WO2019178187A1 - Compositions and methods for hemoglobin production - Google Patents
Compositions and methods for hemoglobin production Download PDFInfo
- Publication number
- WO2019178187A1 WO2019178187A1 PCT/US2019/021986 US2019021986W WO2019178187A1 WO 2019178187 A1 WO2019178187 A1 WO 2019178187A1 US 2019021986 W US2019021986 W US 2019021986W WO 2019178187 A1 WO2019178187 A1 WO 2019178187A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- spop
- inhibitor
- cell
- subject
- globin
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
- A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
- A61K31/445—Non condensed piperidines, e.g. piperocaine
- A61K31/4523—Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems
- A61K31/454—Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems containing a five-membered ring with nitrogen as a ring hetero atom, e.g. pimozide, domperidone
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Definitions
- the present invention relates to the field of hematology. More specifically, the invention provides compositions and methods for the production of various forms of hemoglobin, including adult and fetal type hemoglobin.
- HbF fetal hemoglobin
- compositions and methods are provided for increasing hemoglobin levels (e.g., fetal hemoglobin) in a cell or subject.
- the method comprises administering at least one speckle- type BTB/POZ protein (SPOP; speckle-type POZ protein) inhibitor to the cell or subject.
- SPOP speckle-type BTB/POZ protein
- the subject has a hemoglobinopathy such as sickle cell disease or thalassemia.
- the cell is an erythroid cell.
- the SPOP inhibitor is a small molecule.
- the SPOP inhibitor may be, for example, a MATH domain inhibitor or a BTB domain inhibitor.
- the SPOP inhibitor may be a CRISPR based or siRNA/shRNA inhibitor of the SPOP gene.
- the method may further comprise delivering at least one fetal hemoglobin inducer to the cell or subject.
- the method may exploit additive or synergistic effects with other fetal hemoglobin inducing methods based on pharmacologic compounds and/or various forms of gene therapy.
- a hemoglobinopathy e.g., sickle cell disease or thalassemia
- the method comprises administering at least one SPOP inhibitor to a subject in need thereof.
- the SPOP inhibitor may be in a composition with a pharmaceutically acceptable carrier.
- the subject has a b-chain hemoglobinopathy. In a particular embodiment, the subject has sickle cell anemia. In a particular
- the SPOP inhibitor is a small molecule.
- the SPOP inhibitor may be, for example, a MATH domain inhibitor or a BTB domain inhibitor.
- the SPOP inhibitor may be a CRISPR based or siRNA/shRNA based inhibitor of the SPOP gene.
- the method may further comprise delivering at least one other fetal hemoglobin inducer to the subject.
- FIGS 1A-1C Protein-domain based CRISPR-Cas9 screen identifies SPOP as a novel fetal globin repressor.
- FIG. 1 A Screening strategy. Cas9 expressing HUDEP-2 cells were transduced with a BTB domain and histone modification reader domain-targeting sgRNA library (6 sgRNA/domain). Edited HUDEP-2 cells were then induced to differentiate for 7 days. Differentiated cells were stained by APC conjugated anti-HbF and sorted with HbF high and HbF low by flow cytometry. Enriched sgRNAs were identified by deep sequencing.
- Fig. 1B HbF FACS gating strategy for HbF high and HbF low cell populations.
- Fig. 1C Scatter plot of HbF high (y-axis) and HbF low (x-axis) populations as log 2 transformed normalized read counts, each dot represents a sgRNA.
- Figures 2A-2D SPOP depletion elevates g-globin protein and mRNA levels in HDUEP-2 cells.
- Fig. 2A SPOP protein domain structure and position of three SPOP sgRNAs within the BTB domain.
- Fig. 2C Immunoblots analysis with indicated antibodies using whole cell lysates from cell pools transduced with sgRNAs.
- Fig. 2D Expression of g-globin mRNA was measured by RT-qPCR, data are plotted as percentage of g-globin over g-gl obin+b- globin gene levels. Mean is shown ⁇ SD of at least two biological replicates. *** denotes />-value ⁇ 0.001.
- Figures 3A-3B SPOP depletion specifically and strongly induces g-globin in HUDEP-2 cells.
- Fig. 3A RNA-seq analysis of cell pools with SPOP sgRNA# 1, #2 and #3. Each dot represents an individual gene. Each gene is depicted according to FPKM (Fragments Per Kilobase Million) value.
- Fig. 3B Scatter plots showing the results of mass spectrometry analysis of cell pools with SPOP sgRNA# 1, #2 and #3 using whole cell lysates. Data represent log 2 protein abundances. Protein abundances were quantified by TMT (Tandem mass tag)-labeled MS. Each dot represents a gene.
- Figures 4A-4F SPOP depletion elevates g-globin in primary erythroid CD34+ cells.
- Fig. 4A Schematic diagram of experimental design.
- Fig. 4B Representative HbF flow cytometry of CD34+ erythroid cells at Day 14 of differentiation.
- Fig. 4C Immunoblots analysis with indicated antibodies for differentiated CD34+ cells infected with scrambled or SPOP shRNAs virus.
- Fig. 4D HPLC analysis for cells expressing indicated shRNAs at Day 15-16 of differentiation, HbF indicates fetal hemoglobin; HbA indicates adult hemoglobin. Arrow indicates HbF.
- Fig. 4E shows
- g-globin mRNA was measured by RT-qPCR, data are plotted as percentage of g-globin over y-globin+P-globin gene levels. Mean is shown ⁇ SD of three independent donors. * denotes /i- value ⁇ 0.01. Fig. 4F: RNA-seq analysis for CD34+ cells at Day 14 of differentiation. R value denotes Pearson correlation coefficient. Log 2 FPKM values were averaged from two independent donors.
- Figures 5A-5D SPOP-CEIL3 complex represses g-globin independent of BCL11 A.
- Fig. 5A Immunoblots analysis with indicated antibodies for differentiated HUDEP-2 cells expressing CUL3 sgRNAs.
- Fig. 5B Expression of g-globin mRNA was measured by RT-qPCR, data are plotted as percentage of g-globin over g- globin+P-globin gene levels. Mean is shown ⁇ SD of two biological replicates.
- Fig. 5C Alignment of human (SEQ ID NO: 11) and mouse (SEQ ID NO: 12) SPOP DNA sequence. Shaded marks SPOP sgRNA#l sequence.
- Fig. 5D Expression of g-globin mRNA was measured by RT-qPCR, data are plotted as percentage of g-globin over g- globin+P-globin gene levels. Mean is shown ⁇ SD of two biological replicates.
- Overexpression levels of BCL11 A and mSpop cDNAs were controlled by sorting GFP low cell population.
- Figures 6A-6C Overexpression of SPOP mutant elevates g-globin.
- Fig. 6A HbF flow cyto etry of differentiated HUDEP-2 cells expressing SPOP Y87N mutant.
- Fig. 6B Immunoblots analysis with indicated antibodies for differentiated HUDEP-2 cells expressing empty vector or SPOP mutant.
- Fig. 6C Expression of g-globin mRNA was measured by RT-qPCR, data are plotted as percentage of g-globin over g- globin+P-globin gene levels. Mean is shown ⁇ SD of two biological replicates.
- Figures 7A-7C SPOP depletion strongly enhances the effect on g-globin induction by Pomalidomide treatment.
- Fig. 7A HbF flow cytometry of indicated HUDEP-2 sgRNAs cell pools treated with or without Pomalidomide.
- Fig. 7B HbF flow cytometry of indicated HUDEP-2 sgRNAs cell pools treated with or without Pomalidomide.
- g-globin mRNA was measured by RT-qPCR, data are plotted as percentage of g-globin over g-globin+P-globin gene levels. Mean is shown ⁇ SD of two independent experiments.
- Fig. 7C BCL11 A mRNA levels measured by RT- qPCR. GAPDH was used for normalization. Mean is shown ⁇ SD of two biological replicates.
- Figure 8A provides an example of an amino acid sequence (SEQ ID NO: 8) of human SPOP.
- Figure 8B provides an example of a nucleotide sequence (SEQ ID NO: 9) encoding human SPOP.
- Protein coding region is from position 472 to 1593 (excluding stop codon).
- Underlined sequences and bolded, italicized sequences are examples of target sequences for inhibitory nucleic acid molecules - shRNA and sgRNA, respectively.
- SPOP speckle-type BTB/POZ protein
- PubMed GenelD 8405; see, e.g., GenBank Accession Nos. NM_001007226.1 and NP 001007227.1
- PubMed GenelD 8405; see, e.g., GenBank Accession Nos. NM_001007226.1 and NP 001007227.1
- CUL3 ubiquitin ligase complex that mediates the ubiquitination of target proteins, in most cases, causing protein degradation
- SPOP binds to its substrates by its N-terminal meprin and traf homology (MATH) domain (e.g., amino acids 28-166) and interacts with culin3 via its C-terminal BTB domain (e.g., amino acids 190-297) (Zhuang et al. (2009) Mol. Cell., 36(l):39-50).
- MATH meprin and traf homology
- BTB for BR-C, ttk and bab
- POZ for Pox virus and Zinc finger
- SPOP has been identified as the most frequently mutated gene by exome sequencing in prostate cancer (Barbieri et al. (2012) Nat. Genet., 44(6):685-689). These SPOP mutations observed in human cancers are mainly enriched in its MATH domain which is responsible for substrate binding (Zhuang et al. (2009) Mol. Cell., 36(l):39-50; Barbieri et al. (2012) Nat. Genet., 44(6):685-689).
- substrates including androgen receptor (AR), DEK, TRIM24, SENP7 and BETs (An et al. (2014) Cell. Rep., 6(4):657-669; Theurillat et al. (2014) Science 346(6205):85-89; Zhu et al. (2015)
- SPOP in the suppression of fetal and, to a lesser extent, embryonic globin production has been shown herein. This role is exploited herein to treat hemoglobinopathies such as sickle cell anemia and thalassemia.
- SPOP binds its substrates for ubiquitination through its MATH domain.
- a small molecule designed to inhibit the SPOP-substrate protein interaction has been described (Li et al. (2014) Cancer Cell 25(4):455-468; Guo et al. (2016) Cancer Cell 30(3):474-484). This small molecule appears to mainly inhibit cytoplasmic SPOP- substrate interaction in clear-cell renal cell carcinoma (ccRCC) (Li et al.
- compositions and methods are provided for increasing hemoglobin production in a cell or subject.
- the method increases fetal hemoglobin and/or embryonic globin expression, particularly fetal hemoglobin.
- the method comprises administering at least one SPOP inhibitor to the cell, particularly an erythroid precursor cell or erythroid cell, or subject.
- the subject has a
- hemoglobinopathy such as sickle cell disease or thalassemia.
- the subject has sickle cell anemia.
- the subject has thalassemia, particularly b-thalassemia, and more particularly major b- thalassemia.
- the SPOP inhibitor may be administered in a composition further comprising at least one pharmaceutically acceptable carrier.
- the method further comprises any means by which to induce fetal hemoglobin, such as administering at least one other fetal hemoglobin inducer.
- Fetal hemoglobin inducers include, without limitation, a lysine-specific demethylase 1 (LSD1) inhibitor (e.g., RN-l and tranylcypromine (TCP) (Cui et al. (2015) Blood l26(3):386-96; Shi et al. (2013) Nat. Med., 19(3): 291-294; Sun et al. (2016) Reprod. Biol. Endocrinol., 14: 17)), pomalidomide (Moutouh-de Parseval et al. (2008) J. Clin. Invest.,
- H8(l):248-258) hydroxyurea
- 5-azacytidine sodium butyrate
- activators of the Foxo3 pathway e.g., metformin, phenformin, or resveratrol
- histone e.g., metformin, phenformin, or resveratrol
- HMT inhibitors e.g., a histone lysine methyltransferase inhibitor, Vietnamese histone-lysine N-methyltransferase 2 (EHMT2; G9a) inhibitor, Vietnameseromatic histone-lysine N-methyltransferase 1 (EHMT1; G9a-like protein (GLP)) inhibitor, UNC0638 (2-cyclohexyl-N-(l-isopropylpiperidin-4-yl)-6-methoxy-7-(3- (pyrrolidin-l-yl)propoxy) quinazolin-4-amine), chaetocin, BIX-01294, UNC 0224, UNC 0642, UNC 0631, UNC 0646, A-366 (S Stamm et al.
- the fetal hemoglobin inducer is pomalidomide or hydroxyurea, particularly pomalidomide.
- the SPOP inhibitor and the fetal hemoglobin inducer can be delivered to the cell or subject sequentially or consecutively (e.g., in different compositions) and/or at the same time (e.g., in the same composition).
- compositions and methods for inhibiting e.g., reducing or slowing), treating, and/or preventing a hemoglobinopathy or thalassemia in a subject are provided.
- the methods comprise administering to a subject in need thereof a therapeutically effective amount of at least one SPOP inhibitor.
- the SPOP inhibitor may be administered in a composition further comprising at least one
- hemoglobinopathy is b-thalassemia or sickle cell anemia.
- the subject has sickle cell anemia.
- the method further comprises administering at least one other fetal hemoglobin inducer to the subject as described hereinabove.
- the fetal hemoglobin inducer is pomalidomide or hydroxyurea, particularly pomalidomide.
- the SPOP inhibitor and the fetal hemoglobin inducer can be administered to the subject sequentially or consecutively (e.g., in different compositions) and/or at the same time (e.g., in the same composition).
- SPOP inhibitors are compounds which reduce SPOP activity, inhibit or reduce SPOP-substrate interaction, inhibit or reduce SPOP dimerization, and/or the expression of SPOP.
- Examples of the human amino acid and nucleotide sequence for SPOP are provided in Figure 8.
- the SPOP inhibitor is specific to SPOP.
- Examples of SPOP inhibitors include, without limitation, proteins (e.g., dominant-negative SPOP), polypeptides, peptides, antibodies, small molecules, and nucleic acid molecules.
- the SPOP inhibitor is a MATH domain inhibitor or BTB domain inhibitor.
- the SPOP inhibitor is a BTB domain inhibitor which inhibits interaction with CUL3.
- the SPOP inhibitor is an antibody immunologically specific for the MATH domain or BTB domain.
- the SPOP inhibitor is an inhibitory nucleic acid molecule, such as an antisense, siRNA, or shRNA molecule (or a nucleic acid molecule encoding the inhibitory nucleic acid molecule).
