WO2019180153A1 - Mir-34a modulating compounds in the therapy of diseases - Google Patents

Abstract

The present invention relates to a mi R-34a modulating compound for use in the treatment of a disease accompanied by an impaired T-cell receptor signaling. Further, the present invention relates to a method of determining whether a patient responds to a treatment of a disease accompanied by an impaired T-cell receptor signaling. Furthermore, the present invention relates to a mi R-34a binding molecule for use in the treatment of a disease accompanied by an impaired calcium signaling. In addition, the present invention relates to a method of determining whether a patient responds to a treatment of a disease accompanied by an impaired calcium signaling.

Description

MIR-34A MODULATING COMPOUNDS IN THE THERAPY OF DISEASES

The present invention relates to a miR-34a modulating compound for use in the treatment of a disease accompanied by an impaired T-cell receptor signaling. Further, the present invention relates to a method of determining whether a patient responds to a treatment of a disease accompanied by an impaired T-cell receptor signaling. Furthermore, the present invention relates to a miR-34a binding molecule for use in the treatment of a disease accompanied by an impaired calcium signaling. In addition, the present invention relates to a method of determining whether a patient responds to a treatment of a disease accompanied by an impaired calcium signaling.

BACKGROUND OF THE INVENTION

Towards a deeper understanding of the immune response, it is crucial to dissect the molecular mechanisms regulating the activity of immune cells. MicroRNAs (miRNAs, miRs) play a central role in the regulation of development and homeostasis, particularly in T-cell differentiation. MiRNAs are small non coding RNAs of ~ 21-24 nucleotides in length and regulate gene expression post-transcriptionally. Specifically, miRNAs inhibit protein biosynthesis by binding to sequences in 3’ untranslated regions (3’UTR) or in fewer instances in 5’ untranslated regions or open reading frames of their target mRNA. On the cellular level, miRNAs control various processes including differentiation, development, proliferation, signal transduction and apoptosis. Inappropriate miRNA expression has been linked to a variety of diseases. For example, miRNAs are aberrantly expressed in whole blood from patients with different tumor identities. Thus, molecules that alter the function or abundance of miRNAs represent a new strategy for treating diseases, e.g. cancer. Especially, miRNA replacement therapy seeks to reintroduce a missing miRNA or miRNA inhibition therapy seeks to block an overexpressed miRNA. There still exists an unmet need for such kind of therapeutics. There also exists an unmet need for a powerful and reliable test whether such therapeutics are really effective.

A special miRNA candidate is miR-34a. Analysis of miRNA expression in different blood cell subpopulations showed significant deregulation of miR-34a in CD3+ T-cells of lung cancer patients. MiRNA-34a directly targets five PKC- (protein kinase C-) Isozymes, which affect cell signaling trough the immunological synapse (IS) during the adaptive immune response. Specifically, PRKCQ (protein kinase C theta) controls T-cell functions by regulating signaling pathways leading to activation of nuclear factor kB (NF-kB) which is a major modulator of T cell receptor signaling controlling adaptive immune responses by modulating T-cell fate. To further investigate the impact of miRNA-34a on the NF-kB signalosome, the present inventors analyzed key players in NF-kB signaling for posttranscriptional regulation by this miRNA. Within the NF-kB signaling, they identified miR-34a binding sites in the 3’UTRs of 15 key modulators including TCRA (T-cell receptor alpha locus), PLCG1 (phospholipase C gamma 1), CD3E (CD3e molecule), PIK3CB (phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit beta), TAB 2 (TGFbeta activated kinase 1/MAP3K7 binding protein 2), and NFKBIA (NFKB inhibitor alpha), the latter of which also showing a significantly reduced luciferase activity upon co-transfection with a 3’ UTR reporter vector and a miR-34a expression plasmid. While overexpression of miR- 34a lead to a decrease of endogenous NFKBIA protein as the most cytoplasmic downstream NF- KB pathway member, transfection of anti-miR-34a caused a significant increase of the NFKBIA protein level in primary CD4+ and CD8+ T-cells. As for the upstream effect, ectopic expression of miR-34a caused a significant reduction of the cell surface abundance of TCRA and CD3E in CD4+ and CD8+ T-cells. Inhibition of miR-34a resulted in elevated cell surface levels of CD3E and TCRA in CD4+ T-cells and of TCRA in CD8+ T-cells. CD8+T-cells over expressing miR- 34a displayed a reduced target cell killing 30 and 50 hours after transfection. Thus, miR-34a deregulation results in an impaired T-cell receptor signaling. The T-cell receptor signaling is affected in severe diseases such as cancer or neurodegenerative diseases. Therapeutics which eliminate malfunctions of T-cell receptor signaling are still needed.

Based on the above, the present inventors provide a miR-34a modulating compound for use in the treatment of diseases accompanied by an impaired T-cell receptor signaling. They further provide a new diagnostic test for determining therapy responses of diseases accompanied by an impaired T-cell receptor signaling based on the determination of the expression level of miR-34a.

Store -operated Ca2+ entry (SOCE) is a central signaling pathway in T-cells regulating cellular activation, proliferation, migration, and survival. Upon T-cell receptor activation, second messenger IP3 (Inositol l,4,5-trisphosphate) binds to its receptor in the endoplasmic reticulum (ER) membrane resulting in a depletion of ER Ca2+ stores. This in turn causes conformational changes and oligomerization of the ER Ca2+ sensor STIM (Stromal interaction molecule), accompanied by translocation to the plasma membrane. Interaction of STIM with Ca2+ pore forming ORAI proteins subsequently induces a concentration dependent influx of Ca2+ ions from extracellular space. Within the cell Ca2+ is transported to refill intracellular stores and serves as second messenger. Various Ca2+ induced pathways, including the calcineurin/nuclear factor of activated T-cells (NFAT) pathway, finally result in transcriptional activation of genes that are essential for T-cell activity. Based on its central role for T-cell functions, a deregulation in SOCE is associated with immune deficiency and a reduced anti-tumor immunity in cancer. A recent study on mouse CD4+ T-cells possessing an aberrant miRNA biogenesis reveals changes in efficiency of SOCE, suggesting a functional role of miRNAs in SOCE regulation. Due to a conjunction with miRNA-induced silencing complex, miRNA binding leads to an inhibition of translation or target mRNA degradation and results in a reduction of corresponding protein level. Although SOCE and calcineurin signaling are affected in severe diseases, mechanisms that modulate them are only partially deciphered. In particular, therapeutics which eliminate malfunctions of SOCE and calcineurin signaling are still needed.

The present inventors found that miR-34a is a central regulator of store -operated Ca2+ signaling and downstream calcineurin/NFAT pathway. They provide a miR-34a binding molecule for use in the treatment of a disease accompanied by an impaired calcium signaling. They further provide a new diagnostic test for determining therapy responses of diseases accompanied by impaired calcium signaling based on the determination of the expression level of miR-34a.

SUMMARY OF THE INVENTION

In a first aspect, the present invention relates to a miR-34a modulating compound for use in the treatment of a disease accompanied by an impaired T-cell receptor signaling. This aspect can also be worded as follows: In a first aspect, the present invention relates to the use of a miR- 34a modulating compound for the manufacture of a medicament for the treatment of a disease accompanied by an impaired T-cell receptor signaling. Alternatively, the present invention relates in a first aspect to a method for treating a disease accompanied by an impaired T-cell receptor signaling comprising the step of: administering (an effective amount of) a miR-34a modulating compound to a patient in need thereof.

In a second aspect, the present invention relates to a combination of a miR-34a modulating compound and a drug different from a miR-34a modulating compound for use in the treatment of a disease accompanied by an impaired T-cell receptor signaling. This aspect can also be worded as follows: In a second aspect, the present invention relates to the use of a combination of a miR- 34a modulating compound and a drug different from a miR-34a modulating compound for the manufacture of a medicament for the treatment of a disease accompanied by an impaired T-cell receptor signaling. Alternatively, the present invention relates in a second aspect to a method for treating a disease accompanied by an impaired T-cell receptor signaling comprising the step of: administering (an effective amount of) a combination of a miR-34a modulating compound and a drug different from a miR-34a modulating compound to a patient in need thereof.

In a third aspect, the present invention relates to a pharmaceutical composition comprising the miR-34a modulating compound as defined in the first aspect or the combination as defined in the second aspect and a pharmaceutical acceptable carrier for use in the treatment of a disease accompanied by an impaired T-cell receptor signaling.

In a fourth aspect, the present invention relates to a method of determining whether a patient responds to a treatment of a disease accompanied by an impaired T-cell receptor signaling comprising the step of: determining the level of miR-34a in a biological sample isolated from the patient.

In a fifth aspect, the present invention relates to a miR-34a binding molecule for use in the treatment of a disease accompanied by an impaired calcium signaling. This aspect can also be worded as follows: In a fifth aspect, the present invention relates to the use of a miR-34a binding molecule for the manufacture of a medicament for the treatment of a disease accompanied by an impaired calcium signaling. Alternatively, the present invention relates in a fifth aspect to a method for treating a disease accompanied by an impaired calcium signaling comprising the step of: administering (an effective amount of) a miR-34a binding molecule to a patient in need thereof.

In a sixth aspect, the present invention relates to a combination of a miR-34a binding molecule and a drug different from a miR-34a binding molecule for use in the treatment of a disease accompanied by an impaired calcium signaling. This aspect can also be worded as follows: In a sixth aspect, the present invention relates to the use of a combination of a miR-34a binding molecule and a drug different from a miR-34a binding molecule for the manufacture of a medicament for the treatment of a disease accompanied by an impaired calcium signaling. Alternatively, the present invention relates in a sixth aspect to a method for treating a disease accompanied by an impaired calcium signaling comprising the step of: administering (an effective amount of) a combination of a miR-34a binding molecule and a drug different from a miR-34a binding molecule to a patient in need thereof.

In a seventh aspect, the present invention relates to a pharmaceutical composition comprising the miR-34a binding molecule as defined in the fifth aspect or the combination as defined in the sixth aspect and a pharmaceutical acceptable carrier for use in the treatment of a disease accompanied by an impaired calcium signaling.

In an eight aspect, the present invention relates to a method of determining whether a patient responds to a treatment of a disease accompanied by an impaired calcium signaling comprising the step of: determining the level of miR-34a in a biological sample isolated from a patient.

In a ninth aspect, the present invention relates to a miR-34a molecule for use in the prevention of transplant rejection. This aspect can also be worded as follows: In a ninth aspect, the present invention relates to the use of a miR-34a molecule for the manufacture of a medicament for the prevention of transplant rejection. Alternatively, the present invention relates in a ninth aspect to a method for preventing transplant rejection comprising the step of: administering (an effective amount of) a miR-34a molecule to a patient in need thereof.

In a tenth aspect, the present invention relates to a pharmaceutical composition comprising the miR-34a molecule as defined in the ninth aspect and a pharmaceutical acceptable carrier for use in the prevention of transplant rejection.

This summary of the invention does not necessarily describe all features and/or all aspects of the present invention. Other embodiments will become apparent from a review of the ensuing detailed description.

DETAILED DESCRIPTION OF THE INVENTION

Definitions

Before the present invention is described in detail below, it is to be understood that this invention is not limited to the particular methodology, protocols and reagents described herein as these may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention which will be limited only by the appended claims. Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art.

Preferably, the terms used herein are defined as described in“A multilingual glossary of biotechnological terms: (IUPAC Recommendations)”, Leuenberger, H.G.W, Nagel, B. and Kolbl, H. eds. (1995), Helvetica Chimica Acta, CH-4010 Basel, Switzerland).

Several documents are cited throughout the text of this specification. Each of the documents cited herein (including all patents, patent applications, scientific publications, manufacturer's specifications, instructions, GenBank Accession Number sequence submissions etc.), whether supra or infra, is hereby incorporated by reference in its entirety. Nothing herein is to be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention. In the event of a conflict between the definitions or teachings of such incorporated references and definitions or teachings recited in the present specification, the text of the present specification takes precedence.

The term“comprise” or variations such as“comprises” or“comprising” according to the present invention means the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers. The term“consisting essentially of’ according to the present invention means the inclusion of a stated integer or group of integers, while excluding modifications or other integers which would materially affect or alter the stated integer. The term “consisting of’ or variations such as“consists of’ according to the present invention means the inclusion of a stated integer or group of integers and the exclusion of any other integer or group of integers.

The terms“a” and“an” and“the” and similar reference used in the context of describing the invention (especially in the context of the claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context.

The terms“microRNA”,“miRNA”, or“miR”, as used herein, refer to single-stranded mature RNA molecules of at least 10 nucleotides and of not more than 45 nucleotides covalently linked together. Usually, these RNA molecules are compounds of 10 to 45 nucleotides or 15 to 35 nucleotides in length, more preferably of 16 to 28 nucleotides or 17 to 27 nucleotides in length, i.e. 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45 nucleotides in length, not including optionally labels and/or elongated sequences (e.g. biotin stretches). The terms“microRNA”,“miRNA”, or“miR”, as used herein, further refer to RNA molecules which regulate gene expression pf protein-coding genes. They act as gene silencers, e.g. by binding to the 3’ untranslated regions (UTR) of mRNAs of target genes. The terms“microRNA”,“miRNA”, or“miR” are interchangeably used herein. The miRNAs are encoded by genes from whose DNA they are transcribed but miRNAs are not translated into protein (i.e. miRNAs are non-coding RNAs). The genes encoding miRNAs are longer than the processed mature miRNA molecules. The miRNAs are first transcribed as“primary transcripts” or“pri-miRNAs” The“pri-miRNAs”, which can be more than 1000 nucleotides in length, contain an RNA hairpin in which one of the two strands includes the mature miRNA. The hairpin, which typically comprises about 60 to 120 nucleotides, is cleaved from the“pri-miRNA” in the nucleus. This processing is performed in animals by a protein complex known as the microprocessor complex consisting of the nuclease Drosha and the double-stranded RNA binding protein Pasha.“pri-miRNA” typically comprise a cap and poly-A tail. The resulting“precursor miRNA” or“pre-miRNA” is transported to the cytoplasm via a process that involves Exportin-5. “pre -miRNAs” are short, stem-loop structures encompassing about 50 to 80 nucleotides. These pre-miRNAs are then processed to mature miRNAs in the cytoplasm by interaction with the endonuclease Dicer, which also initiates the formation of the RNA-induced silencing complex (RISC). When Dicer cleaves the pre-miRNA stem-loop, two complementary short RNA molecules are formed, but only one is integrated into the RISC. This strand is known as the guide strand and is selected by the argonaute protein, the catalytically active RNase in the RISC, on the basis of the stability of the 5’ end. The remaining strand, known as the miRNA*, anti-guide (anti-strand), or passenger strand, is degraded as a RISC substrate. Therefore, the miRNA*s are derived from the same hairpin structure like the“normal” miRNAs. So if the“normal” miRNA is then later called the“mature miRNA” or“guide strand”, the miRNA* is the“anti-guide strand” or“passenger strand”. In the context of the present invention, the miRNA is miR-34a. Its primary transcript is designated as pri-miR-34a and its precursor miRNA is designated as pre-miR-34a.

Inappropriately expressed miRNAs cause significant changes in biological pathways that can lead to a disease, e.g. a disease accompanied by an impaired T-cell receptor signaling or calcium signaling. MiRNAs, therefore, represent potential targets whose selective modulation could alter the course of a disease. For miRNAs whose expression is reduced in the disease state, re-introduction of the mature miRNA into the proper tissue could provide a therapeutic benefit by restoring regulation of target genes. Replacement strategies require, for example, delivery vehicles for delivery of double-stranded miRNA mimics. For miRNAs whose expression is increased in the disease state, inhibition of miRNA function through the use of anti-miRNAs could restore proper target gene regulation for therapeutic benefit. Single-stranded miRNA antagonists/anti- miRNAs can be administered systemically without a delivery vehicle, and they distribute to diverse tissue. They might be chemically-modified. In the context of the present invention, it is referred to a miR-34a binding molecule, e.g. anti-miR-34a, in order to therapy diseases accompanied with an upregulation/induction of miR-34a (inhibition therapy) or to a miR-34a molecule, e.g. a miR-34a mimic, in order to therapy diseases accompanied with a downregulation/reduction of miR-34a (replacement therapy).

In this respect, the term“miRNA modulating compound”, as used herein, refers to a molecule which is able to influence the level of a miRNA within the cell. The presence of the miRNA modulating compound may increase the miRNA level or decrease the miRNA level within the cell. The miRNA modulating compound may be a miRNA binding molecule or a miRNA molecule. The administration of a miRNA binding molecule reduces the level of the miRNA within the cell and/or block its function within the cell. The administration of a miRNA molecule increases the level of the miRNA within the cell and/or improves its function within the cell. In the context of the present invention, the miRNA modulating compound is a miR-34a modulating compound.

The term“miRNA binding molecule”, as used herein, refers to a compound which is able to bind to or hybridize with a miRNA. Preferably, the miRNA binding molecule is selected from the group consisting of an anti-miRNA, a small interfering RNA (siRNA), a short hairpin RNA (shRNA), an antisense 2’-0-methyl (2’-OMe) oligoribonucleotide, and an antibody or an antibody fragment thereof. Said miRNA binding molecules can decrease the expression of the miRNA or block the miRNA. The miRNA activity can be inhibited or significantly reduced by using said miRNA binding molecules. Due to their binding, the biochemical and biological function of the miRNA is inhibited or at least partially inhibited. In the context of the present invention, the miRNA binding molecule is a miR-34a binding molecule.

The terms “anti-miRNA oligonucleotides (also known as AMOs)” or simply “anti- miRNAs”, as used herein, refer to molecules that have many uses in cellular mechanics. Anti- miRNAs are synthetically designed molecules which are used to neutralize miRNA function in cells for desired responses. miRNAs have complementary sequences to mRNAs that are involved in the cleavage of RNAs or the suppression of the translation. By controlling the miRNAs that regulate mRNAs in cells, anti-miRNAs can be used as further regulation as well as for therapeutic treatment for certain cellular disorders. This regulation can occur through a steric blocking mechanism as well as hybridization to miRNA. Anti-miRNAs are typically single-stranded oligonucleotides complementary to the miRNAs in order to block their function. These interactions, within the body between miRNA and anti-miRNAs, can be for therapeutics in disorders in which over expression occurs or aberrations in miRNA lead to coding issues. Some of the miRNA linked disorders that are encountered in animals or humans include cancers, autoimmune disorders, and viruses. In order to determine the functionality of certain anti-miRNAs, the anti-miRNAs/miRNA binding expression (transcript concentration) must be measured against the expressions of the isolated miRNA. The direct detection of differing levels of genetic expression allow the relationship between anti-miRNAs and miRNAs to be shown. This can be detected through luciferase activity (biolumincescence in response to targeted enzymatic activity). Understanding the miRNA sequences involved in these diseases can allow the use of anti-miRNAs to disrupt pathways that lead to the over expression of proteins of cells that can cause symptoms for these diseases. In the context of the present invention, the anti-miRNA is anti-miR-34a.

MiRNA blocking/inhibition can also be achieved by using RNA interference (RNAi) technology. RNA interference uses typically small interfering RNAs (siRNAs) and/or short hairpin RNAs (shRNAs). The administration of such molecules (e.g. siRNAs, shRNAs) leads to a decrease of the level of the miRNAs within the cell.

The term“siRNA”, as used herein, refers to typically double-stranded RNA molecules (dsRNA) that mediate the targeted cleavage of a RNA transcript via a RNA-induced silencing complex (RISC) pathway. siRNA molecules interfere with the expression of specific genes with complementary nucleotide sequences by degrading mRNA after transcription.

The terms“short hairpin RNA (shRNA)” or“small hairpin RNA (shRNA)”, as used herein, refer to an artificial RNA molecule with a tight hairpin turn that can be used to silence target gene expression via RNA interference (RNAi). In particular, the shRNAs comprise a hairpin structure (also called stem loop). In a preferred embodiment, shRNAs comprise a short antisense strand, followed by a nucleotide loop of about 5 to about 9 nucleotides, and the analogous sense strand. Alternatively, the sense strand may precede the nucleotide loop structure and the antisense strand may follow.

The miRNA binding molecules can be synthesized to include a modification that imparts a desired characteristic. For example, the modification can improve stability, hybridization thermodynamics with the target miRNA, targeting to a particular tissue or cell-type, or cell permeability. Modifications can also increase sequence specificity, and consequently decrease off site targeting. The miRNA binding molecule may include a non-nucleotide moiety. The non nucleotide moiety can be attached to the 3' or 5' end of the oligonucleotide agent. A wide variety of well-known, alternative oligonucleotide chemistries may be used (see, e.g. US 2007/0213292, US 2008/0032945, US 2007/0287831 , etc.), particularly single-stranded complementary oligonucleotides comprising 2' methoxyethyl, 2'-fluoro, and morpholino bases. The oligonucleotide may include a 2 '-modified nucleotide, e.g., a 2'-deoxy, 2'-deoxy-2'-fluoro, 2'-0- methyl, 2' -O -methoxyethyl (2'-0-MOE), 2'-0- aminopropyl (2'-0-AP), 2'-0-dimethylaminoethyl (2'-0-DMAOE), 2'-0- dimethylaminopropyl (2'-0-DMAP), 2'-0-dimethylaminoethyloxy ethyl (2'- O- DMAEOE), or 2'-0-N-methylacetamido (2'-0— NMA). Also contemplated are locked nucleic acid (LNA) and peptide nucleic acids (PNA).

The terms “antibody”, “immunoglobulin”, “Ig” and “Ig molecule” are used interchangeably herein. They refer to Y-shaped proteins that are produced by the immune system to help stop intruders from harming the body. When an intruder enters the body, the immune system springs into action. These invaders, which are called antigens, can be viruses, bacteria, or other chemicals. When an antigen is found in the body, the immune system will create antibodies to mark the antigen for the body to destroy. The terms are used in their broadest sense and include monoclonal antibodies (including full length monoclonal antibodies), polyclonal antibodies, single chain antibodies, and multispecific antibodies (e.g. bispecific antibodies). The term“antibody fragment”, as used herein, refers to a polypeptide that includes at least one immunoglobulin variable domain or immunoglobulin variable domain sequence and which specifically binds a specific antigen. An antibody fragment can comprise an antibody or a polypeptide comprising an antigen-binding domain of an antibody. An antibody fragment can comprise a monoclonal antibody or a polypeptide comprising an antigen-binding domain of a monoclonal antibody. For example, an antibody can include a heavy (H) chain variable region and a light (L) chain variable region. An antibody may include two heavy (H) chain variable regions and two light (L) chain variable regions. The term“antibody fragment” encompasses antigen-binding fragments of antibodies such as single chain antibodies, Fab fragments, F(ab')2, Fv fragments and scFv. An antibody can have the structural features of IgA, IgG, IgE, IgD, IgM (as well as subtypes and combinations thereof). Antibodies can be from any source, including mouse, rabbit, pig, rat, and primate (human and non-human primate), whereby the antibodies have to be humanized before administered to a patient. Methods to humanize antibodies are well known in the art. The antibody or a fragment thereof may also be used to bind to/neutralize a miRNA.

The administration of such miRNA binding molecules (e.g. anti-miRNA, siRNA, shRNA) leads to a decrease in expression of the miRNA and/or blocking of the miRNA. In some embodiments, miRNA expression is decreased and/or miRNA blocking is achieved for an extended duration, e.g., at least one week, two weeks, three weeks, or four weeks or longer. For example, in certain instances, miRNA expression and/or miRNA function is suppressed by at least about 5%, preferably at least 10%, more preferably at least 15%, more preferably at least 20%, more preferably at least 25%, more preferably at least 30%, more preferably at least 40%, more preferably at least 50%, more preferably at least 60%, more preferably at least 70%, more preferably at least 80%, more preferably at least 90%, by administration of the miRNA binding molecule described herein. The degree of identity of the antisense sequences to the targeted sequence should be at least 85%, preferably at least 90%, more preferably at least 95%, more preferably at least 98%, in particular 100%.

In the context of the present invention, the miRNA binding molecule is a miR-34a binding molecule. The miR-34a binding molecule is preferably selected from the group consisting of an anti-miRNA, a small interfering RNA (siRNA), a short hairpin RNA (shRNA), an antisense 2’-0- methyl (2’-OMe) oligoribonucleotide, and an antibody or an antibody fragment thereof.

In an alternative approach, to increase the level of a miRNA within a cell, the miRNA modulating compound is a“miRNA molecule”, e.g. a nucleic acid molecule encoding the miRNA. The administration of such a nucleic acid molecule is advantageous because it can be used to express the miRNA within the body. The nucleic acid molecule is preferably a DNA or RNA molecule, wherein the DNA molecule is preferably comprised in an expression vector, preferably an expression plasmid. The expression vector preferably comprises a promoter. Promoters which can be used for this purpose include a cytomegalovirus (CMV) promoter, thymidine kinase (TK) promoter of herpes simplex virus (HSV), SV40 promoter, etc. Preferably, the miRNA molecule is selected from the group consisting of a mature miRNA, pre -miRNA, pri-miRNA, miR mimic, and a nucleotide sequence encoding the miRNA.

The term“miRNA mimics”, as used herein, refers to small, chemically modified double- stranded RNAs that mimic endogenous miRNAs and enable up-regulation of miRNA activity. In contrast thereto,“miRNA inhibitors” such as anti-miRNAs are small, chemically modified single- stranded RNA molecules designed to specifically bind to and inhibit endogenous miRNA molecules and enable down-regulation of miRNA activity. The administration of such miRNA molecules (e.g. a mature miRNA or a nucleotide sequence encoding the miRNA) leads to an increase in expression of the miRNA or increase of the level of the miRNA within the cell. In some embodiments, the miRNA expression is increased or miRNA level is increased for an extended duration, e.g., at least one week, two weeks, three weeks, or four weeks or longer. For example, in certain instances, the miRNA expression or miRNA level is increased by at least about 5%, preferably at least 10%, more preferably at least 15%, more preferably at least 20%, more preferably at least 25%, more preferably at least 30%, more preferably at least 40%, more preferably at least 50%, more preferably at least 60%, more preferably at least 70%, more preferably at least 80%, more preferably at least 90%, by administration of the miRNA molecule described herein. The degree of identity of the sense sequences to the targeted sequence should be at least 85%, preferably at least 90%, more preferably at least 95%, more preferably at least 98%, in particular 100%.

In the context of the present invention, the miRNA molecule is a miR-34a molecule. The miR-34a molecule is preferably selected from the group consisting of a mature miR-34a, pre-miR- 34a, pri-miR-34a, miR-34a mimic, and a nucleotide sequence encoding miR-34a.

The term “miRNA modulating compound delivery”, as used herein, refers to the administration of the miRNA modulating compound to a patient in need thereof. A variety of methods/techniques may be used to deliver a miRNA modulating compound, including an anti- miRNA and a miRNA mimic, into a body, in particular into a target cell comprised therein. The delivery can be accomplished by direct injection into cells or into the blood stream and can often be enhanced using hydrophobic or cationic carriers. For example, the anti-miRNA can be administered to the patient in need thereof either as a naked oligonucleotide agent, in conjunction with a delivery reagent, or as a recombinant plasmid or viral vector which expresses the oligonucleotide agent. For cells in situ, several applicable delivery methods are well-established. In particular, cationic lipids and polymers such as polyethylenimine have been used to facilitate oligonucleotide delivery. Compositions consisting essentially of the oligomer (i.e., the oligomer in a carrier solution without any other active ingredients) can be directly injected into the host. In vivo applications of duplex RNAs are also possible. When microinjection is not an option, delivery can be enhanced in some cases by using Lipofectamine™ (Invitrogen, Carlsbad, CA). Peptides such as penetratin, transportan, Tat peptide, nuclear localization signal (NLS), and others, can be attached to the oligomer to promote cellular uptake. Alternatively, certain single-stranded oligonucleotide agents can be expressed within cells from eukaryotic promoters. Those skilled in the art realize that any nucleic acid can be expressed in eukaryotic cells from the appropriate DNA/RNA vector. The recombinant vectors can be DNA/RNA plasmids or viral vectors. Oligonucleotide agent-expressing viral vectors can be constructed based on, but not limited to, adeno-associated virus, retrovirus, adenovirus, or alphavirus. The recombinant vectors capable of expressing the oligonucleotide agents can be delivered as described above, and can persist in target cells. Alternatively, viral vectors can be used that provide for transient expression of nucleic acid molecules. Such vectors can be repeatedly administered as necessary. Once expressed, the miRNA binding molecule interacts with the target RNA (e.g., miRNA or pre -miRNA) and inhibits miRNA activity. In a particular embodiment, the miRNA binding molecule forms a duplex with the target miRNA, which prevents the miRNA from binding to its target mRNA, which results in increased translation of the target mRNA. Delivery of oligonucleotide agent-expressing vectors can be systemic, such as by intravenous or intra-muscular administration, by administration to target cells ex-planted from a subject followed by reintroduction into the subject, or by any other means that would allow for introduction into the desired target cell. It is preferred that the miRNA modulating compound is suitable to be administered topically, intravenously, intradermally, intraarterially, intraperitoneally, intralesionally, intracranially, intraarticularly, intraprostaticaly, intrapleurally, intratracheally, intraocularly, intranasally, intravitreally, intravaginally, intrarectally, intramuscularly, subcutaneously, subconjunctivally, intravesicularly, mucosally, intrapericardially, intraumbilically, orally, by inhalation, by injection, by infusion, by continuous infusion, by localized perfusion bathing target cells directly, via a catheter, or via a lavage. It is also preferred that the miRNA modulating compound is suitable to be administered by providing a delivery system selected from the group consisting of an expression construct, preferably a vector, more preferably a viral vector, even more preferably an adenovirus, an adeno-associated virus, a retrovirus, or a lentivirus vector, a liposome, a polymer-mediated delivery system, a conjugate delivery system, an exosome, a microsponge, and a nanoparticle, preferably a gold particle.

