WO2019168467A1

WO2019168467A1 - A method and system for determining membrane protein recycling rates

Info

Publication number: WO2019168467A1
Application number: PCT/SG2019/050087
Authority: WO
Inventors: Andrew Chwee Aun Wan; Chan DU
Original assignee: Agency For Science, Technology And Research
Priority date: 2018-02-27
Filing date: 2019-02-14
Publication date: 2019-09-06

Abstract

A method and system for determining a protein recycling rate of a target cell membrane protein comprising: a) conjugating a fluorophore to a single stranded oligonucleotide having a high binding affinity and specificity to the target cell membrane protein to form a complex; b) applying a test mixture of a fluorescence quencher (eg. graphene oxide) and the complex to a predetermined density of cells; c) exciting the cells at an excitation wavelength of the fluorophore; d) measuring an emitted fluorescence at an emission wavelength of the fluorophore at predetermined time points; e) plotting an amount of fluorescence measurements over time; f) determining a value representing an amount of target protein present on the cell membrane; and g) determining a rate of fluorescence change of a curve of the plotted fluorescence measurements wherein the rate of fluorescence change of the curve indicates the protein recycling rate of the target cell membrane.

Description

A method and system for determining membrane protein recycling rates

Cross reference to related applications

[0001] This application claims the priority to Singapore application No. 10201801594S, filed 27 February 2018, the contents of which are incorporated herein by reference.

Field

[0002] The present invention relates to fluorescence based method and system for analyzing membrane protein recycling rates, preferably for determining membrane protein turnover.

Background

[0003] Protein turnover is a very important biochemical measurement as cell protein turnover will change with changes in the microenvironment and/or physiology of an organism. Current methods of measuring protein turnover are very time consuming and laborious. Cells are known to recycle their membrane proteins in a regular fashion, and such trafficking is important for processes such as cell adhesion, signaling, reprogramming and migration. Thus far, however, the rates for membrane protein recycling have been determined by methods that require separate measurements for protein internalization and recycling back to the plasma membrane [Arjonen A, et al. Traffic 13 (2012) 610-625; Blagojevic Zagorac G, et al. J. Cell Physiol. 232(3) (2017) 463- 476; and Cihil KM, Swiatecka-Urban A. J Vis Exp, 82 (2013) e50867]. These methods require the fixing or lysing of cells for each time point and are unsuitable for high- throughput measurements, or measurements on the same sample over time.

[0004] Aptamer fluorescence quenching by Graphene Oxide and the recovery of fluorescence by target protein binding have been previously developed for determination of protein concentrations [Gao L, et al Nanoscale 7(25) (2015) 10903-7] and qualitative or semi-qualitative probing of reactions that occur in living cells [Wang Y, et al. J Am Chem Soc. 132(27) (2010) 9274-6] [0005] An object of the invention is to ameliorate some of the above mentioned difficulties.

Summary

[0006] A technology that provides a method and or system to determine membrane protein recycling for a single sample over time that is suitable for high throughput is needed.

[0007] Accordingly, a first aspect of the invention includes a method of determining a protein recycling rate of a target cell membrane protein comprising: a) conjugating a fluorophore to a single stranded oligonucleotide having a high binding affinity and specificity to the target cel! membrane protein; b) applying a test mixture of a fluorescence quencher and the conjugated single stranded oligonucleotide to a predetermined density of cells; c) exciting the ceils with a light wavelength specific to the fluorophore; d) measuring an emitted fluorescence at a longer wavelength than the light wavelength specific to the fluorophore within a range specific to the fluorescence emission of the fluorophore at predetermined time points; e) plotting an amount of fluorescence measurements over time; f) determining a value representing an amount of target protein present on the cell membrane; and g) determining a rate of fluorescence change of a curve of the plotted fluorescence measurements wherein the rate of fluorescence change of the curve indicates the protein recycling rate of the target cell membrane.

[0008] Another aspect of the invention relates to a system for determining a protein recycling rate of a target membrane protein comprising: a) a complex of a single stranded oligonucleotide having a high binding affinity and specificity to the target cell membrane protein and a fluorophore conjugated thereto; b) a fluorescence quencher; c) a light source for emitting a predetermined amount of light at a light wavelength specific to the fluorophore; d) a fluorescence sensor for detecting the emitted fluorescence at a longer wavelength than the light wavelength specific to the fluorophore within a range specific to the fluorescence emission of the fluorophore; and e) a processing unit operable to obtain a dataset of fluorescence measurements and plot the dataset over time to determine a value representing an amount of target protein present on the ceil membrane; wherein the processing unit is further operable to determine a rate of fluorescence change of a curve of the plotted fluorescence measurements wherein the rate of fluorescence change of the curve indicates the protein recycling rate of the target cell membrane.

[0009] Other aspects and features of the present invention will become apparent to those of ordinary skill in the art upon review of the following description of specific embodiments of the invention in conjunction with the accompanying figures.

Brief description of the drawings

[0010] In the figures, which illustrate, by way of example only, embodiments of the present invention,

[0011] Figure 1 : (A) The aptamer-GO complex, GO, free aptamer, membrane protein, and the aptamer-protein complex exist in equilibrium (B) % fluorescence recovery vs time plots (C) Fluorescence recovery curves for MCF7 and MDA-MB-231 cell lines (D) A typical curve, exemplified for the cell line MDA-MB-231 , is shown, consisting of exponential in increasing form (surface integrin) and linear (recycled integrin) components, represented by the dashed and banded lines, respectively.

[0012] Figure 2: Integrin cr6 recycling times for a MCF7 and MDA-MB-231 epithelial cancer cell lines, as determined by the present aptamer-GO method Y-axes: l₀ and k_r are parameters that correlate to surface integrin levels and rate of integrin recycling, respectively. From 4 separate experiments, n >3 wells for each experiment; Recycling rate, R = k_r/I₀ (min-1 ), which gives the fraction of surface integrins that are recycled per unit time.

[0013] Figure 3: Effect of 37 nM cilengitide on integrin sd recycling rate for MCF7 and MDA-MB-231 cancer cell lines (n = 4).

[0014] Figure 4: Changes in recycling of integrin a6 for hESC cultured on Matrigel and tissue culture plate (TCP) at different time points (n = 3). [0015] . Figure 5: Recycling rate measurements of (A) PD-L1 and VEGFR2 for the breast cancer cell lines, MCF7 and BT474 (B) PD- L1 for the breast cancer cell lines, MCF7 and BT474 and (C) VEGFR2 for the breast cancer cell lines, MCF7 and BT474.

[0016] Figure 6: Recycling rate of VEGFR2 for the MCF7 cell line after 18h treatment with paclitaxel.

[0017] Figure 7: (A) l₀ and k_r measurements for EPCAM aptamer on BT474 and MCF7 (n=4) (B) Ratio of aptamer fluorescence on BT474 and MCF7 with time, demonstrating loss of fluorescence due to recycling (n=2).

[0018] Figure 8: Effect of doxorubicin on the ABCG2 transporter protein in Caeo2 cells (n=2 for DOX-added sample, n=3 for controls).

[0019] Figure 9: Effect of different concentrations of folic acid on the ABCG2 transporter protein in Caco2 cells (A) 13pg/mL of folic acid, and (B) 100pg/mL of folic acid (n=3). Values of lo and kr are in parentheses, respectively.

[0020] Figure 10: Effect of SPARC on integrin c/6 in MCF7 cells (n=4).

[0021] Figure 11: Changes in recycling of integrin cr6 proteins using different graphene oxide concentrations of 30pg/ml and above.

[0022] Figure 12: Changes in recycling of integrin c/6 proteins using different graphene oxide concentrations of 30pg/ml and below.

[0023] Figure 13: Changes in recycling of integrin a6 proteins in epidermal carcinoma cells and dermal papilla ceils

[0024] Figure 14: Changes in recycling of integrin a6 proteins in ductal carcinoma cells.

[0025] Figure 15: Changes in recycling of integrin a6 proteins in liposarcoma cells.

[0026] Figure 16: Changes in recycling of integrin a6 proteins using different aptamer concentrations. [0027] Figure 17: Fluorescence emission of integrin a6 apfamer measured over time in three cell lines.

