WO2019196717A1 - Randomly mutated gene editing system and use thereof - Google Patents

Abstract

Disclosed in the present application are a gene editing system for randomly mutating genes and the use thereof. The gene editing system of the present invention comprises a targeting element and an editing element, the targeting element directing the editing element to edit a gene, characterized in that the targeting element can be randomly mutated to direct the editing element to edit a new target sequence. By using the system of the present invention, random mutation can be performed in cells, which is a new method for random mutation, and a high-throughput library of thousands of random mutants can be constructed with high efficiency and at low cost.

Description

A random mutation gene editing system and its application Technical field

The invention belongs to the field of biotechnology, and particularly relates to a random mutation gene editing system and an application thereof.

Background technique

Gene editing technology, especially CRISPR/Cas9 technology, enables precise gene editing in biological cells. The technical principle is: through a piece of guide RNA (sgRNA or gRNA) combined with endonuclease (such as Cas9, Cpf1, etc.) to form a complex of RNA and protein (referred to as RNP), the complex can search and guide RNA on the genome The complementary target sequence is such that the endonuclease precisely cleaves the bound DNA in this region. Depending on the nature of the endonuclease, the results of the cleavage are diverse and can be double-stranded DNA cleavage (DSB) at the blunt end or sticky end, or single-stranded DNA cleavage (Nick). The repair of the DSB or Nick by the organism's own cells leads to the insertion or deletion of the base (Indel), resulting in a frameshift mutation, resulting in loss of gene function, thereby enabling precise editing of the target gene. In addition, if a DNA repair template is provided, the DNA fragment may be repaired and integrated into the DSB or Nick region to achieve precise DNA fragment insertion or replacement.

Since many organisms already have clear genomic information, gene editing technology enables large-scale gene knockout of organisms at the genome level to create new mutant libraries. The technical route is to design and synthesize tens of thousands of guide RNAs for different genes, and transfer them to target biological cells by means of viruses, gene guns, and Agrobacterium to obtain mutant libraries. Using this technical route, mutant libraries were successfully constructed on bacteria, animal cells and plants. However, the need to synthesize tens of thousands of boot RNAs is a major drawback of this technology system. In addition, the construction of mutant libraries requires high-throughput transformation systems. Therefore, a technique capable of generating random guide RNA in biological cells will greatly overcome these drawbacks.

Summary of the invention

In view of the above problems, a first object of the present invention is to provide a gene editing system for random mutation.

A randomly mutated gene editing system comprising a targeting element and an editing element, the targeting element directing an editing element to edit a gene, the targeting element being capable of random mutation to direct an editing element pair The new target sequence is edited.

In the above gene editing system, the targeting element comprises a combination of one or both of protein, RNA, DNA, or the targeting element comprises a different protein, a different RNA or a different DNA; the editing element It is an enzyme that uses DNA or a base as a substrate.

The targeting element can be realized by specific binding of protein to DNA, or by specific binding between nucleic acids (between DNA and DNA, between RNA and DNA, between RNA and RNA). . The editing element may be an endonuclease that directly cleaves DNA, or may be a base-based enzyme such as cytosine deaminase or adenine deaminase fused to these endonucleases or Compound.

In the above gene editing system, the editing element is an endonuclease; the targeting element is two sgRNA sequences: sgRNA1 and sgRNA2, the partial sequence of the sgRNA2 and the sequence of the corresponding sgRNA1 are highly coincident, and the sgRNA1 is guided into the nucleic acid. The dicer is genetically edited in the DNA region where sgRNA2 is expressed, thereby randomly generating a new sgRNA, which can direct the endonuclease for gene editing, thereby generating a random mutation.

The above gene editing system includes a CRISPR system.

In the above gene editing system, the two sgRNA sequences respectively comprise one or two identical or different sequences.

In the above gene editing system, the partial sequence of the sgRNA2 and the sequence of the corresponding sgRNA1 are highly coincident means that the gene sequence expressing sgRNA2 can be recognized by sgRNA1 and cleaved by an endonuclease.

For example, in one embodiment, the sequence of a certain sgRNA2 comprises the sequence of the corresponding sgRNA1 and an endonuclease recognition site (eg, a PAM sequence), ie, the sgRNA2 partial sequence and the target sequence of sgRNA1 are coincident, and the target of sgRNA1 After the point sequence, the endonuclease recognition site is set, and the endonuclease cleaves the sgRNA2 gene, and then repairs, randomly generates a new sgRNA gene, and expresses a new sgRNA.