The miRNA modulating compound may be administered in the form of any suitable pharmaceutical composition. Said pharmaceutical composition may further comprise pharmaceutical acceptable carriers, diluents, and/or excipients. Said pharmaceutical composition is useful for treating, preventing, or reducing the severity of a disease, in particular a disease accompanied by an impaired T-cell receptor signaling or calcium signaling. It may be administered locally or systemically, preferably systemically.

The term“systemic administration”, a used herein, refers to the administration of the miRNA modulating compound such that said compound becomes widely distributed in the body of a patient in significant amounts and develops a biological effect. Typical systemic routes of administration include administration by introducing the miRNA modulating compound directly into the vascular system or oral, pulmonary, or intramuscular administration wherein the miRNA modulating compound enters the vascular system and is carried to one or more desired site(s) of action via the blood. The systemic administration may be by parenteral administration. The term “parenteral administration”, as used herein, refers to the administration of the miR A modulating compound such that said compound does not pass the intestine. The term “parenteral administration” includes intravenous administration, subcutaneous administration, intradermal administration, or intraarterial administration, but is not limited thereto.

The pharmaceutical composition according to the present invention is generally applied in a“pharmaceutically effective amount”. The term“pharmaceutically effective amount”, as used herein, refers to the amount which achieves a desired reaction or a desired effect alone or together with further doses. In case of the treatment of a particular disease, the desired reaction preferably relates to an inhibition of the course of the disease. This comprises slowing down the progress of the disease and, in particular, interrupting or reversing the progress of the disease. The desired reaction in a treatment of a disease may also be a delay of the onset or a prevention of the onset of the disease. An effective amount of the compounds or compositions described herein will depend on the condition to be treated, the severeness of the disease, the individual parameters of the patient, including age, physiological condition, size, and weight, the duration of treatment, the type of an accompanying therapy (if present), the specific route of administration, and similar factors. Accordingly, the doses of the compounds or compositions described herein may depend on various of such parameters. In case that a reaction in the patient/subject is insufficient with an initial dose, higher doses (or effectively higher doses achieved by a different, more localized route of administration) may be used.

The compounds/molecules described herein are preferably administered in an amount of 0.1 to 10 mg/kg body weight, preferably 0.2 to 8 mg/kg body weight, more preferably 0.3 to 6 mg/kg body weight, more preferably 0.4 to 5 mg/kg body weight, more preferably 0.5 to 4 mg/kg body weight.

As mentioned above, the pharmaceutical composition of the present invention may further comprise pharmaceutical acceptable carriers, diluents, and/or excipients.

The term “excipient”, as used herein, is intended to indicate all substances in a pharmaceutical composition which are not active ingredients such as binders, lubricants, thickeners, surface active agents, preservatives, emulsifiers, buffers, flavoring agents, or colorants.

The term“diluent”, as used herein, relates to a diluting and/or thinning agent. Moreover, the term“diluent” includes a solution, suspension (e.g. liquid or solid suspension) and/or media.

The term“carrier”, as used herein, relates to one or more compatible solid or liquid fillers, which are suitable for an administration, e.g. to a human. The term“carrier” relates to a natural or synthetic organic or inorganic component which is combined with an active component in order to facilitate the application of the active component. Preferably, carrier components are sterile liquids such as water or oils, including those which are derived from mineral oil, animals, or plants, such as peanut oil, soy bean oil, sesame oil, sunflower oil, etc. Salt solutions and aqueous dextrose and glycerin solutions may also be used as aqueous carrier compounds.

Pharmaceutically acceptable carriers or diluents for therapeutic use are well known in the pharmaceutical art, and are described, for example, in Remington's Pharmaceutical Sciences, Mack Publishing Co. (A. R Gennaro edit. 1985). Examples of suitable carriers include, for example, magnesium carbonate, magnesium stearate, talc, sugar, lactose, pectin, dextrin, starch, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose, a low melting wax, cocoa butter, and the like. Examples of suitable diluents include ethanol, glycerol, and water.

Pharmaceutical carriers, diluents, and/or excipients can be selected with regard to the intended route of administration and standard pharmaceutical practice. The pharmaceutical compositions of the present invention may comprise as, or in addition to, the carrier(s), excipient(s) or diluent(s) any suitable binder(s), lubricant(s), suspending agent(s), coating agent(s), and/or solubilising agent(s). Examples of suitable binders include starch, gelatin, natural sugars such as glucose, anhydrous lactose, free-flow lactose, beta-lactose, com sweeteners, natural and synthetic gums, such as acacia, tragacanth or sodium alginate, carboxymethyl cellulose, and polyethylene glycol. Examples of suitable lubricants include sodium oleate, sodium stearate, magnesium stearate, sodium benzoate, sodium acetate, sodium chloride, and the like. Preservatives, stabilizers, dyes, and even flavoring agents may be provided in the pharmaceutical composition. Examples of preservatives include sodium benzoate, sorbic acid, and esters of p-hydroxybenzoic acid. Antioxidants and suspending agents may be also used.

The term“polynucleotide probe”, as used herein, means a molecule of at least 10 nucleotides and of not more than 45 nucleotides covalently linked together. Preferably, the polynucleotide probes described herein are molecules of 10 to 35 nucleotides or 15 to 45 nucleotides in length, more preferably of 16 to 28 nucleotides or 17 to 27 nucleotides in length, i.e. 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45 nucleotides in length, not including optionally spacer elements and/or elongation elements described below. The depiction of a single strand of a polynucleotide probe also defines the sequence of the complementary strand. Polynucleotide probes may be single-stranded or may contain portions of both double-stranded and single- stranded sequences. The term“polynucleotide probe” means a polymer of deoxyribonucleotide or ribonucleotide bases and includes DNA and RNA molecules, both sense and anti-sense strands. In detail, the polynucleotide probe may be DNA, both cDNA and genomic DNA, RNA, cRNA or a hybrid, where the polynucleotide sequence may contain combinations of deoxyribonucleotide or ribonucleotide bases, and combinations of bases including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine, hypoxanthine, isocytosine and isoguanine. Polynucleotides may be obtained by chemical synthesis methods or by recombinant methods.

The polynucleotide probe is capable of binding to, hybridizing with, or detecting a target of complementary sequence, such as a nucleotide sequence of a miRNA or miRNA*, through one or more types of chemical bonds, usually through complementary base pairing, usually through hydrogen bond formation. Polynucleotides in their function as probes may bind target sequences, such as nucleotide sequences of miRNAs or miRNAs*, lacking complete complementarity with the polynucleotide sequences depending upon the stringency of the hybridization condition. There may be any number of base pair mismatches which will interfere with hybridization between the target sequence, such as a nucleotide sequence of a miRNA or miRNA*, and the single-stranded polynucleotide described herein. However, if the number of mutations is so great that no hybridization can occur under even the least stringent hybridization conditions, the sequences are no complementary sequences. The polynucleotide used as a probe for detecting a miRNA or miRNA*, may be unlabeled, directly labeled, or indirectly labeled, such as with biotin to which a streptavidin complex may later bind. The polynucleotide, e.g. the polynucleotide used as a probe for detecting a miRNA or miRNA*, may also be modified, e.g. may comprise an elongation (EL) element. For use in a RAKE or MPEA assay, a polynucleotide with an elongation element may be used as a probe. The elongation element comprises a nucleotide sequence with 1 to 30 nucleotides chosen on the basis of showing low complementarity to potential target sequences, such as nucleotide sequences of miRNAs or miRNAs*, therefore resulting in not to low degree of cross- hybridization to a target mixture. Preferred is a homomeric sequence stretch Nn with n = 1 to 30, i.e. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30, and N = A or C, or T or G. Particularly preferred is a homomeric sequence stretch Nn with n = 1 to 12, i.e. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12, and N = A or C, or T or G. The polynucleotide used as a probe for detecting a miRNA or miRNA*, may be present in form of a tandem, i.e. in form of a polynucleotide hybrid of two different or identical polynucleotides, both in the same orientation, i.e. 5’ to 3’ or 3’ to 5’, or in different orientation, i.e. 5’ to 3’ and 3’ to 5’. Said polynucleotide hybrid/tandem may comprise a spacer element. For use in a tandem hybridization assay, the polynucleotide hybrid/tandem as a probe may comprise a spacer (SP) element. The spacer element represents a nucleotide sequence with n = 0 to 12, i.e. 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12, nucleotides chosen on the basis of showing low complementarity to potential target sequences, such as nucleotide sequences of miRNAs or anti-miRNAs, therefore resulting in not to low degree of cross-hybridization to a target mixture. It is preferred that n is 0, i.e. that there is no spacer between the two miRNA sequence stretches. In the context of the present invention, the polynucleotide probe is a probe which is capable of binding to, hybridizing with, or detecting miR-34a, in particular in order to determine the level of miR-34a within the biological sample isolated from a patient/subject.

The term“label”, as used herein, means a composition detectable by spectroscopic, photochemical, biochemical, immunochemical, chemical, or other physical means. For example, useful labels include 32P, fluorescent dyes, electron-dense reagents, enzymes (e.g., as commonly used in an ELISA), biotin, digoxigenin, or haptens and other entities which can be made detectable. A label may be incorporated into nucleic acids at any position, e.g. at the 3’ or 5’ end or internally. The polynucleotide probe and/or the miRNA itself may be labeled.

The term“stringent hybridization conditions”, as used herein, means conditions under which a first nucleic acid sequence (e.g. polynucleotide in its function as a probe for detecting a miRNA or miRNA*) will hybridize to a second nucleic acid sequence (e.g. target sequence such as nucleotide sequence of a miRNA or miRNA*), such as in a complex mixture of nucleic acids. Stringent conditions are sequence-dependent and will be different in different circumstances. Stringent conditions may be selected to be about 5 to l0°C lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength pH. The Tm may be the temperature (under defined ionic strength, pH, and nucleic acid concentration) at which 50% of the probes complementary to the target hybridize to the target sequence at equilibrium (as the target sequences are present in excess, at Tm, 50% of the probes are occupied at equilibrium). Stringent conditions may be those in which the salt concentration is less than about 1.0 M sodium ion, such as about 0.01 tol .O M sodium ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 20°C for short probes (e.g., about 10-35 nucleotides) and up to 60°C for long probes (e.g., greater than about 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. For selective or specific hybridization, a positive signal may be at least 2 to 10 times background hybridization. Exemplary stringent hybridization conditions include the following: 50% formamide, 5x SSC, and 1% SDS, incubating at 42°C, or, 5x SSC, 1% SDS, incubating at 65°C, with wash in 0.2x SSC, and 0.1% SDS at 65°C; or 6x SSPE, 10 % formamide, 0.01 %,' Tween 20, 0.1 x TE buffer, 0.5 mg/ml BSA, 0.1 mg/ml herring sperm DNA, incubating at 42°C with wash in 05x SSPE and 6x SSPE at 45°C.

The term “antisense”, as used herein, refers to nucleotide sequences which are complementary to a specific DNA or RNA sequence. The term“antisense strand” is used in reference to a nucleic acid strand that is complementary to the“sense” strand.

Residues in two or more polynucleotides are said to“correspond” to each other if the residues occupy an analogous position in the polynucleotide structures. It is well known in the art that analogous positions in two or more polynucleotides can be determined by aligning the polynucleotide sequences based on nucleic acid sequence or structural similarities. Such alignment tools are well known to the person skilled in the art.

The term“differential expression” of a nucleic acid molecule, as used herein, refers to a qualitative and/or quantitative difference in the temporal and/or local nucleic acid molecule expression pattern, e.g. within and/or among biological samples. Thus, a differentially expressed nucleic acid molecule may qualitatively have its expression altered, including an activation or inactivation in, for example, a biological sample from a diseases subject versus a biological sample from a healthy subject. The difference in nucleic acid molecule expression may also be quantitative, e.g. in that expression is modulated, i.e. either up-regulated, resulting in an increased amount of the nucleic acid molecule, or down-regulated, resulting in a decreased amount of the nucleic acid molecule. The degree to which nucleic acid molecule expression differs need only be large enough to be quantified via standard expression characterization techniques, e.g. by quantitative hybridization (e.g. to a microarray, to beads), amplification (PCR, RT-PCR, qRT- PCR, high-throughput RT-PCR), ELISA for quantitation, next generation sequencing (e.g. ABI SOLID, Illumina Genome Analyzer, Roche 454 GS LL, BGISEQ), flow cytometry (e.g. LUMINEX) and the like.

The term“level”, as used herein, refers to an amount (measured for example in grams, mole, or counts such as ion or fluorescence counts) or concentration (e.g. absolute or relative concentration) of a miRNA. The term“level”, as used herein, also comprises scaled, normalized, or scaled and normalized amounts or values. Preferably, the level determined herein is the expression level.

The term“disease”, as used herein, refers to an abnormal condition that affects the body of an individual. A disease is often construed as a medical condition associated with specific symptoms and signs. A disease may be caused by factors originally from an external source, such as infectious disease, or it may be caused by internal dysfunctions, such as autoimmune diseases. In humans,“disease” is often used more broadly to refer to any condition that causes pain, dysfunction, distress, social problems, or death to the individual afflicted, or similar problems for those in contact with the individual. In this broader sense, it sometimes includes injuries, disabilities, disorders, syndromes, infections, isolated symptoms, deviant behaviors, and atypical variations of structure and function, while in other contexts and for other purposes these may be considered distinguishable categories. Diseases usually affect individuals not only physically, but also emotionally, as contracting and living with many diseases can alter one's perspective on life, and one's personality. In the context of the present invention, the disease is a disease accompanied by an impaired T-cell receptor signaling or calcium signaling. The term“T-cell receptor signaling”, as used herein, refers to a signaling pathway playing a key role in functioning of T-cells and formation of immunological synapses. It provides connection between T-cell and the antigen-presenting cell (APC). T-cell receptor (TCR) activation promotes a number of signaling cascades that ultimately determine cell fate through regulating cytokine production, cell survival, proliferation, and differentiation. Activation of T-lymphocytes is a key event for an efficient response of the immune system. In particular, NF-kB functions as a modulator of T-cell receptor signaling controlling the adaptive immune response. In several diseases the T-cell receptor signaling is impaired.

The terms“T-cells” or“T-lymphocytes”, as used herein, relate to types of lymphocytes that play a central role in cell-mediated immunity. T-cells or T-lymphocytes can be distinguished from other lymphocytes, such as B-cells and natural killer (NK) cells, by the presence of a T-cell receptor (TCR) on the cell surface. They do not have antigen presenting properties (but rather, requiring B-cells or NK cells for its antigen-presenting property). They are called T-cells because they mature in the thymus. T-cells are capable of recognizing an antigen when displayed on the surface of antigen presenting cells or matrix together with one or more MHC molecules or one or more non-classical MHC molecules.

The term“T-cell cytotoxicity/killing”, as used herein, refers to a process wherein cancer cells, cells that are infected (particularly with viruses), or cells that are damaged in other ways are destroyed. In this way, cancer and infections by intracellular pathogens can be cured. In this process, killer T-cells (also designated as cytotoxic T-cells) are involved. A killer T-cell is a T- lymphocyte (a type of white blood cell) that kills cancer cells, cells that are infected (particularly with viruses), or cells that are damaged in other ways. A killer T-cell expresses T-cell receptors (TCRs) that can recognize a specific antigen. An antigen is a molecule capable of stimulating an immune response, and is often produced by cancer cells or viruses. Antigens inside a cell are bound to class I MHC molecules, and brought to the surface of the cell by the class I MHC molecule, where they can be recognized by the T-cell. If the TCR is specific for that antigen, it binds to the complex of the class I MHC molecule and the antigen, and the T-cell destroys the cell. In order for the TCR to bind to the class I MHC molecule, the former must be accompanied by a glycoprotein called CD8, which binds to the constant portion of the class I MHC molecule. Therefore, this T-cell is also called CD8+ T-cell.

The term“T-cell modulation”, as used herein, refers to a process wherein the immune response is changed/adapted by the secretion of small proteins called cytokines by activated T- cells. In this process, T-helper cells are involved. This cells are also called CD4+ T-cells. A CD4+ T-cell expresses the CD4 glycoprotein on its surface. It becomes activated when it is presented with peptide antigens by MHC class II molecules, which are expressed on the surface of antigen- presenting cells (APCs). Once activated, it divides rapidly and secretes small proteins called cytokines that regulate or assist in modulating the immune response. This cell can differentiate into one of several subtypes, including THI , TH2, TH3, TH17, TH9, or TFH, which secrete different cytokines to facilitate different types of immune responses.

The term“antigen presenting cell (APC)”, as used herein, is a cell of a variety of cells capable of displaying, acquiring, and/or presenting at least one antigen or antigenic fragment on (or at) its cell surface. Antigen-presenting cells can be distinguished in professional antigen presenting cells and non-professional antigen presenting cells.

The term“macrophage”, as used herein, refers to a subgroup of phagocytic cells produced by the differentiation of monocytes. Macrophages which are activated by inflammation, immune cytokines, or microbial products nonspecifically engulf and kill foreign pathogens within the macrophage by hydrolytic and oxidative attack resulting in degradation of the pathogen. Peptides from degraded proteins are displayed on the macrophage cell surface where they can be recognized by T-cells, and they can directly interact with antibodies on the B-cell surface, resulting in T- and B-cell activation and further stimulation of the immune response. Macrophages belong to the class of antigen presenting cells (APCs).

The term“disease accompanied by an impaired T-cell receptor signaling”, as used herein, refers to any condition wherein the T-cell receptor signaling is disturbed. These diseases may be characterized by a reduced T-cell receptor signaling which may lead to a“shutdown” of the T-cell receptor signaling process. In this case, the T-cell mediated modulation of the immune response of an individual will be ended. These diseases may also be characterized by an increased T-cell receptor signaling which may lead to a“sloping over” of the T-cell receptor signaling process. In a preferred embodiment, the disease accompanied by an impaired T-cell receptor signaling is selected from the group consisting of a neurodegenerative disease, an autoimmune disease, an infectious disease, and cancer.

The term“neurodegenerative disease”, as used herein, refers to a condition which primarily affects the neurons in the brain. Neurons are the building blocks of the nervous system which includes the brain and spinal cord. Neurons normally don’t reproduce or replace themselves, so when they become damaged or die they cannot be replaced by the body. Examples of neurodegenerative diseases include Parkinson’s, Alzheimer’s, and Huntington’s disease. Neurodegenerative diseases are incurable and debilitating conditions that result in progressive degeneration and/or death of nerve cells. This causes problems with movement (called ataxias), or mental functioning (called dementias). Dementias are responsible for the greatest burden of neurodegenerative diseases, with Alzheimer’s representing approximately 60-70% of dementia cases. The term“autoimmune disease”, as used herein, refers to any disease in which the body produces an immunogenic (i.e. immune system) response to some constituent of its own tissue. In other words, the immune system loses its ability to recognize some tissue or system within the body as self and targets and attacks it as if it were foreign. Autoimmune diseases can be classified into those in which predominantly one organ is affected (e.g. hemolytic anemia and anti-immune thyroiditis), and those in which the autoimmune disease process is diffused through many tissues (e.g. systemic lupus erythematosus). For example, multiple sclerosis is thought to be caused by T- cells attacking the sheaths that surround the nerve fibers of the brain and spinal cord. This results in loss of coordination, weakness, and blurred vision. Autoimmune diseases are known in the art and include, for instance, Hashimoto's thyroiditis, Grave's disease, lupus, multiple sclerosis, rheumatic arthritis, hemolytic anemia, anti-immune thyroiditis, systemic lupus erythematosus, celiac disease, Crohn's disease, colitis, diabetes, scleroderma, psoriasis, and the like.

The term “infectious disease”, as used herein, refers to any disease which can be transmitted from individual to individual or from organism to organism, and is caused by a microbial agent (e.g. common cold). Infectious diseases are known in the art and include, for example, a viral disease, a bacterial disease, or a parasitic disease. Said diseases are caused by a virus, a bacterium, and a parasite, respectively. In this regard, the infectious disease can be, for example, hepatitis, sexually transmitted diseases (e.g. chlamydia or gonorrhea), tuberculosis, HIV/acquired immune deficiency syndrome (AIDS), diphtheria, hepatitis B, hepatitis C, cholera, severe acute respiratory syndrome (SARS), the bird flu, and influenza.

The terms “cancer disease” or “cancer”, as used herein, refer to or describe the physiological condition in an individual that is typically characterized by unregulated cell growth. Examples of cancers include, but are not limited to, carcinoma, lymphoma, blastoma, sarcoma, and leukemia. More particularly, examples of such cancers include bone cancer, blood cancer lung cancer, liver cancer, pancreatic cancer, skin cancer, cancer of the head or neck, cutaneous or intraocular melanoma, uterine cancer, ovarian cancer, rectal cancer, cancer of the anal region, stomach cancer, colon cancer, breast cancer, prostate cancer, uterine cancer, carcinoma of the sexual and reproductive organs, Hodgkin's Disease, cancer of the esophagus, cancer of the small intestine, cancer of the endocrine system, cancer of the thyroid gland, cancer of the parathyroid gland, cancer of the adrenal gland, sarcoma of soft tissue, cancer of the bladder, cancer of the kidney, renal cell carcinoma, carcinoma of the renal pelvis, neoplasms of the central nervous system (CNS), neuroectodermal cancer, spinal axis tumors, glioma, meningioma, and pituitary adenoma. The term“cancer” according to the invention also comprises cancer metastases.

The term“calcium signaling”, as used herein, refers to a cellular pathway in which calcium is involved. In particular, calcium can act in signal transduction resulting from activation of ion channels or as a second messenger caused by indirect signal transduction pathways. Calcium (as Ca2+) is a ubiquitous second messenger with wide-ranging physiological roles. These include muscle contraction, neuronal transmission as in an excitatory synapse, cellular motility (including the movement of flagella and cilia), fertilisation, cell growth or proliferation, neurogenesis, learning and memory as with synaptic plasticity, and secretion of saliva. High levels of cytoplasmic calcium can also cause the cell to undergo apoptosis. Other biochemical roles of calcium include regulating enzyme activity, permeability of ion channels, activity of ion pumps, and components of the cytoskeleton. Moreover, store-operated Ca²⁺ entry (SOCE) and calcineurin signaling are central signaling pathways in immune cells. These pathways are affected in severe disease.

The term“disease accompanied by an impaired calcium signaling”, as used herein, refers to any condition wherein the calcium signaling is disturbed. There diseases may be characterized by a reduced calcium signaling which may lead to a“shutdown” of the calcium signaling process. These diseases may also be characterized by an increased calcium signaling which may lead to a “sloping over” of the calcium signaling process. In a preferred embodiment, the disease accompanied by an impaired calcium signaling is selected from the group consisting of a neurodegenerative disease and cardiovascular disease.

The term“cardiovascular disease”, as used herein, refers to a condition that involves the heart or blood vessels. Cardiovascular disease includes coronary artery diseases (CAD) such as angina and myocardial infarction (commonly known as a heart attack). Other CVDs include stroke, heart failure, hypertensive heart disease, rheumatic heart disease, cardiomyopathy, heart arrhythmia, congenital heart disease, valvular heart disease, carditis, aortic aneurysms, peripheral artery disease, thromboembolic disease, and venous thrombosis.

The term“miR-34a (also designated as miR-34a-5p herein)”, as used herein, refers to a miRNA member of the miR-34 family. The miR-34a family further comprises the miRNA members miR-34b and miR-34c. In mammalians, the miR-34 family comprises three processed miRNAs that are encoded by two different genes: miR-34a is encoded by its own transcript, whereas miR-34b and miR-34c share a common primary transcript. In mice, miR-34a is ubiquitously expressed with the highest expression in brain, whereas miR-34b/c is mainly expressed in lung tissues. MiR-34a is expressed at higher levels than miR-34b/c, with the exception of the lung, in which miR-34b/c is dominantly expressed. Therefore, the miR-34 genes presumably have tissue-specific functions. MiR-34a is upregulated in neurodegenerative diseases, autoimmune diseases, infectious diseases, and cardiovascular diseases (compared to a healthy control state). In contrast thereto, miR-34a is downregulated in cancer (compared to a healthy control state). Preferably, the (mature) miR-34a has a nucleotide sequence according to SEQ ID NO: 1.

The present inventors found that miR-34a impairs T-cell receptor signaling by binding to the mRNA of one or more target genes selected from the group consisting of TCRA, PLCG1, CD3E, PIK3CB, TAB 2, and NFKBIA. Due to this binding, T-cell receptor signaling is reduced. It may also be abolished due to the action of miR-34a. The present inventors found that diseases accompanied with an impaired, in particular reduced, T-cell receptor signaling like neurodegenerative diseases, autoimmune diseases, and infectious diseases can be treated by administering to a patient in need thereof a miR-34a binding molecule such as an anti-miR-34a. The anti-miR-34a has preferably a nucleotide sequence according to SEQ ID NO: 3. It may also be a variant thereof having a sequence identity of at least 90%, preferably at least 95%, thereto. Cancer, which is also a disease accompanied with an impaired T-cell receptor signaling, can, for example, be treated by administering to a patient in need thereof a miR-34a molecule such as a miR-34a mimic. The miR-34a is downregulated in cancer diseases. Preferably, the miR-34a mimic has a nucleotide sequence according to SEQ ID NO: 2. It may also be a variant thereof having a sequence identity of at least 90%, preferably at least 95%, thereto.

The present inventors also found that miR-34a impairs calcium signaling by binding to the mRNA of one or more target genes selected from the group consisting of ITPR2, CAMLG, STIM1, ORAI3, RCAN1, PPP3R1, and NFATC4. In particular, an impaired calcium signaling encompasses an impairment of a store-operated Ca2+ entry (SOCE) and/or calcineurin signaling. Due to this binding, calcium signaling is reduced. It may also be abolished due to the action of miR-34a. The present inventors found that diseases accompanied with an impaired, in particular reduced, calcium signaling like neurodegenerative diseases and cardiovascular disease can be treated by administering to a patient in need thereof a miR-34a binding molecule such as an anti-miR-34a. The anti-miR-34a has preferably a nucleotide sequence according to SEQ ID NO: 3. It may also be a variant thereof having a sequence identity of at least 90%, preferably at least 95%, thereto. The miR34a precursor has a nucleotide sequence according to SEQ ID NO: 4. The miR-34a sequence according to SEQ ID NO: 1 is comprised therein. From the miR34a precursor (SEQ ID NO: 4), the pri-miR34a and the pra-miR34a are produced, before the (mature) miR-34a (SEQ ID NO: 1) is finally generated.

The term “patient”, as used herein, refers to any subject suffering from a disease accompanied by an impaired T-cell receptor signaling or calcium signaling. The patient may be treated and/or the response to said treatment may be evaluated. The patient may also be a transplanted patient. The patient may be any mammal, including both a human and another mammal, e.g. an animal such as a rabbit, mouse, rat, or monkey. Human subjects as patients are particularly preferred.

The term“(control) subject”, as used herein, refers to a subject known to be not affected by a disease accompanied by an impaired T-cell receptor signaling or calcium signaling (negative control), i.e. healthy with respect to a disease accompanied by an impaired T-cell receptor signaling or calcium signaling. The term“(control) subject”, as used herein, also refers to a subject known to be affected by a disease accompanied by an impaired T-cell receptor signaling or calcium signaling, i.e. diseased. The (control) subject may be any mammal, including both a human and another mammal, e.g. an animal such as a rabbit, mouse, rat, or monkey. Human (control) subjects are particularly preferred. It should be noted that a (control) subject which is known to be healthy, i.e. not suffering from a disease accompanied by an impaired T-cell receptor signaling or calcium signaling, may possible suffer from another disease not known/tested.

The term“treatment”, in particular“therapeutic treatment”, as used herein, refers to any therapy which improves the health status and/or prolongs (increases) the lifespan of a patient. Said therapy may eliminate the disease in a patient, arrest or slow the development of a disease in a patient, inhibit or slow the development of a disease in a patient, decrease the frequency or severity of symptoms in a patient, and/or decrease the recurrence in a patient who currently has or who previously has had a disease.