[0028] F igure 18: (A) integrin a6b4 levels in MCF7 at different times after initial attachment, (B) integrin a6b4 levels in DLD1 at different times after initial attachment, (C) integrin adb4 levels in DLD1 at o and 24 hours after initial attachment compared with HDF control at 2 hours.

Detailed description

[0029] Here, a method to measure the appearance of recycled membrane proteins directly was developed, by measuring the recovery of a fluorescence quencher such as graphene oxide (GO) quenched-single stranded oligonucleotide fluorescence, upon binding of the single stranded oligonucleotide such as an aptamer to a target protein on live cells. To illustrate the method, in several embodiments the recycling time for the integrin proteins a6 over a range of cell types were measured. However, the fluorescence quencher-single stranded oligonucleotide fluorescence such as the aptamer-GO system used is not limited to this specific integrin protein, it can be applied to any membrane protein, as long as a single stranded oligonucleotide towards the target protein with sufficiently high affinity is available. This new tool allows routine measurements of recycling rate to be performed, and is a process that can be automated and multiplexed in the form of a recycling rate machine. Determination of recycling rate for different cel! types in response to different conditions would be applicable to high throughput drug screening and has the potential to advance understanding of the interactions between the cell and its environment.

[0030] Accordingly, a first aspect of the invention includes a method of determining a. protein recycling rate of a target cell membrane protein comprising: a) conjugating a fluorophore to a single stranded oligonucleotide having a high binding affinity and specificity to the target cell membrane protein; b) applying a test mixture of a fluorescence quencher and the conjugated single stranded oligonucleotide to a predetermined density of cells; c) exciting the cells with a light wavelength specific to the fluorophore; d) measuring an emitted fluorescence at a longer wavelength than the light wavelength specific to the fluorophore within a range specific to the fluorescence emission of the fluorophore at predetermined time points; e) plotting an amount of fluorescence measurements over time; f) determining a value representing an amount of target protein present on the cell membrane; and g) determining a rate of fluorescence change of a curve of the plotted fluorescence measurements wherein the rate of fluorescence change of the curve indicates the protein recycling rate of the target cell membrane.

[0031] Described is a method to measure the appearance of recycled membrane proteins directly, by measuring the recovery of quenched- single stranded oligonucleotide fluorescence, upon binding of the single stranded oligonucleotide to the target cell membrane protein on live cells.

[0032] As used herein the term“target cell membrane protein” refers to any protein or glycoprotein known to be present on the surface of a cell. In various embodiments the target cell membrane protein comprises receptor proteins, cell signaling proteins, ABC transporter proteins, transmembrane glycoproteins or any other protein known to be associated with a cell membrane. In various embodiments the target cell membrane protein comprises integrin proteins such as integrin alpha 6 (ad), integrin alpha V (aV), integrin alpha 6 beta 4 (a6b4). In various embodiments the target cell membrane protein comprises membrane proteins such as G-protein coupled receptors, including serotonin, dopamine, GABA, and glutamate receptors. In various embodiments the target cell membrane protein comprises receptor tyrosine kinases, for example VEGFR, EGFR, FGFR and PDGF receptors in various embodiments the target cell membrane protein comprises immune checkpoint receptors, for example, PD-1 and CTLA-4. In various embodiments the target cell membrane protein comprises ABC transporter proteins such as ATP-binding cassette super family G member protein 2 (ABCG2). In various embodiments the target cell membrane protein comprises cell signaling proteins such as epithelial adhesion molecule (EpCAM).

[0033] As used herein the term “single stranded oligonucleotide” refers to any oligonucleotide including DNA, RNA, LNA Spiegelmer which are composed partially or entirely of an unnatural L-ribonucleic acid backbone or any other oligonucleotide based on any natural or modified nucleotide bases known in the art. In various embodiments the single stranded oligonucleotide comprises of 10 to 50 nucleic acids In length, 10 to 40 nucleic acids in length, 10 to 30 nucleic acids in length, 10 to 20 nucleic acids in length, or 12 to 20 nucleic acids in length. In various embodiments the single stranded oligonucleotide comprises a nucleic acid set out in any one of SEQ ID NOS: 1 to 5. In various embodiments the single stranded oligonucleotide comprises a nucleic acid set forth in SEQ ID NO. 1 :

(CGT ATT CGTACTGGAACT GAT AT CG AT GT CCCCATGCTT ATT CT). in various embodiments the single stranded oligonucleotide comprises a nucleic acid set forth in SEQ ID NO. 2:

(GAT GT G AGT GT GTGACG AGCT ACG ACGT CTGGT GTAATTT AT AAAGACAGT GTGT AT AT GAACAACAG AACAAG G AAAG GT). In various embodiments the single stranded oligonucleotide comprises a nucleic acid set forth in SEQ ID NO. 3: (ACGGGCCACAT CAACT CATT GATAGACAATGCGT CCACT GCCCGT). In various embodiments the single stranded oligonucleotide comprises a nucleic acid set forth in SEQ ID NO. 4: (AG AGA GG TTG CGT CTG T). In various embodiments the single stranded oligonucleotide comprises a nucleic acid set forth in SEQ ID NO. 5: (ACGCTCGGATGCCACTACAGGCCCAGCCTCATGGACGTGCTGGTGAC). In various embodiments the single stranded oligonucleotide comprises an integrin a6b4 aptamer set forth in nucleic acid sequence represented by SEQ ID NO. 1. In various embodiments the single stranded oligonucleotide comprises VEGFR aptamer set forth in SEQ ID NO. 2. In various embodiments the single stranded oligonucleotide comprises PDL-1 aptamer set forth in SEQ ID NO. 3. In various embodiments the single stranded oligonucleotide comprises EPCAM aptamer set forth in nucleic acid sequence represented by SEQ ID NO. 4. In various embodiments the single stranded oligonucleotide comprises ABCG2 aptamer set forth in nucleic acid sequence represented by SEQ ID NO. 5.

[0034] In various embodiments the single stranded oligonucleotide comprises an aptamer that has been selected in silico and/or in vitro to selectively and sensitively bind to the target cell membrane protein. In various embodiments, in vitro selection of an aptamer is done using systematic evolution of ligands by exponential enrichment (SELEX), Aptamer-Facilitated Biomarker Discovery (AptaBiD) or any other method known in the art to evolve single stranded oligonucleotide with a high binding affinity and specificity to a target cell membrane protein. In various embodiments a high binding affinity refers to a dissociation constant K_d of 500 nM or less. In various embodiments a high binding affinity refers to a dissociation constant K_d within the range of about 0.1 nM to 500 nM. In various embodiments a high binding affinity refers to a dissociation constant Kd of about 140nM. In various embodiments a high binding affinity refers to a dissociation constant Kd of about 0.12 nM. In various embodiments a high binding affinity refers to a dissociation constant J of about 4.7 nM. In various embodiments a high binding affinity refers to a dissociation constant K_d within the range of about 120 nM to 420 nM.

[0035] As used herein‘a test mixture’ refers to a mixture of a fluorescence quencher and a single stranded oligonucleotide conjugated to a fiuorophore. In various embodiments the components of the test mixture are incubated prior to use. In various embodiments the components of the test mixture are incubated for about 30 minutes prior to use.

[0036] As used herein the term‘fluorescence quencher’ refers to any process which decreases the fluorescence intensity of a given fiuorophore. In various embodiments the fluorescence quencher comprises a chemical fluorescence quencher such as molecular oxygen, iodide ions or acrylamide. In various embodiments the fluorescence quencher comprises a black hole quencher which can potentially be used, but black hole quenchers are much less commercially viable as a complementary quencher has to be designed for each aptamer type. In various embodiments the fluorescence quencher comprises a graphene oxide (GO).

[0037] As used herein the term‘fiuorophore’ refers to a compound that can re-emit light upon light excitation. In various embodiments the fiuorophore comprises any fluorescent compound capable of being conjugated to a single stranded oligonucleotide with minimal effects on the single stranded oligonucleotide’s binding affinity to a target protein. In various embodiments the fiuorophore may be conjugated to a single stranded oligonucleotide with an alkyl linker. In various embodiments the fiuorophore comprises a fluorescein based compound or any other fluorescent dye known in the art. In various embodiments the fiuorophore comprises a fluorescein modified uridine incorporated into a single stranded oligonucleotide comprising an RNA or an LNA. In various embodiments the fiuorophore comprises 5(6)-carboxyfluorescein. Known fluorescent compounds have known excitation wavelength and a known fluorescence emission wavelength at a longer wavelength than the excitation wavelength specific to the fiuorophore used. [0038] In various embodiments the predetermined time points is every 2 to 5 minutes. In various embodiments the predetermined time points is every 2 to 4 minutes. In various embodiments the predetermined time points is every 30 minutes. In various embodiments the predetermined time points is every 60 minutes. In various embodiments the predetermined time points is 24 hours.