- the inhibitory nucleic acid molecule targets a sequence within the BTB domain.
- the SPOP inhibitor is a CRISPR based targeting of the SPOP gene (e.g., with a guide RNA targeting the SPOP gene).
- the SPOP inhibitor may be a synthetic or non-natural compound.
- the SPOP inhibitor is a small molecule.
- SPOP small molecule inhibitors include, without limitation,
- CRISPR Clustered, regularly interspaced, short palindromic repeat
- Cas9 e.g., from Streptococcus pyogenes
- CRISPR Clustered, regularly interspaced, short palindromic repeat
- Cas9 e.g., from Streptococcus pyogenes
- gene editing are well known in the art (see, e.g., Sander et al. (2014) Nature Biotech., 32:347-355; Jinek et al. (2012) Science, 337:816-821; Cong et al. (2013) Science 339:819-823; Ran et al. (2013) Nature Protocols 8:2281-2308; Mali et al. (2013) Science 339:823-826;
- the RNA-guided CRISPR/Cas9 system involves expressing Cas9 along with a guide RNA molecule (gRNA). When coexpressed, gRNAs bind and recruit Cas9 to a specific genomic target sequence where it mediates a double strand DNA (dsDNA) break.
- dsDNA double strand DNA
- the binding specificity of the CRISPR/Cas9 complex depends on two different elements. First, the binding complementarity between the targeted genomic DNA (genDNA) sequence and the complementary recognition sequence of the gRNA (e.g., -18-22 nucleotides, particularly about 20 nucleotides).
- PAM protospacer-adjacent motif
- PAMs of other Cas9 are also known (see, e.g., addgene.org/ cri spr/gui de/#pam-tabl e). Guidelines and computer-assisted methods for generating gRNAs are available (see, e.g, CRISPR Design Tool (crispr.mit.edu/); Hsu et al. (2013) Nat. Biotechnol. 31 :827-832; addgene.org/CRISPR; and CRISPR gRNA Design tool - DNA2.0 (dna20.com/eCommerce/startCas9)).
- the PAM sequence is 3’ of the DNA target sequence in the genomic sequence.
- the method comprises administering at least one Cas9 (e.g., the protein and/or a nucleic acid molecule encoding Cas9) and at least one gRNA (e.g., a nucleic acid molecule encoding the gRNA) to the cell or subject.
- the Cas9 is S. pyogenes Cas9.
- the targeted PAM is in the 5’UTR, promoter, or first intron.
- a second gRNA is provided which targets anywhere from the 5’UTR to the 3’UTR of the gene, particularly within the first intron.
- the nucleic acids of the instant invention may be administered consecutively (before or after) and/or at the same time (concurrently).
- the nucleic acid molecules may be administered in the same composition or in separate compositions.
- the nucleic acid molecules are delivered in a single vector (e.g., a viral vector).
- the nucleic acid molecules of the instant invention are delivered (e.g., via infection, transfection, electroporation, etc.) and expressed in cells via a vector (e.g., a plasmid), particularly a viral vector.
- a vector e.g., a plasmid
- the expression vectors of the instant invention may employ a strong promoter, a constitutive promoter, and/or a regulated promoter.
- the nucleic acid molecules are expressed transiently. Examples of promoters are well known in the art and include, but are not limited to, RNA polymerase II promoters, the T7 RNA
- RNA polymerase promoter examples include, without limitation, plasmids and viral vectors (e.g., adeno-associated viruses (AAVs), adenoviruses, retroviruses, and lentiviruses).
- AAVs adeno-associated viruses
- adenoviruses examples include, without limitation, adenoviruses, retroviruses, and lentiviruses.
- the guide RNA of the instant invention may comprise separate nucleic acid molecules.
- one RNA may specifically hybridize to a target sequence (crRNA) and another RNA (trans-activating crRNA (tracrRNA)) specifically hybridizes with the crRNA.
- the guide RNA is a single molecule (sgRNA) which comprises a sequence which specifically hybridizes with a target sequence (crRNA; complementary sequence) and a sequence recognized by Cas9 (e.g., a tracrRNA sequence; scaffold sequence).
- gRNA scaffold sequences are well known in the art (e.g., 5’- GUUUUAGAGC UAGAAAUAGC AAGUUAAAAU AAGGCUAGU C CGUUAUCAAC UUGAAAAAGU GGCACCGAGU CGGUGCUUUU; SEQ ID NO: 10).
- the term“specifically hybridizes” does not mean that the nucleic acid molecule needs to be 100% complementary to the target sequence.
- the sequence may be at least 80%, 85%, 90%, 95%, 97%, 99%, or 100% complementary to the target sequences (e.g., the complementary between the gRNA and the genomic DNA).
- the greater the complementarity reduces the likelihood of undesired cleavage events at other sites of the genome.
- the region of complementarity e.g., between a guide RNA and a target sequence
- the region of complementarity (e.g., between a guide RNA and a target sequence) is about 15 to about 25 nucleotides, about 15 to about 23 nucleotides, about 16 to about 23 nucleotides, about 17 to about 21 nucleotides, about 18 to about 22 nucleotides, or about 20 nucleotides.
- the guide RNA targets a sequence or comprises a sequence (inclusive of RNA version of DNA molecules) as set forth in the Example provided herein (see, e.g., the sequences provided in Table 1 (e.g., sgRNAl, sgRNA2, or sgRNA3)).
- the guide RNA targets a sequence or comprises a sequence (e.g., RNA version) which has at least 80%, 85%, 90%, 95%, 97%, 99%, or 100% homology or identity to a sequence set forth in the Example (e.g., Table 1 provided herein; (e.g., sgRNAl, sgRNA2, or sgRNA3 (SEQ ID NO: 1, 2, or 3))).
- the sequences may be extended or shortened by 1, 2, 3, 4, or 5 nucleotides at the end of the sequence opposite from the PAM (e.g., at the 5’ end). When the sequence is extended the added nucleotides should correspond to the genomic sequence.
- the methods of the instant invention can comprise isolating hematopoietic cells (e.g., erythroid precursor cells) or erythroid cells from a subject, delivering at least one SPOP inhibitor to the cells, and administering the treated cells to the subject.
- the isolated cells may also be treated with other reagents in vitro , such as at least one fetal hemoglobin inducer, prior to administration to the subject.
- at least one fetal hemoglobin inducer prior to administration to the subject.
- the cells are not fully mature, enucleated erythrocytes.
- the methods of the instant invention may further comprise monitoring the disease or disorder in the subject after administration of the composition(s) of the instant invention to monitor the efficacy of the method.
- the subject may be monitored for characteristics of low hemoglobin or a hemoglobinopathy.
- an inhibitory nucleic acid molecule e.g., an shRNA such as shRNA3 or shRNA5
- the inhibitory nucleic acid molecule may be administered directly or an expression vector may be used.
- an expression vector may be used.
- the inhibitory nucleic acid molecules are delivered (e.g., via infection, transfection, electroporation, etc.) and expressed in cells via a vector (e.g., a plasmid), particularly a viral vector.
- a vector e.g., a plasmid
- the expression vectors of the instant invention may employ a strong promoter, a constitutive promoter, and/or a regulated promoter.
- the inhibitory nucleic acid molecules are expressed transiently.
- the promoter is cell-type specific (e.g., erythroid cells).
- promoters are well known in the art and include, but are not limited to, RNA polymerase II promoters, the T7 RNA polymerase promoter, and RNA polymerase III promoters (e.g., U6 and Hl; see, e.g., Myslinski et al. (2001) Nucl. Acids Res., 29:2502-09).
- expression vectors for expressing the molecules of the invention include, without limitation, plasmids and viral vectors (e.g., adeno-associated viruses (AAVs), adenoviruses, retroviruses, and lentiviruses).
- AAVs adeno-associated viruses
- retroviruses retroviruses
- lentiviruses lentiviruses
- the SPOP inhibitory nucleic acid molecules target and/or encompass the target sequence of SEQ ID NO: 5, 6, or 7, particularly SEQ ID NO: 5 or 6.
- the SPOP inhibitory nucleic acid molecules e.g., siRNA or shRNA
- compositions of the instant invention are useful for increasing hemoglobin production and for treating hemoglobinopathies and thalassemias.
- a therapeutically effective amount of the composition may be administered to a subject in need thereof.
- the dosages, methods, and times of administration are readily determinable by persons skilled in the art, given the teachings provided herein.
- the components as described herein will generally be administered to a patient as a pharmaceutical preparation.
- the term“patient” or“subject” as used herein refers to human or animal subjects.
- the components of the instant invention may be employed therapeutically, under the guidance of a physician for the treatment of the indicated disease or disorder.
- the pharmaceutical preparation comprising the components of the invention may be conveniently formulated for administration with an acceptable medium (e.g., pharmaceutically acceptable carrier) such as water, buffered saline, ethanol, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol and the like), dimethyl sulfoxide (DMSO), oils, detergents, suspending agents or suitable mixtures thereof.
- an acceptable medium e.g., pharmaceutically acceptable carrier
- a pharmaceutically acceptable carrier such as water, buffered saline, ethanol, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol and the like), dimethyl sulfoxide (DMSO), oils, detergents, suspending agents or suitable mixtures thereof.
- concentration of the agents in the chosen medium may be varied and the medium may be chosen based on the desired route of administration of the pharmaceutical preparation. Except insofar as any conventional media or agent is incompatible with the agents to be administered, its use in the pharmaceutical preparation is contemplated
- compositions of the present invention can be administered by any suitable route, for example, by injection (e.g., for local (direct) or systemic administration), oral, pulmonary, topical, nasal or other modes of administration.
- the composition may be administered by any suitable means, including parenteral, intramuscular, intravenous, intraarterial, intraperitoneal, subcutaneous, topical, inhalatory, transdermal, intrapulmonary, intraareterial, intrarectal, intramuscular, and intranasal administration.
- the composition is administered directly to the blood stream (e.g., intravenously).
- the pharmaceutically acceptable carrier of the composition is selected from the group of diluents, preservatives, solubilizers, emulsifiers, adjuvants and/or carriers.
- the compositions can include diluents of various buffer content (e.g., Tris HC1, acetate, phosphate), pH and ionic strength; and additives such as detergents and solubilizing agents (e.g., polysorbate 80), anti oxidants (e.g., ascorbic acid, sodium metabi sulfite), preservatives (e.g., Thimersol, benzyl alcohol) and bulking substances (e.g., lactose, mannitol).
- buffer content e.g., Tris HC1, acetate, phosphate
- pH and ionic strength e.g., Tris HC1, acetate, phosphate
- additives e.g., polysorbate 80
- anti oxidants e.g.,
- compositions can also be incorporated into particulate preparations of polymeric compounds such as polyesters, polyamino acids, hydrogels, polylactide/glycolide copolymers, ethylenevinylacetate copolymers, polylactic acid, polyglycolic acid, etc., or into liposomes.
- polymeric compounds such as polyesters, polyamino acids, hydrogels, polylactide/glycolide copolymers, ethylenevinylacetate copolymers, polylactic acid, polyglycolic acid, etc., or into liposomes.
- Such compositions may influence the physical state, stability, rate of in vivo release, and rate of in vivo clearance of components of a pharmaceutical composition of the present invention. See, e.g., Remington: The Science and Practice of Pharmacy, 2lst edition, Philadelphia, PA. Lippincott Williams & Wilkins.
- the pharmaceutical composition of the present invention can be prepared, for example, in liquid form, or can be in dried powder form (e.g.
- “pharmaceutically acceptable carrier” includes any and all solvents, dispersion media and the like which may be appropriate for the desired route of administration of the pharmaceutical preparation, as exemplified in the preceding paragraph.
- the use of such media for pharmaceutically active substances is known in the art. Except insofar as any conventional media or agent is incompatible with the molecules to be administered, its use in the pharmaceutical preparation is
- compositions containing a compound of the present invention as the active ingredient in intimate admixture with a pharmaceutical carrier can be prepared according to conventional pharmaceutical compounding techniques.
- the carrier may take a wide variety of forms depending on the form of preparation desired for administration, e.g., intravenous. Injectable suspensions may be prepared, in which case appropriate liquid carriers, suspending agents and the like may be employed.
- Pharmaceutical preparations for injection are known in the art. If injection is selected as a method for administering the therapy, steps should be taken to ensure that sufficient amounts of the molecules reach their target cells to exert a biological effect.
- a pharmaceutical preparation of the invention may be formulated in dosage unit form for ease of administration and uniformity of dosage.
- Dosage unit form refers to a physically discrete unit of the pharmaceutical preparation appropriate for the patient undergoing treatment. Each dosage should contain a quantity of active ingredient calculated to produce the desired effect in association with the selected pharmaceutical carrier. Procedures for determining the appropriate dosage unit are well known to those skilled in the art. Dosage units may be proportionately increased or decreased based on the weight of the patient.
- Appropriate concentrations for alleviation of a particular pathological condition may be determined by dosage concentration curve calculations, as known in the art.
- the appropriate dosage unit for the administration of the molecules of the instant invention may be determined by evaluating the toxicity of the molecules in animal models.
- Various concentrations of pharmaceutical preparations may be administered to mice with transplanted human tumors, and the minimal and maximal dosages may be determined based on the results of significant reduction of tumor size and side effects as a result of the treatment.
- Appropriate dosage unit may also be determined by assessing the efficacy of the treatment in combination with other standard therapies.
- the pharmaceutical preparation comprising the molecules of the instant invention may be administered at appropriate intervals, for example, at least twice a day or more until the pathological symptoms are reduced or alleviated, after which the dosage may be reduced to a maintenance level.
- the appropriate interval in a particular case would normally depend on the condition of the patient.
- isolated is not meant to exclude artificial or synthetic mixtures with other compounds or materials, or the presence of impurities that do not interfere with the fundamental activity, and that may be present, for example, due to incomplete purification, or the addition of stabilizers.
- “Pharmaceutically acceptable” indicates approval by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans.
- A“carrier” refers to, for example, a diluent, adjuvant, preservative (e.g., Thimersol, benzyl alcohol), anti-oxidant (e.g., ascorbic acid, sodium metabisulfite), solubilizer (e.g., polysorbate 80), emulsifier, buffer (e.g., Tris HC1, acetate, phosphate), antimicrobial, bulking substance (e.g., lactose, mannitol), excipient, auxilliary agent or vehicle with which an active agent of the present invention is administered.