A drug used in chemotherapy is a chemotherapeutic agent. The term“chemotherapeutic agent”, as used herein, refers to a compound that is administered in the treatment of cancer. These agents or drugs are categorized by their mode of activity within a cell, for example, whether and at what stage they affect the cell cycle. Alternatively, an agent may be characterized based on its ability to directly cross-link DNA, to intercalate into DNA, or to induce chromosomal and mitotic aberrations by affecting nucleic acid synthesis. Most chemotherapeutic agents fall into the following categories: alkylating agents, antimetabolites, antitumor antibiotics, mitotic inhibitors, and nitrosoureas.

The term“ biological sample”, as used herein, refers to any biological sample from a patient or (control) subject containing miR As, in particular miR-34a. The biological sample may be body fluid samples, e.g. blood (e.g. whole blood or blood fraction such as blood cell fraction, serum or plasma) samples, lymph samples, saliva samples, urine samples, or samples from other peripheral sources. Said biological samples may be provided by removing a body fluid from a patient or control (subject), but may also be provided by using a previously isolated sample. For example, a blood sample may be taken from a patient or (control) subject by conventional blood collection techniques. The biological sample, e.g. urine sample or blood sample, may be obtained from a patient or (control) subject prior to the initiation of a therapeutic treatment, during the therapeutic treatment, and/or after the therapeutic treatment. If the biological sample is obtained from a (control) subject, it is designated as a“reference biological sample”. Preferably, the reference biological sample is from the same source than the biological sample of the patient to be tested, e.g. both are blood samples or urine samples. It is further preferred that both are from the same species, e.g. from a human. It is also (alternatively or additionally) preferred that the measurements of the reference biological sample of the (control) subject and the biological sample of the patient to be tested are identical, e.g. both have an identical volume. It is particularly preferred that the reference biological sample and the biological sample are from patients/ (control) subjects of the same sex and similar age, e.g. no more than 2 years apart from each other.

The term“body fluid sample”, as used herein, refers to any liquid sample derived from the body of a patient or (control) subject containing miRNAs, in particular miR-34a. Said body fluid sample may be a urine sample, blood sample, sputum sample, breast milk sample, cerebrospinal fluid (CSF) sample, cerumen (earwax) sample, gastric juice sample, mucus sample, lymph sample, endolymph fluid sample, perilymph fluid sample, peritoneal fluid sample, pleural fluid sample, saliva sample, sebum (skin oil) sample, semen sample, sweat sample, tears sample, cheek swab, vaginal secretion sample, liquid biopsy, or vomit sample including components or fractions thereof.

The term“blood sample”, as used herein, refers to any blood sample derived from the body of a patient or (control) subject containing miRNAs, in particular miR-34a. Especially, the term “blood sample”, as used herein, encompasses whole blood or a blood fraction such as a blood cell/cellular fraction, serum, or plasma. Said blood sample may be provided by removing blood from a patient or (control) subject, but may also be provided by using a previously isolated sample. For example, a blood sample may be taken from a patient or (control) subject by conventional blood collection techniques. The blood sample may further be obtained from a patient or (control) subject prior to the initiation of a therapeutic treatment, during the therapeutic treatment, and/or after the therapeutic treatment.

It is preferred that the whole blood sample is collected by means of a blood collection tube. It is, for example, collected in a PAXgene Blood RNA tube, in a Tempus Blood RNA tube, in an EDTA- tube, in a Na-citrate tube, Heparin-tube or in a ACD-tube (Acid citrate dextrose). Preferably, when the whole blood sample is collected, the RNA-fraction, especially the miRNA fraction, may be protected/guarded against degradation. For this purpose special collection tubes (e.g. PAXgene Blood RNA tubes from Preanalytix, Tempus Blood RNA tubes from Applied Biosystems) or additives (e.g. RNAlater from Ambion, RNAsin from Promega), that stabilize the RNA fraction and/or the miRNA fraction, may be employed. It is also preferred that the whole blood sample is collected by means of a bloodspot technique, e.g. using a Mitra Microsampling Device. This technique requires smaller sample volumes, typically 45-60 mΐ for humans or less. For example, the whole blood may be extracted from the patient via a finger prick with a needle or lancet. Thus, the whole blood sample may have the form of a blood drop. Said blood drop is then placed on an absorbent probe, e.g. a hydrophilic polymeric material such as cellulose, which is capable of absorbing the whole blood. Once sampling is complete, the blood spot is dried in air before transferring or mailing to labs for processing. Because the blood is dried, it is not considered hazardous. Thus, no special precautions need be taken in handling or shipping. Once at the analysis site, the desired components, e.g. miRNAs, are extracted from the dried blood spots into a supernatant which is then further analyzed.

The term“blood cell/cellular fraction”, as used herein, refers to a blood cell/cellular portion which has been produced from whole blood by removing the extracellular fraction (serum and/or plasma). In other words, the blood cell/cellular fraction is depleted of the extracellular blood components, such as serum and/or plasma. Preferably, the blood cell/cellular portion comprises/essentially consists of/consists of erythrocytes, leukocytes, and/or thrombocytes, e.g. erythrocytes, leukocytes, and thrombocytes. In one embodiment, the blood cell/cellular portion comprises/essentially consists of the miRNAs of erythrocytes, leukocytes, and/or thrombocytes. In one another embodiment, the level of the miRNAs isolated from/obtained from erythrocytes, leukocytes, and/or thrombocytes is determined. In one another embodiment, the level of the miRNAs comprised in erythrocytes, leukocytes, and/or thrombocytes is determined. In one another embodiment, the level of miRNAs comprised in total RNA isolated from the (pelleted) blood cellular fraction of a whole blood sample is determined.

The term“total RNA” as used herein relates to the isolated RNA comprising the miRNA- fraction present in a blood sample, e.g. a blood cell preparation derived from a whole blood sample. Preferably, the total RNA contains the miRNA-fraction or contains a miRNA-enriched fraction of the isolated RNA. For example, the total RNA (comprising the miRNA-fraction or miRNA- enriched fraction) is obtained by lysis (e.g. Trizol) of the blood cells in the blood cell preparation, followed by RNA purification e.g. by phenol/chloroform extraction and/or separation based techniques (e.g. glass fiber filter column, silica-membrane column). Examples of kits for RNA isolation and purification include the miRNeasy Kits (Qiagen), PAXgene Blood miRNA Kit (Qiagen), mirVana PARIS Kit (Life Technologies), PARIS Kit (Life Technologies), Tempus Spin RNA Isolation Kit (Life Technologies).

In one embodiment, the total intracellular RNA from all blood cells, namely from erythrocytes, leukocytes, and thrombocytes, obtained from a whole blood sample taken/isolated from a patient is extracted and in said total intracellular RNA the level of the miRNAs, in particular miR-34a, is determined.

Embodiments of the invention

As mentioned above, NF-kB functions as modulator of T-cell receptor signaling controlling the adaptive immune response. Within the NF-kB signaling, the present inventors identified six new target genes of miR-34a , namely TCRA, PLCG1, CD3E, PIK3CB, TAB2, and NFKBIA. Ectopic expression of miR-34a in CD4+ and CD8+ T-cells lead to a significant decrease of both endogenous NFKBIA protein as the most cytoplasmic downstream NF-kB member and of the cell surface abundance of TCRA and CD3E. Inhibition of miR-34a caused a significant increase of the NFKBIA protein level in T-cells. The miR-34a inhibition elevated cell surface levels of TCRA in CD4+ and CD8+ T-cells. In CD4+ cells additionally CD3E levels were elevated. The inhibition of the identified new target genes by miR-34a resulted in an impaired T- cell receptor signaling. In particular, a reduction of the T-cell killing rate accompanied by a gradual increased miR-34a upon CD8+ T-cell activation further supports a model with miR-34a as a central NF-kB regulator. The T-cell receptor signaling is affected in severe diseases such as cancer, neurodegenerative diseases, infectious diseases, or autoimmune diseases. Therapeutics which eliminate malfunctions of T-cell receptor signaling are still needed. In view of the above, the present inventors provide a miR-34a modulating compound for use in the treatment of a disease accompanied by an impaired T-cell receptor signaling.

Thus, in a first aspect, the present invention relates to a miR-34a modulating compound for use in the treatment of a disease accompanied by an impaired T-cell receptor signaling.

In particular, the impaired T-cell receptor signaling is characterized by an inhibition of the translation of the mRNA of one or more target genes selected from the group consisting of TCRA, PLCG1, CD3E, PIK3CB, TAB2, and NFKBIA by miR-34a, e.g. in neurodegenerative diseases, infectious diseases, and autoimmune diseases. This inhibition leads to a reduction of the T-cell receptor signaling process. This reduction can finally result in a“shutdown” of the NF-KB signaling process.

Without the NF-kB signaling pathway, the T-cell, in particular CD8+ T-cell, mediated killing of the target cell is stopped/ended. A killer T-cell (also designated as cytotoxic cell) is a T- lymphocyte (a type of white blood cell) that kills cancer cells, cells that are infected (particularly with viruses), or cells that are damaged in other ways. A killer T-cell expresses T-cell receptors (TCRs) that can recognize a specific antigen. An antigen is a molecule capable of stimulating an immune response, and is often produced by cancer cells or viruses. Antigens inside a cell are bound to class I MHC molecules, and brought to the surface of the cell by the class I MHC molecule, where they can be recognized by the T-cell. If the TCR is specific for that antigen, it binds to the complex of the class I MHC molecule and the antigen, and the T-cell destroys the cell. In order for the TCR to bind to the class I MHC molecule, the former must be accompanied by a glycoprotein called CD8, which binds to the constant portion of the class I MHC molecule. Therefore, this T-cell is also called CD8+ T-cell.

In addition, without the NF-kB signaling pathway, the T-cell, in particular CD4+ T-cell, mediated modulation of the immune response, is stopped/ended. A CD4+ T-cell expresses the CD4 glycoprotein on its surface. It is also designated as T helper cell. It becomes activated when it is presented with peptide antigens by MHC class II molecules, which are expressed on the surface of antigen-presenting cells (APCs). Once activated, it divides rapidly and secretes small proteins called cytokines that regulate or assist in modulating the immune response. This cell can differentiate into one of several subtypes, including THI , TH2, TH3, TH17, TH9, or TFH, which secrete different cytokines to facilitate different types of immune responses.

Especially, miR-34a binds the mRNA of one or more target genes selected from the group consisting of TCRA, PLCG1, CD3E, PIK3CB, TAB2, and NFKBIA. In particular, miR-34a binds the 3’untranslated region (UTR) of the mRNA of said one or more target genes. Specifically, miR- 34a has a single binding site within the 3’UTRs of CD3E, PIK3CB, TAB2, and NFKBIA, miR-34a has four binding sites within the 3’UTR of TCRA, and/or miR-34a has two binding sites within the 3’UTR of PLCG1. The exact nucleotide positions of the binding sites of miR-34a within the 3’UTRs of these six genes are given in Figure 1 A-F. The binding of miR-34a preferably results in the inhibition of the translation of the mRNA of said one or more target genes.

Alternatively, the impaired T-cell receptor signaling is characterized by an insufficient induction of miR-34a expression, e.g. by NFKB, and/or inhibition of miR-34a, e.g. in cancer.

It is preferred that the miR-34a modulating compound is a miR-34a binding molecule or a miR-34a molecule.

It is more preferred that the miR-34a binding molecule is selected from the group consisting of an anti-miRNA, a small interfering RNA (siRNA), a short hairpin RNA (shRNA), an antisense 2’-0- methyl (2’-OMe) oligoribonucleotide, and an antibody or an antibody fragment thereof. It is most preferred that the anti-miR-34a has a nucleotide sequence according to SEQ ID NO: 3. It may also be a variant thereof having a sequence identity of at least 90%, preferably of at least 95%, e.g. of at least 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%, thereto, in particular over the whole length. The anti-miR-34a may further be chemically modified to improve stability and hybridization. In specific embodiments, anti-miR-34a comprises a nucleotide sequence according to SEQ ID NO: 3. It is also more preferred that the miR-34a molecule is selected from the group consisting of a mature miR-34a, pre-miR-34a, pri-miR-34a, miR-34a mimic, and a nucleotide sequence encoding miR-34a. It is most preferred that the mature miR-34a has a nucleotide sequence according to SEQ ID NO: 1. It may also be a variant thereof having a sequence identity of at least 90%, preferably of at least 95%, %, e.g. of at least 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%, thereto, in particular over the whole length. The mature miR-34a may further be chemically modified to improve stability and/or processing. In specific embodiments, the mature miR-34a comprises a nucleotide sequence according to SEQ ID NO: 1. It is also most preferred that the miR-34a mimic has a nucleotide sequence according to SEQ ID NO: 2. It may also be a variant thereof having a sequence identity of at least 90%, preferably of at least 95%, %, e.g. of at least 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%, thereto, in particular over the whole length. The miR-34a mimic may further be chemically modified to improve stability and/or processing. In specific embodiments, miR-34a mimic comprises a nucleotide sequence according to SEQ ID NO: 2.

It is (alternatively or additionally) further preferred that the disease is selected from the group consisting of a neurodegenerative disease, an autoimmune disease, an infectious disease, and cancer.

Specifically,

(i) the neurodegenerative disease is selected from the group consisting of Alzheimer’s disease (AD) and other dementias, Parkinson’s disease (PD) and PD-related diseases, Prion disease, Motor neurone diseases (MND), Huntington’s disease (HD), Spinocerebellar ataxia (SCA), Spinal muscular atrophy (SMA), AIDS dementia complex, and atherosclerosis,

(ii) the autoimmune disease is selected from the group consisting of diabetes, rheumatoid arthritis (RA), multiple sclerosis (MS), systemic lupus erythematosus (lupus), Graves’ disease, Sjogren’s syndrome, Hashimoto’s thyroiditis, Myasthenia gravis, Vasculitis, Pernicious anemia, and Celiac disease,

(iii) the infectious disease is selected from the group consisting of viral infection, preferably chronic or persistent viral infection, bacterial infection, parasitic infection, or

(iv) the cancer is selected from the group consisting of skin cancer, nasopharyngeal cancer, neuroendrocrine cancer, lung cancer, colon cancer, urothelial cancer, bladder cancer, liver cancer, ovarian cancer, gastric cancer, esophageal cancer, pancreatic cancer, kidney cancer, stomach cancer, esophageal cancer, breast cancer, renal cancer, head and neck cancer, brain cancer, lymphatic cancer, blood cancer, squamous cell cancer, laryngeal cancer, retina cancer, prostate cancer, cervical cancer, uterine cancer, testicular cancer, bone cancer, lymphoma, and leukemia. More specifically,

(i) the viral infection is selected from the group consisting of human immunodeficiency virus (HIV), hepatitis B virus (HBV), hepatitis C virus (HCV), rhinovirus (common cold), herpes simplex virus (HSV), and respiratory syncytial virus (RSV) infection,

(ii) the bacterial infection is selected from the group consisting of Helicobacter pylori, Mycobacterium tuberculosis, Mycobacterium leprae, and Chlamydia trachomatis infection, or

(iii) the parasitic infection is selected from the group consisting of a Schistosoma mansoni, Taenia crassiceps, or Leishmania mexicana infection.

In particular, the miR-34a modulating compound is suitable to be administered topically, intravenously, intradermally, intraarterially, intraperitoneally, intralesionally, intracranially, intraarticularly, intraprostaticaly, intrapleurally, intratracheally, intraocularly, intranasally, intravitreally, intravaginally, intrarectally, intramuscularly, subcutaneously, subconjunctivally, intravesicularly, mucosally, intrapericardially, intraumbilically, orally, by inhalation, by injection, by infusion, by continuous infusion, by localized perfusion bathing target cells directly, via a catheter, or via a lavage.

In particular (additionally or alternatively), the miR-34a modulating compound is suitable to be administered by providing a delivery system selected from the group consisting of an expression construct, e.g. a vector, like a viral vector, such as an adenovirus, an adeno-associated virus, a retrovirus, or a lentivirus vector, a liposome, a polymer-mediated delivery system, a conjugate delivery system, an exosome, a microsponge, and a nanoparticle, e.g. a gold particle.

It is even more preferred that the miR-34a modulating compound is a miR-34a binding molecule and the disease is selected from the group consisting of a neurodegenerative disease, an autoimmune disease, and an infectious disease. In these diseases, the T-cell receptor signaling is preferably reduced, it may also be abolished. The miR-34a binding molecule is preferably selected from the group consisting of an anti-miRNA, a small interfering RNA (siRNA), a short hairpin RNA (shRNA), an antisense 2’-0-methyl (2’-OMe) oligoribonucleotide, and an antibody or an antibody fragment thereof. The present inventors have namely found that miR-34a is upregulated in neurodegenerative diseases, autoimmune diseases, and infectious diseases (compared to a heathy state). For miR-34a, whose expression is increased in these diseases, inhibition of miR-34a function through the use of a miR-34a binding molecule, e.g. an anti-miR-34a, which restores proper target gene regulation, has therapeutic benefit. In particular, a single-stranded miR-34a antagonist/anti-miR-34a can be administered systemically without a delivery vehicle, and they distribute to diverse tissue. They might be chemically-modified.

Specifically, (i) the neurodegenerative disease is selected from the group consisting of Alzheimer’s disease (AD) and other dementias, Parkinson’s disease (PD) and PD-related diseases, Prion disease, Motor neurone diseases (MND), Huntington’s disease (HD), Spinocerebellar ataxia (SCA), Spinal muscular atrophy (SMA), AIDS dementia complex, and atherosclerosis,

(ii) the autoimmune disease is selected from the group consisting of diabetes, rheumatoid arthritis (RA), multiple sclerosis (MS), systemic lupus erythematosus (lupus), Graves’ disease, Sjogren’s syndrome, Hashimoto’s thyroiditis, Myasthenia gravis, Vasculitis, Pernicious anemia, and Celiac disease, or

(iii) the infectious disease is selected from the group consisting of viral infection, preferably chronic or persistent viral infection, bacterial infection, parasitic infection.

More specifically,

(i) the viral infection is selected from the group consisting of human immunodeficiency virus (HIV), hepatitis B virus (HBV), hepatitis C virus (HCV), rhinovirus (common cold), herpes simplex virus (HSV), and respiratory syncytial virus (RSV) infection,

(ii) the bacterial infection is selected from the group consisting of Helicobacter pylori, Mycobacterium tuberculosis, Mycobacterium leprae, and Chlamydia trachomatis infection, or

(iii) the parasitic infection is selected from the group consisting of a Schistosoma mansoni, Taenia crassiceps, or Leishmania mexicana infection.

It is also even more preferred that the miR-34a modulating compound is a miR-34a molecule and the disease is cancer. The miR-34a molecule is preferably selected from the group consisting of a mature miR-34a, pre-miR-34a, pri-miR-34a, miR-34a mimic, and a nucleotide sequence encoding miR-34a. The present inventors have namely found that miR-34a is downregulated in cancer (compared to a heathy state). For miR-34a, whose expression is reduced in this disease, re-introduction of mature miR-34a into the proper tissue has a therapeutic benefit by restoring regulation of target genes. Replacement strategies may require, for example, delivery vehicles for delivery of double-stranded miR-34a mimics.

In particular, the cancer is selected from the group consisting of skin cancer, nasopharyngeal cancer, neuroendrocrine cancer, lung cancer, colon cancer, urothelial cancer, bladder cancer, liver cancer, ovarian cancer, gastric cancer, esophageal cancer, pancreatic cancer, kidney cancer, stomach cancer, esophageal cancer, breast cancer, renal cancer, head and neck cancer, brain cancer, lymphatic cancer, blood cancer, squamous cell cancer, laryngeal cancer, retina cancer, prostate cancer, cervical cancer, uterine cancer, testicular cancer, bone cancer, lymphoma, and leukemia. It is also preferred that the treatment results in a T-cell activation, preferably in an activation of T-cell modulation and/or T-cell cytotoxicity/killing. The T-cells are preferably CD8⁺, CD3⁺, and/or CD4⁺ cells. The treatment specifically pertains to the administration of a miR-34a binding molecule. In particular, the disease to be treated is neurodegenerative disease, autoimmune disease, or an infectious disease. In the case of a neurodegenerative disease, an autoimmune disease, and an infectious disease, the treatment preferably takes place by (directly) activating T- cell receptor signaling. This is achieved by administering a miR-34a binding molecule.

This aspect of the present invention can also be worded as follows: In a first aspect, the present invention relates to the use of a miR-34a modulating compound for the manufacture of a medicament for the treatment of a disease accompanied by an impaired T-cell receptor signaling. Alternatively, the present invention relates in a first aspect to a method for treating a disease accompanied by an impaired T-cell receptor signaling comprising the step of: administering (an effective amount of) a miR-34a modulating compound to a patient in need thereof.

The ability of miR-34a to regulate the expression of key target genes of the T-cell receptor signaling pathway and its involvement in diseases accompanied by an impaired T-cell receptor signaling makes miR-34a to a candidate to combine it with other therapeutics which are frequently used to treat diseases accompanied by an impaired T-cell receptor signaling. In this way, the therapeutic effect can be improved. This way of treatment may also be designated as combination therapy.

Thus, in a second aspect, the present invention relates to a combination of a miR-34a modulating compound and a drug different from a miR-34a modulating compound for use in the treatment of a disease accompanied by an impaired T-cell receptor signaling.

The disease is preferably selected from the group consisting of a neurodegenerative disease, an autoimmune disease, an infectious disease, and cancer.

Specifically,

(i) the neurodegenerative disease is selected from the group consisting of Alzheimer’s disease (AD) and other dementias, Parkinson’s disease (PD) and PD-related diseases, Prion disease, Motor neurone diseases (MND), Huntington’s disease (HD), Spinocerebellar ataxia (SCA), Spinal muscular atrophy (SMA), AIDS dementia complex, and atherosclerosis,

(ii) the autoimmune disease is selected from the group consisting of diabetes, rheumatoid arthritis (RA), multiple sclerosis (MS), systemic lupus erythematosus (lupus), Graves’ disease, Sjogren’s syndrome, Hashimoto’s thyroiditis, Myasthenia gravis, Vasculitis, Pernicious anemia, and Celiac disease, (iii) the infectious disease is selected from the group consisting of viral infection, preferably chronic or persistent viral infection, bacterial infection, parasitic infection, or

(iv) the cancer is selected from the group consisting of skin cancer, nasopharyngeal cancer, neuroendrocrine cancer, lung cancer, colon cancer, urothelial cancer, bladder cancer, liver cancer, ovarian cancer, gastric cancer, esophageal cancer, pancreatic cancer, kidney cancer, stomach cancer, esophageal cancer, breast cancer, renal cancer, head and neck cancer, brain cancer, lymphatic cancer, blood cancer, squamous cell cancer, laryngeal cancer, retina cancer, prostate cancer, cervical cancer, uterine cancer, testicular cancer, bone cancer, lymphoma, and leukemia.

More specifically,

(i) the viral infection is selected from the group consisting of human immunodeficiency virus (HIV), hepatitis B virus (HBV), hepatitis C virus (HCV), rhinovirus (common cold), herpes simplex virus (HSV), and respiratory syncytial virus (RSV) infection,

(ii) the bacterial infection is selected from the group consisting of Helicobacter pylori, Mycobacterium tuberculosis, Mycobacterium leprae, and Chlamydia trachomatis infection, or

(iii) the parasitic infection is selected from the group consisting of a Schistosoma mansoni, Taenia crassiceps, or Leishmania mexicana infection.

It is preferred that

(i) the miR-34a modulating compound is a miR-34a binding molecule or a miR-34a molecule, and/or

(ii) the drug different from a miR-34a modulating compound is selected from the group consisting of a drug used in cancer therapy, immunotherapy, chemotherapy, hormone therapy, gene therapy, and infectious therapy.

It is more preferred that

(i) the miR-34a binding molecule is selected from the group consisting of an anti-miRNA, a small interfering RNA (siRNA), a short hairpin RNA (shRNA), an antisense 2’-0-methyl (2’-OMe) oligoribonucleotide, and an antibody or an antibody fragment thereof, and/or

(ii) the miR-34a molecule is selected from the group consisting of a mature miR-34a, pre-miR- 34a, pri-miR-34a, miR-34a mimic, and a nucleotide sequence encoding miR-34a.

It is even more preferred that the anti-miR-34a has a nucleotide sequence according to SEQ ID

NO: 3. It may also be a variant thereof having a sequence identity of at least 90%, preferably of at least 95%, e.g. of at least 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%, thereto, in particular over the whole length. The anti-miR-34a may further be chemically modified to improve stability and hybridization. In specific embodiments, anti-miR-34a comprises a nucleotide sequence according to SEQ ID NO: 3.

It is also even more preferred that the mature miR-34a has a nucleotide sequence according to SEQ ID NO: 1. It may also be a variant thereof having a sequence identity of at least 90%, preferably of at least 95%, %, e.g. of at least 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%, thereto, in particular over the whole length. The mature miR-34a may further be chemically modified to improve stability and/or processing. In specific embodiments, the mature miR-34a comprises a nucleotide sequence according to SEQ ID NO: 1.

It is also even more preferred that the miR-34a mimic has a nucleotide sequence according to SEQ ID NO: 2. It may also be a variant thereof having a sequence identity of at least 90%, preferably of at least 95%, %, e.g. of at least 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%, thereto, in particular over the whole length. The miR-34a mimic may further be chemically modified to improve stability and/or processing. In specific embodiments, miR-34a mimic comprises a nucleotide sequence according to SEQ ID NO: 2.

It is further even more preferred that

(i) the drug used in cancer therapy or immunotherapy is an antibody or a fragment thereof,

(ii) the drug used in infectious therapy is an antibiotic or antiviral agent, and/or

(ii) the drug used in chemotherapy (chemotherapeutic agent) is selected from the group consisting of an alkylating agent, an antimetabolite, an antitumor antibiotic, a mitotic inhibitor, and a nitrosourea.

Examples of chemotherapeutic agents include alkylating agents such as thiotepa and cyclosphosphamide; alkyl sulfonates such as busulfan, improsulfan and piposulfan; aziridines such as benzodopa, carboquone, meturedopa, and uredopa; ethylenimines and methylamelamines including altretamine, triethylenemelamine, trietylenephosphoramide, triethiylenethiophosphoramide and trimethylolomelamine; acetogenins (especially bullatacin and bullatacinone); a camptothecin (including the synthetic analogue topotecan); bryostatin; callystatin; CC- 1065 (including its adozelesin, carzelesin and bizelesin synthetic analogues); cryptophycins (particularly cryptophycin 1 and cryptophycin 8); dolastatin; duocarmycin (including the synthetic analogues, KW-2189 and CB1-TM1); eleutherobin; pancratistatin; a sarcodictyin; spongistatin; nitrogen mustards such as chlorambucil, chlomaphazine, cholophosphamide, estramustine, ifosfamide, mechlorethamine, mechlorethamine oxide hydrochloride, melphalan, novembichin, phenesterine, prednimustine, trofosfamide, uracil mustard; nitrosureas such as carmustine, chlorozotocin, fotemustine, lomustine, nimustine, and ranimnustine; antibiotics such as the enediyne antibiotics (e.g., calicheamicin, especially calicheamicin gammall and calicheamicin omegall; dynemicin, including dynemicin A; bisphosphonates, such as clodronate; an esperamicin; as well as neocarzinostatin chromophore and related chromoprotein enediyne antiobiotic chromophores, aclacinomysins, actinomycin, authramycin, azaserine, bleomycins, cactinomycin, carabicin, carminomycin, carzinophilin, chromomycinis, dactinomycin, daunorubicin, detorubicin, 6-diazo-5-oxo-L- norleucine, doxorubicin (including morpholino-doxorubicin, cyanomorpholino- doxorubicin, 2-pyrrolino- doxorubicin and deoxy doxorubicin), epirubicin, esorubicin, idarubicin, marcellomycin, mitomycins such as mitomycin C, mycophenolic acid, nogalamycin, olivomycins, peplomycin, potfiromycin, puromycin, quelamycin, rodorubicin, streptonigrin, streptozocin, tubercidin, ubenimex, zinostatin, zorubicin; anti-metabolites such as methotrexate and 5-fluorouracil (5-FU); folic acid analogues such as denopterin, methotrexate, pteropterin, trimetrexate; purine analogs such as fludarabine, 6-mercaptopurine, thiamiprine, thioguanine; pyrimidine analogs such as ancitabine, azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, doxifluridine, enocitabine, floxuridine; androgens such as calusterone, dromostanolone propionate, epitiostanol, mepitiostane, testolactone; anti-adrenals such as aminoglutethimide, mitotane, trilostane; folic acid replenisher such as frolinic acid; aceglatone; aldophosphamide glycoside; aminolevulinic acid; eniluracil; amsacrine; bestrabucil; bisantrene; edatraxate; defofamine; demecolcine; diaziquone; elformithine; elliptinium acetate; an epothilone; etoglucid; gallium nitrate; hydroxyurea; lentinan; lonidainine; maytansinoids such as maytansine and ansamitocins; mitoguazone; mitoxantrone; mopidanmol; nitraerine; pentostatin; phenamet; pirarubicin; losoxantrone; podophyllinic acid; 2-ethylhydrazide; procarbazine; PSK polysaccharide complex); razoxane; rhizoxin; sizofiran; spirogermanium; tenuazonic acid; triaziquone; 2, 2', 2"- trichlorotriethylamine; trichothecenes (especially T-2 toxin, verracurin A, roridin A and anguidine); urethan; vindesine; dacarbazine; mannomustine; mitobronitol; mitolactol; pipobroman; gacytosine; arabinoside ("Ara-C"); cyclophosphamide; thiotepa; taxoids, e.g., paclitaxel and doxetaxel; chlorambucil; gemcitabine; 6-thioguanine; mercaptopurine; methotrexate; platinum coordination complexes such as cisplatin, oxaliplatin and carboplatin; vinblastine; platinum; etoposide (VP- 16); ifosfamide; mitoxantrone; vincristine; vinorelbine; novantrone; teniposide; edatrexate; daunomycin; aminopterin; xeloda; ibandronate; irinotecan (e.g., CPT-I 1); topoisomerase inhibitor RFS 2000; difluorometlhylomithine (DMFO); retinoids such as retinoic acid; capecitabine; cisplatin (CDDP), carboplatin, procarbazine, mechlorethamine, cyclophosphamide, camptothecin, ifosfamide, melphalan, chlorambucil, busulfan, nitrosurea, dactinomycin, daunorubicin, doxorubicin, bleomycin, plicomycin, mitomycin, etoposide (VP 16), tamoxifen, raloxifene, estrogen receptor binding agents, taxol, paclitaxel, docetaxel, gemcitabien, navelbine, famesyl-protein tansferase inhibitors, transplatinum, 5-fluorouracil, vincristin, vinblastin and methotrexate and pharmaceutically acceptable salts, acids or derivatives of any of the above.

