutiapa virus), 카담 바이러스(Kadam virus), 케도구 바이러스(Kedougou virus), 코코베라 바이러스(Kokobera virus), 코탱고 바이러스(Koutango virus), 캬사누 포레스트 질병 바이러스(Kyasanur Forest disease virus), 란갓 바이러스(Langat virus), 도약병 바이러스(Louping ill virus), 미반 바이러스(Meaban virus), 모독 바이러스(Modoc virus), 몬타나 미오티스 류코엔세팔리티스 바이러스(Montana myotis leukoencephalitis virus), 머레이 밸리 엔세팔리티스 바이러스(Murray Valley encephalitis virus), 은타야 바이러스(Ntaya virus), 옴스크 출혈열 바이러스(Omsk hemorrhagic fever virus), 프놈펜 배트 바이러스(Phnom Penh bat virus), 포와산 바이러스(Powassan virus), 리오 브라보 바이러스(Rio Bravo virus), 로얄 팜 바이러스(Royal Farm virus), 사보야 바이러스(Saboya virus), 세인트루이스 엔세팔리티스 바이러스(Saint Louis encephalitis virus), 살 비에야 바이러스(Sal Vieja virus), 산 퍼리타 바이러스(San Perlita virus), 사우마레즈 잎 바이러스(Saumarez Reef virus), 세픽 바이러스(Sepik virus), 템부수 바이러스(Tembusu virus), 진드기 매개 뇌염 바이러스(Tick-borne encephalitis virus), 튤레니 바이러스(Tyuleniy virus), 우간다 S 바이러스(Uganda S virus), 우수투 바이러스(Usutu virus), 웨셀스브론 바이러스(Wesselsbron virus), 웨스트 나일 바이러스(West Nile virus), 야오운데 바이러스(Yaounde virus), 황열 바이러스(Yellow fever virus), 요코세 바이러스(Yokose virus), 지카 바이러스(Zika virus) 등일 수 있으며, 구체적으로는 뎅기바이러스일 수 있고, 보다 구체적으로는 뎅기바이러스 serotype2일 수 있으나, 이에 제한되는 것은 아니다.The compositions of the present invention can inhibit or kill the growth of various species of the Flavivirus genus. For example, Apoi virus, Aroa virus, Bagaza virus, Banzi virus, Bouboui virus, Bucarasa bat virus , Cacipacore virus, Carey Island virus, Cowbone Ridge virus, Dakar bat virus, Dengue virus, Edge Hill virus Hill virus, Entebbe bat virus, Gadgets Gully virus, Ilheus virus, Israel turkey meningoencephalomyelitis virus, Japanese encephalitis virus ), Jugra virus, Jutiapa virus, Kadam virus, Kedougou virus, Cocovera virus kobera virus, Kotango virus, Kyasanur Forest disease virus, Langat virus, Louping ill virus, Meaban virus, blasphemy virus ( Modoc virus, Montana myotis leukoencephalitis virus, Murray Valley encephalitis virus, Ntaya virus, Omsk hemorrhagic fever virus ), Phnom Penh bat virus, Powassan virus, Rio Bravo virus, Royal Farm virus, Saboya virus, St. Louis Encephalitis Virus (Saint Louis encephalitis virus), Sal Vieja virus, San Perlita virus, Saumarez leaf virus (Sauma) rez Reef virus, Sepik virus, Tembusu virus, Tick-borne encephalitis virus, Tyuleniy virus, Uganda S virus, Excellent Usutu virus, Wesselsbron virus, West Nile virus, Yaounde virus, Yellow fever virus, Yokose virus, Zika Virus (Zika virus), and the like, specifically, dengue virus, and more specifically, dengue virus serotype2, but are not limited thereto.
본 발명의 조성물은 앞서 예시한 약학적 조성물과 같이 제형화될 수 있으나, 이에 제한되는 것은 아니다.The composition of the present invention may be formulated as the pharmaceutical composition illustrated above, but is not limited thereto.
또한, 본 발명은 겐타마이신 설페이트(Gentamicin Sulfate), 네틸마이신(Netilmicin), 토브라마이신(Tobramycin), 파로모마이신(Paromomycin), 아미카신(Amikacin), 카프레오마이신(Capreomycin), 트리플루오페라진(Trifluoperazine), 디하이드로스트렙토마이신(Dihydrostreptomycin), 히드록시클로로퀸(Hydroxychloroquine), 티오리다진 HCl(Thioridazine HCl), 에파비렌즈(Efavirenz), 밀테포신(Miltefosine), 니스타틴(Nystatin), 미카펀진(Micafungin), 블레오마이신(Bleomycin), 레스미노스타트(Resminostat), 몬테루카스트(Montelukast), 노르플록사신(Norfloxacin), 네다플라틴(Nedaplatin)
및 세팔로신(Cephalothin) 중 적어도 하나; 또는 이들의 약학적으로 허용되는 염 중 적어도 하나;의 플라비바이러스 감염증 예방 또는 치료용 조성물의 제조를 위한 용도에 관한 것이다.In addition, the present invention is a gentamicin sulfate (Gentamicin Sulfate), netylmicin (Netilmicin), Tobramycin (Tobramycin), Paromomycin (Aromikacin), Capreomycin (Capreomycin), Trifluoropera Trifluoperazine, Dihydrostreptomycin, Hydroxychloroquine, Thioridazine HCl, Efavirenz, Miltefosine, Nystatin, Nystatin (Micafungin), bleomycin, lesminostat, montelukast, norfloxacin, nedaplatin And at least one of cephalothin; Or at least one of pharmaceutically acceptable salts thereof; and relates to a use for the preparation of a composition for preventing or treating flavivirus infection.
구체적인 일 구현예에 따르면 겐타마이신 설페이트(Gentamicin Sulfate), 네틸마이신(Netilmicin), 토브라마이신(Tobramycin), 파로모마이신(Paromomycin), 아미카신(Amikacin), 카프레오마이신(Capreomycin), 트리플루오페라진(Trifluoperazine), 디하이드로스트렙토마이신(Dihydrostreptomycin), 히드록시클로로퀸(Hydroxychloroquine), 티오리다진 HCl(Thioridazine HCl), 레스미노스타트(Resminostat), 몬테루카스트(Montelukast), 노르플록사신(Norfloxacin) 및 네다플라틴(Nedaplatin) 중 적어도 하나; 또는 이들의 약학적으로 허용되는 염 중 적어도 하나;를 사용할 수 있다.According to a specific embodiment, gentamicin sulfate (Gentamicin Sulfate), netylmicin (Netilmicin), tobramycin (Tobramycin), Paromomycin (Aromikacin), Capreomycin (Capreomycin), tripleru Trifluoperazine, Dihydrostreptomycin, Hydroxychloroquine, Thioridazine HCl, Resminostat, Montelukast, Norfloxacin and Norfloxacin At least one of daplatin; Or at least one of their pharmaceutically acceptable salts.
또한, 구체적인 일 구현예에 따르면 에파비렌즈(Efavirenz), 밀테포신(Miltefosine), 니스타틴(Nystatin), 미카펀진(Micafungin), 블레오마이신(Bleomycin) 및 세팔로신(Cephalothin) 중 적어도 하나; 또는 이들의 약학적으로 허용되는 염 중 적어도 하나;를 사용할 수 있다.Further, according to a specific embodiment, at least one of Efavirenz, Miltefosine, Milstatin, Nystatin, Micafungin, Bleomycin, and Cephalothin; Or at least one of their pharmaceutically acceptable salts.