- Pharmaceutically acceptable carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin.
- Water or aqueous saline solutions and aqueous dextrose and glycerol solutions are preferably employed as carriers, particularly for injectable solutions.
- Suitable pharmaceutical carriers are described in Remington: The Science and Practice of Pharmacy, (Lippincott, Williams and Wilkins); Liberman, et ah, Eds., Pharmaceutical Dosage Forms, Marcel Decker, New York, N.Y.; and Rowe, et ak, Eds., Handbook of Pharmaceutical Excipients, Pharmaceutical Pr.
- treat refers to any type of treatment that imparts a benefit to a patient suffering from an injury, including improvement in the condition of the patient (e.g., in one or more symptoms), delay in the progression of the condition, etc.
- the term“prevent” refers to the prophylactic treatment of a subject who is at risk of developing a condition and/or sustaining an injury, resulting in a decrease in the probability that the subject will develop conditions associated with the hemoglobinopathy or thalassemia.
- A“therapeutically effective amount” of a compound or a pharmaceutical composition refers to an amount effective to prevent, inhibit, or treat a particular injury and/or the symptoms thereof.
- “therapeutically effective amount” may refer to an amount sufficient to modulate the pathology associated with a hemoglobinopathy or thalassemia.
- the term“subject” refers to an animal, particularly a mammal, particularly a human.
- A“vector” is a genetic element, such as a plasmid, cosmid, bacmid, phage, transposon, or virus, to which another genetic sequence or element (either DNA or RNA) may be attached so as to bring about the replication and/ or expression of the attached sequence or element.
- a vector may be either RNA or DNA and may be single or double stranded.
- a vector may comprise expression operons or elements such as, without limitation, transcriptional and translational control sequences, such as promoters, enhancers, translational start signals, polyadenylation signals, terminators, and the like, and which facilitate the expression of a polynucleotide or a polypeptide coding sequence in a host cell or organism.
- small molecule refers to a substance or compound that has a relatively low molecular weight (e.g., less than 4,000, less than 2,000, particularly less than 1 kDa or 800 Da).
- small molecules are organic, but are not proteins, polypeptides, amino acids, or nucleic acids.
- an“antibody” or“antibody molecule” is any immunoglobulin, including antibodies and fragments thereof, that binds to a specific antigen.
- antibody or antibody molecule contemplates intact immunoglobulin molecules, immunologically active portions/fragment (e.g., antigen binding portion/fragment) of an immunoglobulin molecule, and fusions of immunologically active portions of an immunoglobulin molecule.
- Antibody fragments include, without limitation, immunoglobulin fragments including, without limitation: single domain (Dab; e.g., single variable light or heavy chain domain), Fab, Fab', F(ab') 2 , and F(v); and fusions (e.g., via a linker) of these immunoglobulin fragments including, without limitation: scFv, SCFV 2 , SCFV-FC, minibody, diabody, triabody, and tetrabody.
- immunoglobulin fragments including, without limitation: single domain (Dab; e.g., single variable light or heavy chain domain), Fab, Fab', F(ab') 2 , and F(v); and fusions (e.g., via a linker) of these immunoglobulin fragments including, without limitation: scFv, SCFV 2 , SCFV-FC, minibody, diabody, triabody, and tetrabody.
- proteins/polypeptides particularly antibodies, that bind to one or more epitopes of a protein or compound of interest, but which do not substantially recognize and bind other molecules in a sample containing a mixed population of antigenic biological molecules.
- siRNA small, interfering RNA
- siRNA refers to a short (typically less than 30 nucleotides long, particularly 12-30 or 20-25 nucleotides in length) double stranded RNA molecule.
- the siRNA modulates the expression of a gene to which the siRNA is targeted.
- Methods of identifying and synthesizing siRNA molecules are known in the art (see, e.g., Ausubel et ak, Current Protocols in
- Short hairpin RNA molecules typically consist of short complementary sequences (e.g., an siRNA) separated by a small loop sequence (e.g., 6-15 nucleotides, particularly 7-10 nucleotides) wherein one of the sequences is complimentary to the gene target.
- shRNA molecules are typically processed into an siRNA within the cell by endonucleases.
- exemplary modifications to siRNA molecules are provided in U.S. Application Publication No. 20050032733.
- siRNA and shRNA molecules may be modified with nuclease resistant modifications (e.g.,
- Expression vectors for the expression of siRNA or shRNA molecules may employ a strong promoter which may be constitutive or regulated.
- Such promoters are well known in the art and include, but are not limited to, RNA polymerase II promoters, the T7 RNA polymerase promoter, and the RNA
- polymerase III promoters EG6 and Hl see, e.g., Myslinski et al. (2001) Nucl. Acids Res., 29:2502-09).
- Antisense nucleic acid molecules or“antisense oligonucleotides” include nucleic acid molecules (e.g., single stranded molecules) which are targeted
- antisense molecules are typically between about 15 and about 50 nucleotides in length, more particularly between about 15 and about 30 nucleotides, and often span the translational start site of mRNA molecules.
- Antisense constructs may also be generated which contain the entire sequence of the target nucleic acid molecule in reverse orientation.
- Antisense oligonucleotides targeted to any known nucleotide sequence can be prepared by oligonucleotide synthesis according to standard methods. Antisense oligonucleotides may be modified as described above to comprise nuclease resistant modifications.
- HbF fetal hemoglobin
- SCD sickle cell disease
- BTB domain containing proteins BTB domain containing proteins
- Hemoglobin is comprised of a tetramer containing two a-type and two b-type subunits.
- the b-type globin gene cluster consists of an embryonic (e-globin), two fetal (g-globin) and two adult type (d-globin and b-globin) genes. Mutations in the b- globin gene that underlie sickle cell disease (SCD) and some types of b-thalassemia become clinically relevant after birth when the fetal genes are silenced. Increased fetal hemoglobin (HbF) production due to natural genetic variation or therapeutic intervention can lower morbidity and mortality in b-hemoglobinopathies (Platt, et al., N. Engl. J. Med.
- BCL11 A and LRF are critical direct transcriptional repressors of the g-globin genes (Menzel, et al., Nat. Genet. (2007) 39: 1197-1199; ETda, et al., Proc. Natl. Acad. Sci. (2008) 105: 1620-1625; Sankaran, et al., Science (2008) 322: 1839- 1842; Masuda, et al., Science (2016) 351 :285-289).
- DNA binding proteins with functions in multiple tissues they remain difficult to target
- HUDEP-2 cells were screened using an improved protein-domain based CRISPR- Cas9 platform (Grevet, et al., Science (2016) 361 :285-290; Kurita, et al., PLoS One (2013) 8:e59890; Shi, et al., Nat. Biotechnol. (2015) 33 :661-667). These domains have conserved structure and are required to mediate protein-protein interactions. The conserved protein structure of these domains provides a potential surface for docking small molecule inhibitors.
- the screen selectively identified speckle-type POZ protein SPOP
- SPOP speckle-type POZ protein
- CUE3 ubiquitin ligase complex Choen, et al., Front. Oncol. (2016) 6: 113
- the repressive role of SPOP on g-globin levels is at least in part mediated by the CUL3 ubiquitin ligase complex, and disruption of SPOP-substrate interactions by overexpressing a SPOP dominant-negative mutant recapitulated the effect of SPOP depletion on g-globin expression.
- the activity of SPOP appears to be carried out independently of BCL11 A and LRF. SPOP depletion markedly amplified the effects of pomalidomide, a pharmacologic HbF inducer, indicating that SPOP perturbation is useful in combination with other treatment modalities.
- Biotechnol., 33 (6): 661-7) was employed to identify regulators of fetal globin expression.
- Cas9 possesses two nuclease domains, a RuvC-like nuclease domain and a HNH-like nuclease domain, and is responsible for the destruction of the target DNA (Jinek et al. (2012) Science, 337:816-821;
- the double-stranded endonuclease activity of Cas9 requires a target sequence (e.g., ⁇ 20 nucleotides, see above) and a short conserved sequence ( ⁇ 2-5 nucleotides; e.g., 3 nucleotides) known as protospacer-associated motif (PAM), which follows immediately 3'- of the CRISPR RNA (crRNA) complementary sequence (Jinek et al. (2012) Science, 337:816-821; Nishimasu et al. (2014) Cell l56(5):935-49; Swarts et al.
- a target sequence e.g., ⁇ 20 nucleotides, see above
- a short conserved sequence ⁇ 2-5 nucleotides; e.g., 3 nucleotides
- PAM protospacer-associated motif
- the double strand break can be repaired by non- homologous end joining (NHEJ) pathway yielding an insertion and/or deletion or, in the presence of a donor template, by homology-directed repair (HDR) pathway for replacement mutations (Overballe-Petersen et al. (2013) Proc. Natl. Acad. Sci. U.S.A. 110: 19860-19865; Gong et al. (2005) Nat. Struct. Mol. Biol. 12:304-312).
- NHEJ non- homologous end joining
- HDR homology-directed repair
- the RNA- guided CRISPR/Cas9 system involves expressing Cas9 along with a guide RNA molecule (gRNA).
- gRNAs When coexpressed, gRNAs bind and recruit Cas9 to a specific genomic target sequence where it mediates a double strand DNA (dsDNA) break and activates the dsDNA break repair machinery. Specific DNA fragments can be deleted when two gRNA/Cas9 complexes generate dsDNA breaks at relative proximity, and the genomic DNA is repaired by nonhomologous end joining.
- Protein domain-focused CRISPR-Cas9 screen identifies SPOP as a potential g-globin repressor
- sgRNAs targeting functional protein domains generates phenotype-altering mutations at a higher rate compared to sgRNAs designed to generate null alleles (Shi, et al., Nat. Biotechnol. (2015) 33:661-667).
- a library of sgRNAs targeting approximately 600 proteins was designed covering most of BTB domain and histone modification reader domain containing proteins (6 sgRNAs per domain). This library also included 6 sgRNAs for LRF as positive control, and 50 non-targeting sgRNAs as negative controls.
- This sgRNA library was cloned into the LRG 2.1T lentiviral vector and then introduced into HUDEP-2 cells (Kurita, et al., PLoS One (2013) 8:e59890) stably expressing Cas9 (Figure 1 A). Cells were stained using an anti-HbF antibody and sorted the top 10% and bottom 10% HbF expressing cells by FACS, and deep-sequenced the sgRNAs from each population ( Figure 1B). As expected, non-targeting sgRNAs were evenly distributed across the HbF high and low populations, and all six sgRNAs of LRF were enriched in the HbF high population ( Figure 1C).
- SPOP is one of the substrate adaptors of the CUL3 ubiquitin ligase complex that mediates ubiquitination of target proteins and, in most cases, causes protein degradation (Chen, et al., Front. Oncol. (2016) 6: 113; Pintard, et al., EMBO J. (2004) 23: 1681-1687).
- SPOP binds to its substrates by its N-terminal meprin and traf homology (MATH) domain and interacts with CEIL3 via its C-terminal BTB domain (Zhuang, et al., Mol. Cell (2009) 36:39-50) (Figure 2A).
- SPOP is widely expressed across human tissues (GTEx).
- SPOP is highly enriched in erythroid cells (Bloodspot) and its mRNA expression levels are comparable between fetal and adult erythroblasts (Lessard, et al., Hum. Mol. Genet. (2016) 27: 1411-1420; Huang, et al., Genes Dev. (2017) 31 : 1704-1713). Depletion of SPOP elevates g-globin levels in HUDEP-2 cells
- SPOP sgRNA 1 CCTCTGCAGTAACCTGTCCG (SEQ ID NO: 1)
- SPOP sgRNA2 GAGGACTGTGGGAGAATTCC (SEQ ID NO: 2)
- SPOP sgRNA3 TGATGTGCTTCATTTACACG (SEQ ID NO: 3)
- Neg2 sgRNA GACCGGAACGATCTCGCGTA (SEQ ID NO: 4)
- RNA-seq was performed using HUDEP-2 pools independently derived from 3 SPOP sgRNAs and it was found that global gene expression patterns were highly similar between control and SPOP depleted cells (Pearson correlation coefficient above 0.95).
- g-globin genes appeared to be the most strongly and significantly increased in differentiated cells (Figure 3 A).
- a-globin, b-globin, GATA-l, ALAS2 and BAND3 genes were comparable ( Figure 3 A).
- BCL11 A mRNA levels were unchanged ( Figure 3 A).
- SPOP loss might lead to increased protein levels of its substrates.
- Mass spectrometry experiments were performed to measure protein abundances both in whole cells lysates and nuclear extracts from SPOP depleted cell pools. Among approximately 3000 quantified proteins from whole cell lysates and nuclear extracts, g-globin was one of the most elevated proteins. However, a-globin and b-globin abundance changed little or not at all upon SPOP depletion, consistent with the RNA-Seq results ( Figure 3). Globally, SPOP loss induced g-globin expression accompanied by relatively few changes in transcriptome and proteome.
- RNA-seq analysis of SPOP depleted cells showed that 1) global gene expression patterns were highly correlated between control and SPOP depleted cells, 2) g-globin transcripts were the most elevated with no significant changes of a-globin and b-globin mRNAs, 3) GATA-l, ALAS2 and BAND3 genes were mostly unchanged, and 4) BCL11 A and LRF transcript levels were comparable (Figure 4F). These results were further validated by RT-qPCR. Importantly, SPOP depletion did not impair erythroid maturation, as indicated by the similar transcript levels of the differentiation makers, cell surface makers CD71 and CD235a, and cell morphology.
- SPOP shRNA3 CAAGGTAGTGAAATTCTCCTA (SEQ ID NO: 5)
- SPOP shRNA5 C AGAT GAGTT AGGAGGACTGT (SEQ ID NO: 6)
- CUL3 is the core component of the SPOP-CUL3 E3 ligase complex (Chen, et al., Front. Oncol. (2016) 6: 113), it was determined whether CUL3 is involved in the repression of HbF. Indeed, depletion of CUL3 with sgRNAs targeting its Cullin domain elevated g-globin levels without affecting a- and b-globin levels, and had no significant effects on GATA1, BCL11 A and LRF expression (Figure 5A).
- BCL11 A is decreased at the protein but not the mRNA level both in HUDEP-2 cells and primary erythroid CD34+ cells ( Figure 2C and Figure 4C), possibly explaining some of the effects on g-globin regulation.