In the context of cancer treatment, a drug used in immunotherapy (immunotherapeutic), generally, relies on the use of immune effector cells and molecules to target and destroy cancer cells. Trastuzumab (Herceptin™) is such an example. The immune effector/immunotherapeutic may be, for example, an antibody specific for some markers on the surface of a tumor cell. The antibody alone may serve as an effector of therapy or it may recruit other cells to actually affect cell killing. The antibody also may be conjugated to a drug or toxin (chemotherapeutic, radionuclide, ricin A chain, cholera toxin, pertussis toxin, etc.) and serve merely as a targeting agent. Alternatively, the effector may be a lymphocyte carrying a surface molecule that interacts, either directly or indirectly, with a tumor cell target. Examples of immunotherapies include, but are not limited to, immune adjuvants e.g. Mycobacterium bovis, Plasmodium falciparum, dinitrochlorobenzene and aromatic compounds, cytokine therapy, e.g., interferons a, b, and g; IL-I, GM-CSF and TNF, and monoclonal antibodies, e.g., anti-ganglioside GM2, anti-HER-2, anti- pl85. In active immunotherapy, an antigenic peptide, polypeptide or protein, or an autologous or allogenic tumor cell composition or“vaccine” is administered, generally with a distinct bacterial adjuvant. In adoptive immunotherapy, the patient's circulating lymphocytes, or tumor infiltrated lymphocytes, are isolated in vitro, activated by lymphokines such as IF-2 or transduced with genes for tumor necrosis, and re-administered.

It is most preferred that the miR-34a modulating compound is a miR-34a binding molecule and the disease is selected from the group consisting of a neurodegenerative disease, an autoimmune disease, and an infectious disease.

It is also most preferred that the miR-34a modulating compound is a miR-34a molecule and the disease is cancer.

As mentioned above, a combination of a miR-34a modulating compound and a drug different from a miR-34a modulating compound is used for the treatment of a disease accompanied by an impaired T-cell receptor signaling. The miR-34a modulating compound and the drug different from a miR-34a modulating compound can be administered to a patient either together (in a composition or in separate compositions but given to the patient simultaneously or nearly simultaneous, for instance, within the hour of administration of other compound/drug) or separately (e.g., administered in separate compositions and at different times, typically more than 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, or more hours apart, or even via different routes). For example, the miR-34a modulating compound may be administered up to 1 to 12 hours after the drug different from a miR-34a modulating compound is administered. Alternatively, the drug different from a miR-34a modulating compound may be administered up to 1 to 12 hours after the miR-34a modulating compound is administered. Thus, the miR-34a modulating compound and the drug different from a miR-34a modulating compound, which are applied in combination to treat a disease accompanied by an impaired T-cell receptor signaling, may be part of a composition (the same composition) or may be part of different compositions which is/are used for the treatment.

As to further specific and preferred embodiments, it is referred to the first aspect of the present invention.

This aspect of the present invention can also be worded as follows: In a second aspect, the present invention relates to the use of a combination of a miR-34a modulating compound and a drug different from a miR-34a modulating compound for the manufacture of a medicament for the treatment of a disease accompanied by an impaired T-cell receptor signaling. Alternatively, the present invention relates in a second aspect to a method for treating a disease accompanied by an impaired T-cell receptor signaling comprising the step of: administering (an effective amount of) a combination of a miR-34a modulating compound and a drug different from a miR-34a modulating compound to a patient in need thereof.

In a third aspect, the present invention relates to a pharmaceutical composition comprising the miR-34a modulating compound as defined in the first aspect or the combination as defined in the second aspect and a pharmaceutical acceptable carrier for use in the treatment of a disease accompanied by an impaired T-cell receptor signaling.

The disease is preferably selected from the group consisting of a neurodegenerative disease, an autoimmune disease, an infectious disease, and cancer.

It is preferred that the miR-34a modulating compound is a miR-34a binding molecule or a miR-34a molecule.

It is more preferred that

(i) the miR-34a binding molecule is selected from the group consisting of an anti-miRNA, a small interfering RNA (siRNA), a short hairpin RNA (shRNA), an antisense 2’-0-methyl (2’-OMe) oligoribonucleotide, and an antibody or an antibody fragment thereof, and/or

(ii) the miR-34a molecule is selected from the group consisting of a mature miR-34a, pre-miR- 34a, pri-miR-34a, miR-34a mimic, and a nucleotide sequence encoding miR-34a.

It is even more preferred that the anti-miR-34a has a nucleotide sequence according to SEQ ID NO: 3. It may also be a variant thereof having a sequence identity of at least 90%, preferably of at least 95%, e.g. of at least 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%, thereto, in particular over the whole length. The anti-miR-34a may further be chemically modified to improve stability and hybridization. In specific embodiments, anti-miR-34a comprises a nucleotide sequence according to SEQ ID NO: 3. It is further even more preferred that the mature miR-34a has a nucleotide sequence according to SEQ ID NO: 1. It may also be a variant thereof having a sequence identity of at least 90%, preferably of at least 95%, %, e.g. of at least 90, 91 , 92, 93, 94, 95, 96, 97, 98, or 99%, thereto, in particular over the whole length. The mature miR-34a may further be chemically modified to improve stability and/or processing. In specific embodiments, the mature miR-34a comprises a nucleotide sequence according to SEQ ID NO: 1.

It is also even more preferred that the miR-34a mimic has a nucleotide sequence according to SEQ ID NO: 2. It may also be a variant thereof having a sequence identity of at least 90%, preferably of at least 95%, %, e.g. of at least 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%, thereto, in particular over the whole length. The miR-34a mimic may further be chemically modified to improve stability and/or processing. In specific embodiments, miR-34a mimic comprises a nucleotide sequence according to SEQ ID NO: 2.

In addition to a miR-34a modulating compound, a drug different from a miR-34a modulating compound is preferably used (in form/as part of a combination).

Preferably, the drug different from a miR-34a modulating compound is selected from the group consisting of a drug used in cancer therapy, immunotherapy, chemotherapy, hormone therapy, gene therapy, and infectious therapy.

More preferably,

(i) the drug used in cancer therapy or immunotherapy is an antibody or a fragment thereof,

(ii) the drug used in infectious therapy is an antibiotic or antiviral agent, and/or

(ii) the drug used in chemotherapy (chemotherapeutic agent) is selected from the group consisting of an alkylating agent, an antimetabolite, an antitumor antibiotic, a mitotic inhibitor, and a nitrosourea.

It is most preferred that the miR-34a modulating compound is a miR-34a binding molecule and the disease is selected from the group consisting of a neurodegenerative disease, an autoimmune disease, and an infectious disease.

It is also most preferred that the miR-34a modulating compound is a miR-34a molecule and the disease is cancer.

The pharmaceutical composition may be formulated for local administration or systemic administration. In particular, the local administration is by parenteral administration, e.g. by intravenous administration, subcutaneous administration, intradermal administration, intramuscularly administration, and the systemic administration is by intraarterial administration. In particular the composition is administered subcutaneously, intradermally, or intramuscularly. The composition may further comprise one or more pharmaceutically acceptable carriers, diluents, and/or excipients. As to further specific and preferred embodiments, it is referred to the first or second aspect of the present invention.

In a further aspect, the present invention relates to a composition comprising the miR34a modulating compound according to the first aspect for use in the treatment of diseases accompanied by an impaired T-cell receptor signaling.

According to the present inventors, a reduction of the T-cell killing rate accompanied by a gradual increase of miR-34a upon CD8+ T-cell activation further supports a model with miR-34a as a central NF-kB regulator. MiR-34a deregulation is a cause of diseases accompanied by an impaired T-cell receptor signaling. Thus, the level of miR-34a within a biological sample isolated from a patient might be indicative for the effectiveness of a treatment of a disease accompanied by an impaired T-cell receptor signaling. The patient tested may be classified as responder or non responder.

Thus, in a fourth aspect, the present invention relates to a method of determining whether a patient responds to a treatment of a disease accompanied by an impaired T-cell receptor signaling comprising the step of:

determining the level of miR-34a in a biological sample isolated from the patient.

It is preferred that the patient is a patient to whom at least once (e.g. once, twice, or thrice/l , 2, or 3 times) at least one drug to be used in said treatment is administered or has/had been administered. The way of administration may be oral, nasal, rectal, parenteral, vaginal, or topical. Parental administration includes subcutaneous, intracutaneous, intramuscular, intravenous or intraperitoneal administration.

It is further preferred that the biological sample is isolated from the patient after at least the first (e.g. first, second, or third) administration of the at least one drug. It is particularly preferred that the biological sample is isolated from the patient in a time period of between 12 months and 1 day after at least the first (e.g. first, second, or third) administration of the at least one drug. It is particularly more preferred that the biological sample is isolated from the patient in a time period of between 6 months and 1 day after at least the first (e.g. first, second, or third) administration of the at least one drug. It is particularly even more preferred that the biological sample is isolated from the patient in a time period of between 1 month and 1 day after at least the first (e.g. first, second, or third) administration of the at least one drug. It is particularly most preferred that the biological sample is isolated from the patient in a time period of between 1 week and 1 day after at least the first (e.g. first, second, or third) administration of the at least one drug. For example, the biological sample is isolated from the patient 1, 2, 3, 4, 5, 6, day(s), 1, 2, 3 week(s), 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 month(s) after at least the first (e.g. first, second, or third) administration of the at least one drug. It is also preferred that the level of the miR-34a is compared to a reference level of said miR-34a. Thus, in one particular embodiment, the present invention relates to a method of determining whether a patient responds to a treatment of a disease accompanied by an impaired T-cell receptor signaling comprising the steps of:

(i) determining the level of miR-34a in a biological sample isolated from the patient, and

(ii) comparing the level of miR-34a to a reference level of said miR-34a.

As mentioned above, it is preferred that the patient is a patient to whom at least once (e.g. once, twice, or thrice/l , 2, or 3 times) a drug to be used in said treatment is administered or has/had been administered. It is further preferred that the biological sample is isolated from the patient after at least the first (e.g. first, second, or third) administration of the at least one drug.

The reference level may be any level which allows to determine whether the patient suffering from a disease accompanied by an impaired T-cell receptor signaling responds to a therapeutic treatment of said disease.

It is preferred that the reference level is the level determined by measuring at least one reference biological sample, e.g. at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21,

22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 100, 150, 200, 250, 300, 400, 500, or 1.000 reference biological sample(s), from at least one subject, e.g. at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20,

21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46,

47, 48, 49, 50, 100, 150, 200, 250, 300, 400, 500, or 1.000 subject(s), suffering from a disease accompanied by an impaired T-cell receptor signaling, or

at least one subject , e.g. at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20,

21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46,

47, 48, 49, 50, 100, 150, 200, 250, 300, 400, 500, or 1.000 subject(s), not suffering from a disease accompanied by an impaired T-cell receptor signaling (being healthy).

It is practicable to take one reference biological sample per subject for analysis. If additional reference biological samples are required, e.g. to determine the reference level in different reference biological samples, the same subject may be (re)tested. Said reference level may be an average reference level. It may be determined by measuring reference levels and calculating the“average” value (e.g. mean, median or modal value) thereof.

It is also (alternatively or additionally) preferred that the reference level is the level determined in a reference biological sample isolated from the (same) patient prior to the administration of the at least one drug. It is particularly preferred that the reference biological sample is isolated from the (same) patient in a time period of between 3 months and immediately prior to the administration of the at least one drug. It is particularly more preferred that the reference biological sample is isolated from the (same) patient in a time period of between 1 month and immediately prior to the administration of the at least one drug. It is particularly even more preferred that the reference biological sample is isolated from the (same) patient in a time period of between 3 weeks and immediately prior to the administration of the at least one drug. It is particularly most preferred that the reference biological sample is isolated from the (same) patient in a time period of between 1 day and immediately prior to the administration of the at least one drug or between 1 hour and immediately prior to the administration of the at least one drug. For example, the reference biological sample is isolated from the (same) patient immediately, 10, 20, 30, 40, 50 minutes, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 hour(s), 1, 2, 3, 4, 5, 6 day(s), 1, 2, 3 week(s), 1, 2, or 3 month(s) prior to the administration of the at least one drug.

Preferably, the patients/subjects, from which the biological samples/reference biological samples are, have undergone a wash-out period to remove any pharmaceutical substances from the body. For example, the patients that receive or have/had received a drug for therapeutic treatment have undergone a 3-month was-out period prior to the administration of the drug.

In particular, the disease is selected from the group consisting of a neurodegenerative disease, an autoimmune disease, an infectious disease, and cancer.

Specifically,

(i) the neurodegenerative disease is selected from the group consisting of Alzheimer’s disease (AD) and other dementias, Parkinson’s disease (PD) and PD-related diseases, Prion disease, Motor neurone diseases (MND), Huntington’s disease (HD), Spinocerebellar ataxia (SCA), Spinal muscular atrophy (SMA), AIDS dementia complex, and atherosclerosis,

(ii) the autoimmune disease is selected from the group consisting of diabetes, rheumatoid arthritis (RA), multiple sclerosis (MS), systemic lupus erythematosus (lupus), Graves’ disease, Sjogren’s syndrome, Hashimoto’s thyroiditis, Myasthenia gravis, Vasculitis, Pernicious anemia, and Celiac disease,

(iii) the infectious disease is selected from the group consisting of viral infection, preferably chronic or persistent viral infection, bacterial infection, parasitic infection, or

(iv) the cancer is selected from the group consisting of skin cancer, nasopharyngeal cancer, neuroendrocrine cancer, lung cancer, colon cancer, urothelial cancer, bladder cancer, liver cancer, ovarian cancer, gastric cancer, esophageal cancer, pancreatic cancer, kidney cancer, stomach cancer, esophageal cancer, breast cancer, renal cancer, head and neck cancer, brain cancer, lymphatic cancer, blood cancer, squamous cell cancer, laryngeal cancer, retina cancer, prostate cancer, cervical cancer, uterine cancer, testicular cancer, bone cancer, lymphoma, and leukemia.

More specifically,

(i) the viral infection is selected from the group consisting of human immunodeficiency virus (HIV), hepatitis B virus (HBV), hepatitis C virus (HCV), rhinovirus (common cold), herpes simplex virus (HSV), and respiratory syncytial virus (RSV) infection,

(ii) the bacterial infection is selected from the group consisting of Helicobacter pylori, Mycobacterium tuberculosis, Mycobacterium leprae, and Chlamydia trachomatis infection, or

(iii) the parasitic infection is selected from the group consisting of a Schistosoma mansoni, Taenia crassiceps, or Leishmania mexicana infection.

It is further preferred that the at least one drug is a miR-34a modulating compound. Preferably, the miR-34a modulating compound is a miR-34a binding molecule or a miR-34a molecule.

More preferably, the miR-34a binding molecule is selected from the group consisting of an anti- miRNA, a small interfering RNA (siRNA), a short hairpin RNA (shRNA), an antisense 2’-0- methyl (2’-OMe) oligoribonucleotide, and an antibody or an antibody fragment thereof. Most preferably, the anti-miR-34a has a nucleotide sequence according to SEQ ID NO: 3. It may also be a variant thereof having a sequence identity of at least 90%, preferably of at least 95%, e.g. of at least 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%, thereto, in particular over the whole length. The anti-miR-34a may further be chemically modified to improve stability and hybridization. In specific embodiments, anti-miR-34a comprises a nucleotide sequence according to SEQ ID NO: 3.

More preferably, the miR-34a molecule is selected from the group consisting of a mature miR- 34a, pre-miR-34a, pri-miR-34a, miR-34a mimic, and a nucleotide sequence encoding miR-34a. Most preferably the mature miR-34a has a nucleotide sequence according to SEQ ID NO: 1. It may also be a variant thereof having a sequence identity of at least 90%, preferably of at least 95%, %, e.g. of at least 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%, thereto, in particular over the whole length. The mature miR-34a may further be chemically modified to improve stability and/or processing. In specific embodiments, the mature miR-34a comprises a nucleotide sequence according to SEQ ID NO: 1. Most preferably, the miR-34a mimic has a nucleotide sequence according to SEQ ID NO: 2. It may also be a variant thereof having a sequence identity of at least 90%, preferably of at least 95%, %, e.g. of at least 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%, thereto, in particular over the whole length. The miR-34a mimic may further be chemically modified to improve stability and/or processing. In specific embodiments, miR-34a mimic comprises a nucleotide sequence according to SEQ ID NO: 2.

It is also preferred that in addition to a miR-34a modulating compound, a drug different from a miR-34a modulating compound is administered or has/had been administered. The drug different from a miR-34a modulating compound is preferably selected from the group consisting of a drug used in cancer therapy, immunotherapy, chemotherapy, hormone therapy, gene therapy, and infectious therapy.

More preferably,

(i) the drug used in cancer therapy or immunotherapy is an antibody or a fragment thereof,

(ii) the drug used in infectious therapy is an antibiotic or antiviral agent, and/or

(ii) the drug used in chemotherapy (chemotherapeutic agent) is selected from the group consisting of an alkylating agent, an antimetabolite, an antitumor antibiotic, a mitotic inhibitor, and a nitrosourea.

As to specific embodiments of the drug, it is referred to the second aspect of the present invention.

In particular, the miR-34a modulating compound, e.g. miR-34a binding molecule or miR- 34a molecule, and the drug different from the miR-34a modulating compound are administered or have/had been administered in combination (combination treatment).

In one embodiment,

the miR-34a modulating compound is a miR-34a molecule,

the disease is cancer,

the reference level is the level determined by measuring at least one reference sample from at least one subject suffering from cancer, and

the level of miR-34a above the reference level indicates that the patient responds to said treatment.

In one another embodiment,

the miR-34a modulating compound is a miR-34a molecule,

the disease is cancer,

the reference level is the level determined by measuring at least one reference sample from at least one subject not suffering from cancer (being healthy), and

the level of miR-34a comparable with the reference level indicates that the patient responds to said treatment.

In one another embodiment,

the miR-34a modulating compound is a miR-34a binding molecule,

the disease is a neurodegenerative disease, an autoimmune disease, or an infectious disease, the reference level is the level determined by measuring at least one reference sample from at least one subject suffering from a neurodegenerative disease, an autoimmune disease, or an infectious disease, and

the level of miR-34a below the reference level indicates that the patient responds to said treatment.

In one another embodiment,

the miR-34a modulating compound is a miR-34a binding molecule,

the disease is a neurodegenerative disease, an autoimmune disease, or an infectious disease, the reference level is the level determined by measuring at least one reference sample from at least one subject not suffering from a neurodegenerative disease, an autoimmune disease, or an infectious disease (being healthy), and

the level of miR-34a comparable with the reference level indicates that the patient responds to said treatment.

As mentioned above, the miR-34a binding molecule is preferably selected from the group consisting of an anti-miRNA, a small interfering RNA (siRNA), a short hairpin RNA (shRNA), an antisense 2’-0-methyl (2’-OMe) oligoribonucleotide, and an antibody or an antibody fragment thereof.

More preferably, the anti-miR-34a has a nucleotide sequence according to SEQ ID NO: 3. It may also be a variant thereof having a sequence identity of at least 90%, preferably of at least 95%, e.g. of at least 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%, thereto, in particular over the whole length. The anti-miR-34a may further be chemically modified to improve stability and hybridization. In specific embodiments, anti-miR-34a comprises a nucleotide sequence according to SEQ ID NO: 3.

In addition, the miR-34a molecule is preferably selected from the group consisting of a mature miR-34a, pre-miR-34a, pri-miR-34a, miR-34a mimic, and a nucleotide sequence encoding miR-34a.

More preferably, the mature miR-34a has a nucleotide sequence according to SEQ ID NO: 1. It may also be a variant thereof having a sequence identity of at least 90%, preferably of at least 95%, %, e.g. of at least 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%, thereto, in particular over the whole length. The mature miR-34a may further be chemically modified to improve stability and/or processing. In specific embodiments, the mature miR-34a comprises a nucleotide sequence according to SEQ ID NO: 1. More preferably, the miR-34a mimic has a nucleotide sequence according to SEQ ID NO: 2. It may also be a variant thereof having a sequence identity of at least 90%, preferably of at least 95%, %, e.g. of at least 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%, thereto, in particular over the whole length. The miR-34a mimic may further be chemically modified to improve stability and/or processing. In specific embodiments, miR-34a mimic comprises a nucleotide sequence according to SEQ ID NO: 2.

Preferably, the level of miR-34a is at least 0.6-fold or 0.7-fold, more preferably at least 0.8- fold or 0.9-fold, even more preferably at least 1 2-fold or 1.5-fold, and most preferably at least 2.0- fold or 3.0-fold above/below the reference level. For example, the level of miR-34a is at least 0.6- fold, at least 0.7-fold, at least 0.8-fold, at least 0.9-fold, at least l .O-fold, at least l . l-fold, at least 1.2-fold, at least 1.3-fold, at least 1.4-fold, at least 1.5-fold, at least 1.6-fold, at least 1.7-fold, at least 1.8-fold, at least 1.9-fold, at least 2.0-fold, at least 2. l-fold, at least 2.2-fold, at least 2.3-fold, at least 2.4-fold, at least 2.5-fold, at least 2.6-fold, at least 2.7-fold, at least 2.8-fold, at least 2.9- fold, or at least 3.0-fold above/below the reference level.

A level which is“comparable with” the reference level in this respect means that the level is no more than 15%, preferably no more than 10%, more preferably no more than 5%, above the reference level or the level is no more than 15%, preferably no more than 10%, more preferably no more than 5%, above/below the reference level. Alternatively, a level which is comparable with the reference level in this respect means that the detected level variation is within the accuracy of a measurement. The accuracy of a measurement depends on the measurement method used.

The determination of the level of miR-34a may be carried out by any convenient means for determining the level of a nucleotide sequence such as miRNA. For this purpose, qualitative, semi- quantitative and quantitative detection methods can be used. Quantitative detection methods are preferred. A variety of techniques are well known to the person skilled in the art. For example, the level of miR-34a can be determined by nucleic acid hybridization, nucleic acid amplification, polymerase extension, sequencing, mass spectroscopy, an immunochemical method, or any combination thereof.

Preferably,

(i) the nucleic acid hybridization is performed using a microarray/biochip, or using in situ hybridization,

(ii) the nucleic acid amplification is performed using real-time PCR (RT-PCR) or real-time quantitative PCR (RT-qPCR),

(iii) the sequencing is next generation sequencing, or

(iv) the immunochemical method is an enzyme linked immunosorbent assay (EFISA).

Nucleic acid amplification, for example, may be performed using real time polymerase chain reaction (RT-PCR) such as real time quantitative PCR (RT-qPCR). The real time polymerase chain reaction (RT-PCR) may include the following steps: (i) extracting total RNA from the biological sample isolated from the patient, (ii) obtaining cDNA samples by RNA reverse transcription (RT) reaction using miRNA-specific primers, (iii) designing miRNA-specific cDNA forward primers and providing universal reverse primers to amplify the cDNA via polymerase chain reaction (PCR), (iv) adding a fluorescent probe to conduct PCR, and (v) detecting and comparing the variation in the miRNA level in the biological sample isolated from the patient relative to those of the miRNA in a reference biological sample isolated from a (control) subject. A variety of kits and protocols to determine the miRNA level by real time polymerase chain reaction (RT-PCR) such as real time quantitative PCR (RT-qPCR) are available. For example, reverse transcription of miRNAs may be performed using the TaqMan MicroR A Reverse Transcription Kit (Applied Biosystems) according to manufacturer’s recommendations.

Nucleic acid hybridization, for example, may be performed using a microarray/biochip or in situ hybridization. For nucleic acid hybridization, for example, the polynucleotide (probe) with complementarity to the corresponding miRNA to be detected is attached to a solid phase to generate a microarray/biochip. Said microarray/biochip is then incubated with miRNAs, isolated (e.g. extracted) from the biological sample, which may be labelled or unlabelled. Upon hybridization of the labelled miRNA to the complementary polynucleotide sequence on the microarray/biochip, the success of hybridisation may be controlled and the intensity of hybridization may be determined via the hybridisation signal of the label in order to determine the level of the tested miRNA in said biological sample. In particular, a specific polynucleotide probe is used which is able to hybridize with, detect, or bind to miR-34a.

Alternatively, the miRNA level may be determined using an immunochemical method, e.g. using an ELISA. Said method may include the following steps: (i) isolating miRNAs from a biological sample, (ii) hybridizing a polynucleotide probe (complementary) to the miRNA to be tested to obtain a hybrid of said polynucleotide probe and said miRNA, and (iii) binding said hybrid to an antibody capable of specifically binding the hybrid of said polynucleotide probe and said miRNA, and (iv) detecting the antibody-bound hybrid. In particular, a specific polynucleotide probe is used which is able to hybridize with or bind to miR-34a.

The level is preferably the expression level.

As to the first to fourth aspect of the present invention, it is noted that in a preferred embodiment, the disease accompanied by an impaired T-cell receptor signaling does not encompass cancer/is not cancer.

As mentioned above, store-operated Ca2+ entry (SOCE) and calcineurin signaling are central signaling pathways in immune cells. Although these pathways are affected in severe diseases, mechanisms that modulate them are only partially deciphered. Here, the present inventors showed that miR-34a is a regulator of SOCE and calcineurin signaling. Upon miR-34a overexpression, the present inventors observed both a decreased depletion of ER calcium content and a decreased Ca2+ influx through CRAC channels. Based on an in silico target prediction, they identified multiple miR-34 target genes within both pathways, including ITPR2, CAMLG, STIM1, ORAI3, RCAN1, PPP3R1, and NFATC4. The inhibition of the identified new target genes by miR- 34a resulted in an impaired calcium signaling. An impaired calcium signaling is a cause of severe diseases such as neurodegenerative diseases and cardiovascular diseases. Therapeutics which eliminate malfunctions of SOCE and calcineurin signaling are still needed. In view of the above, the present inventors provide a miR-34a modulating compound for use in the treatment of a disease accompanied by an impaired calcium signaling.

Thus, in a fifth aspect, the present invention relates to a miR-34a binding molecule for use in the treatment of a disease accompanied by an impaired calcium signaling.

In particular, the impaired calcium signaling is characterized by an inhibition of the translation of the mRNA of one or more target genes selected from the group consisting of ITPR2, CAMLG, STIM1, ORAI3, RCAN1, PPP3R1, and NFATC4 by miR-34a, e.g. in neurodegenerative diseases and cardiovascular diseases. This inhibition leads to a reduction of the calcium signaling process. It may also be abolished due to the action of miR-34a. In particular, the calcium signaling encompasses the store-operated calcium entry (SOCE) and/or the calcineurin signaling. These pathways are affected in severe diseases, e.g. in neurodegenerative diseases and cardiovascular diseases, due to the binding of miR-34a.

Especially, miR-34a binds the mRNA of one or more target genes selected from the group consisting of ITPR2, CAMLG, STIM1, ORAI3, RCANl, PPP3R1, and NFATC4. In particular, miR- 34a binds the 3’untranslated region (UTR) of the mRNA of said one or more target genes.