또한, 구체적인 일 구현예에 따르면 토브라마이신, 트리플루오페라진 2HCl, 아미카이신 수화물, 히드록시클로로퀸 황산염, 티오리다진 HCl, 디하이드로스트렙토마이신 황산염, 겐타마이신 황산염, 네틸마이신 황산염, 카프레오마이신 황산염, 파로모마이신 황산염, 레스미노스타트, 몬테루카스트, 노르플록사신, 네다플라틴, 블레오마이신, 니스타틴, 세팔로신, 미카펀진 나트륨, 에파비렌즈 및 밀테포신 중 적어도 하나; 또는 이들의 약학적으로 허용되는 염 중 적어도 하나;를 사용할 수 있다.Further, according to one specific embodiment, tobramycin, trifluoroperazine 2HCl, amikacin hydrate, hydroxychloroquine sulfate, thiolidazine HCl, dihydrostreptomycin sulfate, gentamicin sulfate, netylmycin sulfate, capreomycin At least one of sulfate, paromomycin sulfate, resminostat, montelukast, norfloxacin, nedaplatin, bleomycin, nystatin, cephalosin, mycafungin sodium, epavirenz and mittefosin; Or at least one of their pharmaceutically acceptable salts.
본 발명의 용도에서의 플라비바이러스 감염증은 전술한 바이러스에 의해 유발된 것일 수 있다.Flavivirus infections in the use of the present invention may be caused by the aforementioned viruses.
전술한 바와 같이, 상기 화합물(약물) 또는 이들의 약학적으로 허용되는 염은 우수한 플라비바이러스 생육 저해, 사멸 효과를 나타내어 플라비바이러스 감염증의 예방 또는 치료용 조성물의 제조에 사용될 수 있다.As described above, the compounds (drugs) or pharmaceutically acceptable salts thereof may exhibit excellent flavivirus growth inhibition and killing effects, and thus may be used in the preparation of a composition for preventing or treating flavivirus infection.
또한, 본 발명은 겐타마이신 설페이트(Gentamicin Sulfate), 네틸마이신(Netilmicin), 토브라마이신(Tobramycin), 파로모마이신(Paromomycin), 아미카신(Amikacin), 카프레오마이신(Capreomycin), 트리플루오페라진(Trifluoperazine), 디하이드로스트렙토마이신(Dihydrostreptomycin), 히드록시클로로퀸(Hydroxychloroquine), 티오리다진 HCl(Thioridazine HCl), 에파비렌즈(Efavirenz), 밀테포신(Miltefosine), 니스타틴(Nystatin), 미카펀진(Micafungin), 블레오마이신(Bleomycin), 레스미노스타트(Resminostat), 몬테루카스트(Montelukast), 노르플록사신(Norfloxacin), 네다플라틴(Nedaplatin)
및 세팔로신(Cephalothin) 중 적어도 하나; 또는 이들의 약학적으로 허용되는 염 중 적어도 하나;를 개체에 투여하는 플라비바이러스 감염증의 예방 또는 치료 방법에 관한 것이다.In addition, the present invention is a gentamicin sulfate (Gentamicin Sulfate), netylmicin (Netilmicin), Tobramycin (Tobramycin), Paromomycin (Aromikacin), Capreomycin (Capreomycin), Trifluoropera Trifluoperazine, Dihydrostreptomycin, Hydroxychloroquine, Thioridazine HCl, Efavirenz, Miltefosine, Nystatin, Nystatin (Micafungin), bleomycin, lesminostat, montelukast, norfloxacin, nedaplatin And at least one of cephalothin; Or at least one of pharmaceutically acceptable salts thereof; and a method for preventing or treating flavivirus infection.
구체적인 일 구현예에 따르면 겐타마이신 설페이트(Gentamicin Sulfate), 네틸마이신(Netilmicin), 토브라마이신(Tobramycin), 파로모마이신(Paromomycin), 아미카신(Amikacin), 카프레오마이신(Capreomycin), 트리플루오페라진(Trifluoperazine), 디하이드로스트렙토마이신(Dihydrostreptomycin), 히드록시클로로퀸(Hydroxychloroquine), 티오리다진 HCl(Thioridazine HCl), 레스미노스타트(Resminostat), 몬테루카스트(Montelukast), 노르플록사신(Norfloxacin) 및 네다플라틴(Nedaplatin) 중 적어도 하나; 또는 이들의 약학적으로 허용되는 염 중 적어도 하나;를 투여할 수 있다.According to a specific embodiment, gentamicin sulfate (Gentamicin Sulfate), netylmicin (Netilmicin), tobramycin (Tobramycin), Paromomycin (Aromikacin), Capreomycin (Capreomycin), tripleru Trifluoperazine, Dihydrostreptomycin, Hydroxychloroquine, Thioridazine HCl, Resminostat, Montelukast, Norfloxacin and Norfloxacin At least one of daplatin; Or at least one of their pharmaceutically acceptable salts.
또한, 구체적인 일 구현예에 따르면 에파비렌즈(Efavirenz), 밀테포신(Miltefosine), 니스타틴(Nystatin), 미카펀진(Micafungin), 블레오마이신(Bleomycin) 및 세팔로신(Cephalothin) 중 적어도 하나; 또는 이들의 약학적으로 허용되는 염 중 적어도 하나;를 투여할 수 있다.Further, according to a specific embodiment, at least one of Efavirenz, Miltefosine, Milstatin, Nystatin, Micafungin, Bleomycin, and Cephalothin; Or at least one of their pharmaceutically acceptable salts.
또한, 구체적인 일 구현예에 따르면 토브라마이신, 트리플루오페라진 2HCl, 아미카이신 수화물, 히드록시클로로퀸 황산염, 티오리다진 HCl, 디하이드로스트렙토마이신 황산염, 겐타마이신 황산염, 네틸마이신 황산염, 카프레오마이신 황산염, 파로모마이신 황산염, 레스미노스타트, 몬테루카스트, 노르플록사신, 네다플라틴, 블레오마이신, 니스타틴, 세팔로신, 미카펀진 나트륨, 에파비렌즈 및 밀테포신 중 적어도 하나; 또는 이들의 약학적으로 허용되는 염 중 적어도 하나;를 투여할 수 있다.Further, according to one specific embodiment, tobramycin, trifluoroperazine 2HCl, amikacin hydrate, hydroxychloroquine sulfate, thiolidazine HCl, dihydrostreptomycin sulfate, gentamicin sulfate, netylmycin sulfate, capreomycin At least one of sulfate, paromomycin sulfate, resminostat, montelukast, norfloxacin, nedaplatin, bleomycin, nystatin, cephalosin, mycafungin sodium, epavirenz and mittefosin; Or at least one of their pharmaceutically acceptable salts.
상기 개체는 플라비바이러스 감염증에 감염될 수 있는 모든 개체일 수 있고, 구체적으로 인간을 포함하는 포유류, 보다 구체적으로 인간일 수 있으나, 이에 제한되는 것은 아니다.The individual may be any individual that may be infected with Flavivirus infection, and specifically, may be a mammal including a human, more specifically a human, but is not limited thereto.
플라비바이러스 감염증은 전술한 바이러스에 의해 유발된 것일 수 있다.Flavivirus infections may be caused by the viruses described above.
이하, 본 발명을 구체적으로 설명하기 위해 실시예를 들어 상세하게 설명하기로 한다. Hereinafter, the present invention will be described in detail with reference to Examples.
실시예Example
1. 방법1. How to
(1) 세포 생존율 평가(1) cell viability evaluation
CCK-8 분석은 제조자의 지시에 따라 수행 하였다.CCK-8 analysis was performed according to the manufacturer's instructions.