[0039] In various embodiments the predetermined density of cells are any density of cells. In various embodiments the predetermined density of cells comprises a density of 2 X 10⁵. In various embodiments the predetermined density of cells comprises a density of 2 X 10⁴.

[0040] There are various ways to determine a value representing an amount of target protein present on the cell membrane. In various embodiments the value representing an amount of target protein present on the cell membrane is determined to be the point at which an exponential curve intersects a steady state curve of the plotted fluorescence measurements. In various embodiments the curves are plotted and analyzed using the equation: y_f = y₁ + y₂ = l₀ - C e^A(-k_<At) + k *t. In various embodiments the value representing amount of target protein present on the cell membrane is determined by taking a tangent on the plotted curve at 10 to 25 minutes (average 15 minutes). At this point of time a steady state appeared to have been established. In various embodiments the equilibrium point representing an amount of target protein present on the ceil membrane is determined to be the point at which a tangent of the entire curve intersects with the y axis. In various embodiments the value representing an amount of target protein present on the cell membrane is determined to be l₀ as described herein. Whereby y_t means total complex formation; whereby yi means complex formation with surface protein; whereby y₂ means complex formation with recycled proteins; whereby l₀ means concentration of target membrane protein; whereby C means a constant arising from derivation of the equation; whereby e^A means exponential constant, with a value of

k. At

approximately 2.718 to the power of (-k₀At) e.g. ^e· ^' ; whereby k₀ means rate constant for complex formation with target membrane protein; whereby A means a concentration of the single stranded oligonucleotide conjugated to the fluorophore; whereby k_r means recycling rate; and whereby t means time in minutes. [0041] There are various ways to determine a rate of fluorescence change of a curve of the plotted fluorescence measurements wherein the rate of fluorescence change of the curve indicates the protein recycling rate of the target cell membrane. In various embodiments the rate of fluorescence change of a curve of the plotted fluorescence measurements is determined using the formula R = k_r/l₀ (min-1 ) wherein l_Q = concentration of target cell membrane protein and K_r = Rate of complex formation with recycled target cell membrane protein. In various embodiments the rate of fluorescence change of a curve of the plotted fluorescence measurements is determined by taking the rate of change of a tangent on the plotted curve from 10 to 25 minutes.

[0042] In various embodiments prior to step f) the fluorescence measurements are normalized with a control emitted fluorescence at a longer wavelength than the light wavelength specific to the fluorophore within a range specific to the fluorescence emission of the fluorophore at predetermined time points in control cell samples.

[0043] In various embodiments the control cell samples comprise a first control mixture of the fluorescence quencher and the predetermined density of cells.

[0044] In various embodiments the control cell samples comprise a second control mixture of the single stranded oligonucleotide having a high binding affinity and specificity to the target cell membrane protein conjugated to the fluorophore and the predetermined density of cells and a control emitted fluorescence is calculated as the emitted fluorescence measured in the second control mixture minus emitted fluorescence measured in a third control mixture of the predetermined density of cells in a physiological buffer.

[0045] In various embodiments the amount of fluorescence measurements is a percentage determined as the emitted fluorescence measured in d) minus the emitted fluorescence measured in the first control mixture, then divided by the control emitted fluorescence calculated as the emitted fluorescence measured in the second control mixture minus emitted fluorescence measured in a third control mixture of the predetermined density of cells in a physiological buffer multiplied by 100.

[0046] In various embodiments normalizing the fluorescence measurements comprises determining: % of Fluorescent recovery = (test mixture_t - first contro!_f)/(second control - third control_f)^*100

[0047] whereby the subscript f denotes fluorescence readings obtained at a wavelength within a range specific to the fluorescence emission of the fluorophore used for samples added with the respective reagents

[0048] In various embodiments the control cell samples comprise a second control mixture of the single stranded oligonucleotide having a high binding affinity and specificity to the target cell membrane protein conjugated to the fluorophore and the predetermined density of cells and a second control emitted fluorescence is calculated as the emitted fluorescence measured in the second control mixture.

[0049] In various embodiments the amount of fluorescence measurements is a percentage determined as the emitted fluorescence measured in d) divided by the second control emitted fluorescence measured in claim 6 multiplied by 100.

[0050] The emitted fluorescence measured in d) is the emitted fluorescence at a longer wavelength than the light wavelength specific to the fluorophore within a range specific to the fluorescence emission of the fluorophore at predetermined time points measured in the test mixture.

[0051] In various embodiments normalizing the fluorescence measurements comprises determining:

% Fluorescent recovery = (test mixture_f)/( second control_f)^*10Q

[0052] whereby the subscript f denotes fluorescence readings obtained at a wavelength within a range specific to the fluorescence emission of the fluorophore used for samples added with the respective reagents.

[Q053] In various embodiments the predetermined density of cells are the same for the test mixture, the first control, second control and third control to allow suitable normalization of the fluorescence measurements.

[0054] In various embodiments the fluorescence quencher is graphene oxide in various embodiments the graphene oxide is single layer graphene oxide. [0055] In various embodiments the method further comprises determining the optimum concentration of the fluorescence quencher to be use to yield just enough free aptamer to form the protein-aptamer complex efficiently, but not much higher, to minimize background fluorescence due to the free aptamer.

[0056] In various embodiments the target protein is selected from the group consisting of integrin protein, ABC transporter protein, cell signaling protein, and check point receptor protein. In various embodiments the integrin protein is an integrin alpha 6 protein (a6). In various embodiments the integrin protein is an integrin alpha 6 beta 4 (adb4). In various embodiments the ABC transporter protein is an ATP-binding cassette super family G member protein 2 (ABCG2). In various embodiments the ceil signaling protein is an epithelial adhesion molecule (EpCAM) protein. In various embodiments the ceil signaling protein is a tyrosine kinase receptor protein. In various embodiments the cell signaling protein is Vascular endothelial growth factor receptor 2 (VEGFR2). In various embodiments the check point receptor protein is programmed cel! death ligand 1 (PD-L1 ).

[0057] In various embodiments the fluorophore comprises 5(6)-carboxyfluorescein (FAM), the light wavelength specific to the fluorophore for excitation is 480nm and the range specific to the fluorescence emission of the fluorophore is between 515nm to 525nm. Known fluorescent compounds have known excitation wavelength and a known fluorescence emission wavelength at a longer wavelength than the excitation wavelength specific to the fluorophore used. 5(6)-carboxyfluorescein (FAM) has an excitation wavelength at about 480nm and a fluorescence emission wavelength at 520nm. However, to account for a complex cellular system that may have compound that are natural quenchers and the interaction with the introduced fluorescence quencher it is preferable to measure the fluorescence emission spectrum over a range of wave lengths for example between 515nm to 525nm, or from 516nm to 524nm, or at 516nm, 518nrn, 520nm, 522nm, and/or at 524nm.

[0058] In various embodiments the single stranded oligonucleotide comprises a ribonucleic acid aptamer.

[0059] In various embodiments the method further comprises comparing the value representing an amount of target protein present on the cel! membrane and the protein recycling rate of the target cell membrane protein between a test mixture and a test mixture with a test compound added thereto wherein a difference in the value representing an amount of target protein present on the cell membrane and/or the protein recycling rate of the target cell membrane indicates the test compound is a substrate for the target ceil membrane protein or a protein associated with the target ceil membrane protein.

[0060] !n various embodiments the test compound may be a compound suspected of interacting with the target cell membrane protein or a protein associated with the target cell membrane protein either up or downstream of the target cell membrane protein.