In the above gene editing system, the endonuclease is a Cas protein or a Cpf1 protein.

In the above gene editing system, preferably, the Cas protein is Cas9, Cas9n, dCas9 or xCas9.

A second object of the present invention is to provide a nucleic acid expressing the above gene editing system.

A third object of the present invention is to provide a vector expressing the above gene editing system.

The carrier is a single carrier or a dual carrier;

The single vector refers to a nucleic acid expressing the above-described gene editing system on a vector, and the double vector refers to a nucleic acid expressing the above-described gene editing system on two vectors, for example, in one embodiment, an endonuclease and The expression genes of the two sgRNA sequences are located on two vectors, respectively.

The above vector is a vector capable of expressing the CRISPR system, and may be a plant vector, an animal vector, a bacterial vector or a fungal vector;

The above vector is an optional pHEE401E vector plasmid, an adenovirus vector, a pCRISPR vector, a pDONR207 vector, a lenti CRISPR carrier, a pCMV vector, a pU6 vector, a T1706, a pLko vector, and the like.

A fourth object of the present invention is to provide a method for random mutation in a cell comprising the steps of introducing the above nucleic acid or the above vector into a host cell.

A fifth object of the present invention is to provide a method for constructing a mutant library comprising the steps of introducing the above nucleic acid or the above vector into a host cell.

In the above method, the host is a bacterium, a fungus, a plant or an animal.

In the above method, the host cell is a germ cell in a sexual reproductive organism or a cleavable cell in an asexual reproductive organism and grows into a cell of the individual.

In the above method, the method further comprises: cultivating a next generation cell or an individual of the host cell;

Alternatively, the nucleic acid or the above vector is repeatedly introduced into the next generation cell or individual of the host as described above.

For example, in one embodiment, in a plant, the nucleic acid or the vector is introduced into a plant egg cell, and Cas9 is driven by an egg cell-specific promoter (or other germ cell-specific expression promoter) to sgRNA2-directed constitutive expression of sgRNA. The random mutations generated by the endonuclease editing of the sgRNA1 gene will only occur in the egg cells, and the new sgRNA generated randomly will also edit the plant genome only in the egg cells, and the harvested seeds will have different editing events. A plant can produce tens of thousands of seeds. In theory, most seeds will contain new sgRNA genes. If the genome has matching sequences, new mutations will be produced.