실험 전에, VeroE6 세포를 각각 10.5 x 10
4 세포/cm
2, 7.0 x 10
4 세포/cm
2의 밀도로 파종하였다. 37 ℃, 5 % CO
2에서 24 시간 배양한 후, 몬테루카스트를 48시간 동안 연속 희석된 농도로 처리하였다. CCK-8 시약을 각 군에 10 % v/v의 농도로 처리하고 통상적인 세포 배양 조건에서 1~4 시간 동안 배양하였다. 비색 강도의 변화에 대한 정량 분석은 마이크로 플레이트 판독기(Molecular Devices, Inc., USA)를 사용하여 450 nm에서 포르마잔염의 광학 밀도를 측정함으로써 수행되었다. 실험은 평균 ± SEM으로 나타낸 데이터를 3 중으로 수행 하였다.Prior to the experiment, VeroE6 cells were seeded at densities of 10.5 × 10 4 cells / cm 2 and 7.0 × 10 4 cells / cm 2 , respectively. After 24 hours of incubation at 37 ° C., 5% CO 2 , montelukast was treated at a continuously diluted concentration for 48 hours. CCK-8 reagents were treated in each group at a concentration of 10% v / v and incubated for 1-4 hours at normal cell culture conditions. Quantitative analysis of changes in colorimetric intensity was performed by measuring the optical density of formazan salt at 450 nm using a microplate reader (Molecular Devices, Inc., USA). The experiment was performed in triplicate with data represented as mean ± SEM.
(2) 세포 내 바이러스 감염 실험의 실험군(2) Experimental group of intracellular virus infection experiment
실험 전에, VeroE6 세포를 각각 10.5 x 10
4 세포/cm
2, 7.0 x 10
4 세포/cm
2의 밀도로 파종하였다. 37 ℃, 5 % CO
2에서 24 시간 배양한 후, 뎅기바이러스 serotype2를 2시간 동안 무혈청 배지에서 각각 0.1, 0.5 및 2.5의 MOI로 각 세포 컬쳐에 접종하였다. 배양 플레이트를 매 30 분마다 부드럽게 흔들어 세포에 바이러스를 균일하게 분포시켰다. 몬테루카스트 용액은 0.75% 메틸 셀룰로오스를 함유하는 각각의 완전한 배양 배지에서 연속 희석된 농도로 제조하였다. 인큐베이션 후, 바이러스 배지를 제거하고 세포를 멸균된 PBS로 한번 세척한 후, 화합물 용액을 처리 하였다. 세포를 배양 챔버 아래에서 48시간 동안 배양하였다. 배양 후, 각 군은 초점 형성 분석(FFA) 및 상대 바이러스성 RNA 발현 분석을 위해 준비되었다. FFA의 경우, 화합물 용액을 제거하고 멸균된 PBS로 세포를 한 번 세척한 다음 4 % 파라포름 알데히드로 고정시켰다. 바이러스 RNA 발현 분석을 위해 세포를 TRIZOL로 세척한 후 추가 분석을 위해 -70 ℃에서 보관하였다.Prior to the experiment, VeroE6 cells were seeded at densities of 10.5 × 10 4 cells / cm 2 and 7.0 × 10 4 cells / cm 2 , respectively. After 24 hours of incubation at 37 ° C., 5% CO 2 , dengue virus serotype2 was inoculated into each cell culture with MOI of 0.1, 0.5 and 2.5, respectively, in serum-free medium for 2 hours. The culture plate was shaken gently every 30 minutes to evenly distribute the virus in the cells. Montelukast solutions were prepared at serially diluted concentrations in each complete culture medium containing 0.75% methyl cellulose. After incubation, virus medium was removed and cells were washed once with sterile PBS and then treated with compound solution. The cells were incubated for 48 hours under the culture chamber. After incubation, each group was prepared for focal formation assay (FFA) and relative viral RNA expression analysis. For FFA, the compound solution was removed and the cells washed once with sterile PBS and then fixed with 4% paraform aldehyde. Cells were washed with TRIZOL for viral RNA expression analysis and stored at −70 ° C. for further analysis.
(3) 초점 형성 분석 (FFA)(3) focal formation analysis (FFA)
FFA를 DV serotype2의 NS1 단백질에 대해 수행하였다. 4 % 파라 포름 알데히드로 고정된 세포를 PBS로 3회 세정하였다. 블로킹 용액을 실온에서 1시간 동안 처리하였다. PBS로 세척한 후 1 차 항체 (Mouse anti-Flavivirus NS1, 1 : 2000)를 실온에서 2 시간 또는 4 ℃에서 밤새 각 군에 처리하였다. PBS로 세척 한 후, 2 차 항체(항 - 마우스 IgG-FITC, 1 : 500)를 각 그룹에 실온에서 1시간 동안 적용하였다. 헹굼 후, HOECHST 33342 10㎍/㎖를 함유하는 PBS를 핵 염색을 위해 각 군에 처리하였다. 형광으로 염색된 바이러스성 포커스 형성 단위를 관찰하고 현미경(Olympus, Japan)으로 분석 하였다.FFA was performed on NS1 protein of DV serotype2. 4% paraformaldehyde fixed cells were washed three times with PBS. The blocking solution was treated for 1 hour at room temperature. After washing with PBS, the primary antibody (Mouse anti-Flavivirus NS1, 1: 2000) was treated in each group for 2 hours at room temperature or overnight at 4 ° C. After washing with PBS, a secondary antibody (anti-mouse IgG-FITC, 1: 500) was applied to each group for 1 hour at room temperature. After rinsing, PBS containing 10 μg / ml HOECHST 33342 was treated in each group for nuclear staining. Fluorescent stained viral focus forming units were observed and analyzed under a microscope (Olympus, Japan).
(4) 동물 실험(4) animal experiment
AG129 마우스(129/Sv IFN-α/β, -γ 수용체 결핍)를 Marshall BioResources (Aldbrough, UK)로부터 구입 하였다. 모든 실험 절차는 전북 대학교 IACUC에 의해 사전 승인되었으며, 실험 동물 관리 협회 평가 및 권고에 대한 지침에 따라 수행되었다. DV가 모기에 의해 전염되면서 예상치 못한 접촉과 오염을 피하기 위해 필터 커버가 있는 케이지가 사용되었다.AG129 mice (129 / Sv IFN-α / β, -γ receptor deficiency) were purchased from Marshall BioResources (Aldbrough, UK). All experimental procedures were pre-approved by Chonbuk National University IACUC and were performed in accordance with the Guidelines for Laboratory Animal Care Association Evaluation and Recommendations. As DV was spread by mosquitoes, cages with filter covers were used to avoid unexpected contact and contamination.
(5) 생체 내 바이러스 감염 실험을 위한 실험군(5) Experimental group for in vivo virus infection experiment
감염에 대한 적절한 바이러스 역가를 결정하기 위해, AG129 마우스 (10-12 주)에게 10
6, 5 x 10
6 및 10
7 FFU의 다양한 바이러스 역가를 복강 내 주사하여 접종하였다. 몬테루카스트의 항바이러스성을 평가하기 위해 AG129 마우스(10-12 주)에게 10
7 FFU (IP)를 주사한 다음 200 ㎕의 montelukast (IP, 10 mg / kg / day) 또는 PBS를 투여했다. 약물 치료는 하루에 한 번 수행되었다. 음성 대조구(감염되지 않은 그룹)는 바이러스 대신 PBS (IP) 300 ㎕를 투여하였다. 마약 통제 그룹의 경우, 몬테루카스트 200 ㎕ (IP, 10 mg/kg/day)를 전염되지 않은 AG129 마우스에게 단독으로 투여하였다.To determine the appropriate viral titer for infection, AG129 mice (10-12 weeks) were inoculated by intraperitoneal injection of various viral titers of 10 6 , 5 × 10 6 and 10 7 FFU. To assess the antivirality of montelukast, AG129 mice (10-12 weeks) were injected with 10 7 FFU (IP) and then 200 μl of montelukast (IP, 10 mg / kg / day) or PBS. Medication was performed once a day. Negative controls (uninfected group) received 300 μl of PBS (IP) instead of virus. For the drug control group, 200 μl of montelukast (IP, 10 mg / kg / day) was administered alone to uninfected AG129 mice.