[0061] Another aspect of the invention relates to a system for determining a protein recycling rate of a target membrane protein comprising: a) a complex of a single stranded oligonucleotide having a high binding affinity and specificity to the target cell membrane protein and a fluorophore conjugated thereto; b) a fluorescence quencher; c) a light source for emitting a predetermined amount of light at a light wavelength specific to the fluorophore; d) a fluorescence sensor for detecting the emitted fluorescence at a longer wavelength than the light wavelength specific to the fluorophore within a range specific to the fluorescence emission of the fluorophore; and e) a processing unit operable to obtain a dataset of fluorescence measurements and plot the dataset over time to determine an equilibrium point indicating an amount of target protein present on the cel! membrane; wherein the processing unit is further operable to determine a rate of fluorescence change of a curve of the plotted fluorescence measurements wherein the rate of fluorescence change of the curve indicates the protein recycling rate of the target cell membrane.

[0062] In various embodiments the fluorescence sensor is placed away from a light path emitted from the light source, in order to prevent excitation or irradiation light emitted from the light source reaching the fluorescence sensor.

[0063] In various embodiments the processing unit may be operable to emit light from the light source at an excitation wavelength specific to the fluorophore at predetermined time points. Similarly, in such embodiments the processing unit may be operable to detect fluorescence at a longer wavelength than the excitation wavelength specific to the fluorophore within a range specific to the fluorescence emission of the fluorophore at predetermined time points in various embodiments this may comprise reading of fluorescence at regular time intervals for a determined duration such as every 5 minutes for a 40 to 60 minutes time period, every 4 minutes for a 40 to 60 minutes time period, every 3 minutes for a 40 to 60 minutes time period, or every 2 minutes for a 40 to 60 minutes time period.

[00643 In various embodiments the processing unit may be operable to remove media from wells.

[0065] In various embodiments the processing unit may be operable to dispense the complex and the fluorescence quencher such as an aptamer-GO solution. In various embodiments the processing unit may be operable to dispense control solutions into the wells. In such embodiments these solutions may comprise the complex such as aptamers probes, for different target membrane proteins, which may be transferred from a manually prepared‘reservoir’ of corresponding format.

[0066] In various embodiments the processing unit may be operable to remove reagents and/or replace reagents or media with new reagents and/or media, allowing continuous culture of the cells.

[0067] In various embodiments the processing unit may be operable to average fluorescence readings and plot percentage fluorescence recovery vs time curve. In various embodiments the percentage fluorescence recovery is calculated as:

% of Fluorescent recovery = (test mixture_t - first control_f)/(second contra If - third

control_f)^*100.

[0068] In various other embodiments the percentage fluorescence recovery is calculated as:

% Fluorescent recovery = (test mixture_t )/( second control_f)*100

[0069] Whereby the subscript f denotes fluorescence readings obtained at a wavelength within a range specific to the fluorescence emission of the fluorophore used for samples added with the respective reagents. Whereby the test mixture comprises a fluorescence quencher; a single stranded oligonucleotide having a high binding affinity and specificity to the target cell membrane protein conjugated to a fluorophore; and a predetermined density of cells. Whereby the first control comprises a mixture of the fluorescence quencher and the predetermined density of cells. Whereby the second control comprises a mixture of the single stranded oligonucleotide having a high binding affinity and specificity to the target cell membrane protein conjugated to the fluorophore and the predetermined density of cells. Whereby the third control comprises a mixture of the predetermined density of cells in a physiological buffer.

[0070] In various embodiments the processing unit may be operable to determine curve fitting and determination of l₀, k_r and R parameters. In various embodiments curve fitting may be performed using the equation: y_t = y-i + y₂ = l_o - C e^A(~k₀A_t) + k_r ^*t.

[0071] Whereby y_t means total complex formation; whereby i means complex formation with surface protein; whereby y₂ means complex formation with recycled proteins; whereby l₀ means concentration of target membrane protein; whereby C means a constant arising from derivation of the equation; whereby e^A means exponential constant, with a value of approximately 2.718 to the power of (-k₀A_t); whereby k₀ means rate constant for complex formation with target membrane protein; whereby A means a concentration of the single stranded oligonucleotide conjugated to the fluorophore; whereby k_r means recycling rate; and whereby t means time in minutes.

[0072] In various embodiments the system further comprises a container for holding cells in proximity to the light source and the fluorescence sensor. In various embodiments the container may comprise wells such as those in a 96-well plate or any other suitable vessel for containing or holding cells in proximity to the light source and the fluorescence sensor.

[0073] In various embodiments the fluorescence quencher comprises a chemical fluorescence quencher such as molecular oxygen, iodide ions or acrylamide in various embodiments the fluorescence quencher comprises a black hole quencher which can potentially be used, but black hole quenchers are much less commercially viable as a complementary quencher has to be designed for each aptamer type. In various embodiments the fluorescence quencher comprises a graphene oxide (GO). In various embodiments the fluorescence quencher is graphene oxide. In various embodiments the graphene oxide is single layer graphene oxide. [0074] In various embodiments the fluorophore comprises any fluorescent compound capable of being conjugated to a single stranded oligonucleotide with minimal effects on the single stranded oligonucleotide’s binding affinity to a target protein. In various embodiments the fluorophore may be conjugated to a single stranded oligonucleotide with an alkyl linker in various embodiments the fluorophore comprises a fluorescein based compound or any other fluorescent dye known in the art. In various embodiments the fluorophore comprises a fluorescein modified uridine incorporated into a single stranded oligonucleotide comprising an RNA or an LNA. In various embodiments the fluorophore comprises 5(6)-carboxyfluorescein. Known fluorescent compounds have known excitation wavelength and a known fluorescence emission wavelength at a longer wavelength than the excitation wavelength specific to the fluorophore used. In various embodiments the fluorophore comprises 5(6)-carboxyfluorescein, the light wavelength specific to the fluorophore for excitation is 480nm and the range specific to the fluorescence emission of the fluorophore is between 515nm to 525nm.

[0075] In various embodiments the single stranded oligonucleotide comprises of 10 to 50 nucleic acids in length, 10 to 40 nucleic acids in length, 10 to 30 nucleic acids in length, 10 to 20 nucleic acids in length, 12 to 20 nucleic acids in length. In various embodiments the single stranded oligonucleotide comprises a nucleic acid set forth in any one of SEQ ID NOs: 1 to 5 as listed above. In various embodiments the single stranded oligonucleotide comprises an aptamer that has been selected in silica and/or in vitro to selectively and sensitively bind to the target cell membrane protein. In various embodiments, in vitro selection of an aptamer is done using systematic evolution of ligands by exponential enrichment (SELEX), Aptamer-Facilitated Biomarker Discovery (AptaBiD) or any other method known in the art to evolve single stranded oligonucleotide with a high binding affinity and specificity to a target ceil membrane protein. In various embodiments a high binding affinity refers to a dissociation constant K_d of 500 nM or less in various embodiments a high binding affinity refers to a dissociation constant K_d within the range of about 0.1 nM to 500 nM. In various embodiments a high binding affinity refers to a dissociation constant K_d of about 140nM. In various embodiments a high binding affinity refers to a dissociation constant K_d of about 0.12 nM. In various embodiments a high binding affinity refers to a dissociation constant K_d of about 4.7 nM. In various embodiments a high binding affinity refers to a dissociation constant K_d within the range of about 120 nM to 420 nM. In various embodiments the single stranded oligonucleotide is as described above herein. In various embodiments the single stranded oligonucleotide comprises a ribonucleic acid aptamer.

[0076] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by a skilled person to which the subject matter herein belongs. As used herein, the following definitions are supplied in order to facilitate the understanding of the present invention.

[0077] Throughout this document, unless otherwise indicated to the contrary, the terms“comprising”,“consisting of”,“having” and the like, are to be construed as non- exhaustive, or in other words, as meaning“including, but not limited to”.

[0078] Furthermore, throughout the specification, unless the context requires otherwise, the word “include” or variations such as “includes” or “including” will be understood to imply the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers.

[0079] As used in the specification and the appended claims, the singular form“a”, and“the” include plural references unless the context clearly dictates otherwise.

Examples

[0080] In various embodiments a method to measure the appearance of recycled membrane proteins directly, by measuring the recovery of graphene oxide (GO) quenched-aptamer fluorescence, upon binding of the aptamer to the target protein on live cells is described.