- rescue experiments were performed by re-introducing either BCL11 A cDNA or mouse Spop cDNA, which contains 2 mismatched nucleotides upstream of the “PAM” sequence of SPOP gRNA#l into SPOP depleted cells ( Figure 5C).
- SPOP- CUL3 Given its role as E3 ligase that targets proteins to the proteasome, SPOP- CUL3 likely represses the transcription of the g-globin genes by promoting the ubiquitylation and degradation of proteins that might function as transcriptional activators of g-globin.
- a SPOP mutant in which Tyr 87 is replaced by Asn (Y87N) in the MATH domain was expressed.
- the Y87N mutation disrupts SPOP- substrate interactions in a dominant-negative manner (Zhuang, et ah, Mol. Cell (2009) 36:39-50).
- SPOP a substrate adaptor of the CUL3 ubiquitin E3 ligase complex
- HbF a novel regulator of HbF expression. Reduction in SPOP levels increases HbF production in HUDEP-2 and primary human cell cultures without substantial disruption of the cellular transcriptome and proteome. Mechanistically, it is demonstrated that the repressive role of SPOP on g-globin is dependent on the CUE3 ubiquitin ligase complex.
- ectopic expression of a dominant-negative form of SPOP (Y87N) unable to bind to its substrates substantially induce HbF production.
- Y87N dominant-negative form of SPOP
- CEIL3 interacts with BTB/POZ domain proteins such as SPOP.
- BTB/POZ domain proteins such as SPOP.
- SPOP is the only one involved in HbF repression, reflecting a selective function of SPOP, and consistent with general target selectivity of CEIL3 E3 ligases via different BTB-domain containing substrate adaptors.
- SPOP(Y87N) expression induces g-globin to levels similar to those observed upon SPOP depletion, but, in contrast to the latter condition, BCL11 A levels remained unchanged.
- a means to increase the therapeutic index is to combine therapies that impact different cellular pathways.
- SPOP depletion had no effect on BCL11 A mRNA levels, but pomalidomide is known to lower production of BCL11 mRNA.
- the co- operativity of SPOP and pomalidomide during HbF induction was tested.
- the combination of SPOP depletion and pomalidomide treatment induced HbF production to levels much higher compared to either treatment alone. This indicates that SPOP inhibition can be combined with other treatments to augment effect size and lower adverse effects through dose reduction.
- the BTB domain is a highly druggable structure (Kerres, et al., Cell. Rep. (2017) 20:2860-2875). Small molecules designed to inhibit the SPOP-substrate protein interactions have been reported (Guo, et al., Cancer Cell 30:474-484). This indicates that SPOP-substrate protein interactions is a therapeutic target for small molecule inhibitors. Importantly, strong HbF induction achieved through disrupting SPOP-substrate interactions by overexpressing SPOP(Y87N) mutant further supports this position. In summary, SPOP functions as a novel regulator of HbF and offers a therapeutic target for monotherapy or combination therapies for g- hemoglobinopathies.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Life Sciences & Earth Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Methods and compositions for producing fetal hemoglobin and treating a hemoglobinopathy or thalassemia are disclosed.
Description
COMPOSITIONS AND METHODS FOR HEMOGLOBIN PRODUCTION
By Gerd Blobel
Jeremy Grevet
Junwei Shi
Xianjiang Lan
This application claims priority under 35 U.S.C. §119(e) to U.S. Provisional Patent Application No. 62/642,174, filed March 13, 2018. The foregoing application is incorporated by reference herein.
This invention was made with government support under Grant Nos.
R37DK058044, R01DK054937, and R01HL119479 awarded by National Institutes of Health. The government has certain rights in the invention.
FIELD OF THE INVENTION
The present invention relates to the field of hematology. More specifically, the invention provides compositions and methods for the production of various forms of hemoglobin, including adult and fetal type hemoglobin.
BACKGROUND OF THE INVENTION
Several publications and patent documents are cited throughout the specification in order to describe the state of the art to which this invention pertains. Each of these citations is incorporated herein by reference as though set forth in full.
Sickle cell disease and thalassemia cause significant worldwide morbidity and mortality (Modell et al. (2008) Bull. World Health Org., 86:480-487; Modell et al. (2008) J. Cardiovasc. Magn. Reson., 10:42). However, effective drugs do not exist for these illnesses. One goal in the treatment of these diseases is to reactivate fetal hemoglobin (HbF). HbF reduces the propensity of sickle cell disease red blood cells to undergo sickling. Indeed, high fetal globin levels are associated with improved outcomes for sickle cell anemia patients (Platt et al. (1994) N. Engl. J. Med., 330:783- 784). Elevating HbF also reduces the globin chain imbalance in certain thalassemias, thereby improving symptoms. There is an enormous unmet need to identify compounds that ameliorate the course of these diseases.
SUMMARY OF THE INVENTION
In accordance with the present invention, compositions and methods are provided for increasing hemoglobin levels (e.g., fetal hemoglobin) in a cell or subject. In a particular embodiment, the method comprises administering at least one speckle- type BTB/POZ protein (SPOP; speckle-type POZ protein) inhibitor to the cell or subject. In a particular embodiment, the subject has a hemoglobinopathy such as sickle cell disease or thalassemia. In a particular embodiment, the cell is an erythroid cell. In a particular embodiment, the SPOP inhibitor is a small molecule. The SPOP inhibitor may be, for example, a MATH domain inhibitor or a BTB domain inhibitor. The SPOP inhibitor may be a CRISPR based or siRNA/shRNA inhibitor of the SPOP gene. The method may further comprise delivering at least one fetal hemoglobin inducer to the cell or subject. The method may exploit additive or synergistic effects with other fetal hemoglobin inducing methods based on pharmacologic compounds and/or various forms of gene therapy.
In accordance with another aspect of the instant invention, methods of inhibiting, treating, and/or preventing a hemoglobinopathy (e.g., sickle cell disease or thalassemia) in a subject are provided. In a particular embodiment, the method comprises administering at least one SPOP inhibitor to a subject in need thereof. The SPOP inhibitor may be in a composition with a pharmaceutically acceptable carrier.
In a particular embodiment, the subject has a b-chain hemoglobinopathy. In a particular embodiment, the subject has sickle cell anemia. In a particular
embodiment, the SPOP inhibitor is a small molecule. The SPOP inhibitor may be, for example, a MATH domain inhibitor or a BTB domain inhibitor. The SPOP inhibitor may be a CRISPR based or siRNA/shRNA based inhibitor of the SPOP gene. The method may further comprise delivering at least one other fetal hemoglobin inducer to the subject.
BRIEF DESCRIPTIONS OF THE DRAWINGS
Figures 1A-1C: Protein-domain based CRISPR-Cas9 screen identifies SPOP as a novel fetal globin repressor. Fig. 1 A: Screening strategy. Cas9 expressing HUDEP-2 cells were transduced with a BTB domain and histone modification reader domain-targeting sgRNA library (6 sgRNA/domain). Edited HUDEP-2 cells were then induced to differentiate for 7 days. Differentiated cells were stained by APC conjugated anti-HbF and sorted with HbF high and HbF low by flow cytometry.
Enriched sgRNAs were identified by deep sequencing. Fig. 1B: HbF FACS gating strategy for HbF high and HbF low cell populations. Fig. 1C: Scatter plot of HbF high (y-axis) and HbF low (x-axis) populations as log2 transformed normalized read counts, each dot represents a sgRNA.
Figures 2A-2D: SPOP depletion elevates g-globin protein and mRNA levels in HDUEP-2 cells. Fig. 2A: SPOP protein domain structure and position of three SPOP sgRNAs within the BTB domain. Fig. 2B: HbF flow cytometry of differentiated cells transduced with indicated sgRNAs. Mean is shown ± standard deviation (SD) (N=2). Fig. 2C: Immunoblots analysis with indicated antibodies using whole cell lysates from cell pools transduced with sgRNAs. Fig. 2D: Expression of g-globin mRNA was measured by RT-qPCR, data are plotted as percentage of g-globin over g-gl obin+b- globin gene levels. Mean is shown ± SD of at least two biological replicates. *** denotes />-value < 0.001.
Figures 3A-3B: SPOP depletion specifically and strongly induces g-globin in HUDEP-2 cells. Fig. 3A: RNA-seq analysis of cell pools with SPOP sgRNA# 1, #2 and #3. Each dot represents an individual gene. Each gene is depicted according to FPKM (Fragments Per Kilobase Million) value. Fig. 3B: Scatter plots showing the results of mass spectrometry analysis of cell pools with SPOP sgRNA# 1, #2 and #3 using whole cell lysates. Data represent log2 protein abundances. Protein abundances were quantified by TMT (Tandem mass tag)-labeled MS. Each dot represents a gene.
Figures 4A-4F: SPOP depletion elevates g-globin in primary erythroid CD34+ cells. Fig. 4A: Schematic diagram of experimental design. Fig. 4B: Representative HbF flow cytometry of CD34+ erythroid cells at Day 14 of differentiation. Fig. 4C: Immunoblots analysis with indicated antibodies for differentiated CD34+ cells infected with scrambled or SPOP shRNAs virus. Fig. 4D: HPLC analysis for cells expressing indicated shRNAs at Day 15-16 of differentiation, HbF indicates fetal hemoglobin; HbA indicates adult hemoglobin. Arrow indicates HbF. Fig. 4E:
Expression of g-globin mRNA was measured by RT-qPCR, data are plotted as percentage of g-globin over y-globin+P-globin gene levels. Mean is shown ± SD of three independent donors. * denotes /i- value < 0.01. Fig. 4F: RNA-seq analysis for CD34+ cells at Day 14 of differentiation. R value denotes Pearson correlation coefficient. Log2FPKM values were averaged from two independent donors.
Figures 5A-5D: SPOP-CEIL3 complex represses g-globin independent of BCL11 A. Fig. 5A: Immunoblots analysis with indicated antibodies for differentiated
HUDEP-2 cells expressing CUL3 sgRNAs. Fig. 5B: Expression of g-globin mRNA was measured by RT-qPCR, data are plotted as percentage of g-globin over g- globin+P-globin gene levels. Mean is shown ± SD of two biological replicates. Fig. 5C: Alignment of human (SEQ ID NO: 11) and mouse (SEQ ID NO: 12) SPOP DNA sequence. Shaded marks SPOP sgRNA#l sequence. Two mismatched nucleotides upstream of“PAM” in mouse Spop cDNA. Fig. 5D: Expression of g-globin mRNA was measured by RT-qPCR, data are plotted as percentage of g-globin over g- globin+P-globin gene levels. Mean is shown ± SD of two biological replicates.
Overexpression levels of BCL11 A and mSpop cDNAs were controlled by sorting GFP low cell population.
Figures 6A-6C: Overexpression of SPOP mutant elevates g-globin. Fig. 6A: HbF flow cyto etry of differentiated HUDEP-2 cells expressing SPOP Y87N mutant. Fig. 6B: Immunoblots analysis with indicated antibodies for differentiated HUDEP-2 cells expressing empty vector or SPOP mutant. Fig. 6C: Expression of g-globin mRNA was measured by RT-qPCR, data are plotted as percentage of g-globin over g- globin+P-globin gene levels. Mean is shown ± SD of two biological replicates.
Figures 7A-7C: SPOP depletion strongly enhances the effect on g-globin induction by Pomalidomide treatment. Fig. 7A: HbF flow cytometry of indicated HUDEP-2 sgRNAs cell pools treated with or without Pomalidomide. Fig. 7B:
Expression of g-globin mRNA was measured by RT-qPCR, data are plotted as percentage of g-globin over g-globin+P-globin gene levels. Mean is shown ± SD of two independent experiments. Fig. 7C: BCL11 A mRNA levels measured by RT- qPCR. GAPDH was used for normalization. Mean is shown ± SD of two biological replicates.
Figure 8A provides an example of an amino acid sequence (SEQ ID NO: 8) of human SPOP. Figure 8B provides an example of a nucleotide sequence (SEQ ID NO: 9) encoding human SPOP. Protein coding region is from position 472 to 1593 (excluding stop codon). Underlined sequences and bolded, italicized sequences are examples of target sequences for inhibitory nucleic acid molecules - shRNA and sgRNA, respectively.
DETAILED DESCRIPTION OF THE INVENTION
A major goal in the treatment of sickle cell disease and thalassemia is the reactivation of fetal type globin expression in cells of the adult red blood lineage. In
an unbiased genetic screen, speckle-type BTB/POZ protein (SPOP; speckle-type POZ protein) was identified as a strong regulator of fetal globin production. SPOP (see, e.g., PubMed GenelD: 8405; see, e.g., GenBank Accession Nos. NM_001007226.1 and NP 001007227.1) is a substrate adaptor of the CUL3 ubiquitin ligase complex that mediates the ubiquitination of target proteins, in most cases, causing protein degradation (Pintard et al. (2004) EMBO J., 23(8): 1681-1687; Chen et al. (2016). Front. Oncol., 6: 113). SPOP binds to its substrates by its N-terminal meprin and traf homology (MATH) domain (e.g., amino acids 28-166) and interacts with culin3 via its C-terminal BTB domain (e.g., amino acids 190-297) (Zhuang et al. (2009) Mol. Cell., 36(l):39-50). The BTB (for BR-C, ttk and bab) or POZ (for Pox virus and Zinc finger) domain is a common structural domain contained within some proteins.
SPOP has been identified as the most frequently mutated gene by exome sequencing in prostate cancer (Barbieri et al. (2012) Nat. Genet., 44(6):685-689). These SPOP mutations observed in human cancers are mainly enriched in its MATH domain which is responsible for substrate binding (Zhuang et al. (2009) Mol. Cell., 36(l):39-50; Barbieri et al. (2012) Nat. Genet., 44(6):685-689). In the context of prostate cancer, a number of substrates have been identified including androgen receptor (AR), DEK, TRIM24, SENP7 and BETs (An et al. (2014) Cell. Rep., 6(4):657-669; Theurillat et al. (2014) Science 346(6205):85-89; Zhu et al. (2015)
Cell. Rep., 13(6): 1183-1193; Groner et al. (2016) Cancer Cell., 29(6):846-858; Dai et al. (2017) Nat. Med., 23(9): 1063-1071; Janouskova et al. (2017) Nat. Med.,
23(9): 1046-1054; Zhuang et al. (2009) Mol. Cell., 36(l):39-50). However, it is shown herein that the depletion of SPOP raises fetal hemoglobin levels. Indeed, the genetic screen described herein for HbF inducers in human cells indicates that the loss of SPOP function increases HbF levels. Additional experiments show that the loss of SPOP increases fetal hemoglobin production in human erythroid cells, including primary cells. Without being bound by theory, the mechanism by which this occurs likely involves in the regulation of the protein stability of specific substrates which modulate the transcriptional and/or posttranscriptional upregulation of fetal hemoglobin production. Thus, the role of SPOP in the suppression of fetal and, to a lesser extent, embryonic globin production has been shown herein. This role is exploited herein to treat hemoglobinopathies such as sickle cell anemia and thalassemia.