(6) 마우스 체중 감량 및 생존율 분석(6) mouse weight loss and survival analysis
체중 감소 및 사망률 상태를 매일 모니터링했다. 생존 분석에서 심각한 질병 관련 증상이나 급격한 체중 감소를 보이는 안락사된 마우스는 전시가 끝난 현재 사망자로 기록되었다. 각 체중을 0 일에 대한 상대 백분율로 분석하였다.Weight loss and mortality status were monitored daily. In the survival analysis, euthanized mice with severe disease-related symptoms or rapid weight loss were recorded as current deaths after the war. Each body weight was analyzed as a relative percentage of 0 days.
(7) 바이러스 혈증 분석, 전혈 RNA 발현 분석(7) Viremia analysis, whole blood RNA expression analysis
3 일째에, 각 마우스로부터 혈액을 수집하고 EDTA가 코팅된 항응고제 튜브로 옮겼다. 10 분 동안 흔들어서 부드럽게 섞은 후, HEMAVET 950FS (Drew Scientific)을 사용하여 20 ㎕의 각 샘플을 완전한 혈구 수로 분석했다. 각 인자의 측정 값은 감염되지 않은 대조군의 것에 대하여 반 정량 분석되었다. 사이토카인의 혈증과 발현 변화를 분석하기 위해 혈장을 8000g, 4 ℃에서 15 분 동안 원심분리하여 분리하였다. 플라스마 바이러스 역가(viremia)와 전혈에서의 바이러스성 RNA 발현을 정량적 실시간 PCR(qRT-PCR)로 분석 하였다. 모든 샘플을 제조자의 지시 (BD Biosciences, USA)에 따라 분석 하였다.On day 3, blood was collected from each mouse and transferred to an EDTA coated anticoagulant tube. After shaking for 10 minutes and gently mixing, 20 μl of each sample was analyzed by complete blood count using HEMAVET 950FS (Drew Scientific). The measured value of each factor was semi-quantified against that of the uninfected control. Plasma was isolated by centrifugation at 8000 g and 4 ° C. for 15 minutes to analyze the cytokine hematocrit and expression changes. Plasma virus titer and viral RNA expression in whole blood were analyzed by quantitative real-time PCR (qRT-PCR). All samples were analyzed according to manufacturer's instructions (BD Biosciences, USA).
(8) 마우스 검시(8) mouse necropsy
3 일째에, 마우스를 각 그룹으로부터 희생시켰다(n = 6). 바이러스 RNA 발현 분석 및 조직 병리학 분석을 위해 장기 샘플(비장, 간, 폐, 소장 및 대장)을 수집하고 준비했다. 비장은 비장 비대를 측정하기 위해 계량되었다. 바이러스 RNA 발현 분석을 위해 비장, 간 및 폐의 절반을 균질화하고 TRIZOL 시약으로 처리한 후 추가 분석을 위해 -70℃에서 보관하였다. 동일한 절차가 소장과 대장의 전체 샘플에 적용되었다. 비장, 간 및 폐의 다른 절반은 고정을 위해 4 % 파라포름 알데히드에 담궈 4℃에 보관했다.On day 3 mice were sacrificed from each group (n = 6). Organ samples (spleen, liver, lung, small intestine and large intestine) were collected and prepared for viral RNA expression analysis and histopathology analysis. The spleen was weighed to measure splenomegaly. Half of the spleen, liver and lung were homogenized for viral RNA expression analysis and treated with TRIZOL reagent and stored at -70 ° C for further analysis. The same procedure was applied to the entire sample of the small and large intestine. The other half of the spleen, liver and lungs were soaked in 4% paraformaldehyde for storage and stored at 4 ° C.
(9) 상대적 바이러스 RNA 발현 수준 분석(9) Relative viral RNA expression level analysis
수집된 표본의 바이러스 RNA 발현 변화를 조사하기 위해 TRIZOL 시약으로 처리한 세포 기반 및 동물계 샘플에서 RNA를 분리한 후 지침서에 따라 MLVRT ™ 역전사 효소에 의한 cDNA 합성을 실시하였다.RNA was isolated from cell-based and animal-based samples treated with TRIZOL reagents to investigate viral RNA expression changes in the collected samples, followed by cDNA synthesis by MLVRT ™ reverse transcriptase according to the instructions.
표적 유전자 증폭을 위해, 각 프라이머는 50 % 미만의 GC 함량 및 약 100 bps의 예상 앰플 리콘 크기를 갖는 표적 유전자의 2 개의 엑손 사이의 중첩을 고려하여 설계되었다. 프라이머 서열은 표 2에 나타낸 바와 같이 확인되었다. 정량 실시간 PCR (qRT-PCR)은 바이러스 RNA를 정량하기 위해 수행되었다. 각 반응은 SYBR 녹색 마스터 믹스를 사용하여 20μL 부피로 수행되었다. Quantstudio3 ™ (Applied Biosystems Inc., USA)는 2 단계 증폭 과정에서이 연구에 사용되었다. 바이러스 혈증의 분석을 위해, 바이러스 역가(FFU / mL)와 상응하는 역치주기 (CT) 값 사이에 선형 상관 표준 곡선이 확립되었다.For target gene amplification, each primer was designed taking into account the overlap between two exons of the target gene with a GC content of less than 50% and an expected amplicon size of about 100 bps. Primer sequences were identified as shown in Table 2. Quantitative real time PCR (qRT-PCR) was performed to quantify viral RNA. Each reaction was performed in 20 μL volume using SYBR green master mix. Quantstudio3 ™ (Applied Biosystems Inc., USA) was used for this study in the two step amplification process. For the analysis of viremia, a linear correlation standard curve was established between the viral titer (FFU / mL) and the corresponding threshold cycle (CT) value.
혈장 내 바이러스는 표준 곡선의 방정식에 따라 계산되었다. 표준 곡선은 연속 희석된 바이러스 역가에 대해 유도되었다. 세포-기반 그룹 및 마우스 기관 샘플(전혈 포함)에 대하여, 반-정량 바이러스 성 RNA를 내인성 대조군인 GAPDH에 대해 분석하였다.Virus in plasma was calculated according to the equation of the standard curve. Standard curves were derived for serially diluted virus titers. For cell-based group and mouse organ samples (including whole blood), semi-quantitative viral RNA was analyzed for GAPDH, an endogenous control.