[0081] An equilibrium exists between free aptamer, bound aptamer and the free GO surface. When an aptamer-GO solution is introduced to plated live cells, the free aptamer binds to the membrane protein on the surface of the cells and the aptamer concentration is reduced, leading to dissociation of the GO quenched-fluorescent aptamer reservoir to produce more aptamer, thus leading to fluorescence recovery. By curve-fitting, the resulting fluorescence recovery curve can be decomposed into two components that correlate to levels of surface protein and recycling rate of the protein, respectively. The method is non-destructive to cells and allows high-throughput measurements of recycling rate. [0082] In various embodiments the method measures recycling rate based on the switching on of a fluorescence signal that accumulates in the form of a fluorescence recovery curve.

[0083] In various embodiments to obtain absolute values, calibration can potentially be performed with a second method that allows absolute quantitation of protein levels.

Example 1: Measurement of integrin «6 recycling rate

[0084] The integrin alpha 6 (a6) aptamers were designed according to the sequences identified by Berg et al. [Berg K, Lange T, Mittelberger F, Schumacher U, Hahn U. Selection and Characterization of an a6/34 Integrin blocking DNA Aptamer, Mol Ther Nucleic Acids 5 (2016) e294], and purchased from Integrated DNA Technologies, USA. The Integrin a6b4 aptamer is a nucleic acid set forth in SEQ ID NO. 1 : CGT ATT CGTACTGGAACT GAT AT CGAT GT CCCCAT G CTT ATT CT. The K_d of the aptamer of SEQ ID NO. 1 is about 140 nM. The aptamers were modified with 5(6)-carboxyfluorescein (FAM) at the 3’ end. Graphene oxide (Single Layer Graphene Oxide, SLGO) was obtained from Cheap Tubes, USA. Cells were obtained from ATCC, USA unless mentioned otherwise. GO was dissolved in MiliQ water by vortexing and sonication. A GO concentration of 30 pg/mL and aptamer concentration of 60 nM was used for measurements of integrin recycling rate. Cells were plated at a density of 2 X 10⁵/well in 96-well plates. Aptamer and GO solutions were mixed at a 1 :1 volume ratio and allowed to stand for 30 min, prior to being added to the cells. 100 pL of aptamer-GO solution was added to each well of the 96-well plate. The plates were transferred to a TECAN Infinite M200 PRO multiplate reader and the fluorescence at 520 nm was read, using an excitation wavelength of 480 nm. The elapsed time between addition of the aptamer-GO solution to the cells and fluorescence reading was noted (ranging between 2 and 4 minutes) and used to obtain the corrected time of reaction. Readings were typically obtained from 0 to 45 minutes, at intervals of 5 minutes. For every experiment, fluorescence readings were also obtained from wells where control samples such as only phosphate buffered saline (PBS) (third control), aptamer (second control) or GO (first control) were added to the cells, where the reagents were diluted to the same final concentrations as in the aptamer-GO (test mixture) solutions. Percentage fluorescent recovery is calculated according to the formula: [0085] % Fluorescent recovery = (Aptamer. GO520 - G0₅₂o)/(Aptamer₅₂o - PBSs₂o)^*100

[0086] Where the subscript 520 denotes fluorescence readings obtained at 520 nm for wells added with the respective reagents.

[0087] The curves were plotted and analyzed using Microsoft Excel and Origin software. Curve fitting was performed using the equation: y_t = yi + y₂ = l₀ - C e^A(-k₀A_t) + k_r ^*i.

[0088] Derivation and modelling of complex formation curve

GO-a mer complex

I otal complex formation (y_t) = complex formation with surface integrins (yi) + complex formation with recycled integrins (y₂) - dissociation of integrin-aptamer complex

Assuming k_f » k_d ; i.e. negligible dissociation of integrin-aptamer complex

yt = yi yå

Considering the two components (yi and y₂) separately:

1. Rate of complex formation with surface integrins =

Where A = concentration of aptamer; y = concentration of integrin-aptamer complex at time t; k₀ = rate constant for complex formation with surface integrins; l₀ = concentration of surface integrins

fd_yi =fkoA[l₀ y].dt

fl/[lo - yi]. dy =fkoA.dt

-In [ lo yi]= koAt ci

! ₀— y 1 = e^A(-koAt)^*e^A ci

l₀ - yi C e^A(-k_oAt)

yi = l_o - C e^A(-k_oAt)

2. Rate of complex formation with recycled integrins =

g₂ = k ^*t

Combining 1 and 2,

y_t = yi + y_å = l_o - C e^A(-kAt) + k ^*t— (1 )

As y_t is proportional to fluorescence recovery due to complex formation, Equation (1 ) can be used for curve-fitting of the % fluorescence recovery vs time plots that are experimentally obtained (Figure 1 B, Figure 1 D). The simulated curves for the yi and y₂ components of the curve are also shown in Figure 1 C . R² values obtained from curve fitting are typically 0.99 or better.

[0089] The GO-aptamer complex acts as a reservoir for free aptamer, which forms a complex with the protein according to the equilibrium equation in Figure 1A. When the aptamer is bound to GO via n-n stacking interactions, its fluorescence is quenched due to FRET between graphene and the dye, and it is thus ^'switched off. An equilibrium exists between free aptamer, bound aptamer and the free GO surface. When an aptamer-GO solution is introduced to plated live cells, the free aptamer binds to the membrane protein on the surface of the cells and the aptamer concentration is reduced, leading to dissociation of the GO quenched-fluorescent aptamer reservoir to produce more aptamer, thus leading to fluorescence recovery. The component of fluorescence recovery that predominates at early time points involves complexation of aptamer with the membrane proteins that are present on the surface of the cell at steady state. However, the free aptamer also forms a complex with newly appearing, recycled proteins on the cell surface, which is the second component of fluorescence recovery.

[0090] To demonstrate the application of this system, the recycling rates for integrins Q6 were measured, integrin o6 being from a class of membrane proteins that mediate the interaction of cells with the extracellular matrix. The resulting fluorescence recovery curve is made up of exponentially decay curve in increasing form and linear components, related to surface integrin (yi) and recycled integrin (y₂) levels, respectively (Figure 1 C, D). The derivation of the equation to model the curve is presented in above. Using Origin software, curve fitting was performed to obtain values of the parameters l₀ and k_r, which are fluorescence recovery levels that correspond to the surface and recycled integrins, respectively. From these parameters, a parameter R, is derived where R = k_r/l₀ (min-1 ), and which is proportional to the recycling rate.

[0091] it was found in the present example that the reagent preparation conditions are especially crucial in making accurate measurements of the protein recycling rate, as a multi-component equilibrium is involved (see above). In this sense, the present system differs from the use of aptamer-Graphene Oxide systems for the determination of ^'static’ protein concentrations.

Example 2: Recycling time measurement for different cell types

[0092] The integrin r6 aptamers were designed as described above. The aptamers were modified with FAM at the 3’ end. Graphene oxide (Single Layer Graphene Oxide, SLGO) was obtained from Cheap Tubes, USA. Cells were obtained from ATCC, USA unless mentioned otherwise. GO was dissolved in MiliQ water by vortexing and sonication. A GO concentration of 30 pg/nnL and aptamer concentration of 60 nM was used for measurements of integrin recycling rate. Cells were plated at a density of 2 X 10⁵/well in 96-well plates. Aptamer and GO solutions were mixed at a 1 :1 volume ratio and allowed to stand for 30 min, prior to being added to the cells. 100 pL of aptamer-GO solution was added to each well of the 96-well plate. The plates were transferred to a TECAN Infinite M200 PRO multiplate reader and the fluorescence at 520 nm was read, using an excitation wavelength of 480 nm. The elapsed time between addition of the aptamer-GO solution to the cells and fluorescence reading was noted (ranging between 2 and 4 minutes) and used to obtain the corrected time of reaction. Readings were typically obtained from 0 to 45 minutes, at intervals of 5 minutes. For every experiment, fluorescence readings were also obtained from wells where only phosphate buffered saline (PBS), aptamer or GO were added to the cells, where the reagents were diluted to the same final concentrations as in the aptamer-GO solutions. Percentage fluorescent recovery is calculated according to the formula:

[0093] % Fluorescent recovery = (Aptamer.GOs2o - GOs2o)/(Aptamer52o - PBS52o)^*100

[0094] Where the subscript 520 denotes fluorescence readings obtained at 520 nm for wells added with the respective reagents.