SPOP binds its substrates for ubiquitination through its MATH domain. A small molecule designed to inhibit the SPOP-substrate protein interaction has been described (Li et al. (2014) Cancer Cell 25(4):455-468; Guo et al. (2016) Cancer Cell 30(3):474-484). This small molecule appears to mainly inhibit cytoplasmic SPOP- substrate interaction in clear-cell renal cell carcinoma (ccRCC) (Li et al. (2014) Cancer Cell 25(4):455-468; Guo et al. (2016) Cancer Cell 30(3):474-484). This finding indicates that the SPOP-substrate protein interaction is a target for small molecule design. Although SPOP KO mice is embryonic lethal (Claiborn et al.
(2010) J. Clin. Invest., 120(10):3713-3721), proper control of the dosage and tissue- specific delivery of the SPOP inhibitor can ameliorate or avoid potential detrimental side effects.
In accordance with the instant invention, compositions and methods are provided for increasing hemoglobin production in a cell or subject. In a particular embodiment, the method increases fetal hemoglobin and/or embryonic globin expression, particularly fetal hemoglobin. The method comprises administering at least one SPOP inhibitor to the cell, particularly an erythroid precursor cell or erythroid cell, or subject. In a particular embodiment, the subject has a
hemoglobinopathy such as sickle cell disease or thalassemia. In a particular embodiment, the subject has sickle cell anemia. In a particular embodiment, the subject has thalassemia, particularly b-thalassemia, and more particularly major b- thalassemia.
The SPOP inhibitor may be administered in a composition further comprising at least one pharmaceutically acceptable carrier. In a particular embodiment, the method further comprises any means by which to induce fetal hemoglobin, such as administering at least one other fetal hemoglobin inducer. Fetal hemoglobin inducers include, without limitation, a lysine-specific demethylase 1 (LSD1) inhibitor (e.g., RN-l and tranylcypromine (TCP) (Cui et al. (2015) Blood l26(3):386-96; Shi et al. (2013) Nat. Med., 19(3): 291-294; Sun et al. (2016) Reprod. Biol. Endocrinol., 14: 17)), pomalidomide (Moutouh-de Parseval et al. (2008) J. Clin. Invest.,
H8(l):248-258), hydroxyurea, 5-azacytidine, sodium butyrate, activators of the Foxo3 pathway (e.g., metformin, phenformin, or resveratrol), histone
methyltransferase (HMT) inhibitors (e.g., a histone lysine methyltransferase inhibitor, euchromatic histone-lysine N-methyltransferase 2 (EHMT2; G9a) inhibitor, euchromatic histone-lysine N-methyltransferase 1 (EHMT1; G9a-like protein (GLP))
inhibitor, UNC0638 (2-cyclohexyl-N-(l-isopropylpiperidin-4-yl)-6-methoxy-7-(3- (pyrrolidin-l-yl)propoxy) quinazolin-4-amine), chaetocin, BIX-01294, UNC 0224, UNC 0642, UNC 0631, UNC 0646, A-366 (Sweis et al. (2014) ACS Med. Chem. Lett., 5(2):205-209), etc.), histone deacetylase (HDAC) inhibitors, and eIF2aKl inhibitors (see, e.g., PCT/US18/15918). In a particular embodiment, the fetal hemoglobin inducer is pomalidomide or hydroxyurea, particularly pomalidomide.
The SPOP inhibitor and the fetal hemoglobin inducer can be delivered to the cell or subject sequentially or consecutively (e.g., in different compositions) and/or at the same time (e.g., in the same composition).
In accordance with another aspect of the instant invention, compositions and methods for inhibiting (e.g., reducing or slowing), treating, and/or preventing a hemoglobinopathy or thalassemia in a subject are provided. In a particular embodiment, the methods comprise administering to a subject in need thereof a therapeutically effective amount of at least one SPOP inhibitor. The SPOP inhibitor may be administered in a composition further comprising at least one
pharmaceutically acceptable carrier. In a particular embodiment, the
hemoglobinopathy is b-thalassemia or sickle cell anemia. In a particular embodiment, the subject has sickle cell anemia. In a particular embodiment, the method further comprises administering at least one other fetal hemoglobin inducer to the subject as described hereinabove. In a particular embodiment, the fetal hemoglobin inducer is pomalidomide or hydroxyurea, particularly pomalidomide. The SPOP inhibitor and the fetal hemoglobin inducer can be administered to the subject sequentially or consecutively (e.g., in different compositions) and/or at the same time (e.g., in the same composition).
SPOP inhibitors are compounds which reduce SPOP activity, inhibit or reduce SPOP-substrate interaction, inhibit or reduce SPOP dimerization, and/or the expression of SPOP. Examples of the human amino acid and nucleotide sequence for SPOP are provided in Figure 8. In a particular embodiment, the SPOP inhibitor is specific to SPOP. Examples of SPOP inhibitors include, without limitation, proteins (e.g., dominant-negative SPOP), polypeptides, peptides, antibodies, small molecules, and nucleic acid molecules. In a particular embodiment, the SPOP inhibitor is a MATH domain inhibitor or BTB domain inhibitor. In a particular embodiment, the SPOP inhibitor is a BTB domain inhibitor which inhibits interaction with CUL3. In a particular embodiment, the SPOP inhibitor is an antibody immunologically specific
for the MATH domain or BTB domain. In another embodiment, the SPOP inhibitor is an inhibitory nucleic acid molecule, such as an antisense, siRNA, or shRNA molecule (or a nucleic acid molecule encoding the inhibitory nucleic acid molecule). In a particular embodiment, the inhibitory nucleic acid molecule targets a sequence within the BTB domain. In a particular embodiment, the SPOP inhibitor is a CRISPR based targeting of the SPOP gene (e.g., with a guide RNA targeting the SPOP gene). The SPOP inhibitor may be a synthetic or non-natural compound.
In a particular embodiment, the SPOP inhibitor is a small molecule. Examples of SPOP small molecule inhibitors include, without limitation,
(2016) Cancer Cell 30(3):474-484) (see, also, Zheng et al. (2017) Sci. China Life Sci., 60:91-93). These compounds have been shown to inhibit SPOP-PTEN and SPOP- DUSP7 protein interaction in kidney cancer (Guo et al. (2016) Cancer Cell 30(3):474- 484).
Clustered, regularly interspaced, short palindromic repeat (CRISPR)/Cas9 (e.g., from Streptococcus pyogenes) technology and gene editing are well known in the art (see, e.g., Sander et al. (2014) Nature Biotech., 32:347-355; Jinek et al. (2012) Science, 337:816-821; Cong et al. (2013) Science 339:819-823; Ran et al. (2013) Nature Protocols 8:2281-2308; Mali et al. (2013) Science 339:823-826;
addgene.org/crispr/guide/). The RNA-guided CRISPR/Cas9 system involves expressing Cas9 along with a guide RNA molecule (gRNA). When coexpressed, gRNAs bind and recruit Cas9 to a specific genomic target sequence where it mediates a double strand DNA (dsDNA) break. The binding specificity of the CRISPR/Cas9 complex depends on two different elements. First, the binding complementarity between the targeted genomic DNA (genDNA) sequence and the complementary recognition sequence of the gRNA (e.g., -18-22 nucleotides, particularly about 20 nucleotides). Second, the presence of a protospacer-adjacent motif (PAM) juxtaposed to the genDNA/gRNA complementary region (Jinek et al. (2012) Science 337:816- 821; Hsu et al. (2013) Nat. Biotech., 31 :827-832; Sternberg et al. (2014) Nature 507:62-67). The PAM motif for S. Pyogenes Cas9 has been fully characterized, and
is NGG or NAG (Jinek et al. (2012) Science 337:816-821; Hsu et al. (2013) Nat. Biotech., 31 :827-832). Other PAMs of other Cas9 are also known (see, e.g., addgene.org/ cri spr/gui de/#pam-tabl e). Guidelines and computer-assisted methods for generating gRNAs are available (see, e.g, CRISPR Design Tool (crispr.mit.edu/); Hsu et al. (2013) Nat. Biotechnol. 31 :827-832; addgene.org/CRISPR; and CRISPR gRNA Design tool - DNA2.0 (dna20.com/eCommerce/startCas9)). Typically, the PAM sequence is 3’ of the DNA target sequence in the genomic sequence.
In a particular embodiment, the method comprises administering at least one Cas9 (e.g., the protein and/or a nucleic acid molecule encoding Cas9) and at least one gRNA (e.g., a nucleic acid molecule encoding the gRNA) to the cell or subject. In a particular embodiment, the Cas9 is S. pyogenes Cas9. In a particular embodiment, the targeted PAM is in the 5’UTR, promoter, or first intron. When present, a second gRNA is provided which targets anywhere from the 5’UTR to the 3’UTR of the gene, particularly within the first intron. The nucleic acids of the instant invention may be administered consecutively (before or after) and/or at the same time (concurrently). The nucleic acid molecules may be administered in the same composition or in separate compositions. In a particular embodiment, the nucleic acid molecules are delivered in a single vector (e.g., a viral vector).
In a particular embodiment, the nucleic acid molecules of the instant invention are delivered (e.g., via infection, transfection, electroporation, etc.) and expressed in cells via a vector (e.g., a plasmid), particularly a viral vector. The expression vectors of the instant invention may employ a strong promoter, a constitutive promoter, and/or a regulated promoter. In a particular embodiment, the nucleic acid molecules are expressed transiently. Examples of promoters are well known in the art and include, but are not limited to, RNA polymerase II promoters, the T7 RNA
polymerase promoter, and RNA polymerase III promoters (e.g., U6 and Hl; see, e.g., Myslinski et al. (2001) Nucl. Acids Res., 29:2502-09). Examples of expression vectors for expressing the molecules of the invention include, without limitation, plasmids and viral vectors (e.g., adeno-associated viruses (AAVs), adenoviruses, retroviruses, and lentiviruses).
In a particular embodiment, the guide RNA of the instant invention may comprise separate nucleic acid molecules. For example, one RNA may specifically hybridize to a target sequence (crRNA) and another RNA (trans-activating crRNA (tracrRNA)) specifically hybridizes with the crRNA. In a particular embodiment, the
guide RNA is a single molecule (sgRNA) which comprises a sequence which specifically hybridizes with a target sequence (crRNA; complementary sequence) and a sequence recognized by Cas9 (e.g., a tracrRNA sequence; scaffold sequence).
Examples of gRNA scaffold sequences are well known in the art (e.g., 5’- GUUUUAGAGC UAGAAAUAGC AAGUUAAAAU AAGGCUAGU C CGUUAUCAAC UUGAAAAAGU GGCACCGAGU CGGUGCUUUU; SEQ ID NO: 10). As used herein, the term“specifically hybridizes” does not mean that the nucleic acid molecule needs to be 100% complementary to the target sequence.
Rather, the sequence may be at least 80%, 85%, 90%, 95%, 97%, 99%, or 100% complementary to the target sequences (e.g., the complementary between the gRNA and the genomic DNA). The greater the complementarity reduces the likelihood of undesired cleavage events at other sites of the genome. In a particular embodiment, the region of complementarity (e.g., between a guide RNA and a target sequence) is at least about 10, at least about 12, at least about 15, at least about 17, at least about 20, at least about 25, at least about 30, at least about 35, or more nucleotides. In a particular embodiment, the region of complementarity (e.g., between a guide RNA and a target sequence) is about 15 to about 25 nucleotides, about 15 to about 23 nucleotides, about 16 to about 23 nucleotides, about 17 to about 21 nucleotides, about 18 to about 22 nucleotides, or about 20 nucleotides. In a particular embodiment, the guide RNA targets a sequence or comprises a sequence (inclusive of RNA version of DNA molecules) as set forth in the Example provided herein (see, e.g., the sequences provided in Table 1 (e.g., sgRNAl, sgRNA2, or sgRNA3)). In a particular embodiment, the guide RNA targets a sequence or comprises a sequence (e.g., RNA version) which has at least 80%, 85%, 90%, 95%, 97%, 99%, or 100% homology or identity to a sequence set forth in the Example (e.g., Table 1 provided herein; (e.g., sgRNAl, sgRNA2, or sgRNA3 (SEQ ID NO: 1, 2, or 3))). The sequences may be extended or shortened by 1, 2, 3, 4, or 5 nucleotides at the end of the sequence opposite from the PAM (e.g., at the 5’ end). When the sequence is extended the added nucleotides should correspond to the genomic sequence.
The above methods also encompass ex vivo methods. For example, the methods of the instant invention can comprise isolating hematopoietic cells (e.g., erythroid precursor cells) or erythroid cells from a subject, delivering at least one SPOP inhibitor to the cells, and administering the treated cells to the subject. The isolated cells may also be treated with other reagents in vitro , such as at least one fetal
hemoglobin inducer, prior to administration to the subject. In a particular
embodiment, the cells are not fully mature, enucleated erythrocytes.
The methods of the instant invention may further comprise monitoring the disease or disorder in the subject after administration of the composition(s) of the instant invention to monitor the efficacy of the method. For example, the subject may be monitored for characteristics of low hemoglobin or a hemoglobinopathy.