GeneGene | Forward primerForward primer | Reverse primerReverse primer | Amplicon size(bp)Amplicon size (bp) |
Human GAPDHHuman GAPDH | TCACTGCCACCCAGAAGACTG(서열번호 1)TCACTGCCACCCAGAAGACTG (SEQ ID NO: 1) | GGATGACCTTGCCCACAGC(서열번호 2)GGATGACCTTGCCCACAGC (SEQ ID NO: 2) | 123123 |
Mouse GAPDHMouse GAPDH | TGACCTCAACTACATGGTCTACA(서열번호 3)TGACCTCAACTACATGGTCTACA (SEQ ID NO: 3) | CTTCCCATTCTCGGCCTTG(서열번호 4)CTTCCCATTCTCGGCCTTG (SEQ ID NO: 4) | 8585 |
DV2 NS1DV2 NS1 | GCTCCTTCAATGACAATGCGCTGTA(서열번호 5)GCTCCTTCAATGACAATGCGCTGTA (SEQ ID NO: 5) | CCTGAAACC CCTTCCACGAAGTC(서열번호 6)CCTGAAACC CCTTCCACGAAGTC (SEQ ID NO: 6) | 6565 |
(10) 병리학 분석(10) Pathology Analysis
4 % 파라포름 알데히드로 고정된 장기 샘플은 헤마톡실린과 에오신(hematoxylin and eosin)을 이용한 파라핀 삽입, 절편 및 염색과 같은 일련의 과정을 거쳤다.Organ samples fixed with 4% paraformaldehyde were subjected to a series of procedures such as paraffin insertion, sectioning and staining with hematoxylin and eosin.
(11) 통계 분석(11) statistical analysis
농도 의존 분석법을 이용한 데이터 플롯을 OriginPro 8로 분석했다. 간단히 말하면, 각 데이터 세트에 따라 로그 S 자형 곡선이 사용되었다. 오류 막대는 다르게 명시된 경우를 제외하고는 ± SEM을 나타낸다. 시험관 내 및 생체 내 항바이러스제 효능 분석의 통계적 유의성을 양측 t- 검정으로 평가하였다. 생존율의 통계적 유의성은 R (통계 작성을 위한 R Foundation, 오스트리아)의 log-rank test로 분석되었다.Data plots using concentration dependent analysis were analyzed with OriginPro 8. In short, a log S curve was used for each data set. Error bars represent ± SEM unless otherwise indicated. Statistical significance of the in vitro and in vivo antiviral efficacy assays was assessed by a two-tailed t-test. The statistical significance of survival was analyzed by the log-rank test of R (R Foundation for Statistics).
2. 결과2. Results
(1) 뎅기바이러스 효소 활성 저해 확인(1) Confirmation of dengue virus enzyme activity inhibition
14종 화합물의 농도에 따른 뎅기 바이러스 RdRp 효소 활성 저해 정도를 확인하였다(IC
50 값 제시, 도 1 내지 3).The degree of inhibition of dengue virus RdRp enzyme activity according to the concentration of 14 compounds was confirmed (IC 50 values presented, FIGS. 1 to 3).
도 1 내지 3을 참조하면, 14종 화합물이 뎅기바이러스 RdRp를 높은 효율로 저해함을 확인할 수 있다.1 to 3, it can be seen that 14 compounds inhibit dengue virus RdRp with high efficiency.
(2) 헬리케이즈 효소 활성 저해 확인(2) Confirmation of inhibition of helicase enzyme activity
6종 화합물의 농도에 따른 뎅기 바이러스 헬리케이즈 활성 저해 정도를 확인하였다(IC
50 값 제시, 도 4).The degree of inhibition of dengue virus helicase activity was confirmed according to the concentrations of the six compounds (IC 50 values presented, FIG. 4).
도 4를 참조하면, 6종 화합물이 뎅기바이러스 헬리케이즈를 높은 효율로 저해함을 확인할 수 있다.Referring to Figure 4, it can be seen that six compounds inhibit dengue virus helicase with high efficiency.
(3) 뎅기바이러스 혈증 감소 효과 확인(3) Confirm the effect of reducing dengue virus
dengue infection 모델(AG129 mouse)을 사용하여 약물 처리 후 mouse 혈액내 DENV viremia 감소를 확인하였다(도 5). Micafungin sodium은 I.P.(Intraperitoneal) injection, Miltefosine 은 Oral injection 으로 각각 약물을 주입하였고, Vechicle control은 PBS를 주입한 것이다.The dengue infection model (AG129 mouse) was used to confirm DENV viremia reduction in mouse blood after drug treatment (FIG. 5). Micafungin sodium was injected with I.P. (Intraperitoneal) injection, Miltefosine was injected with Oral injection, and Vechicle control was injected with PBS.
도 5를 참조하면, micafungin sodium, miltefosine 처리에 의해 뎅기바이러스 혈증이 크게 감소한 것을 확인할 수 있다.Referring to Figure 5, it can be seen that the dengue virus hyperemia significantly reduced by micafungin sodium, miltefosine treatment.
(4) 뎅기바이러스 감소 효과 확인(4) Confirmation of dengue virus reduction effect
각 화합물의 항 뎅기바이러스 활성 평가를 위해 세포-기초 평가가 수행되었다. VeroE6 세포를 사용하여 각 화합물의 농도 의존 항바이러스 효과를 조사하기 위해 시험관 내 바이러스성 초점 형성 분석을 수행하였다. 바이러스 초점 이미지는 도 6에 나타내었다.Cell-based evaluation was performed to evaluate the anti-dengue virus activity of each compound. In vitro viral focal formation assays were performed to investigate the concentration dependent antiviral effects of each compound using VeroE6 cells. Virus focus images are shown in FIG. 6.
도 6을 참조하면, 11종 화합물의 처리시에 바이러스가 크게 감소한 것을 확인할 수 있다.Referring to Figure 6, it can be seen that the virus significantly reduced during the treatment of 11 compounds.
(5) 바이러스 증식 억제 및 생존율 증가 효과 확인(5) Confirm the effect of inhibiting virus growth and increasing survival rate
몬테루카스트 10mg/kg을 DENV2(뎅기바이러스 serotype2) 감염된 AG129 마우스(10-12 주, n = 10)에 1일 1회 처리하였다. Vechicle로는 PBS를 주입하였다. 감염 이후 날짜별 체중을 측정하고, 생존율, 감염 후 3일째에 혈장내 혈증을 측정하였다(도 7). Montelukast 10 mg / kg was treated once daily in DENV2 (denguevirus serotype2) infected AG129 mice (10-12 weeks, n = 10). Vechicle was injected with PBS. Body weights were measured by date after infection, and survival and plasma plasma levels were measured at 3 days after infection (FIG. 7).
도 7을 참조하면, 몬테루카스트 투여군에서 체중 감소 정도가 적고, 생존율이 높으며, 혈증이 적은 것을 확인할 수 있다.Referring to FIG. 7, it can be seen that the montelukast-administered group has a low weight loss, high survival rate, and low blood pressure.
(6) 조직 특이적 항바이러스 효과 확인(6) Confirmation of tissue specific antiviral effect
몬테루카스트의 조직 특이적 항바이러스 효과를 주요 장기별로 확인하였다.Tissue-specific antiviral effects of montelukast have been identified by major organs.
몬테루카스트 10mg/kg을 매일 DENV2(뎅기바이러스 serotype2) 감염 AG129 마우스(n = 6)에 처리 하였다. 처리 후 3 일째에 마우스를 희생시켰다. 전혈, 비장, 간, 폐, 소장 및 대장을 채취하였고, 비장, 간 및 폐의 절반이 파라포름알데히드 보존 처리되었다. 다른 절반에서 RNA를 분리하고 바이러스 역가 분석에 적용했다. Montelukast 10 mg / kg was treated daily in DENV2 (dengue virus serotype2) infected AG129 mice (n = 6). Mice were sacrificed three days after treatment. Whole blood, spleen, liver, lungs, small intestine and large intestine were collected and half of the spleen, liver and lungs were paraformaldehyde preserved. RNA was isolated from the other half and subjected to virus titer analysis.
상대적인 뎅기바이러스 RNA 발현을 각 조직 샘플로부터 측정하였고, 도 8에 나타내었다.Relative dengue virus RNA expression was measured from each tissue sample and is shown in FIG. 8.