In the present invention, "plant" is understood to mean any differentiated multicellular organism capable of photosynthesis, in particular monocotyledonous or dicotyledonous plants, for example: (1) a food crop: Oryza spp., such as rice. (Oryza sativa), Oryza latifolia, Oryza sativa, Oryza glaberrima, Triticum spp., such as Triticum aestivum, Durum wheat (T.Turgidumssp) .durum); Hordeum spp., such as Hordeum vulgare, Hordeum arizonicum; Secale cereale; Avena spp., such as oat (Avena sativa), wild oats (Avena fatua), Avena byzantina, Avena fatua var.sativa, Avena hybrida, Echinochloa spp., for example, Pennisetum glaucum, sorghum (Sorghum) Bicolor), Sorghum vulgare, black wheat, maize or corn, millet, rice, millet, hazelnut, Sorghum bicolor, scorpion, Fagopyrum spp., Panicum Mi Liaceum), Setaria italica, Zizania palustris, Eragrostis tef, Panicum miliaceum, Eleusine coracana; (2) Bean crop: Glycine Spp.), such as soybean (Glycine max), soybean (Soja hispida), Soja max), Vicia spp., Vigna spp., Pisum spp., cow bean (field bean) ), Lupinus spp., Vicia, Tamarindus indica, Lens culinaris, Lathyrus spp., Lablab, broad beans, mung beans , red beans, chickpeas; (3) oil crops: peanuts (Arachis hypogaea), Arachis spp, Sesamum spp., Helianthus spp. (such as sunflower (Helianthus annuus), Oil genus (Elaeis) (eg Eiaeis guineensis, Elaeis oleifera), soybean, rape (Brassicanapus), canola, sesame, mustard (Brassicajuncea), rapeseed (oilseedrape) , Camellia, Oil Palm, Olive Oil, Castor, Europe Brassica napus L., canola; (4) fiber crops: Agave sisalana, cotton (cotton, Gossypium barbadense, Gossypium hirsutum), red Hemp, sisal, abaca, flax (Linum usitatissimum), jute, ramie, cannabis (Cannabis sativa), hemp; (5) fruit crops: Ziziphus spp., Cucumis spp. Eggia (Passiflora edulis), Vitis spp., Vaccinium spp., Pyrus communis, Prunus spp., Psidium spp., pomegranate Punica granatum), Malus spp., Citrus autum lanatus, Citrus spp., Ficus carica, Fortunella spp., Fragaria spp. Crataegus spp., Diospyros spp., Eugenia unifora, Eriobotrya japonica, Dimocarpus longan, Carica papaya, Cocos spp. ), Averrhoa carambola, Actinidia spp., almond (Pr) Unus amygdalus), Musa spp. (banana), Persea spp. (Persea americana), guava (Psidium guajava), Manmie americana, Mangifera Indica), olive (Oleaeuropaea), papaya (Caricapapaya), coconut (Cocos nucifera), Malpighia emarginata, Manilkara zapota, Ananas comosus, Annona Spp.), citrus tree (Citrus spp.), Artocarpus spp., litchi chinensis, Ribes spp., Rubus spp. ), pear, peach, apricot, plum, bayberry, lemon, kumquat, durian, orange, strawberry (berry), blueberry, cantaloupe, melon, date palm, walnut tree, cherry tree; (6) root crop: cassava Genihot spp., Ipomoea batatas, Colocasia esculenta, mustard, onion, alfalfa, oil sedge, yam; (7) vegetable crops: spinacia spp., genus (Phaseolus) Spp.), lettuce (Lactuca sativa), Momordica spp. ), Pestelinum crispum, Capsicum spp., Solanum spp. (eg Solanum tuberosum, Solanum integrifolium or Solanum lycopersicum), Lycopersicon Spp.) (eg, tomatoes (Lycopersicon esculentum), tomatoes (Lycopersicon lycopersicum, Lycopersicon pyriforme), genus Macrotyloma spp. Lentil, okra, onion, potato, artichoke, asparagus, broccoli, Brussels sprouts, cabbage ), carrot, cauliflower, celery, collard greens, squash, benincasa hispida, Asparagus officinalis, Apium graveolens, Amaranthus spp., Allium spp., Abelmoschus spp., Cichorium endivia, Cucurbita spp., Coriandrum sativum, A. B. carinata, Rapbanus sativus, Brassica species (eg, Brassica napus, Brassica rapa ssp., canola) ), oilseed rape, turnip rape, mustard, cabbage, black mustard, rapeseed rape, spore cabbage, Solanaceae (eggplant), sweet pepper, cucumber, loofah, cabbage, rape , cabbage, gourd, leeks, lotus, alfalfa, lettuce; (8) flower crops: Tropaeolum minus, Tropaeolum majus, Canna indica, Opuntia spp., marigold (Tagetes spp.), orchid, Manjusri, Clivia, arborvitae, rose, rose, jasmine, tulip, cherry blossom, morning glory, calendula, lotus, daisy, carnation, petunia, tulip, lily, plum, Narcissus, Yingchun, Primula, Ruixiang, Camellia, Magnolia, Purple Magnolia, Qionghua, Clivia, Begonia, Peony, Peony, Clove, Rhododendron, Western Rhododendron, Chixiao, Bauhinia, Poria, Jinhuahua, Forsythia, Yunnan yellow , gorse, cyclamen, phalaenopsis, sarcophagus, hyacinth, iris, calla lily, calendula, sage, sea bream, bellow, sea bream, geranium; (9) medicinal crop: red Flower (Carthamus tinctorius), Mentha spp., Rheu rhrabarbarum, Crocus sativus, Poria, Polygonatum, Polygonatum, Zhimu, Ophiopogon, Chuanbei, Yujin, sand Ren, Polygonum, Rhubarb, Licorice, Astragalus, Ginseng, Sanqi, Wujia, Angelica, Chuanxiong, Bupleurum, Mandala, Golden Flower, Peppermint, Motherwort, Musk, Astragalus, Prunella, Pyrethrum, Ginkgo, Cinchona tree, natural rubber tree, alfalfa, pepper; (10) raw material crops: rubber, ramie (Ricinus communis), tung tree, mulberry, bud, birch, eucalyptus, lacquer tree; (11) pasture crop: genus (Agropyron spp.), Trifolium spp., Miscanthus sinensis, Pennisetum sp., Phalaris arundinacea, Panicum virgatum, prairiegrasses, Indiangrass, Big blue Stem grass), Phleum pratense, turf, sedge (Carle pediformis, sedge), sedge, steppe, alfalfa, rhododendron, purple Yunying, Ramie, Tianjing, Azolla, Water Hyacinth, Amorpha, Lupin, Clover, Sandawang, Water Lotus, Water Peanut, Ryegrass; (12) Sugar Crop: Sugarcane (Saccharum species) (Saccharum spp.), Beet (Beta vulgaris); (13) Beverage crops: Camellia sinensis, Camellia Sinensis, tea, coffee (Coffea spp.), Theobroma cacao, hops (hops); (14) turf plants: Ammophila arenaria, Poa spp. (Poa pratensis (bluegrass)), cut stock Agrostis spp. (Agrostis palustris), Lolium spp. (rye), Festuca spp. (feather grass) , Zoysia spp. (Zoysia japonica), Cynodon spp. (Bermuda grass, Bermuda root) , Stenotaphrum secunda tum (St. Augustine), Paspalum spp. (Baja grass), Eremochloa ophiuroides (Hundred Grass), Carpet species (Axonopus spp .) (Carpet grass), Bouteluaa dactyloides (Buffalo grass), Phyllostachys var. sp. (Gutema grass), Digitaria sanguinalis, Aconite ( Cyperusrotundus), Kyllingabrevifolia, Cyperusamuricus, Erigeroncanadensis, Hydrocotylesibthorpioides, Kummerowistriata, Euphorbiahumifusa, Violaarvensis, White stalk, stalk, turf; (15) tree crops: Pinus spp., Salix sp., Acer spp., Hibiscus spp .), Eucalyptus sp., Ginkgo biloba, Bambusa sp., Populus spp., Prosopis spp., Quercus spp. ), Phoenix spp., Fagus spp., Kyrgyzstan (Ceiba pentandra), Cinnamomum spp., Corchorus sp., Phragmites australis, Physalis spp., Desmodium spp., Yang, Chang Ivy, poplar, coral tree, ginkgo, medlar, skunk, hibiscus, holly, sycamore, privet, big leaf huangyang, larch, black wattle, masson pine, Simao pine, Yunnan pine, South Asian pine, Chinese pine , Korean pine, black walnut, lemon, sycamore, rose apple, paulownia, kapok, Javan kapok, bauhinia, hoof, rain tree, acacia, dragon tooth, thorn, magnolia, sago, crape, conifer, tree (16) nut crops: Brazilian chestnut (Bertholletia excelsea), Castanea spp., Corylus spp., Carya spp., Juglans spp. Pistacia vera, Anacardium occidentale, macadamia (Macadamia integrifolia), pecans, macadamia, pistachios, almonds, and nuts-producing plants; (17) Other: Arabidopsis, arm grass, valerian, large Foxtail, goosegrass, Cadaba farinosa, algae, Carex elata, ornamental plants, Carissa macrocarpa, Cynara spp., Daucus carota, Dioscorea Spp.), Erianthus sp., Festuca arundinacea, Hemerocallis fulva, Lotus spp., Luzula sylvatica, Medicago sativa, hibiscus Genus (Melilotus spp.), Morus nigra, Nicotiana spp., Olea spp., Ornithopus spp., Pastinaca sativa, elderberry Genus (Sambucus spp.), Sinapis sp., Syzygium spp., Tripsacum dactyloides, Triticosecale rimpaui, Viola odorata, and the like.