Specifically, miR-34a has a single binding site within the 3’UTRs of ITPR2, CAMLG, STIM1, and RCAN1 and/or miR-34a has two binding site within the 3’UTRs of ORAI3, PPP3R1, and NFATC4. The exact nucleotide positions of the binding sites of miR-34a within the 3’UTRs of these seven genes are given in Figures 9 and 10.

The binding of miR-34a preferably results in the inhibition of the translation of the mRNA of said one or more target genes. It is particularly preferred that the treatment results in an activation/restoration of calcium signaling.

It is preferred that the miR-34a binding molecule is selected from the group consisting of an anti-miRNA, a small interfering RNA (siRNA), a short hairpin RNA (shRNA), an antisense 2’- O-methyl (2’-OMe) oligoribonucleotide, and an antibody or an antibody fragment thereof. It is more preferred that anti-miR-34a has a nucleotide sequence according to SEQ ID NO: 3. It may also be a variant thereof having a sequence identity of at least 90%, preferably of at least 95%, e.g. of at least 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%, thereto, in particular over the whole length. The anti-miR-34a may further be chemically modified to improve stability and hybridization. In specific embodiments, anti-miR-34a comprises a nucleotide sequence according to SEQ ID NO: 3.

It is (alternatively or additionally) preferred that the disease is selected from the group consisting of a neurodegenerative disease and a cardiovascular disease. It is more preferred that

(i) the neurodegenerative disease is selected from the group consisting of Alzheimer’s disease (AD) and other dementias, Parkinson’s disease (PD) and PD-related diseases, Prion disease, Motor neurone diseases (MND), Huntington’s disease (HD), Spinocerebellar ataxia (SCA), Spinal muscular atrophy (SMA), AIDS dementia complex, and atherosclerosis, or

(ii) the cardiovascular disease is selected from the group consisting of coronary artery disease, heart attack, heart failure, heart valve disease, congenital heart disease, heart muscle disease, pericardial disease, aorta disease, and blood vessel disease.

The present inventors found that diseases accompanied with an impaired, in particular reduced, calcium signaling like neurodegenerative diseases and cardiovascular disease can be treated by administering to a patient in need thereof a miR-34a binding molecule. The present inventors have namely recognized that miR-34a is upregulated in neurodegenerative diseases and cardiovascular diseases accompanied by an impaired calcium signaling (compared to a heathy state). For miR-34a, whose expression is increased in these diseases, inhibition of miR-34a function through the use of a miR-34a binding molecule, e.g. an anti-miR-34a, which restores proper target gene regulation, has therapeutic benefit. In particular, a single-stranded miR-34a antagonist/anti-miR-34a can be administered systemically without a delivery vehicle, and they distribute to diverse tissue. They might be chemically-modified.

It is (alternatively or additionally) also preferred that the miR-34a binding molecule is suitable to be administered topically, intravenously, intradermally, intraarterially, intraperitoneally, intralesionally, intracranially, intraarticularly, intraprostaticaly, intrapleurally, intratracheally, intraocularly, intranasally, intravitreally, intravaginally, intrarectally, intramuscularly, subcutaneously, subconjunctivally, intravesicularly, mucosally, intrapericardially, intraumbilically, orally, by inhalation, by injection, by infusion, by continuous infusion, by localized perfusion bathing target cells directly, via a catheter, or via a lavage.

It is (alternatively or additionally) further preferred that the miR-34a binding molecule is suitable to be administered by providing a delivery system selected from the group consisting of an expression construct, e.g. a vector, like a viral vector, such as an adenovirus, an adeno- associated virus, a retrovirus, or a lentivirus vector, a liposome, a polymer-mediated delivery system, a conjugate delivery system, an exosome, a microsponge, and a nanoparticle, e.g. a gold particle. This aspect can also be worded as follows: In a fifth aspect, the present invention relates to the use of a miR-34a binding molecule for the manufacture of a medicament for the treatment of a disease accompanied by an impaired calcium signaling. Alternatively, the present invention relates in a fifth aspect to a method for treating a disease accompanied by an impaired calcium signaling comprising the step of: administering (an effective amount of) a miR-34a binding molecule to a patient in need thereof.

The ability of miR-34a to regulate the expression of key target genes of the calcium signaling pathway and its involvement in diseases accompanied by an impaired calcium signaling makes miR-34a to a candidate to combine it with other therapeutics which are frequently used to treat diseases accompanied by an impaired calcium signaling. In this way, the therapeutic effect can be improved. This way of treatment may also be designated as combination therapy.

Thus, in a sixth aspect, the present invention relates to a combination of a miR-34a binding molecule and a drug different from a miR-34a binding molecule for use in the treatment of a disease accompanied by an impaired calcium signaling.

The disease is preferably selected from the group consisting of a neurodegenerative disease and cardiovascular disease.

In particular,

(i) the neurodegenerative disease is selected from the group consisting of Alzheimer’s disease (AD) and other dementias, Parkinson’s disease (PD) and PD-related diseases, Prion disease, Motor neurone diseases (MND), Huntington’s disease (HD), Spinocerebellar ataxia (SCA), Spinal muscular atrophy (SMA), AIDS dementia complex, and atherosclerosis, or

(ii) the cardiovascular disease is selected from the group consisting of coronary artery disease, heart attack, heart failure, heart valve disease, congenital heart disease, heart muscle disease, pericardial disease, aorta disease, and blood vessel disease.

It is preferred that

(i) the miR-34a binding molecule is selected from the group consisting of an anti-miRNA, a small interfering RNA (siRNA), a short hairpin RNA (shRNA), an antisense 2’-0-methyl (2’-OMe) oligoribonucleotide, and an antibody or an antibody fragment thereof, and/or

(ii) the drug different from a miR-34a binding molecule is selected from the group consisting of a drug used in immunotherapy, hormone therapy, and cardiovascular therapy.

It is more preferred that the anti-miR-34a has a nucleotide sequence according to SEQ ID NO: 3. It may also be a variant thereof having a sequence identity of at least 90%, preferably of at least 95%, e.g. of at least 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%, thereto, in particular over the whole length. The anti-miR-34a may further be chemically modified to improve stability and hybridization. In specific embodiments, anti-miR-34a comprises a nucleotide sequence according to SEQ ID NO: 3.

It is also more preferred that

(i) the drug used in immunotherapy is an antibody or a fragment thereof,

(ii) the drug used in cardiovascular therapy is selected from the group consisting of anticoagulants, antiplatelet agents, angiotensin-converting enzyme (ACE) inhibitors, angiotensin II receptor blockers or inhibitors, angiotensin receptor neprilysin inhibitors, beat blockers, alpha blockers, calcium channel blockers, cholesterol-lowering medications, digitalis preparations, diuretics, and vasodilators.

As mentioned above, a combination of a miR-34a binding molecule and a drug different from a miR-34a binding molecule is used for the treatment of a disease accompanied by an impaired calcium signaling. The miR-34a binding molecule and the drug different from a miR- 34a binding molecule can be administered to a patient either together (in a composition or in separate compositions but given to the patient simultaneously or nearly simultaneous, for instance, within the hour of administration of other compound/drug) or separately (e.g., administered in separate compositions and at different times, typically more than 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, or more hours apart, or even via different routes). For example, the miR-34a binding molecule may be administered up to 1 to 12 hours after the drug different from a miR-34a binding molecule is administered. Alternatively, the drug different from a miR-34a binding molecule may be administered up to 1 to 12 hours after the miR-34a binding molecule is administered. Thus, the miR-34a binding molecule and the drug different from a miR-34a binding molecule, which are applied in combination to treat a disease accompanied by an impaired calcium signaling, may be part of a composition (the same composition) or may be part of different compositions which is/are used for the treatment.

As to further specific and preferred embodiments, it is referred to the fifth aspect of the present invention.

This aspect can also be worded as follows: In a sixth aspect, the present invention relates to the use of a combination of a miR-34a binding molecule and a drug different from a miR-34a binding molecule for the manufacture of a medicament for the treatment of a disease accompanied by an impaired calcium signaling. Alternatively, the present invention relates in a sixth aspect to a method for treating a disease accompanied by an impaired calcium signaling comprising the step of: administering (an effective amount of) a combination of a miR-34a binding molecule and a drug different from a miR-34a binding molecule to a patient in need thereof.

In a seventh aspect, the present invention relates to a pharmaceutical composition comprising the miR-34a binding molecule as defined in the fifth aspect or the combination as defined in the sixth aspect and a pharmaceutical acceptable carrier for use in the treatment of a disease accompanied by an impaired calcium signaling.

The disease is preferably selected from the group consisting of a neurodegenerative disease and a cardiovascular disease.

Preferably, the miR-34a binding molecule is selected from the group consisting of an anti- miRNA, a small interfering RNA (siRNA), a short hairpin RNA (shRNA), an antisense 2’-0- methyl (2’-OMe) oligoribonucleotide, and an antibody or an antibody fragment thereof. More preferably, the anti-miR-34a has a nucleotide sequence according to SEQ ID NO: 3. It may also be a variant thereof having a sequence identity of at least 90%, preferably of at least 95%, e.g. of at least 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%, thereto, in particular over the whole length. The anti-miR-34a may further be chemically modified to improve stability and hybridization. In specific embodiments, anti-miR-34a comprises a nucleotide sequence according to SEQ ID NO: 3.

In addition to a miR-34a binding molecule, a drug different from a miR-34a binding molecule is preferably used (in form/as part of a combination).

Preferably, the drug different from a miR-34a binding molecule is selected from the group consisting of a drug used in immunotherapy, hormone therapy, and cardiovascular therapy.

More preferably,

(i) the drug used in immunotherapy is an antibody or a fragment thereof,

(ii) the drug used in cardiovascular therapy is selected from the group consisting of anticoagulants, antiplatelet agents, angiotensin-converting enzyme (ACE) inhibitors, angiotensin II receptor blockers or inhibitors, angiotensin receptor neprilysin inhibitors, beat blockers, alpha blockers, calcium channel blockers, cholesterol-lowering medications, digitalis preparations, diuretics, and vasodilators.

The pharmaceutical composition may be formulated for local administration or systemic administration. In particular, the local administration is by parenteral administration, e.g. by intravenous administration, subcutaneous administration, intradermal administration, intramuscularly administration, and the systemic administration is by intraarterial administration. In particular the composition is administered subcutaneously, intradermally, or intramuscularly. The composition may further comprise one or more pharmaceutically acceptable carriers, diluents, and/or excipients.

As to further specific and preferred embodiments, it is referred to the fifth or sixth aspect of the present invention. In a further aspect, the present invention relates to a composition comprising the miR34a binding molecule according to the fifth aspect for use in the treatment of diseases accompanied by an impaired calcium signaling.

According to the present inventors, a depletion of ER calcium content and a decreased Ca²⁺ influx through CRAC channels accompanied by a gradual increase of miR-34a is a cause of diseases accompanied by an impaired calcium signaling. Thus, the level of miR-34a within the cell might be indicative for the effectiveness of a treatment of a disease accompanied by an impaired calcium signaling. The patient tested may be classified as responder or non-responder.

Thus, in an eight aspect, the present invention relates to a method of determining whether a patient responds to a treatment of a disease accompanied by an impaired calcium signaling comprising the step of:

determining the level of miR-34a in a biological sample isolated from a patient.

It is preferred that the patient is a patient to whom at least once (e.g. once, twice, or thrice/l , 2, or 3 times) at least one drug to be used in said therapeutic treatment is administered or has/had been administered. The way of administration may be oral, nasal, rectal, parenteral, vaginal, or topical. Parental administration includes subcutaneous, intracutaneous, intramuscular, intravenous or intraperitoneal administration.

It is further preferred that the biological sample is isolated from the patient after at least the first (e.g. first, second, or third) administration of the at least one drug. It is particularly preferred that the biological sample is isolated from the patient in a time period of between 12 months and 1 day after at least the first (e.g. first, second, or third) administration of the at least one drug. It is particularly more preferred that the biological sample is isolated from the patient in a time period of between 6 months and 1 day after at least the first (e.g. first, second, or third) administration of the at least one drug. It is particularly even more preferred that the biological sample is isolated from the patient in a time period of between 1 month and 1 day after at least the first (e.g. first, second, or third) administration of the at least one drug. It is particularly most preferred that the biological sample is isolated from the patient in a time period of between 1 week and 1 day after at least the first (e.g. first, second, or third) administration of the at least one drug. For example, the biological sample is isolated from the patient 1, 2, 3, 4, 5, 6, day(s), 1, 2, 3 week(s), 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 month(s) after at least the first (e.g. first, second, or third) administration of the at least one drug.

It is also preferred that the level of the miR-34a is compared to a reference level of said miR-34a. Thus, in one particular embodiment, the present invention relates to a method of determining whether a patient responds to a treatment of a disease accompanied by an impaired calcium signaling comprising the steps of: (i) determining the level of miR-34a in a biological sample isolated from the patient, and

(ii) comparing the level of miR-34a to a reference level of said miR-34a.

As mentioned above, it is preferred that the patient is a patient to whom at least once (e.g. once, twice, or thrice/l, 2, or 3 times) a drug to be used in said therapeutic treatment is administered or has/had been administered. It is further preferred that the biological sample is isolated from the patient after at least the first (e.g. first, second, or third) administration of the at least one drug.

The reference level may be any level which allows to determine whether the patient suffering from a disease accompanied by an impaired calcium signaling responds to a therapeutic treatment of said disease.

It is preferred that the reference level is the level determined by measuring at least one reference biological sample, e.g. at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21,

22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47,

48, 49, 50, 100, 150, 200, 250, 300, 400, 500, or 1.000 reference biological sample(s), from at least one subject, e.g. at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20,

21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46,

47, 48, 49, 50, 100, 150, 200, 250, 300, 400, 500, or 1.000 subject(s), suffering from a disease accompanied by an impaired calcium signaling, or

at least one subject , e.g. at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 100, 150, 200, 250, 300, 400, 500, or 1.000 subject(s), not suffering from a disease accompanied by an impaired calcium signaling (being healthy).

It is practicable to take one reference biological sample per subject for analysis. If additional reference biological samples are required, e.g. to determine the reference level in different reference biological samples, the same subject may be (re)tested. Said reference level may be an average reference level. It may be determined by measuring reference levels and calculating the“average” value (e.g. mean, median or modal value) thereof.

It is also (alternatively or additionally) preferred that the reference level is the level determined in a reference biological sample isolated from the (same) patient prior to the administration of the at least one drug. It is particularly preferred that the reference biological sample is isolated from the (same) patient in a time period of between 3 months and immediately prior to the administration of the at least one drug. It is particularly more preferred that the reference biological sample is isolated from the (same) patient in a time period of between 1 month and immediately prior to the administration of the at least one drug. It is particularly even more preferred that the reference biological sample is isolated from the (same) patient in a time period of between 3 weeks and immediately prior to the administration of the at least one drug. It is particularly most preferred that the reference biological sample is isolated from the (same) patient in a time period of between 1 day and immediately prior to the administration of the at least one drug or between 1 hour and immediately prior to the administration of the at least one drug. For example, the reference biological sample is isolated from the (same) patient immediately, 10, 20, 30, 40, 50 minutes, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 hour(s), 1, 2, 3, 4, 5, 6 day(s), 1, 2, 3 week(s), 1, 2, or 3 month(s) prior to the administration of the at least one drug.

Preferably, the patients/subjects, from which the biological samples/reference biological samples are, have undergone a wash-out period to remove any pharmaceutical substances from the body. For example, the patients that receive or have received a drug for therapeutic treatment have undergone a 3-month was-out period prior to the administration of the drug.

In particular, the disease is selected from the group consisting of a neurodegenerative disease and a cardiovascular disease.

Specifically

(i) the neurodegenerative disease is selected from the group consisting of Alzheimer’s disease (AD) and other dementias, Parkinson’s disease (PD) and PD-related diseases, Prion disease, Motor neurone diseases (MND), Huntington’s disease (HD), Spinocerebellar ataxia (SCA), Spinal muscular atrophy (SMA), AIDS dementia complex, and atherosclerosis, or

(ii) the cardiovascular disease is selected from the group consisting of coronary artery disease, heart attack, heart failure, heart valve disease, congenital heart disease, heart muscle disease, pericardial disease, aorta disease, and blood vessel disease.

It is further preferred that the at least one drug is a miR-34a binding molecule. More preferably, the miR-34a binding molecule is selected from the group consisting of an anti-miRNA, a small interfering RNA (siRNA), a short hairpin RNA (shRNA), an antisense 2’-0-methyl (2’- OMe) oligoribonucleotide, and an antibody or an antibody fragment thereof. Most preferably, the anti-miR-34a has a nucleotide sequence according to SEQ ID NO: 3. It may also be a variant thereof having a sequence identity of at least 90%, preferably of at least 95%, e.g. of at least 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%, thereto, in particular over the whole length. The anti-miR- 34a may further be chemically modified to improve stability and hybridization. In specific embodiments, anti-miR-34a comprises a nucleotide sequence according to SEQ ID NO: 3.

It is also preferred that in addition to a miR-34a binding molecule, a drug different from a miR-34a binding molecule is administered or has/had been administered. The drug different from a miR-34a binding molecule is preferably selected from the group consisting of a drug used in immunotherapy, hormone therapy, and cardiovascular therapy. More preferably,

(i) the drug used in immunotherapy is an antibody or a fragment thereof,

(ii) the drug used in cardiovascular therapy is selected from the group consisting of anticoagulants, antiplatelet agents, angiotensin-converting enzyme (ACE) inhibitors, angiotensin II receptor blockers or inhibitors, angiotensin receptor neprilysin inhibitors, beat blockers, alpha blockers, calcium channel blockers, cholesterol-lowering medications, digitalis preparations, diuretics, and vasodilators.

In particular, the miR-34a binding molecule and the drug different from the miR-34a binding molecule are administered or have/had been administered in combination (combination treatment).

In one embodiment,

the drug is a miR-34a binding molecule,

the disease is a neurodegenerative disease or a cardiovascular disease,

the reference level is the level determined by measuring at least one reference sample from at least one subject suffering from a neurodegenerative disease or a cardiovascular disease, and the level of miR-34a below the reference level indicates that the patient responds to said treatment.

In one another embodiment,

the drug is a miR-34a binding molecule,

the disease is a neurodegenerative disease or a cardiovascular disease,

the reference level is the level determined by measuring at least one reference sample from at least one subject not suffering from a neurodegenerative disease or a cardiovascular disease (being healthy), and

the level of miR-34a comparable with the reference level indicates that the patient responds to said treatment.

Preferably, the level of miR-34a is at least 0.6-fold or 0.7-fold, more preferably at least 0.8- fold or 0.9-fold, even more preferably at least 1 2-fold or 1.5-fold, and most preferably at least 2.0- fold or 3.0-fold below the reference level. For example, the level of miR-34a is at least 0.6-fold, at least 0.7-fold, at least 0.8-fold, at least 0.9-fold, at least l .O-fold, at least l .l-fold, at least 1.2- fold, at least 1.3-fold, at least 1.4-fold, at least 1.5-fold, at least 1.6-fold, at least 1.7-fold, at least 1.8-fold, at least 1.9-fold, at least 2.0-fold, at least 2.1 -fold, at least 2.2-fold, at least 2.3-fold, at least 2.4-fold, at least 2.5-fold, at least 2.6-fold, at least 2.7-fold, at least 2.8-fold, at least 2.9-fold, or at least 3.0-fold below the reference level.

A level which is“comparable with” the reference level in this respect means that the level is no more than 15%, preferably no more than 10%, more preferably no more than 5%, above the reference level or the level is no more than 15%, preferably no more than 10%, more preferably no more than 5%, above/below the reference level. Alternatively, a level which is comparable with the reference level in this respect means that the detected level variation is within the accuracy of a measurement. The accuracy of a measurement depends on the measurement method used.

The determination of the level of miR-34a may be carried out by any convenient means for determining the level of a nucleotide sequence such as miRNA. For this purpose, qualitative, semi- quantitative and quantitative detection methods can be used. Quantitative detection methods are preferred. A variety of techniques are well known to the person skilled in the art. For example, the level of miR-34a can be determined by nucleic acid hybridization, nucleic acid amplification, polymerase extension, sequencing, mass spectroscopy, an immunochemical method, or any combination thereof.

Preferably,

(i) the nucleic acid hybridization is performed using a microarray/biochip, or using in situ hybridization,

(ii) the nucleic acid amplification is performed using real-time PCR (RT-PCR) or real-time quantitative PCR (RT-qPCR),

(iii) the sequencing is next generation sequencing, or

(iv) the immunochemical method is an enzyme linked immunosorbent assay (ELISA).

As to further preferred embodiments, it is referred to the fourth aspect of the present invention.

Rejection is one of the major causes of transplant failure and preventing and treating acute rejection are the central tasks for clinicians working with transplant patients. Transplant rejection occurs when transplanted tissue is rejected by the recipient's immune system, which destroys the transplanted tissue. There is an unmet need for novel drugs to prevent acute rejection. The present inventors found that miR-34a upregulation results in an impaired T-cell signaling. Especially, high miR-34a levels within a cell result in a“shutdown” of the T-cell receptor signaling process. After transplantation any form of immune reaction should be prevented. The present inventors found that the administration of a miR-34a molecule ensures an inhibited or even abolished T-cell signaling process and, thus, reduces the risk of transplant rejections.

Thus, in a ninth aspect, the present invention relates to a miR-34a molecule for use in the prevention of transplant rejection.

Preferably, the miR-34a molecule is selected from the group consisting of a mature miR- 34a, pre-miR-34a, pri-miR-34a, miR-34a mimic, and a nucleotide sequence encoding miR-34a. More preferably, the mature miR-34a has a nucleotide sequence according to SEQ ID NO: 1. It may also be a variant thereof having a sequence identity of at least 90%, preferably of at least 95%, %, e.g. of at least 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%, thereto, in particular over the whole length. The mature miR-34a may further be chemically modified to improve stability and/or processing. In specific embodiments, the mature miR-34a comprises a nucleotide sequence according to SEQ ID NO: 1. More preferably, the miR-34a mimic has a nucleotide sequence according to SEQ ID NO: 2. It may also be a variant thereof having a sequence identity of at least 90%, preferably of at least 95%, %, e.g. of at least 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%, thereto, in particular over the whole length. The miR-34a mimic may further be chemically modified to improve stability and/or processing. In specific embodiments, miR-34a mimic comprises a nucleotide sequence according to SEQ ID NO: 2.

This aspect of the present invention can also be worded as follows: In a ninth aspect, the present invention relates to the use of a miR-34a molecule for the manufacture of a medicament for the prevention of transplant rejection. Alternatively, the present invention relates in a ninth aspect to a method for preventing transplant rejection comprising the step of: administering (an effective amount of) a miR-34a modulating compound to a patient in need thereof.

In a tenth aspect, the present invention relates to a pharmaceutical composition comprising the miR-34a molecule as defined in the ninth aspect and a pharmaceutical acceptable carrier for use in the prevention of transplant rejection.

The sequence listing comprises the following sequences with respect to miR34a:

SEQ ID NO: 1 = (mature) miR34a,

SEQ ID NO: 2 = miR34a mimic,

SEQ ID NO: 3 = anti-miR34a, and

SEQ ID NO: 4 = miR34a precursor.

The invention is summarized as follows:

1. A miR-34a modulating compound for use in the treatment of a disease accompanied by an impaired T-cell receptor signaling.

2. The miR-34a modulating compound for use of item 1, wherein the miR-34a modulating compound is a miR-34a binding molecule or a miR-34a molecule.

3. The miR-34a modulating compound for use of item 2, wherein the miR-34a binding molecule is selected from the group consisting of an anti-miRNA, a small interfering RNA (siRNA), a short hairpin RNA (shRNA), an antisense 2’-0-methyl (2’-OMe) oligoribonucleotide, and an antibody or an antibody fragment thereof.

4. The miR-34a modulating compound for use of item 2, wherein the miR-34a molecule is selected from the group consisting of a mature miR-34a, pre-miR-34a, pri-miR-34a, miR- 34a mimic, and a nucleotide sequence encoding miR-34a.

5. The miR-34a modulating compound for use of any one of items 1 to 4, wherein the disease is selected from the group consisting of a neurodegenerative disease, an autoimmune disease, an infectious disease, and cancer. The miR-34a modulating compound for use of any one of items 2 to 3, or 5, wherein the miR-34a modulating compound is a miR-34a binding molecule and the disease is selected from the group consisting of a neurodegenerative disease, an autoimmune disease, and an infectious disease.

The miR-34a modulating compound for use of item 6, wherein

(i) the neurodegenerative disease is selected from the group consisting of Alzheimer’s disease (AD) and other dementias, Parkinson’s disease (PD) and PD-related diseases, Prion disease, Motor neurone diseases (MND), Huntington’s disease (HD), Spinocerebellar ataxia (SCA), Spinal muscular atrophy (SMA), AIDS dementia complex, and atherosclerosis,

(ii) the autoimmune disease is selected from the group consisting of diabetes, rheumatoid arthritis (RA), multiple sclerosis (MS), systemic lupus erythematosus (lupus), Graves’ disease, Sjogren’s syndrome, Hashimoto’s thyroiditis, Myasthenia gravis, Vasculitis, Pernicious anemia, and Celiac disease, or

(iii) the infectious disease is selected from the group consisting of viral infection, preferably chronic or persistent viral infection, bacterial infection, parasitic infection.

The miR-34a modulating compound for use of item 7, wherein

(i) the viral infection is selected from the group consisting of human immunodeficiency virus (HIV), hepatitis B virus (HBV), hepatitis C virus (HCV), rhinovirus (common cold), herpes simplex virus (HSV), and respiratory syncytial virus (RSV) infection,

(ii) the bacterial infection is selected from the group consisting of Helicobacter pylori, Mycobacterium tuberculosis, Mycobacterium leprae, and Chlamydia trachomatis infection, or

(iii) the parasitic infection is selected from the group consisting of a Schistosoma mansoni, Taenia crassiceps, or Leishmania mexicana infection.

The miR-34a modulating compound for use of any one of items 2 or 4 to 5, wherein the miR-34a modulating compound is a miR-34a molecule and the disease is cancer.

The miR-34a modulating compound for use of item 9, wherein the cancer is selected from the group consisting of skin cancer, nasopharyngeal cancer, neuroendrocrine cancer, lung cancer, colon cancer, urothelial cancer, bladder cancer, liver cancer, ovarian cancer, gastric cancer, esophageal cancer, pancreatic cancer, kidney cancer, stomach cancer, esophageal cancer, breast cancer, renal cancer, head and neck cancer, brain cancer, lymphatic cancer, blood cancer, squamous cell cancer, laryngeal cancer, retina cancer, prostate cancer, cervical cancer, uterine cancer, testicular cancer, bone cancer, lymphoma, and leukemia.

11. The miR-34a modulating compound for use of any one of items 1 to 10, wherein miR-34a binds the mRNA of one or more target genes selected from the group consisting of TCRA, PLCG1, CD3E, PIK3CB, TAB2, and NFKBIA.

12. The miR-34a modulating compound for use of item 11, wherein the miR-34a binds the 3’ untranslated region (UTR) of the mRNA of said one or more target genes.

13. The miR-34a modulating compound for use of items 11 or 12, wherein the binding results in the inhibition of the translation of the mRNA of said one or more target genes.

14. The miR-34a modulating compound for use of any one of items 1 to 13, wherein the treatment results in a T-cell activation, preferably in an activation of T-cell modulation and/or T-cell cytotoxicity/killing.

15. The miR-34a modulating compound for use of item 14, wherein the T-cells are CD8⁺, CD3⁺, and/or CD4⁺ cells.

16. The miR-34a modulating compound for use of any one of items 1 to 15, wherein the miR- 34a modulating compound is suitable to be administered topically, intravenously, intradermally, intraarterially, intraperitoneally, intralesionally, intracranially, intraarticularly, intraprostaticaly, intrapleurally, intratracheally, intraocularly, intranasally, intravitreally, intravaginally, intrarectally, intramuscularly, subcutaneously, subconjunctivally, intravesicularly, mucosally, intrapericardially, intraumbilically, orally, by inhalation, by injection, by infusion, by continuous infusion, by localized perfusion bathing target cells directly, via a catheter, or via a lavage.

17. The miR-34a modulating compound for use of any one of items 1 to 16, wherein the miR- 34a modulating compound is suitable to be administered by providing a delivery system selected from the group consisting of an expression construct, preferably a vector, more preferably a viral vector, even more preferably an adenovirus, an adeno-associated virus, a retrovirus, or a lentivirus vector, a liposome, a polymer-mediated delivery system, a conjugate delivery system, an exosome, a microsponge, and a nanoparticle, preferably a gold particle.

18. A combination of a miR-34a modulating compound and a drug different from a miR-34a modulating compound for use in the treatment of a disease accompanied by an impaired T- cell receptor signaling.