도 8을 참조하면, 몬테루카스트 처리군에서 뎅기바이러스 RNA 발현이 현저히 낮은 것을 확인할 수 있다.Referring to Figure 8, it can be seen that the dengue virus RNA expression is significantly low in the montelukast treatment group.
(7) 바이러스 증식 억제 효과의 조직학적 분석(7) histological analysis of virus proliferation inhibitory effect
뎅기바이러스 감염 마우스에 몬테루카스트를 처리하여, 처리군과 무처리군의 조직학적 데이터를 얻었다. 각 군의 비장과 간을 절제한 후 H&E 염색을 수행하였다. 결과는 도 9에 나타내었다.Montelukast-treated mice were treated with montelukast to obtain histological data of the treated and untreated groups. H & E staining was performed after resection of the spleen and liver of each group. The results are shown in FIG.
도 9를 참조하면, 몬테루카스트 처리에 의해 바이러스 복제가 감소한 것을 확인할 수 있다.Referring to Figure 9, it can be seen that the virus replication is reduced by the montelukast treatment.
Claims (8)
- 겐타마이신 설페이트(Gentamicin Sulfate), 네틸마이신(Netilmicin), 토브라마이신(Tobramycin), 파로모마이신(Paromomycin), 아미카신(Amikacin), 카프레오마이신(Capreomycin), 트리플루오페라진(Trifluoperazine), 디하이드로스트렙토마이신(Dihydrostreptomycin), 히드록시클로로퀸(Hydroxychloroquine), 티오리다진 HCl(Thioridazine HCl), 에파비렌즈(Efavirenz), 밀테포신(Miltefosine), 니스타틴(Nystatin), 미카펀진(Micafungin), 블레오마이신(Bleomycin), 레스미노스타트(Resminostat), 몬테루카스트(Montelukast), 노르플록사신(Norfloxacin), 네다플라틴(Nedaplatin) 및 세팔로신(Cephalothin) 중 적어도 하나; 또는 이들의 약학적으로 허용되는 염 중 적어도 하나;를 포함하는 플라비바이러스 감염증의 예방 또는 치료용 약학적 조성물.Gentamicin Sulfate, Netilmicin, Tobramycin, Paromomycin, Amikacin, Capreomycin, Trifluoperazine, Dihydrostreptomycin, Hydroxychloroquine, Thiolidazine HCl, Efavirenz, Miltefosine, Nystatin, Micafungin, Bleio Bleomycin, Resminostat, Monteukast, Norfloxacin, Nedaplatin And at least one of cephalothin; Or at least one of pharmaceutically acceptable salts thereof. A pharmaceutical composition for preventing or treating flavivirus infection.
- 청구항 1에 있어서, 상기 플라비바이러스 감염증은 아포이 바이러스(Apoi virus), 아로아 바이러스(Aroa virus), 바가자 바이러스(Bagaza virus), 반지 바이러스(Banzi virus), 보우부이 바이러스(Bouboui virus), 부카라사 배트 바이러스(Bukalasa bat virus), 카시파코레 바이러스(Cacipacore virus), 캐리섬 바이러스(Carey Island virus), 카우본 릿지 바이러스(Cowbone Ridge virus), 다카르 배트 바이러스(Dakar bat virus), 뎅기 바이러스(Dengue virus), 엣지 힐 바이러스(Edge Hill virus), 엔데뻬 배트 바이러스(Entebbe bat virus), 가젯 굴리 바이러스(Gadgets Gully virus), 일헤우스 바이러스(Ilheus virus), 이스라엘 터키 뇌수막척수염 바이러스(Israel turkey meningoencephalomyelitis virus), 일본 뇌염 바이러스(Japanese encephalitis virus), 주그라 바이러스(Jugra virus), 주티아파 바이러스(Jutiapa virus), 카담 바이러스(Kadam virus), 케도구 바이러스(Kedougou virus), 코코베라 바이러스(Kokobera virus), 코탱고 바이러스(Koutango virus), 캬사누 포레스트 질병 바이러스(Kyasanur Forest disease virus), 란갓 바이러스(Langat virus), 도약병 바이러스(Louping ill virus), 미반 바이러스(Meaban virus), 모독 바이러스(Modoc virus), 몬타나 미오티스 류코엔세팔리티스 바이러스(Montana myotis leukoencephalitis virus), 머레이 밸리 엔세팔리티스 바이러스(Murray Valley encephalitis virus), 은타야 바이러스(Ntaya virus), 옴스크 출혈열 바이러스(Omsk hemorrhagic fever virus), 프놈펜 배트 바이러스(Phnom Penh bat virus), 포와산 바이러스(Powassan virus), 리오 브라보 바이러스(Rio Bravo virus), 로얄 팜 바이러스(Royal Farm virus), 사보야 바이러스(Saboya virus), 세인트루이스 엔세팔리티스 바이러스(Saint Louis encephalitis virus), 살 비에야 바이러스(Sal Vieja virus), 산 퍼리타 바이러스(San Perlita virus), 사우마레즈 잎 바이러스(Saumarez Reef virus), 세픽 바이러스(Sepik virus), 템부수 바이러스(Tembusu virus), 진드기 매개 뇌염 바이러스(Tick-borne encephalitis virus), 튤레니 바이러스(Tyuleniy virus), 우간다 S 바이러스(Uganda S virus), 우수투 바이러스(Usutu virus), 웨셀스브론 바이러스(Wesselsbron virus), 웨스트 나일 바이러스(West Nile virus), 야오운데 바이러스(Yaounde virus), 황열 바이러스(Yellow fever virus), 요코세 바이러스(Yokose virus) 또는 지카 바이러스(Zika virus) 유발 감염증인 조성물.The method of claim 1, wherein the flavivirus infection is Apoi virus (Arpo virus), Aroa virus (Aroa virus), Bagaga virus (Bagaza virus), Ringzi (Banzi virus), Bouboui virus, Bucara Bukalasa bat virus, Cacipacore virus, Carey Island virus, Cowbone Ridge virus, Dakar bat virus, Dengue virus virus, Edge Hill virus, Entebbe bat virus, Gadgets Gully virus, Ilheus virus, Israel turkey meningoencephalomyelitis virus , Japanese encephalitis virus, Jugra virus, Jutiapa virus, Kadam virus, Kedogba Kedougou virus, Kokobera virus, Kotango virus, Kyasanur Forest disease virus, Langat virus, Louping ill virus, Meaban virus, Modoc virus, Montana myotis leukoencephalitis virus, Murray Valley encephalitis virus, Ntaya virus , Omsk hemorrhagic fever virus, Phnom Penh bat virus, Powassan virus, Rio Bravo virus, Royal Farm virus, Savoya Saboya virus, Saint Louis encephalitis virus, Sal Vieja virus, San Perita virus Perlita virus, Saumarez Reef virus, Sepik virus, Tembusu virus, Tick-borne encephalitis virus, Tuleniy virus, Uganda S virus, Usutu virus, Wesselsbron virus, West Nile virus, Yaounde virus, Yellow fever virus , Yokose virus or Zika virus induced infection.
- 청구항 1에 있어서, 상기 플라비바이러스 감염증은 뎅기바이러스 유발 감염증인 조성물.The composition of claim 1, wherein the flavivirus infection is a dengue virus induced infection.