[0095] The curves were plotted and analyzed using Microsoft Excel and Origin software. Curve fitting was performed using the equation: y_t = yi + y₂ = l₀ - C e^A(-k₀A_t) + k_r ^*t (see above). [0096] The convenience and speed of the current method allows measurements of the parameters l₀ (correlated to surface integrin proteins) and k_r (correlated to integrin recycling rate) for integrin a6, for a range of different cell types- breast cancer ceils (MCF7, MDA-MB-231 , A431 cell lines), human embryonic stem cells (H7 cell line from WiCeil Research Institute, USA), liposarcoma (CRL-3043 cell line), and primary dermal papilla cells (PromoCell, GmbH). Most of the examples have focused on the MCF7 and MDA-MB-231 cell lines. Figure 2 shows that MDA-MB-231 cells exhibit slightly higher k_r and lower i₀ for integrin a6 than MCF7 cells, leading to a higher recycling rate (R). Without being limited to any theory it is proposed that, in addition to gene expression and steady state surface protein levels, the recycling rate would be an important parameter to characterize for integrins and other receptor proteins when investigating invasiveness of cancer cells.

Example 3: Recycling rate response to inhibition of integrin alpha v beta 3

[0097] The integrin ad aptamers were designed as described above. The aptamers were modified with FAM at the 3’ end. Graphene oxide (Single Layer Graphene Oxide, SLGO) was obtained from Cheap Tubes, USA. Cells were obtained from ATCC, USA unless mentioned otherwise. GO was dissolved in Mi!iQ water by vortexing and sonication. A GO concentration of 30 pg/mL and aptamer concentration of 60 nM was used for measurements of integrin recycling rate. Cells were plated at a density of 2 X 10⁵/weil in 96-well plates. Aptamer and GO solutions were mixed at a 1 :1 volume ratio and allowed to stand for 30 min, prior to being added to the cells. 100 pL of aptamer-GO solution was added to each well of the 96-well plate. The plates were transferred to a TECAN Infinite M200 PRO multiplate reader and the fluorescence at 520 nm was read, using an excitation wavelength of 480 nm. The elapsed time between addition of the aptamer-GO solution to the cells and fluorescence reading was noted (ranging between 2 and 4 minutes) and used to obtain the corrected time of reaction. Readings were typically obtained from 0 to 45 minutes, at intervals of 5 minutes. For every experiment, fluorescence readings were also obtained from wells where only phosphate buffered saline (PBS), aptamer or GO were added to the cells, where the reagents were diluted to the same final concentrations as in the aptamer-GO solutions. Percentage fluorescent recovery is calculated according to the formula: [0098] % Fluorescent recovery = (Aptamer.G0₅₂o - GOs2o)/(Aptamer52o - PBSs2o)^*100

[0099] where the subscript 520 denotes fluorescence readings obtained at 520 nm for wells added with the respective reagents.

[00100] The curves were plotted and analyzed using

Microsoft Excel and Origin software. Curve fitting was performed using the equation: y_t = yi + y₂ = l_o - C e^A(-k₀A_t) + k_r ^*t (see above).

[00101] The recycling rate of a particular integrin can be affected by the inhibition of other integrins. 37 nM of cilengitide (MedChem Express, USA), an integrin anb 3 inhibitor, was added to 96-well plates containing MDA and MCF7 cell lines for 90 min, with equivalent cells not exposed to cilengitide acting as controls (n=4). The results are shown in Figure 3. An increase in the integrin «6 recycling rate was observed for both MCF7 and MDA when cilengitide was added. On the other hand, there was a measurable decrease in the surface integrin level (for MDA) upon addition of cilengitide. Lower amounts of surface integrins concomitant with increased internalization and recycling of receptors has also been observed for neural crest cells grown on high concentration laminin substrates [Strachan LR, Condic ML. Cranial neural crest recycle surface integrin proteins in a substratum-dependent manner to promote rapid motility, J. Cell Biol. 167(3) (2004), 545-554] It has also been reported that integrin anb 3 inhibits long loop recycling of the integrin a5bΊ , and inhibition of the former integrin leads to higher rate of integrin adbί trafficking and recycling to the plasma membrane [White DP, Caswell PT, Norman JC. alphavbetaS and alphaSbetal integrin recycling pathways dictate downstream Rho kinase signaling to regulate persistent cell migration, J. Cell Biol 177 (3) (2007), 515-525]. It is possible that a similar mechanism operates for integrin 06 in the current example, leading to downregulation of surface integrin proteins and upregulation of recycling rate, respectively.

Example 4: Recycling rate during hESC self-renewal and differentiation

[001 Q2] The integrin c/6 aptamers were designed and purchased as described above. The aptamers were modified with FAM at the 3’ end. Graphene oxide (Single Layer Graphene Oxide, SLGO) was obtained from Cheap T ubes, USA. Ceils were obtained from ATCC, USA unless mentioned otherwise. GO was dissolved in MiliQ water by vortexing and sonication A GO concentration of 30 pg/mL and aptamer concentration of 60 nM was used for measurements of integrin recycling rate. Cells were plated at a density of 2 X 10⁵/well in 96-well plates. Aptamer and GO solutions were mixed at a 1 :1 volume ratio and allowed to stand for 30 min, prior to being added to the cells. 100 mΐ of aptamer-GO solution was added to each well of the 96-well plate. The plates were transferred to a TECAN Infinite M200 PRO multipiate reader and the fluorescence at 520 nm was read, using an excitation wavelength of 480 nm. The elapsed time between addition of the aptamer-GO solution to the cells and fluorescence reading was noted (ranging between 2 and 4 minutes) and used to obtain the corrected time of reaction. Readings were typically obtained from 0 to 45 minutes, at intervals of 5 minutes. For every experiment, fluorescence readings were also obtained from wells where only phosphate buffered saline (PBS), aptamer or GO were added to the cells, where the reagents were diluted to the same final concentrations as in the aptamer-GO solutions. Percentage fluorescent recovery is calculated according to the formula:

[00103] % Fluorescent recovery = (Aptamer. GO520 -

G052o)/(Aptamers2o - PBSs2o)^*100

[00104] where the subscript 520 denotes fluorescence readings obtained at 520 nm for wells added with the respective reagents.

[00105] The curves were plotted and analyzed using

Microsoft Excel and Origin software. Curve fitting was performed using the equation: y_t = yi + y₂ = l_o - C e^A(-k₀A_t) + k ^*t (see above).

[00106] Integrin a6 has been shown to play an especially important role in maintaining the sternness of both mesenchymal and embryonic stem cells [Yu KR, Yang SR, Jung JW, Kim H, Ko K, Han DW, Park SB, Choi SW, Kang SK, Schdler H, Kang KS. CD49f enhances multipotency and maintains sternness through the direct regulation of OCT4 and SOX2, Stem Cells 30(5) (2012) 876-87]. Thus the regulation of integrin a 6 recycling rate in human embryonic stem cel! (hESC) self-renewal and differentiation was studied. When hESCs were cultured on Matrigel (BD Biosciences, USA), the recycling rate of integrin a6 increased from 20 h to 90 h, which indicated that the self-renewal characteristic of hESCs on Matrigel was being maintained (Figure 4). Such a trend is not obvious from changes in the surface integrin levels alone (corresponding to l₀), underlining the potential value of measuring protein recycling rates in characterizing the cellular phenotype.

Example 5: Recycling rate measurements for Vascular Endothelial Growth Factor Receptor 2 (VEGFR2) and Programmed Death-Ligand 1 (PD-L1)

[00107] VEGFR2 and PD-L1 aptamers were designed according to the sequences identified by Ramaswamy et al. [Ramaswamy V, et al. Nucleic Acid Ther. 2015 Oct; 25(5):227-34], and Lai et al. [Lai WY, et al. Molecular Therapy— Nucleic Acids 5 (2016), e397], respectively, and purchased from Integrated DNA Technologies, USA. The VEGFR aptamer is a nucleic acid set forth in SEQ ID NO. 2:

(GAT GT G AGT GTGT GACG AGCT ACG ACGT CTGGT GT AATTT ATAAAG ACACT GTGTATAT CAACAACAG AACAAG G AAAG GT) . The Kd of the aptamer of SEQ ID NO. 2 is about 0.12 nM. The PDL-1 aptamer is a nucleic acid set forth in SEQ ID NO. 3:

(ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCGT). The Kd of the aptamer of SEQ ID NO. 3 is about 4.7 nM. The aptamers were modified with FAM at the 3’ end. Recycling rate measurements were performed using a GO concentration of 40 //g/mL and 60 //g/mL for the VEGFR2 and PD-L1 aptamers, respectively (Figure 5).