19. The combination for use of item 18, wherein

(i) the miR-34a modulating compound is a miR-34a binding molecule or a miR-34a molecule, and/or (ii) the drug different from a miR-34a modulating compound is selected from the group consisting of a drug used in cancer therapy, immunotherapy, chemotherapy, hormone therapy, gene therapy, and infectious therapy.

20. A pharmaceutical composition comprising the miR-34a modulating compound as defined in any one of items 1 to 17 or the combination as defined in items 18 or 19 and a pharmaceutical acceptable carrier for use in the treatment of a disease accompanied by an impaired T-cell receptor signaling.

21. A method for treating a disease accompanied by an impaired T-cell receptor signaling comprising the step of:

administering (an effective amount of) a miR-34a modulating compound to a patient in need thereof.

22. A method of determining whether a patient responds to a treatment of a disease accompanied by an impaired T-cell receptor signaling comprising the step of:

determining the level of miR-34a in a biological sample isolated from the patient.

23. The method of item 22, wherein the patient is a patient to whom at least once at least one drug to be used in said treatment is administered or has/had been administered.

24. The method of items 22 or 23, wherein the biological sample is isolated from the patient after at least the first administration of the at least one drug.

25. The method of any one of items 22 to 24, wherein the level of the miR-34a is compared to a reference level of said miR-34a.

26. The method of item 25, wherein the reference level is the level determined by measuring at least one reference biological sample from

at least one subject suffering from a disease accompanied by an impaired T-cell receptor signaling, or

at least one subject not suffering from a disease accompanied by an impaired T-cell receptor signaling (being healthy).

27. The method of items 25 or 26, wherein the reference level is the level determined in a reference biological sample isolated from the patient prior to the administration of the at least one drug.

28. The method of any one of items 22 to 27, wherein the disease is selected from the group consisting of a neurodegenerative disease, an autoimmune disease, an infectious disease, and cancer.

29. The method of item 28, wherein

(i) the neurodegenerative disease is selected from the group consisting of Alzheimer’s disease (AD) and other dementias, Parkinson’s disease (PD) and PD-related diseases, Prion disease, Motor neurone diseases (MND), Huntington’s disease (HD), Spinocerebellar ataxia (SCA), Spinal muscular atrophy (SMA), AIDS dementia complex, and atherosclerosis,

(ii) the autoimmune disease is selected from the group consisting of diabetes, rheumatoid arthritis (RA), multiple sclerosis (MS), systemic lupus erythematosus (lupus), Graves’ disease, Sjogren’s syndrome, Hashimoto’s thyroiditis, Myasthenia gravis, Vasculitis, Pernicious anemia, and Celiac disease,

(iii) the infectious disease is selected from the group consisting of viral infection, preferably chronic or persistent viral infection, bacterial infection, parasitic infection, or

(iv) the cancer is selected from the group consisting of skin cancer, nasopharyngeal cancer, neuroendrocrine cancer, lung cancer, colon cancer, urothelial cancer, bladder cancer, liver cancer, ovarian cancer, gastric cancer, esophageal cancer, pancreatic cancer, kidney cancer, stomach cancer, esophageal cancer, breast cancer, renal cancer, head and neck cancer, brain cancer, lymphatic cancer, blood cancer, squamous cell cancer, laryngeal cancer, retina cancer, prostate cancer, cervical cancer, uterine cancer, testicular cancer, bone cancer, lymphoma, and leukemia.

30. The method of item 29, wherein

(i) the viral infection is selected from the group consisting of human immunodeficiency virus (HIV), hepatitis B virus (HBV), hepatitis C virus (HCV), rhinovirus (common cold), herpes simplex virus (HSV), and respiratory syncytial virus (RSV) infection,

(ii) the bacterial infection is selected from the group consisting of Helicobacter pylori, Mycobacterium tuberculosis, Mycobacterium leprae, and Chlamydia trachomatis infection, or

(iii) the parasitic infection is selected from the group consisting of a Schistosoma mansoni, Taenia crassiceps, or Leishmania mexicana infection.

31. The method of any one of items 23 to 30, wherein the at least one drug is a miR-34a modulating compound.

32. The method of item 31 , wherein the miR-34a modulating compound is a miR-34a binding molecule or a miR-34a molecule.

33. The method of item 32, wherein the miR-34a binding molecule is selected from the group consisting of an anti-miRNA, a small interfering RNA (siRNA), a short hairpin RNA (shRNA), an antisense 2’-0-methyl (2’-OMe) oligoribonucleotide, and an antibody or an antibody fragment thereof. The method of item 32, wherein the miR-34a molecule is selected from the group consisting of a mature miR-34a, pre-miR-34a, pri-miR-34a, miR-34a mimic, and a nucleotide sequence encoding miR-34a.

The method of any one of items 25 to 34, wherein

the miR-34a modulating compound is a miR-34a molecule,

the disease is cancer,

the reference level is the level determined by measuring at least one reference sample from at least one subject suffering from cancer, and

the level of miR-34a above the reference level indicates that the patient responds to said treatment.

The method of any one of items 25 to 35, wherein

the miR-34a modulating compound is a miR-34a molecule,

the disease is cancer,

the reference level is the level determined by measuring at least one reference sample from at least one subject not suffering from cancer (being healthy), and

the level of miR-34a comparable with the reference level indicates that the patient responds to said treatment.

The method of any one of items 25 to 36, wherein

the miR-34a modulating compound is a miR-34a binding molecule,

the disease is a neurodegenerative disease, an autoimmune disease, or an infectious disease, the reference level is the level determined by measuring at least one reference sample from at least one subject suffering from a neurodegenerative disease, an autoimmune disease, or an infectious disease, and

the level of miR-34a below the reference level indicates that the patient responds to said treatment.

The method of any one of items 25 to 37, wherein

the miR-34a modulating compound is a miR-34a binding molecule,

the disease is a neurodegenerative disease, an autoimmune disease, or an infectious disease, the reference level is the level determined by measuring at least one reference sample from at least one subject not suffering from a neurodegenerative disease, an autoimmune disease, or an infectious disease (being healthy), and

the level of miR-34a comparable with the reference level indicates that the patient responds to said treatment.

A miR-34a binding molecule for use in the treatment of a disease accompanied by an impaired calcium signaling. 40. The miR-34a binding molecule for use of item 39, wherein the miR-34a binding molecule is selected from the group consisting of an anti-miRNA, a small interfering RNA (siRNA), a short hairpin RNA (shRNA), an antisense 2’-0-methyl (2’-OMe) oligoribonucleotide, and an antibody or an antibody fragment thereof.

41. The miR-34a binding molecule for use of items 39 or 40 wherein the calcium signaling encompasses the store-operated calcium entry (SOCE) and/or the calcineurin signaling.

42. The miR-34a binding molecule for use of any one of items 39 to 41 , wherein the disease is selected from the group consisting of a neurodegenerative disease and cardiovascular disease.

43. The miR-34a binding molecule for use of item 42, wherein

(i) the neurodegenerative disease is selected from the group consisting of Alzheimer’s disease (AD) and other dementias, Parkinson’s disease (PD) and PD-related diseases, Prion disease, Motor neurone diseases (MND), Huntington’s disease (HD), Spinocerebellar ataxia (SCA), Spinal muscular atrophy (SMA), AIDS dementia complex, and atherosclerosis, or

(ii) the cardiovascular disease is selected from the group consisting of coronary artery disease, heart attack, heart failure, heart valve disease, congenital heart disease, heart muscle disease, pericardial disease, aorta disease, and blood vessel disease.

44. The miR-34a binding molecule for use of any one of items 39 to 43, wherein miR-34a binds the mR A of one or more target genes selected from the group consisting of ITPR2, CAMLG, STIM1, ORAI3, RCAN1, PPP3R1, and NFATC4.

45. The miR-34a binding molecule for use of item 44, wherein the miR-34a binds the 3’untranslated region (UTR) of the mRNA of said one or more target genes.

46. The miR-34a binding molecule for use of items 44 or 45, wherein the binding results in the inhibition of the translation of the mRNA of said one or more target genes.

47. The miR-34a binding molecule for use of any one of items 39 to 46, wherein the treatment results in an activation/restoration of calcium signaling.

48. The miR-34a binding molecule for use of any one of items 39 to 47, wherein the miR-34a binding molecule is suitable to be administered topically, intravenously, intradermally, intraarterially, intraperitoneally, intralesionally, intracranially, intraarticularly, intraprostaticaly, intrapleurally, intratracheally, intraocularly, intranasally, intravitreally, intravaginally, intrarectally, intramuscularly, subcutaneously, subconjunctivally, intravesicularly, mucosally, intrapericardially, intraumbilically, orally, by inhalation, by injection, by infusion, by continuous infusion, by localized perfusion bathing target cells directly, via a catheter, or via a lavage. 49. The miR-34a binding molecule for use of any one of items 39 to 48, wherein the miR-34a binding molecule is suitable to be administered by providing a delivery system selected from the group consisting of an expression construct, preferably a vector, more preferably a viral vector, even more preferably an adenovirus, an adeno-associated virus, a retrovirus, or a lentivirus vector, a liposome, a polymer-mediated delivery system, a conjugate delivery system, an exosome, a microsponge, and a nanoparticle, preferably a gold particle.

50. A combination of a miR-34a binding molecule and a drug different from a miR-34a binding molecule for use in the treatment of a disease accompanied by an impaired calcium signaling.

51. The combination for use of item 50, wherein the drug different from a miR-34a binding molecule is selected from the group consisting of a drug used in immunotherapy, hormone therapy, and cardiovascular therapy.

52. A pharmaceutical composition comprising the miR-34a binding molecule as defined in any one of items 39 to 49 or the combination as defined in items 50 or 51 and a pharmaceutical acceptable carrier for use in the treatment of a disease accompanied by an impaired calcium signaling.

53. A method for treating a disease accompanied by an impaired calcium signaling comprising the step of:

administering (an effective amount of) a miR-34a binding molecule to a patient in need thereof.

54. A method of determining whether a patient responds to a treatment of a disease accompanied by an impaired calcium signaling comprising the step of:

determining the level of miR-34a in a biological sample isolated from a patient.

55. The method of item 54, wherein the patient is a patient to whom at least once at least one drug to be used in said treatment is administered or has/had been administered.

56. The method of items 54 or 55, wherein the biological sample is isolated from the patient after at least the first administration of the at least one drug.

57. The method of any one of items 54 to 56, wherein the level of the miR-34a is compared to a reference level of said miR-34a.

58. The method of item 57, wherein the reference level is the level determined by measuring at least one reference biological sample from

at least one subject suffering from a disease accompanied by an impaired calcium signaling, or

at least one subject not suffering from a disease accompanied by an impaired calcium signaling (being healthy). 59. The method of items 57 or 58, wherein the reference level is the level determined in a reference biological sample isolated from the patient prior to the administration of said at least one drug.

60. The method of any one of items 54 to 59, wherein the disease is selected from the group consisting of a neurodegenerative disease and cardiovascular disease.

61. The method of item 60, wherein

((i) the neurodegenerative disease is selected from the group consisting of Alzheimer’s disease (AD) and other dementias, Parkinson’s disease (PD) and PD-related diseases, Prion disease, Motor neurone diseases (MND), Huntington’s disease (HD), Spinocerebellar ataxia (SCA), Spinal muscular atrophy (SMA), AIDS dementia complex, and atherosclerosis, or

(ii) the cardiovascular disease is selected from the group consisting of coronary artery disease, heart attack, heart failure, heart valve disease, congenital heart disease, heart muscle disease, pericardial disease, aorta disease, and blood vessel disease.

62. The method of any one of items 55 to 61 , wherein the at least one drug is a miR-34a binding molecule.

63. The method of item 62, wherein the miR-34a binding molecule is selected from the group consisting of an anti-miRNA, a small interfering RNA (siRNA), a short hairpin RNA (shRNA), an antisense 2’-0-methyl (2’-OMe) oligoribonucleotide, and an antibody or an antibody fragment thereof.

64. The method of any one of items 57 to 63, wherein

the drug is a miR-34a binding molecule,

the disease is a neurodegenerative disease or a cardiovascular disease,

the reference level is the level determined by measuring at least one reference sample from at least one subject suffering from a neurodegenerative disease or a cardiovascular disease, and

the level of miR-34a below the reference level indicates that the patient responds to said treatment.

65. The method of any one of items 57 to 64, wherein

the drug is a miR-34a binding molecule,

the disease is a neurodegenerative disease or a cardiovascular disease,

the reference level is the level determined by measuring at least one reference sample from at least one subject not suffering from a neurodegenerative disease or a cardiovascular disease (being healthy), and the level of miR-34a comparable with the reference level indicates that the patient responds to said treatment.

66. A miR-34a molecule for use in the prevention of transplant rejection.

67. The miR-34a molecule for use of item 66, wherein the miR-34a molecule is selected from the group consisting of a mature miR-34a, pre-miR-34a, pri-miR-34a, miR-34a mimic, and a nucleotide sequence encoding miR-34a.

68. A pharmaceutical composition comprising the miR-34a molecule as defined in items 66 or 67 and a pharmaceutical acceptable carrier for use in the prevention of transplant rejection.

69. A method for preventing transplant rejection comprising the step of:

administering (an effective amount of) a miR-34a molecule to a patient in need thereof. Various modifications and variations of the invention will be apparent to those skilled in the art without departing from the scope of invention. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention which are obvious to those skilled in the art in the relevant fields are intended to be covered by the present invention.

BRIEF DESCRIPTION OF THE FIGURES

The following Figures are merely illustrative of the present invention and should not be construed to limit the scope of the invention as indicated by the appended claims in any way.

Figure 1: Schematic representation of reporter gene constructs. The position of the predicted miR-34a-5p binding sites in the respective 3’UTR reporter constructs and additionally the sequences of the binding sites of miR-34a-5p in the different 3’UTRs as well as the mutated binding sites (underlined) are shown. A: TCRA -3’ UTR reporter vector, B: PLCGl-VCT reporter vector, C: CD 3is-3’UTR reporter vector, D: PIK3CB- 3’UTR reporter vector, E: 7/452-3’ UTR reporter vector, F: NFKBIA -3’UTR reporter vector.

Figure 2: Dual luciferase reporter assays of TCRA, PLCG1, CD3E, PIK3CB, TAB2, NFKBIA. 48h after transfection of HEK 293T-cells with the indicated combinations of empty vectors, reporter gene constructs, empty expression plasmid pSG5 and miRNA-expression plasmids of miR-34a the cells were lysed and the luciferase activity was detected. The luciferase activity of the control vector experiments was set to 100%. The results represent the mean of four independent experiments carried out in duplicates. Three asterisks correspond to p<0.00l . Data are represented as mean±SEM. A: Results of dual luciferase assays with the TCRA- 3’UTR reporter plasmid, B: Results of dual luciferase assays with the PLCG1- 3’UTR reporter plasmid, C: Results of dual luciferase assays with the CD 3E-3’UTR reporter plasmid, D: Results of dual luciferase assays with the PIK3CB- 3’UTR reporter plasmid, E: Results of dual luciferase assays with the 7 452-3’ UTR reporter plasmid, F: Results of dual luciferase assays with the NFKBIA- 3’UTR reporter plasmid.

Figure 3: Regulation of the endogenous protein level of NFKBIA by an altered miR- 34a expression. A: Western blot analysis of endogenous NFKBIA in miR-34a transfected Jurkat cells. Jurkat cells were transfected either with allstars negative control (ANC) or miR-34a- 5p mimic. 48h after transfection the endogenous protein level of NFKBIA was analyzed by Western blotting using specific antibodies against NFKBIA. GAPDH served as loading control. B: Quantification of endogenous NFKBIA protein levels in miR-34a transfected Jurkat cells. The expression of NFKBIA in three independent Western blot experiments was quantified by densitometry using Image Lab Software. The expression of NFKBIA was normalized to the corresponding GAPDH signals of the respective samples. Two asterisks correspond to p<0.0l C+D: Analysis of the impact of altered miR-34a levels on the endogenous NFKBIA protein level in CD4+ cells. CD4+cells were transfected either with ANC or miR-34a-5p mimic (C) and with inhibitor control (IC) or anti-miR-34a-5p (D). 48h after transfection the endogenous protein level of NFKBIA was analyzed by Western blotting using specific antibodies against NFKBIA. GAPDH served as loading control. E+F: Quantification of endogenous NFKBIA protein levels in CD4+ T-cells with altered miR-34a expression. The NFKBIA protein expression in miR-34a transfected CD4 + T-cells (E) and in anti-miR-34a transfected CD4 + T-cells (F) was quantified by densitometry using Image Lab Software. Three independent Western blot experiments were quantified each. The expression of NFKBIA was normalized to the corresponding GAPDH signals of the respective samples. One asterisks correspond to p<0.05 and two asterisks correspond to p<0.0l . Data are represented as mean±SD.

Figure 4: Regulation of the endogenous protein level of NFKBIA by an altered miR- 34a expression in CD8+ T-cells. A+B: Western blot analysis of the impact of altered miR- 34a-levels on the endogenous NFKBIA protein level in CD8+cells. CD8+cells were transfected either with ANC or miR-34a-5p mimic (A) and with inhibitor control (IC) or anti-miR-34a-5p (B). 48h after transfection the endogenous protein level of NFKBIA was analyzed by Western blotting using specific antibodies against NFKBIA. GAPDH served as loading control. C+D: Quantification of endogenous NFKBIA protein levels in CD8+ T-cells with altered miR-34a expression. The NFKBIA protein expression in miR-34a transfected CD8 + T-cells (E) and in anti-miR-34a transfected CD4 + T-cells (F) was quantified by densitometry using Image Lab Software. Three independent Western blot experiments were quantified each. The expression of NFKBIA was normalized to the corresponding GAPDH signals of the respective samples. One asterisks correspond to p<0.05. Data are represented as mean±SD.

Figure 5: Changes of miR-34a expression in CD4+ and CD8+ T-cells altered the cell surface expression of CD3E and TCRA. Primary CD4+ and CD 8+ T-cells were transfected either with non-targeting control (allstars negative control=ANC) or miR-34a-5p mimic, respectively or with inhibitor control (IC) or anti-miR-34a-5p. A, B, C, D: Mean fluorescence intensities of CD3E and TCRA expression, respectively from ANC-transfected (right histograms in Panel A-D) or miR-34a-5p mimic-transfected CD4+ (left histograms in Panel A and B) or CD8+ (left histograms in Panel C and D) T-cells were analyzed. E,F: FACS data of primary CD4+ and CD8+ T-cells, which were transfected either with non-targeting control (allstars negative control=ANC) or miR-34a-5p mimic respectively or with inhibitor control (IC) or anti-miR-34a- 5p were summarized from three independent donor experiments performed in duplicates. One asterisk corresponds to p<0.05 and two asterisks correspond to p<0.0l . Data are represented as mean±SD.

Figure 6: Real-time killing assay and qRT-PCR analysis of miRNA-expression A-F: Analysis of the real-time killing assay Representative real-time killing assay in MART 1 -specific CD8+ T-cell clones transfected with a miR-34a-5p mimic (upper curves / data points) or allstars Negative Control (ANC) as control (lower courve / data points) with MART1 peptide-loaded T2 cells (left panel). The effector cell to target cell ratio (E:T) was 2: 1. Target lysis at 60, 120 and 240 min analyzed in three independent experiments (MART 1 -specific CD8+ T-cell clones were independently expanded) (middle panel). Maximal killing rate from calculated from real-time killing kinetics (n = 3) (right panel). Results are shown as mean + SEM. Experiments were done after 30hours (A) and 50 hours (B) of transfection. G: qRT-PCR analysis of miRNA-34a expression in stimulated CD4+ and CD8+ T-cells. 7 hours after activation of CD4+ and CD8+ cells from four different donors by CD2/CD3/CD28 beads the total RNA was isolated and miRNA- 34a expression was analyzed by qRT-PCR using specific primers for miRNA-34a. The Fold change was calculated in reference to unstimulated medium controls.

Figure 7: Model of the impact of microRNA-34a-5p on T-cell killing processes mediated by NF-kB signaling.

Figure 8: Impact of miR-34a-5p overexpression on store-operated calcium entry in Jurkat cells. Jurkat cells were transfected for 48 h either with non-targeting control (ANC) or synthetic miR-34a-5p mimic. Respective Ca2+ imaging was performed in five independent experiments on three days of measurement. Intracellular Ca2+ was sensed by Fura-2-AM fluorescent dye and SOCE was induced by Thapsigargin (Tg). Cells were perfused with different solutions providing external Ca2+ ([Ca2+]ext). a: Quotient of Fura-2 fluorescence (Ratio (340/380)) was determined over time of measurement as mean of all tested cells (ANC: h=710; miR-34a-5p: n=756). b: Ratio (340/380) and delta ratio (340/380) were determined for the functional sections of imaging procedure and evaluated as mean of each experiment. Results were standardized to controls and are shown as means of all experiments with corresponding standard error (SEM). Statistical evaluation was performed using student's t-test, expecting a normal distribution of data. (* p < 0.05).

Figure 9: Schematic representation of reporter gene constructs and results of luciferase assays, showing the impact of miR-34a-5p on target genes related to store operated Ca2+ entry, a-d: 3’UTR sequences of ITPR2 (Inositol l,4,5-trisphosphate receptor type 2), CAMLG (Calcium modulating ligand), STIM1 (Stromal interaction molecule 1) and ORAI3 (ORAI calcium release-activated calcium modulator 3) were cloned into pMIR-RNL-TK reporter plasmids. The positions of the predicted miR-34a-5p binding sites within the cloned 3’UTR reporter constructs are illustrated and denoted. Mutated binding sites are shown underlined e-h: Relative luciferase ac 572 tivity [%] is shown for empty reporter plasmids (pMIR-RNL-TK) as well as wild type and mutated (mut) 3’UTR containing constructs. HEK293T-cells were co transfected with control (pSG5) or miR-34a-expression plasmids. Luciferase activities were measured 48 h after transfection. Results are shown as means of 4 independent experiments with corresponding standard errors (SEM). Statistical evaluation was performed using student's t-test, expecting a normal distribution of data. (* p<0.05, ** p<0.0l, *** p<0.00l).

Figure 10: Schematic representation of reporter gene constructs and results of luciferase assays, showing the impact of miR-34a-5p on target genes related to calcineurin/NFAT signaling, a-c: 3’UTR sequences of RCAN1 (Regulator of calcineurin 1), NFATC4 (Nuclear factor of activated T-cells 4) and PPP3R1 (Protein phosphatase 3 regulatory subunit B alpha) were cloned into pMIR-RNL-TK reporter plasmids. The approximate position of the predicted miR-34a-5p binding sites within the 3’UTR reporter constructs are illustrated and the sequences of the binding sites within the respective 3 TJTRs are denoted. Mutated binding sites are shown underlined d-f: Relative luciferase activity [%] is shown for empty reporter plasmids (pMIR-RNL-TK) as well as wild type and mutated (mut) 3 TJTR containing constructs. HEK293T- cells were co transfected with control (pSG5) or miR-34a-expression plasmids. Luciferase activities were measured 48 h after transfection. Results are shown as means of 4 independent experiments with corresponding standard errors (SEM). Statistical evaluation was performed using student's t-test, expecting a normal distribution of data. (* p<0.05, ** p<0.0l, *** p<0.00l).

Figure 11: Western blot analysis of endogenous NFATC4, STIM1 and PPP3R1 protein levels in miR-34a-5p overexpressing Jurkat cells, a, b: Representative western blot 599 images. Jurkat cells were transfected for 48 h either with non-targeting control (ANC) or synthetic miR-34a-5p mimic. NFATC4, STIM1 and PPP3R1 protein was detected by specific monoclonal antibodies in western blot analysis. b-Actin served as loading control c, d, e: Quantification of NFATC4, STIM1 and PPP3R1 expression by densitometric analysis of three independent western blot experiments. Respective protein expression was standardized according to b-Actin loading control and expression level of the control transfected cells was set to 100 %. Results are shown as means with corresponding SEM. Statistical evaluation was performed using student's t-test, expecting a normal distribution of data. (* p < 0.05, ** p < 0.01, *** p < 0.001; NFATC4 (Nuclear factor of activated T-cells 4); STIM1 (Stromal interaction molecule 1); PPP3R1 (Protein phosphatase 3 regulatory subunit B alpha)).

Figure 12: Model of the impact of microRNA-34a-5p on store-operated calcium entry and calcineurin/NFAT signaling. ITPR2, CAMLG, STIM1 and ORAI3 are down regulated by miR-34a-5p, which may lead to a reduced ER depletion and a decrease in CRAC channel Ca2+ influx. Additionally miR-34a-5p reduces PPP3R1, RCAN1 and NFATC4 expression, impacting nuclear transfer of calcium signaling in T-cell activation pathway.

Figure 13: List of oligonucleotide primer pairs including added enzyme restriction sites.

Figure 14: List of oligonucleotide primer pairs including added enzyme restriction sites. The amplified 3’UTR sequences of predicted miR-34a-5p target genes were cloned into pMIR-RNL-TK for luciferase gene reporter analysis.

Figure 15: List of oligonucleotide primer pairs for (primary) overlap extension PCR.

MiR-34a-5p binding sites within the 3’UTR sequences of miR-34a-5p target genes were replaced with enzyme restriction sites by overlap extension PCR and cloned into pMIR-RNL-TK. Wildtype 3 TJTR-pMIR-RNL-TK reporter constructs were used for template. In primary overlap extension PCR two overlapping mutated sequences were amplified that were used for template in secondary PCR (in combination with cloning primer pairs) to generate the complete mutated 3 TJTR insert.

* Oligonucleotide was used for whole amplicon amplification, no secondary PCR was required.

EXAMPLES

The examples given below are for illustrative purposes only and do not limit the invention described above in any way.

Details

Cell lines, tissue culture

The human HEK 293T and Jurkat cells were purchased from the German collection of microorganisms and cell cultures (DSMZ) and authenticated using STR DNA typing. HEK 293T cells were cultured in DMEM (Life Technologies GmbH, Darmstadt, Germany) supplemented with 10% Fetal bovine serum (Biochrom GmbH, Berlin, Germany), Penicillin (100 U/mL), Streptomycin (100 pg/mL). Cells were passaged for less than 6 months after receipt. Jurkat, T2 and lymphoblastoid cells were cultured in RPMI1640 (Life Technologies GmbH, Darmstadt, Germany) supplemented with 10% Fetal bovine serum (Biochrom GmbH, Berlin, Germany), Penicillin (100 U/mL), Streptomycin (100 pg/mL). Cells were passaged for less than 6 months after receipt.

CD4+ and CD8+ T cells from healthy donors

CD4+ T cells were isolated by negative selection from freshly obtained PBMC using human CD4+ T cell isolation kit (Miltenyi Biotech, Bergisch Gladbach, Germany). Purity was confirmed with CD4-FITC (Cat# 555346, BD Bioscience) and analyzed by flow cytometry. CD8+ T cells were isolated by negative selection from freshly obtained PBMC using human CD8+ T cell isolation kit (Miltenyi Biotech, Bergisch Gladbach, Germany). Purity was confirmed with CD8-FITC (Cat# 555366, BD Bioscience) and analyzed by flow cytometry. Cells were cultured in RPMI 1640 medium (Sigma) supplemented with 10% heat-inactivated endotoxin-tested FCS (Biochrom GmbH, Berlin, Germany).

Generation and expansion of MARTI specific CD8+ T cell clones

MART1 (melanoma antigen recognized by T cells 1) specific CD8+ T cell clones were generated as described before (Wolfl and Greenberg, 2014). In brief, monocytes were isolated from PBMC and stimulated with IL-4 and GM-CSF for 72 hours in Cellgro DC medium (CellGenix) supplemented with 1% human serum (Sigma Aldrich) to generate immature DC (dendritic cells). Maturation of DC was induced by GM-CSF, IL-4, LPS, IFNy and MART1 peptide for 16 hours at 37°C. Autologous naive CD8+ T cells were isolated from frozen PBMC. Mature DC (irradiated at 30 Gy) and naive CD8+ T cells were cocultured for 10 days in Cellgro DC medium supplemented with 5 % human serum. IL-21 was added at day 1, IL-7 and IL-15 at day 3, 5 and 7. After 10 days MART 1 -loaded, autologous PBMC (irradiated at 30 Gy) were cocultured with CD8+ T cells for 6 hours. Antigen-specific CD8+ T cells were isolated using IFN-g Secretion Assay. Cells were seeded with 1 cell/well (200 mΐ/wcll) in RPMI1640 supplemented with 10% human serum, Penicillin- Streptomycin (100 U/mL-lOO pg/mL, Sigma Aldrich), 30 ng/ml anti-CD3 antibody (clone:OKT3), 50 U/ml IL-2, 5 x 104 allogenous PBMC/well (irradiated at 30 Gy) and 5 x 104/well of a lymphoblastoid cell line (irradiated at 120 Gy) in 96-well U-bottom plates. After 7 days 50 mΐ of RPMI1640 supplemented with 10% human serum, Penicillin-Streptomycin and 250 U/ml IL-2 were added to each well and incubated for another week. Proliferating CD8+ T cells clones were transferred in a 25 cm2 cell culture flask containing 25 x 106 PBMC (irradiated at 30 Gy) and 5 x 106 cells of a lymphoblastoid cell line (irradiated at 120 Gy) in 20 ml RPMI1640 supplemented with 10% fetal bovine serum, Penicillin-Streptomycin. At day 1, 3, 5, 8 and 11 1200 U IL-2 and 40 ng IL-15 were added. Antigen- specificity was assessed using MART 1 -specific dextramers in flow cytometry. Antigen-specific clones were frozen in aliquots and further experiments were performed at day 11-14 of expansion.