- 청구항 1에 있어서, 상기 조성물은 토브라마이신, 트리플루오페라진 2HCl, 아미카이신 수화물, 히드록시클로로퀸 황산염, 티오리다진 HCl, 디하이드로스트렙토마이신 황산염, 겐타마이신 황산염, 네틸마이신 황산염, 카프레오마이신 황산염, 파로모마이신 황산염, 레스미노스타트, 몬테루카스트, 노르플록사신, 네다플라틴, 블레오마이신, 니스타틴, 세팔로신, 미카펀진 나트륨, 에파비렌즈 및 밀테포신 중 적어도 하나; 또는 이들의 약학적으로 허용되는 염 중 적어도 하나;를 포함하는 조성물.The composition of claim 1, wherein the composition comprises tobramycin, trifluoroperazine 2HCl, amikacin hydrate, hydroxychloroquine sulfate, thiolidazine HCl, dihydrostreptomycin sulfate, gentamicin sulfate, netylmycin sulfate, capreomycin At least one of sulfate, paromomycin sulfate, resminostat, montelukast, norfloxacin, nedaplatin, bleomycin, nystatin, cephalosin, mycafungin sodium, epavirenz and mittefosin; Or at least one of pharmaceutically acceptable salts thereof.
- 겐타마이신 설페이트(Gentamicin Sulfate), 네틸마이신(Netilmicin), 토브라마이신(Tobramycin), 파로모마이신(Paromomycin), 아미카신(Amikacin), 카프레오마이신(Capreomycin), 트리플루오페라진(Trifluoperazine), 디하이드로스트렙토마이신(Dihydrostreptomycin), 히드록시클로로퀸(Hydroxychloroquine), 티오리다진 HCl(Thioridazine HCl), 에파비렌즈(Efavirenz), 밀테포신(Miltefosine), 니스타틴(Nystatin), 미카펀진(Micafungin), 블레오마이신(Bleomycin), 레스미노스타트(Resminostat), 몬테루카스트(Montelukast), 노르플록사신(Norfloxacin), 네다플라틴(Nedaplatin) 및 세팔로신(Cephalothin) 중 적어도 하나; 또는 이들의 약학적으로 허용되는 염 중 적어도 하나;를 포함하는 플라비바이러스 생육 저해 또는 사멸용 조성물.Gentamicin Sulfate, Netilmicin, Tobramycin, Paromomycin, Amikacin, Capreomycin, Trifluoperazine, Dihydrostreptomycin, Hydroxychloroquine, Thiolidazine HCl, Efavirenz, Miltefosine, Nystatin, Micafungin, Bleio Bleomycin, Resminostat, Monteukast, Norfloxacin, Nedaplatin And at least one of cephalothin; Or at least one of pharmaceutically acceptable salts thereof; and a composition for inhibiting or killing flavivirus growth.
- 청구항 5에 있어서, 상기 플라비바이러스는 아포이 바이러스(Apoi virus), 아로아 바이러스(Aroa virus), 바가자 바이러스(Bagaza virus), 반지 바이러스(Banzi virus), 보우부이 바이러스(Bouboui virus), 부카라사 배트 바이러스(Bukalasa bat virus), 카시파코레 바이러스(Cacipacore virus), 캐리섬 바이러스(Carey Island virus), 카우본 릿지 바이러스(Cowbone Ridge virus), 다카르 배트 바이러스(Dakar bat virus), 뎅기 바이러스(Dengue virus), 엣지 힐 바이러스(Edge Hill virus), 엔데뻬 배트 바이러스(Entebbe bat virus), 가젯 굴리 바이러스(Gadgets Gully virus), 일헤우스 바이러스(Ilheus virus), 이스라엘 터키 뇌수막척수염 바이러스(Israel turkey meningoencephalomyelitis virus), 일본 뇌염 바이러스(Japanese encephalitis virus), 주그라 바이러스(Jugra virus), 주티아파 바이러스(Jutiapa virus), 카담 바이러스(Kadam virus), 케도구 바이러스(Kedougou virus), 코코베라 바이러스(Kokobera virus), 코탱고 바이러스(Koutango virus), 캬사누 포레스트 질병 바이러스(Kyasanur Forest disease virus), 란갓 바이러스(Langat virus), 도약병 바이러스(Louping ill virus), 미반 바이러스(Meaban virus), 모독 바이러스(Modoc virus), 몬타나 미오티스 류코엔세팔리티스 바이러스(Montana myotis leukoencephalitis virus), 머레이 밸리 엔세팔리티스 바이러스(Murray Valley encephalitis virus), 은타야 바이러스(Ntaya virus), 옴스크 출혈열 바이러스(Omsk hemorrhagic fever virus), 프놈펜 배트 바이러스(Phnom Penh bat virus), 포와산 바이러스(Powassan virus), 리오 브라보 바이러스(Rio Bravo virus), 로얄 팜 바이러스(Royal Farm virus), 사보야 바이러스(Saboya virus), 세인트루이스 엔세팔리티스 바이러스(Saint Louis encephalitis virus), 살 비에야 바이러스(Sal Vieja virus), 산 퍼리타 바이러스(San Perlita virus), 사우마레즈 잎 바이러스(Saumarez Reef virus), 세픽 바이러스(Sepik virus), 템부수 바이러스(Tembusu virus), 진드기 매개 뇌염 바이러스(Tick-borne encephalitis virus), 튤레니 바이러스(Tyuleniy virus), 우간다 S 바이러스(Uganda S virus), 우수투 바이러스(Usutu virus), 웨셀스브론 바이러스(Wesselsbron virus), 웨스트 나일 바이러스(West Nile virus), 야오운데 바이러스(Yaounde virus), 황열 바이러스(Yellow fever virus), 요코세 바이러스(Yokose virus) 또는 지카 바이러스(Zika virus)인 조성물.The method of claim 5, wherein the flavivirus is Apoi virus (Aroa virus), Aroa virus (Aroa virus), Bagaga virus (Bagaza virus), Ringzi virus (Banzi virus), Bouboui virus, Bucarasa Batalasa bat virus, Cacipacore virus, Carey Island virus, Cowbone Ridge virus, Dakar bat virus, Dengue virus ), Edge Hill virus, Entebbe bat virus, Gadgets Gully virus, Ilheus virus, Israel turkey meningoencephalomyelitis virus, Japanese encephalitis virus, Jugra virus, Jutiapa virus, Kadam virus, Kedog virus edougou virus, Kokobera virus, Kotango virus, Kyasanur Forest disease virus, Langat virus, Louping ill virus, Miban virus (Meaban virus), Modoc virus, Montana myotis leukoencephalitis virus, Murray Valley encephalitis virus, Ntaya virus, Om Omsk hemorrhagic fever virus, Phnom Penh bat virus, Powassan virus, Rio Bravo virus, Royal Farm virus, Savoya virus ( Saboya virus, Saint Louis encephalitis virus, Sal Vieja virus, San Perlita vi rus, Saumarez Reef virus, Sepik virus, Tembusu virus, Tick-borne encephalitis virus, Tyuleniy virus, Uganda Uganda S virus, Usutu virus, Wesselsbron virus, West Nile virus, Yaounde virus, Yellow fever virus, A composition that is Yokose virus or Zika virus.
- 청구항 5에 있어서, 상기 플라비바이러스는 뎅기바이러스인 조성물.The composition of claim 5, wherein the flavivirus is a dengue virus.