[00108] Cells were plated at a density of 2 X 10⁵/well in 96- well plates. Aptamer and GO solutions were mixed at a 1 :1 volume ratio and allowed to stand for 30 min, prior to being added to the cells. 100 pL of aptamer-GO solution was added to each well of the 96-well plate. The plates were transferred to a TECAN Infinite M200 PRO multiplate reader and the fluorescence at 520 nm was read, using an excitation wavelength of 480 nm. The elapsed time between addition of the aptamer-GO solution to the cells and fluorescence reading was noted (ranging between 2 and 4 minutes) and used to obtain the corrected time of reaction. Readings were typically obtained from 0 to 45 minutes, at intervals of 5 minutes. For every experiment, fluorescence readings were also obtained from wells where only phosphate buffered saline (PBS), aptamer or GO were added to the ceils, where the reagents were diluted to the same final concentrations as in the aptamer-GO solutions. Percentage fluorescent recovery is calculated according to the formula:

% Fluorescent recovery = (Aptamer. GO520 - G O520 )/( Aptam e rs2o - PBSs₂o)^*100

[00109] where the subscript 520 denotes fluorescence readings obtained at 520 nm for wells added with the respective reagents.

[00110] The curves were plotted and analyzed using

Microsoft Excel and Origin software. Curve fitting was performed using the equation: y_t = yi + y₂ = f₀ - C e^A(-k₀A_t) + k_r ^*t (see above).

[00111] The results presented in Figure 6 indicate that, while VEGFR2 recycling rates are comparable for MCF7 and BT474, the PD-L1 recycling rate for BT474 is higher than that of MCF7, despite their surface integrin levels (corresponding to l₀) being similar.

Example 6: Effect of paclitaxel treatment of MCF7 on recycling rates of VEGFR2

[00112] VEGFR2 aptamer design and purchase were as described above. The aptamers were modified with FAM at the 3 end. Recycling rate measurements were performed using a GO concentration of 40 pg/mL and 60 mg/ml for the VEGFR2 and integrin oV aptamers, respectively.

[00113] Ceils were plated at a density of 2 X 10⁵/well in 96- well plates. Aptamer and GO solutions were mixed at a 1 :1 volume ratio and allowed to stand for 30 min, prior to being added to the ceils. 100 pL of aptamer-GO solution was added to each well of the 96-well plate. The plates were transferred to a TECAN Infinite M200 PRO multiplate reader and the fluorescence at 520 nm was read, using an excitation wavelength of 480 nm. The elapsed time between addition of the aptamer-GO solution to the cells and fluorescence reading was noted (ranging between 2 and 4 minutes) and used to obtain the corrected time of reaction. Readings were typically obtained from 0 to 45 minutes, at intervals of 5 minutes. For every experiment, fluorescence readings were also obtained from wells where only phosphate buffered saline (PBS), aptamer or GO were added to the cells, where the reagents were diluted to the same final concentrations as in the aptamer-GO solutions. Percentage fluorescent recovery is calculated according to the formula:

% Fluorescent recovery = (Aptamer. GO520 - GOs2o)/(Aptamer52o - PBSs₂o)^*100

[00114] where the subscript 520 denotes fluorescence readings obtained at 520 nm for wells added with the respective reagents.

[00115] The curves were plotted and analyzed using

Microsoft Excel and Origin software. Curve fitting was performed using the equation: y_t = yi + y₂ = to - C e^A(-k₀A_t) + k_r ^*t (see above).

[00116] Recycling rate measurements were performed using a GO concentration of 40 ^g/mL for the VEGFR2 aptamer. MCF7 cells were treated with 40 nM paclitaxel for a period of 18 h. There was a slight decrease in the recycling rate (R) of VEGFR2 upon treatment with paclitaxel, although the surface protein level appeared to increase (Figure 6).

Example 7

[00117] EPCAM aptamer was designed according to the sequences identified by Macdonald et al. [Macdonald J, et al. ACS Chem Neurosci. 2017 Apr 19;8(4):777~784], and purchased from Integrated DNA Technologies, USA. The EPCAM aptamer is a nucleic acid set forth in SEQ ID NO. 4; (AC AGA GG TTG CGT CTG T). The Kd of the aptamer of SEQ ID NO. 4 is in the range of about 120 nM to 420 nM. The aptamers were modified with FAM at the 3’ end. In the present example, the fluorescence recovery curve was calculated using the formula:

% Fluorescent recovery = (Aptamer.G0₅₂o)/(Aptamer₅₂o)*100

[00118] where the subscript 520 denotes fluorescence readings obtained at 520 nm for wells added with the respective reagents.

[00119] The parameters i₀ and kr are not absolute measurements of surface protein levels and recycling rate, as there is a significant component of fluorescence recovery associated with non-specific adsorption to proteins on the well plate and those present in solution. This is illustrated by making simultaneous measurements of fluorescence recovery for EPCAM aptamer in equilibrium with GO, for EPCAM-expressing (BT474) and non-EPCAM-expressing (MCF7) cell lines (Figure 7A). Due to non-specific fluorescence recovery, the Initial levels of fluorescence recovery are similar for the two cell lines. However, at later time points there is an obvious increase in the rate of fluorescence recovery for BT474, relative to MCF7, which is attributed to EPCAM recycling. Transit of the EPCAM aptamer through the intracellular endosomal system is supported by the gradually decreasing ratio of the BT474 aptamer control fluorescence relative to that of MCF7 after 20 min, due to acidification of the fluorescent moiety in the endosomes. (Figure 7B) A similar decrease in fluorescence due to recycling has been observed by other workers. [Blagojevic Zagorac G, et al. J. Cell Physiol. 232(3) (2017) 463-476]

[00120] Thus, although l₀ and k_r are not absolute values, they are able to reflect the relative differences in the surface levels and recycling rate of membrane proteins respectively, in response to a perturbation in the cellular environment. The following three examples illustrate this point by demonstrating the effect of doxorubicin, folic acid and SPARC on l₀ and k_r measurements (Figures 8-10).

Example 8

[001213 ABCG2 aptamer was designed according to the sequences identified by Palaniyandi et al. [Palaniyandi K, et al. J Cancer Sci Ther; 4(7) (2012) 214-222], and purchased from Integrated DNA Technologies, USA. The aptamers were modified with FAM at the 3’ end. In the present example, the fluorescence recovery curve was calculated using the formula:

% Fluorescent recovery = (Aptamer. G0₅₂o)/(Aptamers₂o)* 100

[001223 where the subscript 520 denotes fluorescence readings obtained at 520 nm for wells added with the respective reagents.

[00123] ABCG2 is a membrane associated protein and a member of the ABC (ATP binding cassette) family of transporters that transport a broad range of endogenous and exogenous compounds (substrates) across the cell membrane in the gut and liver. Figures 8 and 9 show the fluorescence recovery curves obtained for the aptamer-GO system on Caco2 cells, a colon adenocarcinoma cell line that exhibits similar structural and functional features of intestinal epithelial cells, when exposed for 1 h to doxorubicin (DOX) and folic acid (at two concentrations), respectively. In both cases, there is an increase in l₀ and a decrease in k_r upon treatment of cells with the compounds. These results indicate an upregulation of ABCG2 surface expression at the expense of ABCG2 recycling. In drug discovery, the identification of the ABC transporter/transporters for a particular molecule is essential as a determinant of its oral bioavailability. Here, the short-term response of Caco2 cells towards doxorubicin and folic acid in terms of surface expression of ABCG2 and its recycling characteristics provides an indication that the latter two compounds are substrates of ABCG2, which is indeed the case.