Method Details

Cloning of reporter constructs

The 3’UTRs ofNFKBIA, RELA, cREL, IKBKB, IKBKG, TAB1, TAB2, TAK1, TRAF2, BCL10, PIK3CB, MALT 1 , PLCG 1 , TCRA and CD3E were cloned into the pMIR-RNLTK vector that was described in Beitzinger et al. using the Spel, Sacl or Nael restriction sites (Beitzinger et ah, 2007). The nucleotides 743-1228 and 3578-4120 of the cREL 3'UTR (NM 002908.3), nucleotides 46- 744 of the RELA 3'UTR (NM 021975.3), nucleotides 1-433 of the NFKBIA 3'UTR (NM 020529.2), nucleotides 1-520 of the IKBKG 3'UTR (NM 001099857.2), nucleotides 189- 900 of the IKBKB 3'UTR (NM 001556.2), nucleotides 829-982 of the TAK1 3'UTR (NM 003298.4), nucleotides 144-900 ofthe TABl 3'UTR (NM 006116.2), nucleotides 102-1009 of the TAB2 3'UTR (NM 015093.5), nucleotides 1-514 of the TRAF2 3'UTR (NM 021138.3), nucleotides 308- 1401 of the BCL10 3'UTR (NM 003921.4), nucleotides 1062- 2243 of the MALT1 3'UTR (NM 006785.3), nucleotides 136-1200 of the PLCG1 3'UTR (NM 002660.2), nucleotides 1436-2137 of the PIK3CB 3'UTR (NM 006219.2), nucleotides 95-497 of the TCRA 3'UTR (X02592.1) and nucleotides l-573of the CD3E 3'UTR (NM 000733.3) were amplified by PCR using specific primers (see Figure 13) from Jurkat cDNA. All hsamiR-34a-5p target sites were mutated by site-directed mutagenesis using the QuickChange II Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, United States) with specific primers (see Figure 13). Dual luciferase reporter assays

6.5x104 HEK 293T cells were seeded out per well of a 24-well plate. The next day the cells were transfected with 0.8 pg miRNA expression plasmid or control plasmid and 0.2 pg reporter vector with 3’UTR or 0.2 pg empty control reporter vector in the appropriate combinations using PolyFect transfection reagent according to the manufacturer’s protocol (Qiagen, Hilden, Germany). 48 hours after transfection the cells were lysed and measured corresponding to the Dual Luciferase® Reporter Assay System protocol (Promega, Mannheim, Germany).

Overexpression of miR-34a in Jurkat CD4+ and CD8+ T cells and Western blot

For Western Blot analysis 1x106 CD4+ or CD8+ T cells per well were seeded out in 12-well plates. 2.5x105 Jurkat cells were seeded out per well of a 6-well plate. Subsequently they were transfected either with the allstars negative control (ANC) and with hsa-miR-34a-5p miScript miRNA Mimic (MIMAT0000255 : 5 'U GGC AGU GU CUU AGCU GGUU GU, SEQ ID NO: 2), respectively or with miScript Inhibitor Negative Control and anti-hsa-miR-34a-5p miScript miRNA Inhibitor: (MIMAT0000255 : 5 CAACCAGCUAAGACACUGCCA, SEQ ID NO: 3) according to the HiPerFect transfection reagent protocol (Qiagen, Hilden, Germany). 48 hours after transfection the cells were lysed with 2x lysis buffer (130 mM Tris/HCl, 6% SDS, 10% 3-Mercapto-l,2- propandiol, 10% glycerol) and sonicated 3 times for 2sec. 15 pg of the whole protein extracts were separated using a Mini-Protean® TGX Stain-FreeTM Precast Gel (Bio-Rad Laboratories Inc., Hercules, California, USA) and electroblotted on a nitrocellulose membrane (Whatman, GE Healthcare, Freiburg, Germany). The detection of NFKBIA was carried out with a monoclonal antibody against NFKBIA (Cat# 4814, Cell Signaling Technology, Danvers, United States). GAPDH served as loading control and was detected with a monoclonal antibody against GAPDH (Cat#2l l8, Cell Signaling Technology, Danvers, United States). All secondary antibodies were purchased from Sigma Aldrich (Sigma Aldrich, Munich, Germany).

Overexpression of miR-34a in MARTI- specific CD8+ T cells

MART 1 -specific CD8+ T cells were transfected at day 11 of expansion. 6 x 106 cells were transfected either with 8 pl 20 pM solution of allstars negative control (ANC) or hsa-miR-34a-5p miScript miRNA Mimic, respectively using P3 Primary Cell 4DNucleofector X Kit (Lonza). 30 hours after transfection cells were washed and resuspended in AIMV medium (Thermo Fisher Scientific) supplemented with 10% fetal bovine serum, 50 U/ml IL-2 and 5 ng/ml IL-15. 30 and 50 hours after transfection cells were used to perform real-time killing assays. Antibodies and Flow Cytometry

The surface antigens CD4, CD8, CD3E and TCR alpha were stained with the following fluorescent labeled antibodies: anti CD4-PE (Cat# 555347, BD Biscience), anti CD8-PE (Cat# 130-091-084, Miltenyi Biotech), anti-CD3E (BD Biosciences, Cat#56l806) and anti TCRA alpha/beta (Thermo Fisher Scientific, Cat# 17-9986-41) for 30 min at 4°C. Cells were fixed in 1 % paraformaldehyde and analyzed by flow cytometry (FACS Canto II, BD Biosciences).

Real-time killing assay

Killing of T2 cells by MART 1 -specific CD8+ T cell clones was measured by a time-resolved, real time killing assay over a time period of 4 hours. The real-time killing assay was carried out as described before (Kummerow et ah, 2014). In brief, T2 cells were loaded with 2.5 pg MART1- specific peptide in 500 mΐ AIMV medium supplemented with 10% fetal bovine serum for 90 minutes at 37°C and 5% C02. 0.5 x 106 MART1-T2 cells were loaded with calcein-AM (500 nM) in AIMV medium supplemented with 10 mM HEPES (AIMV*) for 15 minutes at room temperature. Cells were centrifuged at 200xg for 5 minutes resuspended in 4 ml AIMV*. 200 mΐ per well (25 x 103 target cells) were plated in a black, clear-bottom, 96-well plate (353219, Coming). Cells were settled down for at least 15 minutes at room temperature. CD8+ T cell clones were added slowly at an effector to target ratio of 2: 1. Measurement was started immediately in a GENios Pro plate reader (Tecan) at 37°C every 10 minutes for 4 hours using bottom reading mode. The fraction of killed cells is then calculated for each time point by the equation: target lysis (%) = (Fexp - Flive*I)/((Flysed-Flive)*I)* l00 (Flive: Fluorescence of target cells only; Flysed: fluorescence of lysed target cells only; Fexp: Fluorescence of the experimental well; I (Index): Fexp(at timepoint 0)/Flive (at timepoint 0) All fluorescence values are subtracted by the corresponding medium controls).

Activation of CD4+ and CD8+ cells and Western blot

1x106 freshly isolated CD4+ or CD8+ T cells per 12-well were stimulated with the T Cell Activation/Expansion Kit (bead-to-cell ratio 1 :4, Cat# 130-091-441, Miltenyi Biotech) for 4h. Nuclear and cytoplasmic extracts were prepared according to (Schreiber et ah, 1989) with minor modifications (Fing et ah, 1998). Briefly, T cells were harvested by centrifugation and washed with cold phosphate-buffered saline (PBS). The pellet was resuspended in 150 mL of buffer A (10 mmol/F HEPES, pH 7.9, 10 mmol/F KC1, 0.1 mmol/F EDTA, pH 8.0, 0.1 mmol/F EGTA, 1 mmol/F dithiothreitol (DTT), 100 pg/mF phenylmethylsulfonyl fluoride (PMSF), 1 pg/mF aprotinin, 2 pg/mF leupeptin, 100 pg/mF Pefabloc, and 100 pg/mF chymostatin) by gentle pipetting and incubated on ice for 15 minutes. 10 pL of 10% Nonidet-P-40 solution (Sigma) was added and cells were vigorously mixed for 10 seconds before centrifugation. The supernatant containing the cytoplasmic proteins was transferred to another tube. Pelleted nuclei were resuspended in 50 pL of buffer C (25% glycerol, 20 mmol/L HEPES, pH 7.9, 0.4 mol/L NaCl, 1 mmol/L EDTA, pH 8.0, 1 mmol/L EGTA, 1 mmol/L DTT, 100 pg/mL PMSF, 1 pg/mL aprotinin, 2 pg/mL leupeptin, 100 pg/mL Pefabloc, and 100 pg/mL chymostatin) and mixed at 4°C for 20 minutes. The nuclei were centrifuged for 10 minutes at 13,000 rpm and supernatants containing the nuclear proteins were stored at -80°C. 15 pg of the cytoplasm or nucleus extracts were separated using a Mini-Protean® TGX Stain-FreeTM Precast Gel (Bio-Rad Laboratories Inc., Hercules, California, USA) and electroblotted on a nitrocellulose membrane (Whatman, GE Healthcare, Freiburg, Germany). The detection of NFKBIA was carried out with a monoclonal antibody against NFKBIA (Cat# 4814, Cell Signaling Technology, Danvers, United States) or a monoclonal antibody against p65 (Cat# 8242, Cell Signaling Technology, Danvers, United States), respectively. GAPDH served as loading control and was detected with a monoclonal antibody against GAPDH (Cat# 2118, Cell Signaling Technology, Danvers, United States). All secondary antibodies were purchased from Sigma Aldrich (Sigma Aldrich, Munich, Germany).

RNA Isolation and quantitative real time PCR (qRT-PCR)

7 hours after activation of 1x106 CD4+ or CD8+ T cells they were lysed using Qiazol (Qiagen, Hilden, Germany) and the total RNA was isolated according the protocol of the miRNAeasy Micro KIT (Qiagen, Hilden, Germany). The expression of hsa-miR-34a-5p was analyzed by qRT-PCR using the miScript PCR System (Qiagen, Hilden, Germany) and the StepOnePlus Real-Time PCR System (Applied Biosystems, Foster City, United States) corresponding to the manufacturer’s protocol. In brief, l50ng total RNA was reverse transcribed into cDNA using the miScript RT II Kit with the miScript HiSpec Buffer (Qiagen, Hilden, Germany). RNU48 or served as endogenous control.

Statistical Analysis and Quantification

The statistical analysis of the dual luciferase assays, the Western blots and the FACS experiments was conducted with SigmaPlot 10 (Systat, Chicago, USA) applying student’s t-test. The densitometric analysis of Western blots was carried out with Image Lab Software Version 5.2.1 (Bio-Rad Laboratories Inc., Hercules, California, USA). Data is statistically significant when p< 0.05 by student’s t test. In figures, asterisks correspond to the statistical significance as calculated by student’s t-test: *= 0.01 < p < 0.05; **= 0.001 < p < 0.01; ***= p < 0.001. Results

Target prediction & validation of TCRA, PLCG1, CD3E, PIK3CB, TAB2 and NFKBIA as direct target genes of miR-34a by dual luciferase assay

Recently, miR-34a with a significantly increased abundance in CD3+ T cells of lung cancer patients was reported and five PKC-isozymes as direct targets of miRNA-34a were identified, including PRKCQ, which plays a crucial role in NF-kB signaling of T lymphocytes. To further explore the role of miR-34a in NF-kB signaling, miRWalk 2.0 (http://zmf.umm.uniheidelberg.de/apps/zmf/mirwalk2/index.html) was used to predicted miR-34a target genes (Dweep and Gretz, 2015). Thereby, miR-34a binding sites in the 3’UTRs of 15 modulators of NF-kB were identified including TCRA, CD3E, PLCG1, PIK3CB, MALT1, BCL10, TRAF2, TAB1, TAB2, TAK1, NFKBIA, IKBKG, IKBKB, REL and CREL. Specifically, a single binding site for miR-34a within the 3’UTRs of CD3E, PIK3CB, TAB2, and NFKBIA, each was predicted. The 3’UTR of TCRA contains four binding sites for miR-34a and the 3’UTR of PLCG1 contains two binding sites. The exact nucleotide positions of the predicted binding sites of miR- 34a within the 3’UTRs of these six genes is given in Figurel A-F. For each for the predicted binding sites, the according sequence including the neighboring sequences were amplified. Specifically, nucleotides 95-497 of the 3’UTR of TCRA, nucleotides 136-1200 of the 3’UTRs of PLCG1, nucleotides 1-573 of CD3E, nucleotides 1436-2137 of PIK3CB, nucleotides 102-1009 of TAB 2 and nucleotides 1-433 of NFKBIA were amplified. The amplified sequences were cloned into the pMIR-RNL-TK reporter vector. HEK 293T cells were transfected with the miR-34a expression plasmid or the empty control vector and with reporter constructs harboring the predicted 3’UTRs or with empty reporter plasmids in the appropriate combinations (Fig. 2 A-F). The luciferase activity of the TCRA reporter plasmid (pMIR-RNL-TK-TCRA-3’UTR) was significantly reduced to 44% (p<0.00l) by the co-transfection of miR-34a as compared to pMIR- RNL-TK vector (Fig. 2A). To verify the binding of miR-34a to its target sites in the TCRA 3’UTR, this binding sites were mutated as shown in Figure 1A. The luciferase activity of the mutated TCRA reporter plasmid (pMIR-RNL-TKTCRA-3’UTR mut) cotransfected with miR-34a was comparable to the activity of the empty reporter vector (pMIR-RNL-TK). The luciferase activity of the PLCG1 reporter plasmid (pMIR-RNL-TK- PLCGl-3’UTR) was reduced to 70% (p<0.00l) as compared to pMIR-RNL-TK vector (Fig. 2B). The luciferase activity of the mutated PLCG1 reporter plasmid was again comparable to the activity of the empty pMIR-RNL-TK vector. Likewise, the luciferase activities of the reporter plasmids for CD3E, PIK3CB, TAB2, and NFKBIA, were each significantly reduced as compared to the pMIR-RNLTK vector (Fig. 2C, 2D, 2E, 2F). In detail, the luciferase activity of CD3E reporter plasmid was reduced to 76%, the activity of PIK3CB- to 63%, the activity of TAB2- to 74 %, and the activity of NFKBIA- reporter vector to 53 %. For each of the genes tested, the luciferase activity of the mutated reporter plasmid was comparable to the activity of the empty reporter vector or not significantly reduced. All assays were carried out in duplicates and have been repeated 4 times. For the remaining potential targets of miR-34a, a significant effect on the luciferase activity was not found. In detail, evidence that the genes MALT1, BCL10, TAK1, TAB1, TRAF2, IKBKG, IKBKB, REL and CREL are miR-34a targets could not be provided (data not shown).

Changes of endogenous abundance of NFKBIA as function of altered miR-34a levels

The effect of miR-34a on the endogenous proteins of the genes that have been confirmed as miR- 34a targets was next analyzed by luciferase assay. Since this study is based on the findings of significantly increased levels of miR-34a in CD3+ T-cells of lung cancer patients and since the CD3 antigen is bound to the membranes of all mature T-cells, specifically Jurkat cells, primary CD4+ T cells and CD8+ T cells were analyzed. As readout system for the effects of miR-34a on the NF-kB pathway, NFKBIA as the most cytoplasmic downstream member of the NF-KB pathway was chosen. Both Jurkat cells and primary CD4+ T cells were first transfected with either Allstars Negative Control (ANC) as a non-targeting control or a miR-34a-5p mimic. The overexpression of miR-34a in the transfected CD4+ and CD8+ T cells was confirmed by qRT- PCR (data not shown). Using a specific antibody against NFKBIA, the endogenous NFKBIA levels were analyzed by Western blotting and reduced levels of NFKBIA were detected both in the miR-34a transfected Jurkat cells and the transfected CD4+ T cells (Fig. 3A, 3B, 3C, 3E). A quantification of the NFKBIA protein levels of three independent experiments showed that the mean NFKBIA protein levels were decreased upon transfection of miR-34a to 50% (p<0.0l) in Jurkat cells and to 69% (p<0.0l) in CD4+ cells. As a control experiment, CD4+ T cells were transfected with anti-miR-34a and a significant increase of the NFKBIA protein level to 129% (p<0.05) was found providing further evidence for a functional relevance of miRNA-34a for the regulation of the NFKBIA protein expression (Fig. 3D, 3F). Transfection of primary CD8+ T cells with a miR-34a-5p mimic likewise caused reduced levels of endogenous NFKBIA (Fig. 4A). The mean NFKBIA protein levels in CD8+ T cells were decreased to 72% (p<0.05) (Fig. 4C). Transfection of CD8+ T cells with anti-miR-34a lead to an increase of 125% (p<0.05) of the NFKBIA protein level (Fig. 4B, 4D). Changes of the cell surface expression of TCRA and CD3E as function of altered miR-34a levels

The effect of altered miR-34a on the abundance of CD3E and TCRA expression, both of which map at the upstream part of the NF-kB pathway, was next analyzed. To study the impact of miR- 34a expression on TCRA and CD3E cell surface expression of CD4+ and CD8+ T cells, these cells were transfected with“allstars negative control” (ANC) or with a miR-34a-5p mimic. For miR-34a inhibition, cells were transfected with inhibitor negative control (IC) or anti-hsa-miR- 34a-5p miRNA Inhibitor, respectively. 48h after transfection cell surface expression levels of both proteins were analyzed using flow-cytometry. The ectopic expression of miR-34a caused a reduction of the mean fluorescence intensities for CD3E and TCRA on CD4+ and CD8+ T cells in comparison to ANC transfected cells. The according changes are indicated in Figures 5A-D for CD3E (left curve, Figures 5A and B), TCRA (left curve, Figures 5C and D) and for ANC- transfected cells. The curve of the ANC-transfected cells is the right curve shown in Figures 5A- D. Quantification of three independent experiments from three different donors revealed a significant reduction of CD3E (84%; p<0.05) and TCRA (78%; p<0.0l) cell surface levels on CD4+ T cells (Fig. 5E; CD3E, TCRA). In CD8+ T cells overexpression of miR-34a lead to a significant decrease of CD3E and TCRA cell surface levels to 84% (p<0.0l) and 81% (p<0.0l), respectively (Fig. 5F CD3E, TCRA). Inhibition of miR-34a in CD4+ T cells elevated the cell surface level for CD3E up to 107% (Fig. 5 E), for TCRA up to 112% (p<0.0l) (Fig. 5E). In CD8+ T cells transfection of anti-hsa-miR-34a-5p miRNA Inhibitor increase the TCRA expression up to 110% (p<0.0l) (Fig. 5F) while the CD3E expression was not affected in comparison to T cells transfected by inhibitor negative control (IC).

Impact of miR-34a overexpression on cytotoxicity of CD8+ cells

To analyze the impact of miR-34a on CD8+ T cell function, the effect of miR-34a overexpression on cytotoxicity in MART 1 -specific CD8+ T cell clones was investigated by a real-time killing assay (Kummerow et ah, 2014). CD8+ T cell clones were transfected with either Allstars Negative Control (ANC) as a non-targeting control or a miR-34a-5p mimic and used as effector cells against MART1 peptide-loaded T2 target cells. Transfection efficiency and killing of miR-34a of transfected CD 8+ T cell clones were measured 30 and 50 hours after transfection by qRT-PCR (data not shown) and real-time killing assay, respectively. In this timeframe, transfection of miR- 34a resulted in a 5-8 fold upregulation of miR-34a compared to ANC-transfected cells (data not shown). Concomitantly, the upregulation of miR-34a induced a reduction in killing efficiency of transfected CD8+ T cell clones over the whole measurement periods (Figure 6A, D). 30 hours after transfection, the end point lysis (target cell lysis at time point 240 min of real-time killing assay) was reduced at least by 20% in miR-34a upregulated CD8+ T cell clones (average end point lysis = 69.3%, normalized to ANC transfected CD8+ clones) (Figure 6A). 50 hours after transfection, the endpoint lysis was 80.3% of miR-34a upregulated effector cells normalized to end point lysis of control cells (Figure 6B). The impairment of cytotoxicity was further confirmed by quantifying the maximal killing rate, representing the highest target cell lysis between two time points of 10 min. After 30 hours, the maximal killing rate was reduced between 18 and 49% compared to control (in average: 6.2 %/l0 min in miR-34a transfected cells; 7.6 %/l0 min in ANC- transfected cells). After 50 hours, the maximal killing rate was decreased between 18 and 29% (in average: 7.9 %/l0 min in miR-34a transfected cells; 10.1 %/l0 min in ANC-transfected cells).

Rapid induction of miR-34a expression in TCR stimulated primary CD4+ and CD8+ T cells

To analyze the effect of NF-kB signaling on miR-34a expression, CD4+ and CD8+ T cells, respectively from four different donors were stimulated with CD2/CD3/CD28 beads. As control for an efficient rapid T cell stimulation, a decrease of p65 (RELA proto-oncogene, NF-kB subunit) in the cytoplasm, an increase of p65 in the nuclei and a decrease of NFKBIA in cytoplasm of CD4+ and CD8+ T cells was detected by Western blotting after four hours (data not shown). After seven hours, the stimulated T cells were analyzed for miR-34a expression by qRT-PCR. In the stimulated CD4+ T cells the expression of miR-34a for donor 1 was increased 1.2 fold and for donor 2 1.7 fold whereas the expression of miR-34a in stimulated CD8+ T cells was increased 1.6 fold in donor 3 and 2.1 fold in donor 4 in reference to unstimulated medium controls (Fig. 6G).

In the following table, the miRNA-34a target genes involved in T-cell receptor NF-KB-signaling are summarized:

Table 1: miRNA-34a target genes involved in T-cell receptor NF-KB-signaling

Discussion

Among the tested miRNA-34a target genes within the NF-kB signaling pathway in T lymphocytes TCRA, alpha chain of the human TCR-protein and CD3E, a part of the immunoreceptor-associated signal-transducing CD3 complex, were identified as direct targets of miRNA-34a. The Interaction of TCRA with a peptide-bound major histocompatibility complex (pMHC) initiates the adaptive immune response. As result of the TCR ligand recognition conformational changes in the CD3E cytoplasmic tail are part of the earliest TCR signaling events upon antigen-binding to the TCR subunit complex. TCRA deficient mice show an impaired Treg development and function. CD3E deficiency caused by homozygous mutations in the CD3E gene is associated with the T-B+NK+ SCID (Severe Combined Immunodeficiency) phenotype. In these patients, no T cells were found in the peripheral blood indicating that the absence of CD3E completely inhibits human T cell differentiation. Inhibition of CD3E effects the recruitment of the Src-family proteins tyrosine kinases, which phosphorylate tandem tyrosine residues within the immunoreceptor tyrosine-based activation motifs IT AMs. Dually phosphorylated IT AMs lead to recruitment and activation of key downstream signaling molecules including ZAP70 (zeta chain of Tcell receptor associated protein kinase 70) in T cells. By inhibition of CD3E, miRNA-34a may likewise impact the phosphorylation of IT AMS and the activation of ZAP70 that was identified as direct target of miR- 34a. An increased expression of miR-34a is accompanied by reduced protein levels of ZAP70 resulting in weaker activation of downstream pathways. One of the downstream targets of ZAP70 in NF-kB signaling is PRKCQ. In response to CD3/CD28 co-stimulation ZAP70 activates PRKCQ, which is required for NF-kB activation. Recently, PRKCQ and other PKCfamily members were identified as target genes of miR-34a suggesting that aberrant expression of miRNA-34a plays a role for T cells immunodeficiency associated diseases via its interaction with the CD3E-ZAP70-PRKCQ axis. The miRNA-34a target PLCG1 generates diacylglycerol (DAG), which in turn phosphorylates PRKCQ facilitating activation of NF-kB. The transmission of signals of extracellular stimuli by the PLC family including PLCG1 is found in various cell types especially including cells of the immune system. In adult T-cell leukemia (ATL) whole-exome sequencing identified 50 mutated genes including PLCG1 that was mutated in 36% of all ATL cases. Activating mutations of PLCG1 increasing the transcriptional activity of NF-kB via induction of MALT 1 protease activity were also found in angioimmunoblastic T-cell lymphoma (AITL) and other lymphomas derived from follicular T-helper cells (TFH). The miRNA-34a target PIK3CB participates in TCR-NF-kB signaling after binding of the costimulatory receptor CD28 by B7 ligands on antigen presenting cells (APCs). This molecular interaction activates PIK3 complex triggering phosphorylation of PRKCQ by PDK1 (pyruvate dehydrogenase kinase 1) leading to downstream activation of NF-kB. Since PIK3CB knockout in mice is lethal at very early embryonic stages, T cells lacking PIK3CB cannot been studied. A further member of the TCR- NF-kB signaling and target of miRNA 34a is TAB2, which is ubiquitinated and degraded by RBCK1 (RANBP2-type and C3HC4-type zinc finger containing 1). By targeting TAB2 for degradation RBCK1 negatively regulates TAK1 (nuclear receptor subfamily 2 group C member 2) leading to NF-kB activation. In mice the knockout of TAB2 has been linked to developmental defects and embryonic lethality. Mutations in TAB2 are found in ffontometaphyseal dysplasia (FMD) causing increased TAK1 autophosphorylation and activation of NF-kB pathway. The miR- 34a target NFKBIA inhibits the nuclear translocation of NF-kB into the nucleus by masking nuclear localization signal (NLS) of NF-kB and retaining NF-kB as an inactive complex in the cytoplasm. In response to immune or proinflammatory stimuli, NFKBIA is first phosphorylated and then ubiquitinated for degradation. NFKBIA -/- mice displayed a severe hematological disorder with an increase of granulocyte/erythroid/monocyte/macrophage colony- forming units (CFU-GEMM) and hypergranulopoiesis. In human, a heterozygous mutation of NFKBIA at serine 32 of a patient with hyper immunoglobulin M-like immunodeficiency syndrome and ectodermal dysplasia was accompanied by an impairment of NF-kB translocation and T cell receptor induced proliferation. An inhibition of NFKBIA translation by miR-34a combined with degradation of NFKBIA by induction of NF-kB -signaling further enhances transcriptional activity of NF-kB. NF- KB signaling phosphorylation is a crucial mechanism, which contributes to fast signal transduction thereby enabling T cells to an immediate response upon activation. Besides known proteins of the NF-kB signaling like TCRA, CD3E, PLCG1, PIK3CB, TAB2, and NFKBIA, miRNAs like miR- 146, miR-l55 and miR-34a emerge as a second layer of regulation of this pathway. In comparison to the protein phosphorylation, the fare slower kinetics of the miRNA mediated regulation causes effects that likely show only after several hours upon activation. Although binding of a miRNA to a mRNA target may result in an immediate decrease of the according protein synthesis, a cellular effect is not to be expected as long as the total amount of protein as a function of the protein half live is not affected. A reduction of cytoplasmic NFKBIA and the subsequent increase of nuclear NF-kB was measured after four hours upon T-cell activation. Although the exact role of miR-34a in the NF-kB signaling needs to be established, a possible scenario includes a positive feed-back loop by which the amount of miR-34a is increased. An increased amount of miR-34a inhibits the translation of NFKBIA, which in turn leads to an increase of nuclear NF-kB leading to a further activation of miR-34a transcription which is a known target of NF-kB. This self-reinforcing process of miR-34a activation likely affects also the other miR-34a targets within the NF-KB signaling pathway. The rising amount of miR-34a increasingly inhibits the targets TCRA, CD3E, PLCG1, PIK3CB and TAB2, finally resulting in a“shutdown” of the NF-kB signaling process. Without the NF-kB signaling pathway, the CD8+ T cell mediated killing of the target cell or CD4+ T cell mediated modulation of the immune response, respectively will be ended. In this scenario, the miRNA mediated regulation of the NF-kB pathway is part of a mechanism that acts partly independent of canonical NF-kB signaling transduction and contributes to an alternating T cell activation status. Parallel to initiating the canonical NF-kB signaling cascade, T cell activation triggers an increase of the miRNA-34a expression resulting in a temporary T cell inactivation that may interrupt phases of T cell activity. A further understanding of the role of miRNA-34a in T cells depends on a better insight into the mechanisms of the cell killing including the processes terminating the interaction between T-cell and target cell and its kinetics/duration. Likewise, the role of miRNA-34a in naive T cells may be clarified. Naive T cells show a slower response to antigen stimulation than effector cells. This attenuated response of naive T cells may be linked to an altered NF-kB signaling mechanisms, i.e. altered phosphorylation, association with lipid rafts, signaling protein expression and altered miRNA expression. Beside the role of miRNA-34a in these processes, miRNA- 146 and miRNA- 155 appear to play a pivotal role in regulation of T cell response during T cell activation. Any final scenario describing the NF-kB regulation will have to acknowledge the role of miRNAs that are likely to be part of a still largely unknown layer of organization with a kinetic different from the canonical NF-kB signaling. Both the multiple targeting of modulators of NF-kB signaling by miRNA-34a and the impaired CD8+ T cell mediated cell killing associated with miRNA-34a overexpression indicates a central role of this miRNA in modulating T cell activation via a second layer of regulation with a kinetic different from the signal transduction by phosphorylation. Example 2:

Method Details

Cell lines

Human Jurkat and HEK293T cell lines were purchased from the Leibniz Institute DSMZ German collection of microorganisms and cell cultures. HEK293T cells were cultured in DMEM (Life Technologies GmbH, Darmstadt, Germany) and Jurkat cells in RPMI 1640 medium (Life Technologies GmbH, Darmstadt, Germany), respectively supplemented with 10 % fetal bovine serum (Biochrom GmbH, Berlin, Germany), penicillin (100 U/mL) and streptomycin (100 pg/mL). Cells were passaged for less than 3 months after receipt.