When an inhibitory nucleic acid molecule (e.g., an shRNA such as shRNA3 or shRNA5) is delivered to a cell or subject, the inhibitory nucleic acid molecule may be administered directly or an expression vector may be used. In a particular
embodiment, the inhibitory nucleic acid molecules are delivered (e.g., via infection, transfection, electroporation, etc.) and expressed in cells via a vector (e.g., a plasmid), particularly a viral vector. The expression vectors of the instant invention may employ a strong promoter, a constitutive promoter, and/or a regulated promoter. In a particular embodiment, the inhibitory nucleic acid molecules are expressed transiently. In a particular embodiment, the promoter is cell-type specific (e.g., erythroid cells). Examples of promoters are well known in the art and include, but are not limited to, RNA polymerase II promoters, the T7 RNA polymerase promoter, and RNA polymerase III promoters (e.g., U6 and Hl; see, e.g., Myslinski et al. (2001) Nucl. Acids Res., 29:2502-09). Examples of expression vectors for expressing the molecules of the invention include, without limitation, plasmids and viral vectors (e.g., adeno-associated viruses (AAVs), adenoviruses, retroviruses, and lentiviruses). In a particular embodiment, the SPOP inhibitory nucleic acid molecules (e.g., siRNA or shRNA) target and/or encompass the target sequence of SEQ ID NO: 5, 6, or 7, particularly SEQ ID NO: 5 or 6. In a particular embodiment, the SPOP inhibitory nucleic acid molecules (e.g., siRNA or shRNA) target and/or comprise the target sequence which has at least 80%, 85%, 90%, 95%, 97%, 99%, or 100% homology or identity to SEQ ID NO: 5 or 6 (e.g., the RNA version).
As explained hereinabove, the compositions of the instant invention are useful for increasing hemoglobin production and for treating hemoglobinopathies and thalassemias. A therapeutically effective amount of the composition may be administered to a subject in need thereof. The dosages, methods, and times of administration are readily determinable by persons skilled in the art, given the teachings provided herein.
The components as described herein will generally be administered to a patient as a pharmaceutical preparation. The term“patient” or“subject” as used herein refers to human or animal subjects. The components of the instant invention may be employed therapeutically, under the guidance of a physician for the treatment of the indicated disease or disorder.
The pharmaceutical preparation comprising the components of the invention may be conveniently formulated for administration with an acceptable medium (e.g., pharmaceutically acceptable carrier) such as water, buffered saline, ethanol, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol and the like), dimethyl sulfoxide (DMSO), oils, detergents, suspending agents or suitable mixtures thereof. The concentration of the agents in the chosen medium may be varied and the medium may be chosen based on the desired route of administration of the pharmaceutical preparation. Except insofar as any conventional media or agent is incompatible with the agents to be administered, its use in the pharmaceutical preparation is contemplated.
The compositions of the present invention can be administered by any suitable route, for example, by injection (e.g., for local (direct) or systemic administration), oral, pulmonary, topical, nasal or other modes of administration. The composition may be administered by any suitable means, including parenteral, intramuscular, intravenous, intraarterial, intraperitoneal, subcutaneous, topical, inhalatory, transdermal, intrapulmonary, intraareterial, intrarectal, intramuscular, and intranasal administration. In a particular embodiment, the composition is administered directly to the blood stream (e.g., intravenously). In general, the pharmaceutically acceptable carrier of the composition is selected from the group of diluents, preservatives, solubilizers, emulsifiers, adjuvants and/or carriers. The compositions can include diluents of various buffer content (e.g., Tris HC1, acetate, phosphate), pH and ionic strength; and additives such as detergents and solubilizing agents (e.g., polysorbate 80), anti oxidants (e.g., ascorbic acid, sodium metabi sulfite), preservatives (e.g., Thimersol, benzyl alcohol) and bulking substances (e.g., lactose, mannitol). The compositions can also be incorporated into particulate preparations of polymeric compounds such as polyesters, polyamino acids, hydrogels, polylactide/glycolide copolymers, ethylenevinylacetate copolymers, polylactic acid, polyglycolic acid, etc., or into liposomes. Such compositions may influence the physical state, stability, rate of in vivo release, and rate of in vivo clearance of components of a pharmaceutical
composition of the present invention. See, e.g., Remington: The Science and Practice of Pharmacy, 2lst edition, Philadelphia, PA. Lippincott Williams & Wilkins. The pharmaceutical composition of the present invention can be prepared, for example, in liquid form, or can be in dried powder form (e.g., lyophilized for later reconstitution).
As used herein,“pharmaceutically acceptable carrier” includes any and all solvents, dispersion media and the like which may be appropriate for the desired route of administration of the pharmaceutical preparation, as exemplified in the preceding paragraph. The use of such media for pharmaceutically active substances is known in the art. Except insofar as any conventional media or agent is incompatible with the molecules to be administered, its use in the pharmaceutical preparation is
contemplated.
Pharmaceutical compositions containing a compound of the present invention as the active ingredient in intimate admixture with a pharmaceutical carrier can be prepared according to conventional pharmaceutical compounding techniques. The carrier may take a wide variety of forms depending on the form of preparation desired for administration, e.g., intravenous. Injectable suspensions may be prepared, in which case appropriate liquid carriers, suspending agents and the like may be employed. Pharmaceutical preparations for injection are known in the art. If injection is selected as a method for administering the therapy, steps should be taken to ensure that sufficient amounts of the molecules reach their target cells to exert a biological effect.
A pharmaceutical preparation of the invention may be formulated in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form, as used herein, refers to a physically discrete unit of the pharmaceutical preparation appropriate for the patient undergoing treatment. Each dosage should contain a quantity of active ingredient calculated to produce the desired effect in association with the selected pharmaceutical carrier. Procedures for determining the appropriate dosage unit are well known to those skilled in the art. Dosage units may be proportionately increased or decreased based on the weight of the patient.
Appropriate concentrations for alleviation of a particular pathological condition may be determined by dosage concentration curve calculations, as known in the art. The appropriate dosage unit for the administration of the molecules of the instant invention may be determined by evaluating the toxicity of the molecules in animal models. Various concentrations of pharmaceutical preparations may be administered
to mice with transplanted human tumors, and the minimal and maximal dosages may be determined based on the results of significant reduction of tumor size and side effects as a result of the treatment. Appropriate dosage unit may also be determined by assessing the efficacy of the treatment in combination with other standard therapies.
The pharmaceutical preparation comprising the molecules of the instant invention may be administered at appropriate intervals, for example, at least twice a day or more until the pathological symptoms are reduced or alleviated, after which the dosage may be reduced to a maintenance level. The appropriate interval in a particular case would normally depend on the condition of the patient.
Definitions
The singular forms“a,”“an,” and“the” include plural referents unless the context clearly dictates otherwise.
The terms“isolated” is not meant to exclude artificial or synthetic mixtures with other compounds or materials, or the presence of impurities that do not interfere with the fundamental activity, and that may be present, for example, due to incomplete purification, or the addition of stabilizers.
“Pharmaceutically acceptable” indicates approval by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans.
A“carrier” refers to, for example, a diluent, adjuvant, preservative (e.g., Thimersol, benzyl alcohol), anti-oxidant (e.g., ascorbic acid, sodium metabisulfite), solubilizer (e.g., polysorbate 80), emulsifier, buffer (e.g., Tris HC1, acetate, phosphate), antimicrobial, bulking substance (e.g., lactose, mannitol), excipient, auxilliary agent or vehicle with which an active agent of the present invention is administered. Pharmaceutically acceptable carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin. Water or aqueous saline solutions and aqueous dextrose and glycerol solutions are preferably employed as carriers, particularly for injectable solutions. Suitable pharmaceutical carriers are described in Remington: The Science and Practice of Pharmacy, (Lippincott, Williams and Wilkins); Liberman, et ah, Eds., Pharmaceutical
Dosage Forms, Marcel Decker, New York, N.Y.; and Rowe, et ak, Eds., Handbook of Pharmaceutical Excipients, Pharmaceutical Pr.
The term“treat” as used herein refers to any type of treatment that imparts a benefit to a patient suffering from an injury, including improvement in the condition of the patient (e.g., in one or more symptoms), delay in the progression of the condition, etc.
As used herein, the term“prevent” refers to the prophylactic treatment of a subject who is at risk of developing a condition and/or sustaining an injury, resulting in a decrease in the probability that the subject will develop conditions associated with the hemoglobinopathy or thalassemia.
A“therapeutically effective amount" of a compound or a pharmaceutical composition refers to an amount effective to prevent, inhibit, or treat a particular injury and/or the symptoms thereof. For example,“therapeutically effective amount” may refer to an amount sufficient to modulate the pathology associated with a hemoglobinopathy or thalassemia.
As used herein, the term“subject” refers to an animal, particularly a mammal, particularly a human.
A“vector” is a genetic element, such as a plasmid, cosmid, bacmid, phage, transposon, or virus, to which another genetic sequence or element (either DNA or RNA) may be attached so as to bring about the replication and/ or expression of the attached sequence or element. A vector may be either RNA or DNA and may be single or double stranded. A vector may comprise expression operons or elements such as, without limitation, transcriptional and translational control sequences, such as promoters, enhancers, translational start signals, polyadenylation signals, terminators, and the like, and which facilitate the expression of a polynucleotide or a polypeptide coding sequence in a host cell or organism.
As used herein, the term“small molecule” refers to a substance or compound that has a relatively low molecular weight (e.g., less than 4,000, less than 2,000, particularly less than 1 kDa or 800 Da). Typically, small molecules are organic, but are not proteins, polypeptides, amino acids, or nucleic acids.
An“antibody” or“antibody molecule” is any immunoglobulin, including antibodies and fragments thereof, that binds to a specific antigen. As used herein, antibody or antibody molecule contemplates intact immunoglobulin molecules, immunologically active portions/fragment (e.g., antigen binding portion/fragment) of
an immunoglobulin molecule, and fusions of immunologically active portions of an immunoglobulin molecule. Antibody fragments include, without limitation, immunoglobulin fragments including, without limitation: single domain (Dab; e.g., single variable light or heavy chain domain), Fab, Fab', F(ab')2, and F(v); and fusions (e.g., via a linker) of these immunoglobulin fragments including, without limitation: scFv, SCFV2, SCFV-FC, minibody, diabody, triabody, and tetrabody.
As used herein, the term“immunologically specific” refers to
proteins/polypeptides, particularly antibodies, that bind to one or more epitopes of a protein or compound of interest, but which do not substantially recognize and bind other molecules in a sample containing a mixed population of antigenic biological molecules.
The phrase“small, interfering RNA (siRNA)” refers to a short (typically less than 30 nucleotides long, particularly 12-30 or 20-25 nucleotides in length) double stranded RNA molecule. Typically, the siRNA modulates the expression of a gene to which the siRNA is targeted. Methods of identifying and synthesizing siRNA molecules are known in the art (see, e.g., Ausubel et ak, Current Protocols in
Molecular Biology, John Wiley and Sons, Inc). Short hairpin RNA molecules (shRNA) typically consist of short complementary sequences (e.g., an siRNA) separated by a small loop sequence (e.g., 6-15 nucleotides, particularly 7-10 nucleotides) wherein one of the sequences is complimentary to the gene target.
shRNA molecules are typically processed into an siRNA within the cell by endonucleases. Exemplary modifications to siRNA molecules are provided in U.S. Application Publication No. 20050032733. For example, siRNA and shRNA molecules may be modified with nuclease resistant modifications (e.g.,
phosphorothioates, locked nucleic acids (LNA), 2'-0-methyl modifications, or morpholino linkages). Expression vectors for the expression of siRNA or shRNA molecules may employ a strong promoter which may be constitutive or regulated.
Such promoters are well known in the art and include, but are not limited to, RNA polymerase II promoters, the T7 RNA polymerase promoter, and the RNA
polymerase III promoters EG6 and Hl (see, e.g., Myslinski et al. (2001) Nucl. Acids Res., 29:2502-09).
“Antisense nucleic acid molecules” or“antisense oligonucleotides” include nucleic acid molecules (e.g., single stranded molecules) which are targeted
(complementary) to a chosen sequence (e.g., to translation initiation sites and/or splice
sites) to inhibit the expression of a protein of interest. Such antisense molecules are typically between about 15 and about 50 nucleotides in length, more particularly between about 15 and about 30 nucleotides, and often span the translational start site of mRNA molecules. Antisense constructs may also be generated which contain the entire sequence of the target nucleic acid molecule in reverse orientation. Antisense oligonucleotides targeted to any known nucleotide sequence can be prepared by oligonucleotide synthesis according to standard methods. Antisense oligonucleotides may be modified as described above to comprise nuclease resistant modifications.
The following example is provided to illustrate various embodiments of the present invention. It is not intended to limit the invention in any way.
EXAMPLE
Reactivation of fetal hemoglobin (HbF) production benefits patients with sickle cell disease (SCD) and b-thalassemia. In order to identify new regulators of HbF that might be amenable to pharmacologic control, a protein domain-focused CRISPR-Cas9 library targeting chromatin regulators, including BTB domain containing proteins, was screened. SPOP (Speckle-type POZ protein), a substrate adaptor of the CUL3 ubiquitin ligase complex, emerged as a novel fetal hemoglobin repressor. Depletion of SPOP or overexpression of a dominant negative version significantly raised fetal globin mRNA and protein levels with minimal detrimental effects on normal erythroid maturation, as determined by transcriptome and proteome analyses. SPOP controls HbF expression independently of the major transcriptional fetal hemoglobin repressors BCL11 A and LRF. Finally, pharmacologic HbF inducers cooperate with SPOP depletion during fetal hemoglobin upregulation. The study shows SPOP and the CUL3 ubiquitin ligase system in the control of fetal hemoglobin in human erythroid cells and offers new therapeutic strategies for the treatment of b- hemoglobinopathies.
Hemoglobin is comprised of a tetramer containing two a-type and two b-type subunits. The b-type globin gene cluster consists of an embryonic (e-globin), two fetal (g-globin) and two adult type (d-globin and b-globin) genes. Mutations in the b- globin gene that underlie sickle cell disease (SCD) and some types of b-thalassemia become clinically relevant after birth when the fetal genes are silenced. Increased fetal hemoglobin (HbF) production due to natural genetic variation or therapeutic
intervention can lower morbidity and mortality in b-hemoglobinopathies (Platt, et al., N. Engl. J. Med. (1994) 330: 1639-1644; Miller, et al., N. Engl. J. Med. (2000) 342:83-89). While promising strategies involving gene addition or genome editing are being pursued (Traxler, et al., Nat. Med. (2016) 22:987-990; Canver, et al., Blood (2016) 127:2536-2545; Cai, et al., Stem Cells Transl. Med. (2018) 7:87-97; Wienert, wt al., Trends Genet. (2018) 34(l2):P927-940), their implementation will be largely restricted to patients with access to sophisticated medical providers. Effective HbF induction by pharmacologic means is therefore needed, but remains a challenge.