Advantageous effects of the present invention

(1) The present invention provides a novel random mutation gene editing system which utilizes the CRISPR system to simultaneously edit the characteristics of a plurality of different sites, and designs two different sgRNAs, one of which is sgRNA sequence and expression. The DNA region of another sgRNA is highly coincident, which results in the sgRNA of the former directing the endonuclease to edit the DNA region expressing the latter sgRNA, thereby randomly generating a new random sgRNA. These new randomly generated sgRNAs, once matched to genomic DNA, direct the endonuclease to mutate at these random sites. Using the system of the present invention, random mutations can be made in cells, a novel method of random mutation.

(2) Mutations can be randomly performed in somatic cells using the gene editing system of the present invention, and various mutations can be performed to varying degrees. If an endogenous enzyme is driven by an egg cell-specific promoter, a large number of fertilized eggs or zygotes with independent mutation events can be obtained, and the process can be repeated in the next generation, but only one or several different sgRNA gene editing systems can be constructed. The tens of thousands of random mutant libraries do not need to design thousands of sgRNAs. This method is efficient and low-cost, and can be used to construct mutant libraries.

DRAWINGS

Figure 1 shows the sgRNA1-1 and sgRNA2-1 expression cassette sequences;

Figure 2 shows the structure of the expression cassette of the final vector;

Figure 3 shows the type of sgRNA1-1 region change;

Figure 4 shows the emergence of albino seedlings in the T2 generation;

Figure 5 shows that the PDS3 genes of four albino seedlings have undergone frameshift mutations.

detailed description

The invention will be further illustrated by the following examples in connection with examples. The following description is by way of example, but the scope of protection of the present invention should not be limited thereto.

Example 1. Design and construction capable of spontaneous targeting to generate new sgRNA target sequences

Two expression cassettes expressing sgRNA1-1 and sgRNA2-1, respectively, were constructed by direct gene synthesis. sgRNA2-1 will direct Cas9 to edit the region of DNA that expresses sgRNA1-1, resulting in a new sgRNA sequence. Wherein, the sgRNA1-1 expression cassette sequence SEQ ID NO: 1 and the sgRNA2-1 expression cassette sequence SEQ ID NO: 2 are shown in FIG.

The two expression cassettes were ligated together and cloned into the pHEE401E vector {Reference (1) Xing H L, Dong L, Wang Z P, et al. A CRISPR/Cas9 toolkit for multiplex genome editing in plants [J]. BMC Plant Biology, 2014,14(1):327.(2)Wang Z P,Xing H L,Dong L,et al.Egg cell-specific promoter-controlled CRISPR/Cas9efficiently generate homozygous mutants for multiple target genes in Arabidopsis in a single generation[ J]. Genome Biology, 2015, 16(1): 144.}, transferred into Agrobacterium for transformation of Arabidopsis thaliana by the silk flower method. The expression cassette structure of the final vector is shown in Figure 2, and the full sequence of the vector is shown in SEQ ID NO: 3.

Example 2. Transformation of Arabidopsis thaliana {Methods and materials used in this section, reference (3) Chen Y, Wang Z, Ni H, Xu Y, Chen Q*, Jiang L.*2017.CRISPR/Cas9-mediated base -editing system efficiently generates gain-of-function mutations in Arabidopsis.Science China Life Sciences 60,520-523.}

After the constructed vector was transformed into Agrobacterium GV3101 strain by freeze-thaw method, the bacterial solution was applied to YEP solid medium (containing kanamycin and gentamicin) by scribing, in a dark environment at 28 ° C. After 36-48 hours of culture, a single colony was picked and inoculated into 1 ml of liquid YEB medium to which kanamycin and gentamicin had been added, and cultured overnight with shaking (28 ° C, 200 rpm). At this time, colony PCR was performed, and the positive clones were selected, added to a 50 ml Erlenmeyer flask, and 25 ml of YEP liquid medium (containing kanamycin and gentamicin) was added, and cultured at 28 ° C and 200 rpm. Until the OD600 value rises to within 0.8-1.0. The supernatant was removed by centrifugation, and the cells were resuspended in the same volume of 5% sucrose solution (100 ml sterile deionized water plus 5 g sucrose), and Silwet L-77 (0.02%) was added to the bacterial solution to mix. . The appropriate Arabidopsis inflorescence was taken in the bacterial liquid for 0.5-1 min, and the black opaque plastic bag was covered on the Arabidopsis seedlings to create dark conditions. The cells were placed in a greenhouse at 22 ° C for 24 h and then transferred to light culture. Seeds are harvested after the seeds are ripe.

Example 3. Screening of transgenic Arabidopsis plants {Methods and materials used in this section, refer to (3) Chen Y, Wang Z, Ni H, Xu Y, Chen Q*, Jiang L.*2017.CRISPR/Cas9-mediated base -editing system efficiently generates gain-of-function mutations in Arabidopsis.Science China Life Sciences 60,520-523.}

The harvested Arabidopsis seeds were sterilized and screened for transgenic plants on MS medium containing hygromycin (25 mg/L). The DNA of the T1 plant was extracted, and the regions of sgRNA1-1 and sgRNA2-1 were subjected to PCR amplification and sequencing. T1 generation plants were selected without editing and T2 seeds were harvested.

Example 4. sgRNA sequence appeared in T2 plants

The DNA of the T2 generation green seedlings was extracted, and the sgRNA1-1 and sgRNA2-1 regions were subjected to PCR amplification and sequencing. As a result, it was found that the sgRNA2-1 region was unchanged, and the sgRNA1-1 region was changed from the original CCTGACCGCCGAACCATGGC to a plurality of different types, thereby producing a new sgRNA, as shown in FIG.