- 청구항 5에 있어서, 상기 조성물은 토브라마이신, 트리플루오페라진 2HCl, 아미카이신 수화물, 히드록시클로로퀸 황산염, 티오리다진 HCl, 디하이드로스트렙토마이신 황산염, 겐타마이신 황산염, 네틸마이신 황산염, 카프레오마이신 황산염, 파로모마이신 황산염, 레스미노스타트, 몬테루카스트, 노르플록사신, 네다플라틴, 블레오마이신, 니스타틴, 세팔로신, 미카펀진 나트륨, 에파비렌즈 및 밀테포신 중 적어도 하나; 또는 이들의 약학적으로 허용되는 염 중 적어도 하나;를 포함하는 조성물.The composition of claim 5, wherein the composition comprises tobramycin, trifluoroperazine 2HCl, amikacin hydrate, hydroxychloroquine sulfate, thiolidazine HCl, dihydrostreptomycin sulfate, gentamicin sulfate, netylmycin sulfate, capremycin At least one of sulfate, paromomycin sulfate, resminostat, montelukast, norfloxacin, nedaplatin, bleomycin, nystatin, cephalosin, mycafungin sodium, epavirenz and mittefosin; Or at least one of pharmaceutically acceptable salts thereof.
Priority Applications (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US17/051,117 US20210228607A1 (en) | 2018-04-27 | 2019-04-24 | Pharmaceutical composition for prevention or treatment of flavivirus infection |
CN201980028691.7A CN112040954A (en) | 2018-04-27 | 2019-04-24 | Pharmaceutical composition for preventing or treating flavivirus infection |
EP19792006.9A EP3785718B1 (en) | 2018-04-27 | 2019-04-24 | Pharmaceutical composition for prevention or treatment of flavivirus infectious disease |
Applications Claiming Priority (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US201862663312P | 2018-04-27 | 2018-04-27 | |
US62/663,312 | 2018-04-27 | ||
KR10-2019-0048075 | 2019-04-24 | ||
KR1020190048075A KR102269663B1 (en) | 2018-04-27 | 2019-04-24 | Medicinal composition for preventing or treating flavivirus infections and method for treating the same |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2019209035A1 true WO2019209035A1 (en) | 2019-10-31 |
Family
ID=68294173
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/KR2019/004974 WO2019209035A1 (en) | 2018-04-27 | 2019-04-24 | Pharmaceutical composition for prevention or treatment of flavivirus infectious disease |
Country Status (1)
Country | Link |
---|---|
WO (1) | WO2019209035A1 (en) |
Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20110183892A1 (en) * | 2007-10-11 | 2011-07-28 | Dinman Jonathan D | Methods for the treatment of viral conditions |
WO2015051281A1 (en) * | 2013-10-06 | 2015-04-09 | Morrison Thomas E | Antiviral therapies |
JP2017526728A (en) * | 2014-09-15 | 2017-09-14 | インフラマトリー・レスポンス・リサーチ・インコーポレイテッド | Levocetirizine and montelukast in the treatment of inflammation-mediated conditions |
KR20170105113A (en) * | 2015-01-28 | 2017-09-18 | 아르노 테라퓨틱스 인코포레이티드 | Compositions and methods for inhibiting viral infection |
WO2017181098A2 (en) * | 2016-04-15 | 2017-10-19 | Visterra, Inc. | Antibody molecules to zika virus and uses thereof |
-
2019
- 2019-04-24 WO PCT/KR2019/004974 patent/WO2019209035A1/en active Application Filing
Patent Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20110183892A1 (en) * | 2007-10-11 | 2011-07-28 | Dinman Jonathan D | Methods for the treatment of viral conditions |
WO2015051281A1 (en) * | 2013-10-06 | 2015-04-09 | Morrison Thomas E | Antiviral therapies |
JP2017526728A (en) * | 2014-09-15 | 2017-09-14 | インフラマトリー・レスポンス・リサーチ・インコーポレイテッド | Levocetirizine and montelukast in the treatment of inflammation-mediated conditions |
KR20170105113A (en) * | 2015-01-28 | 2017-09-18 | 아르노 테라퓨틱스 인코포레이티드 | Compositions and methods for inhibiting viral infection |
WO2017181098A2 (en) * | 2016-04-15 | 2017-10-19 | Visterra, Inc. | Antibody molecules to zika virus and uses thereof |
Non-Patent Citations (2)
Title |
---|
NUCLEIC ACIDS RESEARCH, vol. 45, no. 22, 2017, pages 12904 - 12920 |
VIRUSES, vol. 10, no. 2, February 2018 (2018-02-01), pages 76 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
KR102269664B1 (en) | Medicinal composition for preventing or treating flavivirus infections and method for treating the same | |
EP1596859B1 (en) | Treatment of diseases caused by ljungan virus by using pleconaril | |
WO2019209035A1 (en) | Pharmaceutical composition for prevention or treatment of flavivirus infectious disease | |
CA2413331A1 (en) | Use of phyllanthus constituents for treating or preventing infections caused by flaviviridae | |
CN106038695B (en) | Use of avocado extract, avocadol B and (2R,4R) -1,2, 4-trihydroxyheptadeca-16-alkyne, and health food containing avocado extract | |
CN113274375A (en) | Application of metformin and derivatives or pharmaceutically acceptable salts thereof in preparation of drugs for treating coronavirus infection | |
CN114668763A (en) | Application of etravirine in preparation of drugs for resisting infection of tick-borne encephalitis virus West Nile virus yellow fever virus and chikungunya virus | |
WO2022131603A1 (en) | Antiviral composition containing geranium herb extract as active ingredient | |
CN108014129A (en) | Application of the iron ion in RNA virus is suppressed | |
KR102249543B1 (en) | Composition for treating Coronavirus Disease-19 comprising phenanthroindolizidine and phenanthroquinolizidine alkaloid derivatives, optical isomer thereof, or pharmaceutically acceptable salts thereof | |
CN114748481B (en) | Application of terluostat hippurate in preparing medicines for resisting tick-borne encephalitis virus, west nile virus, yellow fever virus and chikungunya fever virus infection | |
WO2023058987A1 (en) | Pharmaceutical composition for preventing or treating viral infectious diseases, containing efavirenz and fluoxetine as active ingredients | |
CN115006386B (en) | Application of nifurazite in preparation of medicines for resisting tick-borne encephalitis virus west nile virus yellow fever virus and chikungunya fever virus infection | |
KR20210135218A (en) | Anti-human norovirus | |
CN114917227B (en) | Application of Ivacizumab in preparation of anti-tick-borne encephalitis virus, west nile virus, yellow fever virus and chikungunya fever virus infection medicines | |
CN111317739A (en) | Application of erythromycin estolate in preparation of medicine for specifically inhibiting virus infection | |
WO2021235695A1 (en) | Preventive or therapeutic pharmaceutical composition for coronavirus infection comprising tetraarsenic hexoxide | |
CN115025094A (en) | Application of masitinib in preparation of drugs for resisting infection of tick-borne encephalitis virus West Nile virus yellow fever virus and chikungunya virus | |
CN115089568B (en) | Application of adapalene in preparation of medicines for resisting tick-borne encephalitis virus west nile virus yellow fever virus and chikungunya fever virus infection | |
CN113440562B (en) | Application of compound houttuynia cordata mixture in preparation of medicine for preventing or treating coronavirus | |
Howard | Viral haemorrhagic fevers: properties and prospects for treatment and prevention | |
US20230137927A1 (en) | Interferon tau as antiviral therapy | |
CN115089574A (en) | Application of pimecrolimus in preparing medicine for resisting infection of tick-borne encephalitis virus West Nile virus yellow fever virus and chikungunya virus | |
WO2022131604A1 (en) | Antiviral composition containing ramulus-mori-derived compound as active ingredient | |
CN114767828A (en) | Application of isoxazomib in preparation of drugs for resisting infection of tick-borne encephalitis virus, west nile virus, yellow fever virus and chikungunya virus |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 19792006 Country of ref document: EP Kind code of ref document: A1 |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2019792006 Country of ref document: EP |