BCL11 A and LRF (ZBTB7A) are critical direct transcriptional repressors of the g-globin genes (Menzel, et al., Nat. Genet. (2007) 39: 1197-1199; ETda, et al., Proc. Natl. Acad. Sci. (2008) 105: 1620-1625; Sankaran, et al., Science (2008) 322: 1839- 1842; Masuda, et al., Science (2016) 351 :285-289). However, as DNA binding proteins with functions in multiple tissues, they remain difficult to target
pharmacologically and in an erythroid selective manner. Moreover, LRF depletion delays erythroid differentiation (Masuda, et al., Science (2016) 351 :285-289; Maeda, et al., Dev. Cell. (2009) 17:527-540). In spite of a deep understanding of the transcriptional control of the globin genes, the regulatory circuitry outside of DNA binding nuclear factors remains under-explored. Yet, it is clear from targeted depletion experiments that non-DNA binding co-regulatory complexes can play pivotal roles in HbF silencing (Liu, et al., Cell (2017) 170: 1028-1043; Grevet, et al., Science (2018) 361 :285-290).
To identify new and potentially druggable nuclear HbF regulators, a library that is composed of sgRNAs directed against chromatin associated nuclear proteins containing BTB domain, Chromo domain, PWWP domain, PHD domain and more, HUDEP-2 cells were screened using an improved protein-domain based CRISPR- Cas9 platform (Grevet, et al., Science (2018) 361 :285-290; Kurita, et al., PLoS One (2013) 8:e59890; Shi, et al., Nat. Biotechnol. (2015) 33 :661-667). These domains have conserved structure and are required to mediate protein-protein interactions. The conserved protein structure of these domains provides a potential surface for docking small molecule inhibitors. Among approximately 600 BTB proteins and E3 ligase components in the library, the screen selectively identified speckle-type POZ protein (SPOP), a substrate adaptor of the CUE3 ubiquitin ligase complex (Chen, et al., Front. Oncol. (2016) 6: 113), as a novel repressor of g-globin transcription.
The repressive role of SPOP on g-globin levels is at least in part mediated by the CUL3 ubiquitin ligase complex, and disruption of SPOP-substrate interactions by overexpressing a SPOP dominant-negative mutant recapitulated the effect of SPOP depletion on g-globin expression. The activity of SPOP appears to be carried out independently of BCL11 A and LRF. SPOP depletion markedly amplified the effects of pomalidomide, a pharmacologic HbF inducer, indicating that SPOP perturbation is useful in combination with other treatment modalities.
As stated above, a CRISPR screening strategy (Shi et al. (2015) Nat.
Biotechnol., 33 (6): 661-7) was employed to identify regulators of fetal globin expression. Clustered, regularly interspaced, short palindromic repeat
(CRISPR)/Cas9 technology is well known in the art (see, e.g., Sander et al. (2014) Nature Biotech., 32:347-355; Jinek et al. (2012) Science, 337:816-821; Cong et al. (2013) Science 339:819-823; Ran et al. (2013) Nature Protocols 8:2281-2308; Mali et al. (2013) Science 339:823-826). Cas9 possesses two nuclease domains, a RuvC-like nuclease domain and a HNH-like nuclease domain, and is responsible for the destruction of the target DNA (Jinek et al. (2012) Science, 337:816-821;
Sapranauskas et al. (2011) Nucleic Acids Res. 39:9275-9282). The two nucleases generate double-stranded breaks. The double-stranded endonuclease activity of Cas9 requires a target sequence (e.g., ~20 nucleotides, see above) and a short conserved sequence (~2-5 nucleotides; e.g., 3 nucleotides) known as protospacer-associated motif (PAM), which follows immediately 3'- of the CRISPR RNA (crRNA) complementary sequence (Jinek et al. (2012) Science, 337:816-821; Nishimasu et al. (2014) Cell l56(5):935-49; Swarts et al. (2012) PLoS One, 7:e35888; Sternberg et al. (2014) Nature 507(7490):62-7). The double strand break can be repaired by non- homologous end joining (NHEJ) pathway yielding an insertion and/or deletion or, in the presence of a donor template, by homology-directed repair (HDR) pathway for replacement mutations (Overballe-Petersen et al. (2013) Proc. Natl. Acad. Sci. U.S.A. 110: 19860-19865; Gong et al. (2005) Nat. Struct. Mol. Biol. 12:304-312). The RNA- guided CRISPR/Cas9 system involves expressing Cas9 along with a guide RNA molecule (gRNA). When coexpressed, gRNAs bind and recruit Cas9 to a specific genomic target sequence where it mediates a double strand DNA (dsDNA) break and activates the dsDNA break repair machinery. Specific DNA fragments can be deleted when two gRNA/Cas9 complexes generate dsDNA breaks at relative proximity, and the genomic DNA is repaired by nonhomologous end joining.
Protein domain-focused CRISPR-Cas9 screen identifies SPOP as a potential g-globin repressor
sgRNAs targeting functional protein domains generates phenotype-altering mutations at a higher rate compared to sgRNAs designed to generate null alleles (Shi, et al., Nat. Biotechnol. (2015) 33:661-667). In order to identify additional potential g- globin repressors, a library of sgRNAs targeting approximately 600 proteins was designed covering most of BTB domain and histone modification reader domain containing proteins (6 sgRNAs per domain). This library also included 6 sgRNAs for LRF as positive control, and 50 non-targeting sgRNAs as negative controls. This sgRNA library was cloned into the LRG 2.1T lentiviral vector and then introduced into HUDEP-2 cells (Kurita, et al., PLoS One (2013) 8:e59890) stably expressing Cas9 (Figure 1 A). Cells were stained using an anti-HbF antibody and sorted the top 10% and bottom 10% HbF expressing cells by FACS, and deep-sequenced the sgRNAs from each population (Figure 1B). As expected, non-targeting sgRNAs were evenly distributed across the HbF high and low populations, and all six sgRNAs of LRF were enriched in the HbF high population (Figure 1C). Moreover, the sgRNAs targeting NuRD complex subunits (CHD4, MBD2 and MTA2) and DNMT1, which are reported to be required for g-globin silencing (Xu, et al., Proc. Natl. Acad. Sci. (2013) 110:6518-6523), were all enriched in HbF high portion, validating the screen. Interestingly, 5 out of 6 sgRNAs targeting SPOP were significantly enriched in the HbF high population, indicating that it functions as a repressor of g-globin (Figure
1C).
SPOP is one of the substrate adaptors of the CUL3 ubiquitin ligase complex that mediates ubiquitination of target proteins and, in most cases, causes protein degradation (Chen, et al., Front. Oncol. (2016) 6: 113; Pintard, et al., EMBO J. (2004) 23: 1681-1687). SPOP binds to its substrates by its N-terminal meprin and traf homology (MATH) domain and interacts with CEIL3 via its C-terminal BTB domain (Zhuang, et al., Mol. Cell (2009) 36:39-50) (Figure 2A). SPOP is widely expressed across human tissues (GTEx). In blood, SPOP is highly enriched in erythroid cells (Bloodspot) and its mRNA expression levels are comparable between fetal and adult erythroblasts (Lessard, et al., Hum. Mol. Genet. (2018) 27: 1411-1420; Huang, et al., Genes Dev. (2017) 31 : 1704-1713).
Depletion of SPOP elevates g-globin levels in HUDEP-2 cells
To validate the results from the screen, 3 of the 6 sgRNAs against the SPOP BTB domain were stably introduced into HUDEP-2-Cas9 cells and allowed the cells to undergo differentiation (Figure 2A; Table 1). All 3 SPOP sgRNAs significantly increased the fraction of HbF expressing cells (Figure 2B). Western blots showed that 1) SPOP protein levels declined somewhat during differentiation; 2) GATA1 protein levels were unchanged upon SPOP depletion, indicating SPOP is not required for normal cell maturation; 3) g-globin protein levels were significantly increased upon SPOP depletion, consistent with the HbF flow cytometry results; 4) LRF was unchanged, but BCL11 A protein levels were modestly decreased (Figure 2C).
CRISPR sgRNA name Target Sequence
SPOP sgRNA 1 CCTCTGCAGTAACCTGTCCG (SEQ ID NO: 1) SPOP sgRNA2 GAGGACTGTGGGAGAATTCC (SEQ ID NO: 2) SPOP sgRNA3 TGATGTGCTTCATTTACACG (SEQ ID NO: 3) Neg2 sgRNA GACCGGAACGATCTCGCGTA (SEQ ID NO: 4)
Table 1: sgRNA sequences
When measuring the transcriptional effects of SPOP perturbation, robust increases in g-globin mRNA and pre-mRNA levels were observed, indicating that SPOP impinges on transcriptional regulation of g-globin. SPOP loss increased e- globin mRNA levels ~2-fold, but b-globin mRNA and per-mRNA levels were similar to controls (Figure 2D). Importantly, there were no notable changes in a-globin, GATA1 and BAND3 mRNA levels (erythroid differentiation makers) and cell morphology, indicating that SPOP loss did not impair erythroid maturation. Varying levels of HbF induction in SPOP depleted clonal HUDEP-2 lines was also observed. In sum, SPOP suppresses g-globin gene expression.
Effects of SPOP inhibition on the erythroid transcriptome and proteome
To study the impact of SPOP depletion globally, RNA-seq was performed using HUDEP-2 pools independently derived from 3 SPOP sgRNAs and it was found that global gene expression patterns were highly similar between control and SPOP depleted cells (Pearson correlation coefficient above 0.95). g-globin genes (HBG1/2) appeared to be the most strongly and significantly increased in differentiated cells (Figure 3 A). Consistent with the qPCR results, a-globin, b-globin, GATA-l, ALAS2
and BAND3 genes were comparable (Figure 3 A). Of note, BCL11 A mRNA levels were unchanged (Figure 3 A).
Given that SPOP functions as a substrate adaptor of CETL3 E3 ligase complex, SPOP loss might lead to increased protein levels of its substrates. Mass spectrometry experiments were performed to measure protein abundances both in whole cells lysates and nuclear extracts from SPOP depleted cell pools. Among approximately 3000 quantified proteins from whole cell lysates and nuclear extracts, g-globin was one of the most elevated proteins. However, a-globin and b-globin abundance changed little or not at all upon SPOP depletion, consistent with the RNA-Seq results (Figure 3). Globally, SPOP loss induced g-globin expression accompanied by relatively few changes in transcriptome and proteome.
Depletion of SPOP elevates g-globin levels in primary erythroid CD34+ cells
The repressive role of SPOP on HbF in a primary human CD34+ cell derived culture system was tested (Figure 4 A). SPOP depletion by two independent shRNAs significantly increased HbF+ cell populations (Figure 4B; Table 2), g-globin protein levels as shown by Western blot and HPLC (Figure 4C-D), and g-globin transcript levels by RT-qPCR (Figure 4E). Similar to HUDEP-2 cells, GATA1 and LRF levels were unchanged but BCL11 A was reduced approximately two-fold. RNA-seq analysis of SPOP depleted cells showed that 1) global gene expression patterns were highly correlated between control and SPOP depleted cells, 2) g-globin transcripts were the most elevated with no significant changes of a-globin and b-globin mRNAs, 3) GATA-l, ALAS2 and BAND3 genes were mostly unchanged, and 4) BCL11 A and LRF transcript levels were comparable (Figure 4F). These results were further validated by RT-qPCR. Importantly, SPOP depletion did not impair erythroid maturation, as indicated by the similar transcript levels of the differentiation makers, cell surface makers CD71 and CD235a, and cell morphology. shRNA name Target Sequence
SPOP shRNA3 CAAGGTAGTGAAATTCTCCTA (SEQ ID NO: 5)
SPOP shRNA5 C AGAT GAGTT AGGAGGACTGT (SEQ ID NO: 6)
SC shRNA AAATT ATT AGCGCT ATCGCGC (SEQ ID NO: 7)
Table 2: shRNA sequences
SPOP-CUL3 complex represses g-globin transcription independent ofBCLUA
Since CUL3 is the core component of the SPOP-CUL3 E3 ligase complex (Chen, et al., Front. Oncol. (2016) 6: 113), it was determined whether CUL3 is involved in the repression of HbF. Indeed, depletion of CUL3 with sgRNAs targeting its Cullin domain elevated g-globin levels without affecting a- and b-globin levels, and had no significant effects on GATA1, BCL11 A and LRF expression (Figure 5A). SPOP protein but not transcript levels were increased upon CUL3 depletion (Figure 5 A), consistent with studies showing that SPOP-CUL3 itself can be ubiquitylated (Theurillat, et al., Science (2014) 346:85-89; Gschweitl, et al., Elife (2016) 5:el384l). This upregulation of SPOP in partially CEIL3 depleted cells might explain the reduced effect size on g-globin induction when compared to SPOP depletion. Although CEIL3 is known to regulate cell cycle progression by targeting Cyclin E (Singer, et al., Genes Dev. (1999) 13:2375-2387), CUE3 depletion did not ostensibly impair the
differentiation of erythroid cells, as evidenced by normal levels of GATA1, a-Globin and BAND3 (Figure 5A). These data also indicate that SPOP regulates g-globin through substrates of the CETL3 ubiquitin proteasome pathway.
Tinder SPOP deficient conditions, BCL11 A is decreased at the protein but not the mRNA level both in HUDEP-2 cells and primary erythroid CD34+ cells (Figure 2C and Figure 4C), possibly explaining some of the effects on g-globin regulation. To test this, rescue experiments were performed by re-introducing either BCL11 A cDNA or mouse Spop cDNA, which contains 2 mismatched nucleotides upstream of the “PAM” sequence of SPOP gRNA#l into SPOP depleted cells (Figure 5C).
Surprisingly, BCL11 A failed to restore repression of g-globin repression, while mouse Spop cDNA lowered g-globin to basal protein and mRNA levels (Figure 5D).