Example 5. New sgRNAs from T2 plants can guide Cas9 to edit Arabidopsis genomes

The above-obtained T2 seeds were screened on MS plates containing hygromycin, and a large number of albino seedlings appeared, as shown in Table 1 and Figure 4.

Table 1. Albino seedlings appear in the T2 generation

DNA of T2 albino seedlings was extracted, and PCR amplification and sequencing were performed on the sgRNA1-1 and sgRNA2-1 regions. As a result, it was found that the sgRNA2-1 region was unchanged, and the sgRNA1-1 region was changed from the original CCTGACCGCCGAACCATGGC to CCTGACCGCCGACCATGGC. This new sgRNA will direct Cas9 to cleave the Arabidopsis PDS3 gene. Sequencing of PDS3 gene amplification in albino seedlings indicated that the PDS3 gene had a frameshift mutation at the target site of the sgRNA, resulting in loss of PDS3 gene function and a whitening phenotype. As shown in Figure 5, the PDS3 genes of 4 randomly selected albino seedlings were sequenced, and the results showed that frameshift mutations occurred.

At the same time, after many tests, it is found that when constructing more random mutant libraries, several different sgRNA gene editing systems can be designed; or two sgRNA sequences of an sgRNA gene editing system include one or two identical Or different sequences, that is, sgRNA may be three or more, such as sgRNA1 including sgRNA1-1, sgRNA1-2, and the like, and sgRNA2 includes sgRNA2-1, sgRNA2-2, and the like. In addition, the technical system of the present invention is applied to a model plant such as Brachypodium serrata, or other aforementioned plants, such as food crops, legume crops, oil crops, fiber crops, fruit crops, root crops, vegetables. Crops, flower crops, medicinal crops, raw crops, pasture crops, sugar crops, beverage crops, turf plants, tree crops, nut crops, etc., also produce corresponding random mutations at specific screening pressures (herbicides, drought) Under abiotic stress or biotic stress such as pests and diseases, it is expected to screen out resistant mutants, and it can also be applied to various animals, so it has good industrial value.

All publications and patent applications mentioned in the specification are hereby incorporated herein by reference in their entirety in their entirety in their entirety herein

Although the foregoing invention has been described in connection with the preferred embodiments and the embodiments of the embodiments Modifications are within the scope of the invention.

Claims (10)

1. A randomly mutated gene editing system comprising a targeting element and an editing element, the targeting element directing an editing element to edit a gene, wherein the targeting element is capable of random mutation, thereby The editing component is guided to edit the new target sequence.
2. The gene editing system according to claim 1, wherein said targeting element comprises a combination of one or both of protein, RNA, DNA, or said targeting element comprises a different protein, a different RNA or a different DNA; the editing element is an enzyme that uses a base of DNA or DNA as a substrate.
3. The gene editing system according to claim 1 or 2, wherein said editing element is an endonuclease; said targeting element is two sgRNA sequences: sgRNA1 and sgRNA2, a partial sequence of said sgRNA2 and a corresponding sgRNA1 The sequences are highly coincident, allowing the sgRNA1-directed endonuclease to perform gene editing in the DNA region expressing sgRNA2, thereby randomly generating a new sgRNA, which can direct the endonuclease for gene editing, thereby generating a random mutation; preferably The gene editing system comprises a CRISPR system; preferably, the two sgRNA sequences comprise one or more identical or different sequences, respectively.
4. The gene editing system according to claim 3, wherein the partial sequence of the sgRNA2 and the sequence of the corresponding sgRNA1 are highly coincident means that the gene sequence expressing sgRNA2 can be recognized by sgRNA1 and cleaved by an endonuclease.
5. The gene editing system according to claim 3 or 4, wherein the endonuclease is a Cas protein or a Cpf1 protein, wherein the Cas protein is preferably Cas9, Cas9n, dCas9 or xCas9.
6. A nucleic acid expressing the gene editing system of any of claims 1-5.
7. A vector expressing the gene editing system of any of claims 1-5.
8. A method of random mutation in a cell, characterized in that the steps are as follows:

   The nucleic acid of claim 6 or the vector of claim 7 is introduced into a host cell to culture the host.
9. A method for constructing a mutant library, characterized in that the steps are as follows:

   The nucleic acid of claim 6 or the vector of claim 7 is introduced into a host cell to culture the host.
10. The method according to claim 8 or 9, wherein the host cell is a germ cell or an asexual reproductive organism in a sexual reproductive organism that is cleavable and capable of growing into an individual.

Images