Fura-2-AM based Ca2+ imaging analysis of miR-34a-5p overexpressing Jurkat cells

2.5x105 Jurkat cells/well were seeded-out in 6-well plates and were transfected either with AllStars negative control (ANC) or with syn-hsa-miR-34a-5p miScript miRNA Mimics (QIAGEN N.V., MIMAT0000255 : 5 JGGCAGUGUCUUAGCUGGUUGU, SEQ ID NO: 2), 279 complying with HiPerFect™ transfection reagent protocol (Qiagen, Hilden, Germany). Transfected cells were incubated for overall 48 h before Ca2+ imaging. Cells were loaded with 1 mM Fura-2-AM (Invitrogen, Waltham, Massachusetts, USA) for 25 min at room temperature and fixed on poly-omithine-coated glass coverslips. For imaging procedure cells were perfused with different solutions, providing external Ca2+. 1 mM external Ca2+ solution contained 155 mM NaCl, 2 mM MgCl2, 10 mM glucose, 5 mM Hepes and 1 mM CaCl2. In 0 mM Ca2+ solution CaCl2 was replaced by 1 mM EGTA and 3 mM MgCl2 (pH 7.4 with NaOH). SOCE was induced using 1 mM irreversible SERCA inhibitor Thapsigargin (Tg) (Invitrogen, Waltham, Massachusetts, USA). Fura-2 fluorescence (F) was detected alternating its excitation from l=340 nm (Ca2+ bound, F340) to 380 nm (Ca2+ free, F380). Images were analysed by TILLVision software (TILL Photonics GmbH, Grafelfing, Germany). Ratio (340/380) was determined by quotient F340/F380. Jurkat cells with basal calcium of > 0.4 Ratio (340/380) were excluded from analysis as pre- activated. Ratio (340/380) was determined for the functional sections of imaging procedure using IGOR Pro (WaveMetrics) software. For delta Ratio, the minimum before adding the Tg was subtracted from Tg peak (ATg peak), Ratio (340/380) before adding 1 mM Ca2+ solution was subtracted from Ratio (340/380) maximum and plateau respectively (A ratio peak, A ratio plateau). Influx rate was determined by the slope of ratio, when adding the 1 mM Ca2+ solution. Target prediction and assembly of 3’UTR reporter gene constructs

miRWalk 2.0 (http://zmf.umm.uni-heidelberg.de/apps/zmf/mirwalk2/index.html) was used for an in silico prediction of miR-34a-5p binding sites within the 3’UTR of possible target genes (Dweep and Gretz, 2015). Subsequently, predicted target genes related to SOCE or calcineurin/NFAT signaling were chosen. The respective 3’UTR sequences of predicted miR-34a-5p target genes were amplified by PCR using specific primer pairs (see Figure 14) and cloned into the multiple cloning site of pMIR-RNL-TK plasmid (Beitzinger et ah, 2007), using Spe I and Sac I restriction sites. Jurkat cDNA was used for template. The denoted parts of human GRCh38/hg38 genome have been cloned utilizing the declared NCBI sequences for reference: ATP2A2 3'UTR (chrl2:l 10,347,119-110,348,110; NM 70665.3), ATP2A3 3'UTR (chrl7:3, 923, 898-3, 924, 783; NM 005173.3), CALM3 3UTR (chrl9:46, 609, 301-46, 610, 572; NM 005184.3), CAMLG 3'UTR (chr5: l34, 750, 951-134, 752, 087; NM_00l745.3), ITPR1 3'UTR (chr3:4, 846, 620-4, 847, 798; NM_00l 168272.1), ITPR2 3'UTR (chrl2:26, 337, 690-26, 338, 767; NM_002223.3), ITPR3 3'UTR (chr6:33, 695, 799-33, 696, 154; NM_002224.3), NFATC4 3'UTR (chrl4:24, 378, 485-24, 379, 520; NM_001136022.2), ORAI3 3UTR (chrl6:30, 953, 784-30, 954, 826; NM 52288.2), PPP3R1 3UTR (chr2:68, 179, 165-68, 180, 278; NM_000945.3), RCAN1 3'UTR (chr21 :34,516,824- 34,517,736; NM_0044l4.6), STIM1 3'UTR (chrl 1 :4,092,219-4,093, 198; NM_00l27796l . l). MiR-34a-5p binding sites were mutated by technique of overlap extension PCR using specific primers (see Figure 15) (Ho et ah, 1989).

Dual luciferase reporter gene assays

HEK293T cells were seeded-out to a count of 6.5x104 cells/well of a 24-well plate. The day after seeding cells were transfected with 0.8 pg pSG5 or pSG5-miR-34a-expression plasmid respectively and either 0.2 pg 3’UTR reporter construct or empty pMIR-RNL-TK plasmid. Transfection was performed following the instructions of Polyfect™ reagent protocol (Qiagen, Hilden, Germany). 48 h after transfection cells were lysed and extracts were measured referring to the protocol of Dual Luciferase® Reporter Assay System (Promega, Mannheim, Germany)

RNA Isolation and quantitative real time PCR (qRT-PCR)

For analysis of gene expression in Jurkat cells, mRNA levels of ITPR1, ITPR2, ITPR3, ORAI1, ORAI2, ORAI3, STIM1, STIM2, NFATC4 and miR-34a-5p were quantified by RT PCR. Untreated Jurkat cells were lysed using Qiazol (Qiagen, Hilden, Germany) and total RNA was isolated by miRNeasy Mini KIT (Qiagen, Hilden, Germany), following the manufacturers protocol. 150 ng total RNA was reverse transcribed by miScript RT II Kit into cDNA. cDNA for subsequent microRNA quantification was transcribed using miScript HiSpec Buffer (Qiagen, Hilden, Germany), for later mRNA quantification miScript HiFlex Buffer (Qiagen, Hilden, Germany) was used. RNU48 and GAPDH served as endogenous control. Expression levels were analysed by miScript PCR System (Qiagen, Hilden, Germany) and a StepOnePlus Real-Time PCR System (Applied Biosystems, Foster City, United States) following the manufacturer’s instructions. Specific primer pairs (QuantiTect Primer Assays) were also purchased from Qiagen: GAPDH (Cat. No. QT00079247), ITPR1 (Cat. No. QT00056490), ITPR2 (Cat. No. QT01336468), ITPR3 (Cat. No. QT00011865), miR-34a (Cat. No. MS00003318), NFATC4 (NFATC4 1 : QT00013587; NFATC4 2: QT01873326), ORAI1 (Cat. No. QT00202587), ORAI2 (Cat. No. QT00215229), ORAI3 (Cat. No. QT00231910), RNU48 (Cat. No. MS00007511), STIM1 (Cat. No. QT00083538), STIM2 (Cat. No. QT00023744).

Western blot analysis of endogenous NFATC4, STIM1 and PPP3R1 protein expression in Jurkat and cells

To obtain endogenous protein extracts from Jurkat cells, 2.5x105 cells/well were seeded-out in 6- well plates and were transfected either with AllStars negative control (ANC) or with syn hsa-miR- 34a-5p miScript miRNA Mimics (QIAGEN N.V., MIMAT0000255:

5 J GGC AGU GU CUUAGCU GGUU GU, SEQ ID NO: 2), complying with HiPerFect™ transfection reagent protocol (Qiagen, Hilden, Germany). Further analysis was performed after an incubation time of 48 h. The transfected cells were lysed by 2x lysis buffer (130 mM Tris/HCl, 6 % SDS, 10 % 3 -Mercapto-l, 2-propanediol, 10 % glycerol) and sonification. 15 pg of whole cell protein extracts were separated by SDS-PAGE on Mini-Protean® TGX Stain-FreeTM Precast Gels (Bio-Rad Faboratories Inc., Hercules, California, USA). Protein bands of NFATC4 and STIM1 were transfered by electrob lotting to a nitrocellulose membrane (Whatman, GE Healthcare, Freiburg, Germany). For PPP3R1 analysis, protein bands were transferred to a polyvinylidene fluoride (PVDF) membrane. Protein bands were detected using specific monoclonal antibodies for STIM1 (anti-STIMl; Cat# 5668S) and NFATC4 (anti-NFAT3; Cat# 2183S) from Cell Signaling Technology Inc. (Danvers, United States) and for PPP3R1 (Cat# MA5-23933) from Thermo Fisher Scientific (Waltham, United States). b-Actin served as loading control and was detected by monoclonal anti-beta-Actin antibody (Cat# A5441) from Sigma Aldrich (Munich, Germany). Secondary antibodies were purchased from Sigma Aldrich (Sigma Aldrich, Munich, Germany).

Statistical evaluation and quantification

Statistical evaluation of dual luciferase assays, western blots and calcium imaging experiments was performed by Student’s t-test, using SigmaPlot 10 software (Systat, Chicago, USA). A normal distribution of data was expected in all experiments. Densitometric analysis of western blot bands was performed, using Image Lab Software Version 5.2.1 (Bio-Rad Laboratories Inc., Hercules, California, USA). The difference of data sets was considered to be significant at a p-value of < 0.05. Asterisks in the figures correspond to the statistical significance: * p < 0.05, ** p < 0.01, *** p < 0.001.

Results

MiR-34a-5p overexpression reduces SOCE in Jurkat cells

To test the impact of miR-34a-5p on SOCE, the functional effect of its overexpression on human T cell line Jurkat was analyzed. Cells were transfected either with miR-34a-5p mimic or control mimic (AllStars Negative Control, ANC) RNA for 48 h before loading with Fura-2-AM. ER depletion was induced by SERCA pump inhibitor Thapsigargin (Tg) and CRAC influx was initiated, providing external Ca2+ solution. Since excitation maximum of Fura-2 fluorescent dye changes from l=380 nm to l=340 nm, when bound to cytosolic Ca2+, relative changes in intracellular calcium concentration were determined by Ratio (340/380) (Figure 8a). Statistical evaluation of the functional imaging sections (Figure 8b) showed no significant effects of miR- 34a-5p overexpression on Ratio (340/380) in resting cells (basal ratio) as well as CRAC influx rate and in the plateau phase of CRAC channel activity (A ratio plateau). Overexpression of miR-34a- 5p however led to a significantly (p<0.05) reduced ratio (340/380) for ER depletion by Tg, which was 78.31 % compared to control transfected cells. Similar was detected for influx peak through CRAC channels (A ratio peak), which was reduced to 84.35 % compared to control transfected cells (p<0.05).

MiR-34a-5p targets SOCE and calcineurin/NFAT signaling related genes

In order to identify target genes of miR-34a-5p related to store-operated Ca2+ entry and downstream calcineurin signaling, an in silico target prediction was performed. Regulation by miR-34a-5p was analyzed by dual luciferase reporter gene assays. Respective 3’UTR sequences containing the predicted microRNA binding sites were cloned into pMIR-RNL-TK reporter plasmid. Activity of firefly luciferase was measured after 48 h co-transfection of HEK293T cells with microRNA-34a expression plasmids (pSG5-miR-34a) or control (pSG5). Binding of the microRNA to the 3’UTR was detected by a decline in relative luciferase activity. Out of twelve predicted and tested miR-34a-5p target genes, seven were identified being determinably effected by miR-34a-5p. No effect of miR-34a expression was observed on ITPR1 and ITPR3 (Inositol l,4,5-trisphosphate receptor 1 and 3), CALM3 (Calmodulin 3) as well as ATP2A2 and ATP2A3 (ATPase sarcoplasmic/endoplasmic reticulum Ca2+ transporting 2 and 3) 3’UTRs (data not shown). ITPR2 (Inositol l,4,5-trisphosphate receptor 2), CAMLG (Calcium modulating ligand), STIM1 (Stromal interaction molecule 1) and ORAI3 (ORAI calcium release-activated calcium modulator 3) were identified as direct target genes of miR-34a-5p with relation to store-operated Ca2+ entry (Figure 9). Analysis of ITPR2-V UTR containing construct in luciferase assays showed a decrease of relative luciferase activity to 76.32 % in cells overexpressing miR-34a. Compared to empty reporter vector, this effect was statistically significant (p<0.00l). The miR- 34a-5p specific effect was further confirmed by mutating the predicted binding sequence. While the CAMLG- 3’ UTR construct showed a significantly reduced relative luciferase of up to 73.37 % (p<0.00l) upon miR-34a overexpression, the mutated construct showed no decrease in reporter gene activity compared to empty control plasmid. Investigation of S77V/7-3’UTR showed a significant reduced relative luciferase activity of 73.1 % (p<0.00l), which was also reconstituted by mutation of specific miR-34a-5p binding site. MiR-34a overexpression led to a significant decline in relative luciferase activity to 74.93 % (p<0.00l), when ORAI3- 3’ UTR construct was compared to empty control plasmid. The mutation of single binding sites respectively showed a significant reduction of reporter construct activity by miR-34a overexpression. The relative luciferase activity was reduced to 81.61 % (p<0.0l) for the first binding site and to 73.29 % (p<0.00l) for the second. By testing double mutated constructs, the luciferase activity was reconstituted showing a combined function of both miR-34a-5p binding sites. RCAN1 140 (Regulator of calcineurin 1), PPP3R1 (Protein phosphatase 3 regulatory subunit B, alpha) as well as NFATC4 (nuclear factor of activated T-cells 4) were further identified as miR-34a-5p target genes important for calcineurin/NFAT signaling (Figure 10). In comparison to empty reporter plasmid, testing of RCAN1 -3’UTR reporter gene construct revealed a reduced activity of luciferase of 54.94 % (p<0.00l). The effect of miR-34a-5p binding again was verified by an increase in reporter gene activity of the mutated construct. Relative luciferase activity of wild type PPP3R1- 3’ UTR construct was reduced by miR-34a overexpression to a content of 63.07 % (p<0.00l). Mutation of binding site one or two respectively within the PPP3R1 reporter gene construct also led to a significantly reduced luciferase activity of 87.13 % (p<0.05) and 76.43 % (p<0.00l), compared to empty control plasmid. Testing of the double mutated construct resulted in a reconstituted activity and verified a functional impact of both binding sites. Analysis of NFATC4 resulted in similar findings. The effects of miR-34a overexpression on NFA TC4-3’ UTR constructs led to a reduced relative luciferase activity of 51.96 % (p<0.00l) for wild type and 73.52 % (p<0.0l) as well as 70.52 % (p<0.00l) for the respective single mutated constructs. Mutation of both miR-34a-5p binding sites reconstituted the luciferase activity. MiR-34a-5p overexpression reduces endogenous STIM1, PPP3R1 and NFATC4 protein levels

Due to the central roles of STIM, calcineurin and NFAT in SOCE and calcineurin pathway, respectively, endogenous protein level of STIM1, PPP3R1 and NFATC4 were analyzed upon miRNA-34a overexpression. The abundance of endogenous NFATC4 and STIM1 mRNA in Jurkat cells was shown by quantitative RT-PCR (data not shown). Endogenous protein expression of NFATC4, STIM1 and PPP3R1 was analyzed by Western blotting in Jurkat cells (data not shown). Cells were transfected using miR-34a-5p-mimic or control mimic (AllStars Negative Control, ANC) RNA for 48 h. Proteins were separated by SDS-PAGE and the target proteins were identified by specific monoclonal antibodies.

Relative protein expression was 168 s related to a b-Actin loading control. In Jurkat lymphocytes overexpressing miR-34a-5p NFATC4 protein level was significantly reduced to 81.34 % (p<0.05) as a result of three independent experiments. Relative endogenous STIM1 expression was reduced upon miR-34a-5p overexpression to 68.09 % (p<0.00l) and PPP3R1 protein level was reduced to 54.84 % (p<0.0l) (Figure 11).

Discussion

MiR-34a-5p is involved in regulation of cell cycle, migration, differentiation and apoptosis. In particular, miR-34a targets several members of the protein kinase C family, which functions in Ca2+ signaling through T cell receptor (TCR). Significantly elevated miR-34a-5p expression in CD3+ T cells of lung cancer patients were found. Here, it could be shown that miR-34a-5p is a key regulator of SOCE and calcineurin signaling (Figure 12). In the following, the miR-34a-5p targets and the effects of a down regulation of these targets will be described. The most upstream miR-34a-5p target gene of the SOCE pathway which was identified was ITPR2. ITPR2 is encoding for IP3 receptor type 2, which is located in the ER membrane. Among the three types of IP3 receptors (IP3Rs) that are expressed in T cells (ITPR1 , ITPR2 and ITPR3), type 2 shows the highest sensitivity to IP3. It is conceivable that the activation of IP3Rs via TCR first leads to a depletion of ER Ca2+ stores and the induction of SOCE, followed by a period of reduced responsiveness mediated by miR-34a-5p that down regulates ITPR2. The second gene, which was identified as a target gene of miR-34a-5p encoding an ER membrane protein, was CAMLG. Overexpression of CAMLG in Jurkat cells causes IP3 -independent influx of extracellular Ca2+ and enables NFAT controlled transcription events. CAMLG-depleted CD8+ positive T cells show a reduced ability of target cell destruction. A miR-34a-5p dependent reduction of CAMLG protein level may therefore be associated with a reduced cytosolic Ca 2+ concentration and a decrease in NFAT mediated transcription to regulate T cell function. ER Ca2+ depletion leads to activation of Ca2+ release-activated Ca2+ (CRAC) channels. The CRAC consist of the Ca2+ sensor STIM, encoded by two different homologues in mammals ( STIM1 and STIM2 ), and the pore forming ORAI in plasma membrane, with three different mammalian homologues ( ORA II , ORAI2 and ORAI3 ). The ER Ca2+ sensor STIM1 is the third ER membrane protein that was identified as a target of miR- 34a-5p. In conjunction with ORAI1, STIM1 is the primary component of the CRAC and enables proper SOCE function. Deletion of STIM1 in mouse T cells is associated with a reduction in NFAT regulated transcription and cytokine expression. STIM1 mutations with a loss of STIM 1 function result in the absence of SOCE and severe immune deficiency in human. Additionally, ORAI3 was identified as a direct target gene of miR-34a-5p. ORAI3 forms homomeric or heteromeric channels in the plasma membrane. Involvement of ORAI3 in channel formation leads to a reduced Ca2+ entry, when compared to homomeric ORAI1 channels. An increased ORAI3 expression within an inflammatory environment has been associated with a reduced sensitivity of effector T cells to reactive oxygen species. Based on these data, the posttranscriptional reduction of ORAI3 by miR- 34a-5p is likely to be associated with an increased ROS-sensitivity of effector T cells. Analysis of miR-34a-5p overexpression on SOCE functionality by Ca2+ imaging revealed both a decreased Thapsigargin-induced ER depletion and a decreased maximum Ca2+ influx through CRAC channels. Besides IP3Rs, which are known to be responsible for ER calcium leak and ER depletion, CAMLG is likely to act on ER depletion as a potential ER leak channel or a SERCA inhibitor. Hence, the reduced ER depletion may be due to the down regulation of ITPR2 and CAMLG in miR-34a-5p overexpressing cells. The reduced calcium entry of extracellular calcium in SOCE may result from STIM1 reduction in miR-34a-5p overexpressing cells. Analysis of Jurkat cells with a reduced STIM1 expression by siRNA also showed a decreased calcium influx through store-operated channels. Since ORAI3 involvement in Ca2+ channel formation leads to a reduced Ca2+ entry, a reduced ORAI3 expression in miR-34a-5p overexpressing cells should, however, result in an increase in SOCE. ORAI3 regulation by miR-34a-5p may impact SOCE to a lower degree than the miR-34a-5p mediated STIM1 reduction, which regulates activity of all ORAI homologues. Nevertheless the opposite effect of ORAI3 down regulation may partially diminish the effect caused by a reduced STIM1 expression upon miR-34a-5p overexpression. Cytosolic Ca2+ serves as second messenger that induces pathways such as calcineurin/NFAT signaling. Within the calcineurin/NFAT pathway, RCAN1 was identified as a miR-34a-5p target gene. Depending on the RCAN phosphorylation status, a reduced level of RCAN1 protein as a result of miR-34a-5p binding may lead to either an inhibition or an enhancement of calcineurin/NFAT signaling. The second identified miR-34a-5p target gene of calcineurin/NFAT pathway was PPP3R1, which encodes calcineurin subunit B. Heteromeric calcineurin consists of a catalytic calcineurin A subunit and a regulatory B subunit. Calcineurin B binds to intracellular Ca2+ and induces structural changes of calcineurin A. Activation of calcineurin A subunit by cytosolic calcium sensor calmodulin subsequently facilitates dephosphorylation of transcription factor NFAT, resulting in nuclear NF AT -translocation and enhanced transcription of T cell activating genes. Moreover calcineurin B prevents degradation of calcineurin A. Posttranscriptional down regulation of PPP3R1 gene by miR-34a-5p may therefore impact phosphatase activity as well as stability of the calcineurin complex. The third miR-34a-5p target gene within the calcineurin/NFAT pathway, which was identified by luciferase assays and Western blotting, was NFATC4 (NFATC4/NFAT3). NFAT proteins constitute a family of transcription factors that enhance transcription of genes, which are crucial for T cell activity. Although there were some reports suggesting that NFATC4 is not expressed in T lymphocytes, NFATC4 expression in T lymphocytes was shown. Down regulation of NFATC4 has been shown to be associated with effective cytokine expression in human CD4+ T cells, suggesting that regulation of NFATC4 expression by miR-34a-5p may take part in orchestrating this process. Taken together miR-34a- 5p overexpression leads to an inhibition of store-operated Ca2+ signaling and impacts downstream calcineurin/NFAT signaling by targeting specific related genes. Analyzing Jurkat cells, a reduction of SOCE by miR-34a-5p overexpression was observed. The increased miR-34a-5p expression may negatively impact activation, proliferation, effector functions as well as survival of T cells. These data indicate an inhibition of immune cell function by miR-34a-5p in the anti-tumor immune response.

REFERENCES

Beitzinger, M., Peters, F., Zhu, J.Y., Kremmer, E., and Meister, G. (2007). Identification of human microRNA targets from isolated argonaute protein complexes. RNA Biol 4, 76-84.

Dweep, H. & Gretz, N. miRWalk2.0: a comprehensive atlas of microRNA-target interactions. Nat Methods 12, 697, doi: l0. l038/nmeth.3485 (2015).

Ho, S. N., Hunt, H. D., Horton, R. M., Pullen, J. K. & Pease, F. R. Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 77, 51-59 (1989).

Kummerow, C., Schwarz, E.C., Bufe, B., Zufall, F., Hoth, M., and Qu, B. (2014). A simple, economic, time -resolved killing assay. Eur J Immunol 44, 1870-1872.

Schreiber, E., Matthias, P., Muller, M.M., and Schaffner, W. (1989). Rapid detection of octamer binding proteins with 'mini-extracts', prepared from a small number of cells. Nucleic acids research 17, 6419.

Fing, W., Rayman, P., Uzzo, R., Clark, P., Kim, H.J., Tubbs, R., Novick, A., Bukowski, R., Hamilton, T., and Finke, J. (1998). Impaired activation of NFkappaB in T cells from a subset of renal cell carcinoma patients is mediated by inhibition of phosphorylation and degradation of the inhibitor, IkappaBalpha. Blood 92, 1334-1341.

Claims

1. A miR-34a binding molecule for use in the treatment of a disease accompanied by an impaired T-cell receptor signaling.

2. The miR-34a binding molecule for use of claim 1 , wherein the miR-34a binding molecule is selected from the group consisting of an anti-miRNA, a small interfering RNA (siRNA), a short hairpin RNA (shRNA), an antisense 2’-0-methyl (2’-OMe) oligoribonucleotide, and an antibody or an antibody fragment thereof.

3. The miR-34a binding molecule for use of claims 1 or 2, wherein the disease is selected from the group consisting of a neurodegenerative disease, an autoimmune disease, and an infectious disease.

4. The miR-34a binding molecule for use of claim 3, wherein

(i) the neurodegenerative disease is selected from the group consisting of Alzheimer’s disease (AD) and other dementias, Parkinson’s disease (PD) and PD-related diseases, Prion disease, Motor neurone diseases (MND), Huntington’s disease (HD), Spinocerebellar ataxia (SCA), Spinal muscular atrophy (SMA), AIDS dementia complex, and atherosclerosis,

(ii) the autoimmune disease is selected from the group consisting of diabetes, rheumatoid arthritis (RA), multiple sclerosis (MS), systemic lupus erythematosus (lupus), Graves’ disease, Sjogren’s syndrome, Hashimoto’s thyroiditis, Myasthenia gravis, Vasculitis, Pernicious anemia, and Celiac disease, or

(iii) the infectious disease is selected from the group consisting of viral infection, preferably chronic or persistent viral infection, bacterial infection, parasitic infection.

5. The miR-34a binding molecule for use of any one of claims 1 to 4, wherein miR-34a binds the 3’untranslated region (UTR) of the mRNA of one or more target genes selected from the group consisting of TCRA, PLCG1, CD3E, PIK3CB, TAB2, and NFKBIA.

6. A combination of a miR-34a binding molecule and a drug different from a miR-34a binding molecule for use in the treatment of a disease accompanied by an impaired T-cell receptor signaling.

7. A pharmaceutical composition comprising the miR-34a binding molecule as defined in any one of claims 1 to 5 or the combination as defined in claim 6 and a pharmaceutical acceptable carrier for use in the treatment of a disease accompanied by an impaired T-cell receptor signaling.

8. A method of determining whether a patient responds to a treatment of a disease accompanied by an impaired T-cell receptor signaling comprising the step of:

determining the level of miR-34a in a biological sample isolated from the patient, wherein the patient is a patient to whom at least once at least one drug to be used in said treatment had been administered, and

wherein the at least one drug is a miR-34a binding molecule.

9. The method of claim 8, wherein the biological sample is isolated from the patient after at least the first administration of the at least one drug.

10. The method of claims 8 or 9, wherein the level of the miR-34a is compared to a reference level of said miR-34a.

11. The method of claim 10, wherein the reference level is the level determined by measuring at least one reference biological sample from

at least one subject suffering from a disease accompanied by an impaired T-cell receptor signaling, or

at least one subject not suffering from a disease accompanied by an impaired T-cell receptor signaling (being healthy).

12. The method of claims 10 or 11, wherein the reference level is the level determined in a reference biological sample isolated from the patient prior to the administration of the at least one drug.

13. The method of any one of claim 8 to 12, wherein the disease is selected from the group consisting of a neurodegenerative disease, an autoimmune disease, and an infectious disease.

14. The method of claim 13, wherein (i) the neurodegenerative disease is selected from the group consisting of Alzheimer’s disease (AD) and other dementias, Parkinson’s disease (PD) and PD-related diseases, Prion disease, Motor neurone diseases (MND), Huntington’s disease (HD), Spinocerebellar ataxia (SCA), Spinal muscular atrophy (SMA), AIDS dementia complex, and atherosclerosis,

(ii) the autoimmune disease is selected from the group consisting of diabetes, rheumatoid arthritis (RA), multiple sclerosis (MS), systemic lupus erythematosus (lupus), Graves’ disease, Sjogren’s syndrome, Hashimoto’s thyroiditis, Myasthenia gravis, Vasculitis, Pernicious anemia, and Celiac disease, or

(iii) the infectious disease is selected from the group consisting of viral infection, preferably chronic or persistent viral infection, bacterial infection, parasitic infection.

15. The method of any one of claims 8 to 14, wherein the miR-34a binding molecule is selected from the group consisting of an anti-miR A, a small interfering RNA (siRNA), a short hairpin RNA (shR A), an antisense 2’-0-methyl (2’-OMe) oligoribonucleotide, and an antibody or an antibody fragment thereof.