Moreover, if SPOP represses g-globin mainly through BCL11 A, SPOP depletion should not further raise g-globin levels in BCL11 A deficient cells. However, loss of SPOP in BCL11 A depleted cells additively elevated g-globin levels, indicating that SPOP and BCL11 A repress g-globin transcription through distinct pathways. Finally, given that SPOP functions as a CUL3 E3 ligase adaptor (Dai, et al., Nat. Med. (2017) 23: 1063-1071), if BCL11 A were one of its direct substrates, depletion of SPOP would be expected to increase, but not decrease, BCL11 A protein levels, and overexpression of WT SPOP, but not derivatives unable to bind substrates (Theurillat, et al., Science (2014) 346:85-89); Dai, et al., Nat. Med. (2017) 23: 1063-1071), should increase the ubiquitination levels of BCL11 A. However, in vivo ubiquitination assays showed that
overexpressing WT SPOP or mutant versions had no effect on the ubiquitylation of BCL11 A. Taken together, although SPOP depletion moderately alters BCL11 A protein level, these results indicate that BCL11 A is not the direct downstream effector of the SPOP-CUL3 complex on the repression of HbF.
Over expression of a dominant-negative acting SPOP mutant strongly increases y- globin levels
Given its role as E3 ligase that targets proteins to the proteasome, SPOP- CUL3 likely represses the transcription of the g-globin genes by promoting the ubiquitylation and degradation of proteins that might function as transcriptional activators of g-globin. To test this, a SPOP mutant in which Tyr87 is replaced by Asn (Y87N) in the MATH domain was expressed. The Y87N mutation disrupts SPOP- substrate interactions in a dominant-negative manner (Zhuang, et ah, Mol. Cell (2009) 36:39-50). Indeed, overexpression of the SPOP(Y87N) strongly elevated g-globin levels and also to some extent the embryonic e-globin gene without significantly affecting a-globin and b-globin levels, and had no measurable effect on BCL11 A or LRF levels (Figure 6). Importantly, overexpression of SPOP(Y87N) had no apparent detrimental effect on cell maturation (Figure 6). In concert, the data indicate that the SPOP-CUL3 complex functions by promoting the turnover of protein(s) involved in g-globin transcriptional regulation.
Depletion of SPOP cooperates with Pomalidomide during HbF induction
It was determined whether activation of g-globin expression by SPOP depletion could be amplified by pharmacologic agents that function via distinct pathways. Although the mechanism by which the drug Pomalidomide induces HbF expression remains unclear, it does trigger downregulation of BCL11 A mRNA levels (Dulmovits, et ak, Blood (2016) 127: 1481-1492; Moutouh-de Parseval, et ah, J. Clin. Invest. (2008) 118:248-258). Therefore, it was tested whether Pomalidomide amplifies the effects of SPOP depletion in HUDEP-2 cells. This was indeed the case, as the combined treatment elevated the fraction of HbF+ cells and increased g-globin transcription more strongly than either treatment alone (Figure 7A-B). Moreover, BCL11 A transcript levels were not changed upon SPOP deletion but significantly decreased upon pomalidomide treatment (Figure 7C). Of note, these conditions did not impair cell differentiation. Together these data indicate that SPOP inhibition in
combination with other treatments is a therapeutic strategy for HbF induction in patients with hemoglobinopathies.
Here, SPOP, a substrate adaptor of the CUL3 ubiquitin E3 ligase complex, has been identified as a novel regulator of HbF expression. Reduction in SPOP levels increases HbF production in HUDEP-2 and primary human cell cultures without substantial disruption of the cellular transcriptome and proteome. Mechanistically, it is demonstrated that the repressive role of SPOP on g-globin is dependent on the CUE3 ubiquitin ligase complex. Moreover, ectopic expression of a dominant-negative form of SPOP (Y87N) unable to bind to its substrates substantially induce HbF production. Finally, it found that combining SPOP depletion with pomalidomide exposure induced higher HbF production than either treatment alone.
CEIL3 interacts with BTB/POZ domain proteins such as SPOP. Although other BTB-domain containing substrate adaptors of the CEIL3 E3 ligase were also included in the sgRNA library, SPOP is the only one involved in HbF repression, reflecting a selective function of SPOP, and consistent with general target selectivity of CEIL3 E3 ligases via different BTB-domain containing substrate adaptors.
Induction of HbF upon CEIL3 depletion was less pronounced compared to SPOP loss, which may be due in part to the compensating effects of increased SPOP protein levels. Moreover, in HUDEP-2 cells, CUL3 depletion impaired cell proliferation, possibly due to deregulation of Cyclin E, but SPOP depletion did not have this effect, indicating that CUL3 targets Cyclin E through another substrate-specific adaptor.
Given the central role of BCL11 A in HbF silencing, the moderate decrease of BCL11 A in SPOP depleted cells might have contributed to HbF induction. However, restoration of BCL11 A levels failed to restore g-globin silencing. Hence, SPOP likely exerts its function via a different mechanism. Since ubiquitination can in some cases increase protein stability or alter protein activity, it was examined whether SPOP ubiquitinates BCL11 A and no changes were observed upon SPOP over-expression, again arguing against a functional link between SPOP and BCL11 A. Regardless, the role of SPOP in HbF silencing very likely involves its role as E3 ligase because forced expression of SPOP(Y87N) leads to strong HbF induction. SPOP(Y87N) expression induces g-globin to levels similar to those observed upon SPOP depletion, but, in contrast to the latter condition, BCL11 A levels remained unchanged. These
results are consistent with SPOP functioning via the CUL3 E3 ligase complex and support a mechanism not involving BCL11 A.
A means to increase the therapeutic index is to combine therapies that impact different cellular pathways. SPOP depletion had no effect on BCL11 A mRNA levels, but pomalidomide is known to lower production of BCL11 mRNA. Thus, the co- operativity of SPOP and pomalidomide during HbF induction was tested. The combination of SPOP depletion and pomalidomide treatment induced HbF production to levels much higher compared to either treatment alone. This indicates that SPOP inhibition can be combined with other treatments to augment effect size and lower adverse effects through dose reduction.
The BTB domain is a highly druggable structure (Kerres, et al., Cell. Rep. (2017) 20:2860-2875). Small molecules designed to inhibit the SPOP-substrate protein interactions have been reported (Guo, et al., Cancer Cell 30:474-484). This indicates that SPOP-substrate protein interactions is a therapeutic target for small molecule inhibitors. Importantly, strong HbF induction achieved through disrupting SPOP-substrate interactions by overexpressing SPOP(Y87N) mutant further supports this position. In summary, SPOP functions as a novel regulator of HbF and offers a therapeutic target for monotherapy or combination therapies for g- hemoglobinopathies.
While certain of the preferred embodiments of the present invention have been described and specifically exemplified above, it is not intended that the invention be limited to such embodiments. Various modifications may be made thereto without departing from the scope and spirit of the present invention, as set forth in the following claims.
Claims
1. A method of increasing the level of human fetal hemoglobin in a cell or subject, the method comprising administering at least one speckle-type POZ protein (SPOP) inhibitor to the cell or subject.
2. The method of claim 1, wherein the subject has a b-chain hemoglobinopathy.
3. The method of claim 1, wherein the subject has thalassemia.
4. The method of claim 1, wherein the subject has sickle cell disease.
5. The method of any of claims 1-4, wherein the SPOP inhibitor is a small molecule.
6. The method of claim 5, wherein the SPOP inhibitor is a MATH domain inhibitor or a BTB domain inhibitor.
7. The method of any one of claims 1-4, wherein the SPOP inhibitor is an inhibitory nucleic acid molecule.
8. The method of claim 7, wherein said inhibitory nucleic acid molecule specifically binds SEQ ID NO: 5 or 6.
9. The method of claim 1, wherein the cell is an erythroid cell, erythroid progenitor cell, or stem cell.
10. The method of claim 1, further comprising administering at least one fetal hemoglobin inducer to the cell or subject.
11. The method of claim 10, wherein said fetal hemoglobin inducer is pomalidomide.
12. A method of treating a hemoglobinopathy in a subject in need thereof, the method comprising administering a composition comprising at least one speckle-type POZ protein (SPOP) inhibitor and a pharmaceutically acceptable carrier to the subject.
13. The method of claim 12, wherein the subject has a b-chain hemoglobinopathy.
14. The method of claim 12, wherein the subject has thalassemia.
15. The method of claim 12, wherein the subject has sickle cell anemia.
16. The method of any one of claims 12-15, wherein the SPOP inhibitor is a small molecule.
17. The method of claim 16, wherein the SPOP inhibitor is a MATH domain inhibitor or a BTB domain inhibitor.
18. The method of any one of claims 12-15, wherein the SPOP inhibitor is an inhibitory nucleic acid molecule.
19. The method of claim 18, wherein said inhibitory nucleic acid molecule specifically binds SEQ ID NO: 5 or 6.
20. The method of claim 12, further comprising administering at least one fetal hemoglobin inducer to the subject.
21. The method of claim 20, wherein said fetal hemoglobin inducer is pomalidomide.
22. The method of claim 12, wherein the SPOP inhibitor is contained within a cell administered to the subject.
23. A composition comprising at least one speckle-type POZ protein (SPOP) inhibitor and at least one fetal hemoglobin inducer.
24. The composition of claim 22, wherein said fetal hemoglobin inducer is pomalidomide.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201862642174P | 2018-03-13 | 2018-03-13 | |
| US62/642,174 | 2018-03-13 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2019178187A1 true WO2019178187A1 (en) | 2019-09-19 |
Family
ID=67908509
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2019/021986 Ceased WO2019178187A1 (en) | 2018-03-13 | 2019-03-13 | Compositions and methods for hemoglobin production |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2019178187A1 (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111638261A (en) * | 2020-04-17 | 2020-09-08 | 融智生物科技(青岛)有限公司 | Computing equipment, storage medium and thalassemia screening device and system |
| EP3883597A2 (en) * | 2018-11-20 | 2021-09-29 | Fulcrum Therapeutics, Inc. | Compositions and methods for increasing fetal hemoglobin and treating sickle cell disease |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20180008725A1 (en) * | 2015-01-21 | 2018-01-11 | Cornell University | Viral vectors for prophylaxis and therapy of hemoglobinopathies |
-
2019
- 2019-03-13 WO PCT/US2019/021986 patent/WO2019178187A1/en not_active Ceased
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20180008725A1 (en) * | 2015-01-21 | 2018-01-11 | Cornell University | Viral vectors for prophylaxis and therapy of hemoglobinopathies |
Non-Patent Citations (2)
| Title |
|---|
| GENG ET AL.: "Prostate cancer-associated mutations in speckle-type POZ protein (SPOP) regulate steroid receptor coactivator 3 protein turnover", PNAS, vol. 110, no. 17, 2013, pages 6997 - 7002, XP055347106, doi:10.1073/pnas.1304502110 * |
| LAN ET AL.: "Domain-Focused CRISPR-Cas9 Screen Identifies the E3 Ubiquitin Ligase Substrate Adaptor Protein SPOP as a Novel Repressor of Fetal Hemoglobin", BLOOD, vol. 132, no. S1, 21 November 2018 (2018-11-21), pages 414 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3883597A2 (en) * | 2018-11-20 | 2021-09-29 | Fulcrum Therapeutics, Inc. | Compositions and methods for increasing fetal hemoglobin and treating sickle cell disease |
| AU2019384547B2 (en) * | 2018-11-20 | 2025-10-30 | Fulcrum Therapeutics, Inc. | Compositions and methods for increasing fetal hemoglobin and treating sickle cell disease |
| EP4509607A3 (en) * | 2018-11-20 | 2026-01-07 | Fulcrum Therapeutics, Inc. | Compositions and methods for increasing fetal hemoglobin and treating sickle cell disease |
| CN111638261A (en) * | 2020-04-17 | 2020-09-08 | 融智生物科技(青岛)有限公司 | Computing equipment, storage medium and thalassemia screening device and system |
| CN111638261B (en) * | 2020-04-17 | 2023-04-07 | 融智生物科技(青岛)有限公司 | Computing equipment, storage medium and thalassemia screening device and system |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Luoni et al. | Whole brain delivery of an instability-prone Mecp2 transgene improves behavioral and molecular pathological defects in mouse models of Rett syndrome | |
| EP3573618B1 (en) | Compositions and methods for hemoglobin production | |
| US20230250407A1 (en) | Silencing of dux4 by recombinant gene editing complexes | |
| US20240327835A1 (en) | Methods for reactivating genes on the inactive x chromosome | |
| WO2022076901A1 (en) | Novel targets for reactivation of prader-willi syndrome-associated genes | |
| JP2022033848A (en) | COMPOSITIONS AND METHODS FOR TREATMENT OF β-CATENIN-ASSOCIATED DISEASE OR DISORDER | |
| US20230174958A1 (en) | Crispr-inhibition for facioscapulohumeral muscular dystrophy | |
| JP2018517660A (en) | Pericyte long noncoding RNA | |
| Liu et al. | Allele-specific gene-editing approach for vision loss restoration in RHO-associated retinitis pigmentosa | |
| Rayana et al. | Using CRISPR interference as a therapeutic approach to treat TGFβ2-induced ocular hypertension and glaucoma | |
| US20230272390A1 (en) | Compositions and methods for hemoglobin production | |
| Yokota et al. | Targeted silencing of SOX2 by an artificial transcription factor showed antitumor effect in lung and esophageal squamous cell carcinoma | |
| WO2019178187A1 (en) | Compositions and methods for hemoglobin production | |
| Jiang et al. | Artificial microRNA-mediated Tgfbr2 and Pdgfrb co-silencing ameliorates carbon tetrachloride–induced hepatic fibrosis in mice | |
| US20090280166A1 (en) | Ferritin as a therapeutic target in abnormal cells | |
| WO2024186883A2 (en) | Compositions and methods for the treatment of human papillomavirus-driven cancers | |
| US20220411879A1 (en) | Compositions and methods for regulating egfr amplification in cancer cells for improving efficacy of egfr-targeted anti-cancer agents | |
| JP2026502888A (en) | Novel inhibitors of epigenetic regulators | |
| EP4630038A1 (en) | Variants of sirtuin 6 for the treatment of non-alcoholic fatty liver disease | |
| WO2025096404A1 (en) | Compositions and methods for hemoglobin production | |
| US20230045199A1 (en) | Compositions and methods for hemoglobin production | |
| CN110863047B (en) | Application of human CCDC154 gene and related product | |
| CN112779252B (en) | Antisense oligonucleotides targeting the key methylation region of the SMN2 promoter region MeCP2 binding | |
| CN117959442A (en) | Reagents and applications for preventing or treating pulmonary fibrosis | |
| US20250283087A1 (en) | Isolated circular rna and use thereof in preventing and treating lung cancer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 19767644 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 19767644 Country of ref document: EP Kind code of ref document: A1 |