Example 9

[00124] The integrin a6 aptamers were designed and purchased as described above. The aptamers were modified with FAM at the 3’ end. Graphene oxide (Single Layer Graphene Oxide, SLGO) was obtained from Cheap T ubes, USA. Cells were obtained from ATCC, USA unless mentioned otherwise. GO was dissolved in MiliQ water by vortexing and sonication. A GO concentration of 30 pg/mL and aptamer concentration of 60 nM was used for measurements of integrin recycling rate. Ceils were plated at a density of 2 X 10⁵/well in 96-well plates. Aptamer and GO solutions were mixed at a 1 :1 volume ratio and allowed to stand for 30 min, prior to being added to the cells. 100 pL of aptamer-GO solution was added to each well of the 96-well plate. The plates were transferred to a TECAN Infinite M200 PRO multiplate reader and the fluorescence at 520 nm was read, using an excitation wavelength of 480 nm. The elapsed time between addition of the aptamer-GO solution to the cells and fluorescence reading was noted (ranging between 2 and 4 minutes) and used to obtain the corrected time of reaction. Readings were typically obtained from 0 to 45 minutes, at intervals of 5 minutes. For every experiment, fluorescence readings were also obtained from wells where only phosphate buffered saline (PBS), aptamer or GO were added to the cells, where the reagents were diluted to the same final concentrations as in the aptamer-GO solutions. Percentage fluorescent recovery is calculated according to the formula:

% Fluorescent recovery = (Aptamer. GO520 - G052o)/(Aptamers2o - PBSs2o)^*100 [00125] where the subscript 520 denotes fluorescence readings obtained at 520 nm for wells added with the respective reagents.

[00126] The curves were plotted and analyzed using

Microsoft Excel and Origin software. Curve fitting was performed using the equation: y_t = yi + Y2 = io - C e^A(-k₀A_t) + k_r ^*t (see above).

[00127] SPARC belongs to a class of matricellular protein that promote a non-adhesive cellular state. SPARC treatment leads to the disassembly of focal adhesions, which are protein complexes which mediate interaction of cells with the extracellular matrix. Focal adhesion disassembly has also been shown to be accompanied by downregulated expression of integrins. When MCF7 cells were treated with SPARC for 1 h, and subjected to recycling measurements using integrin a6 aptamer- GO system, a significant decrease in l₀ was observed, indicating a reduced surface expression of the integrin (Figure 10).

Example 10: Other applications

[00128] As suggested in Example 2, a potentially useful application of the present method would be for analysis of cancer samples (e.g. obtained from biopsies), to characterize the invasiveness of the cancer. As the method is non destructive, the cells couid be employed for other analyses, thus saving valuable clinical specimens.

[00129] Besides integrins, the present method of measuring protein recycling rate can be applied to other membrane proteins such as G- protein coupled receptors, including serotonin, dopamine, GABA, and glutamate receptors, receptor tyrosine kinases, for example VEGFR, EGFR, FGFR and PDGF receptors, and immune checkpoint receptors, for example, PD-1 and CTLA-4.

[00130] Compared to existing methods, the present method for determination of membrane protein recycling is more amenable to automation and multiplexing in the form of a machine. The following steps can be automated:

a. Removal of media from wells

b. Dispensing of aptamer-GO and control solutions into the wells. These solutions may comprise aptamers (probes) for different membrane proteins, which are transferred from a manually prepared ^'reservoir' of corresponding format (e.g. 96-well plate).

c. Reading of fluorescence at regular time intervals for a determined duration (e.g. every 5 mins for 45 min)

d. Removal of reagents and replacement with media, allowing continuous culture of the cells

e. Averaging of readings and plotting of percentage fluorescence recovery vs time curve

f. Curve fitting and determination of l₀, k_r and R parameters Example 11 : Optimization of Graphene Oxide concentration

[00131] Integrin a 6 recycling rate measurements using a different aptamer-GO preparation, on cells.

k_f

GO-aptamer complex ·?— 60 + aptamer ÷ integrin fntegrin-aptamer complex

[00132] The dissociation constant for the GO-aptamer complex,

K_d (GO-aptamer) = [A}{GO]/[GO-A]~- (I)

[00133] From (l), at higher GO concentrations (>30pg/ml), aptamer concentrations are lower; †[GO] [A] whereby at low aptamer and target membrane protein concentrations, the rate of complex formation is less than the rate of dissociation;

K_r[A][l] < k_d[l-A]

[00134] As a result, the concentration of target membrane protein must achieve a threshold level before a aptamer-protein complex forms, i.e. when

Kr[A][l] > kd[i-A]

[00135] This leads to a delayed fluorescence increase (lag) at GO concentrations greater than SOpg/ml (Figure 11 ). [00136] Conversely, at lower GO concentrations (<

30pg/ml), aptamer concentrations are higher. |[GO]† [A] . The rate of aptamer-protein complex formation (= K_t[A][l]) is correspondingly higher, leading to higher fluorescence recovery values. This is also reflected in the calculated l₀ values, which indicate fluorescence levels corresponding to surface integrin proteins (Figure 12).

[00137] However, as both the free aptamer [A] and the complex [l-A] are fluorescent, use of higher GO concentrations (>30pg/ml) would lead to an overestimation of surface integrin protein levels (l₀ component).

[00138] In summary, a GO concentration is selected

(30pg/ml for the current GO type), that yields just enough free aptamer to form the protein- aptamer complex efficiency, but not much higher, to minimize background fluorescence due to the free aptamer.

Example 12: Integrin «6 recycling measurements using different aptamer-GO preparations, on other cells.

[00139] While 30 //g/mL GO was determined as the optimal concentration for the described experiments, the optimal concentration for any GO type would depend on its conditions of preparation, which would in turn affect its particle size, surface area and Carbon to Oxygen ratio. For example, an earlier GO preparation at a concentration of 60 //g/mL was deemed to be an optimal concentration, and used to measure the integrin a?6 recycling rate for epidermoid carcinoma (A431 ), dermal papilla (DP), and ductal carcinoma (BT474) and liposarcoma (CRL-3043) cell lines (Figures I S IS), where each figure corresponds to separate experiments. The aptarner concentration used was 60 nM.

[00140] Using the same 60pg/ml GO preparation, two aptamer concentrations (60 nM and 120 nM) were used to measure the recycling rate for a liposarcoma (CRL-3043) cell line (Figure 16). The same value of K_r, the fluorescence recovery corresponding to protein recycling was obtained. However, l₀, the fluorescence recovery corresponding to surface integrin proteins was almost 2-fold higher when 120 nM aptamer was used. As this would lead to an overestimation of surface integrin protein levels (l₀ component), 60 nM is deemed to be the more optimal aptamer concentration. Example 13: Fluorescence measurements

[00141] Fluorescence emission is measure over a range of wavelengths from 515nm to 525nm every 3-4 minute intervals as depicted in table 1 and table 2. Fluorescence emission was measured at 516nm, 518nm, 520nm, 522nm and 524nm. The results across the range at each time point can then be averaged.

Table 1 : Fluorescence emission measured over a range of wavelengths

Table 2: Fluorescence emission measured over a range of wavelengths

Example 14

initial measurements before calculation [00142] The integrin a6 aptamer was designed and purchased as described above. The aptamers were modified with FAM at the 3’ end. Graphene oxide (Single Layer Graphene Oxide, SLGO) was obtained from Cheap Tubes, USA. Three epithelial cell lines breast cancer cell line (MCF7) adenocarcinoma, breast adenocarcinoma (MDA-MB231 ), and colorectal adenocarcinoma (DLD1 ) were obtained from ATCC, USA. GO was dissolved in MiliQ water by vortexing and sonication. A GO concentration of 60 pg/mL and aptamer concentration of 60 nM was used. Cells were plated at a density of 2 X 10⁴/well in 96-well plates. Aptamer and GO solutions were mixed at a 1 11 volume ratio and allowed to stand for 30 min, prior to being added to the cells. 100 pL of aptamer-GO solution was added to each well of the 96-well plate. The plates were transferred to a TECAN Infinite M200 PRO multiplate reader and the fluorescence emission in the range of 516nm to 524nm was read at different time points, using an excitation wavelength of 480 nm. For every experiment, fluorescence readings were also obtained from wells where only phosphate buffered saline (PBS), aptamer or GO were added to the cells, where the reagents were diluted to the same final concentrations as in the aptamer-GO solutions.

Table 3: Fluorescence emission is measured over a range of wavelengths in 3 different cell lines

WtOA tACr? DIO

146 161,5 166.5

195.5 225 217.5

id 218.5 2465 252

r- 245 223 266

20 263 zms 284.5

i ¾ 26S MB 307

30 258.5 31? s s

45 325.5 356

60 348 ms 387.5

110 484 4S6 446

[00143] The cells were measured again after 1 hour and after 24 hours of incubation with the aptamer-GO complexes. The results are depicted in Figure 18A and B. From the results it is apparent that the levels of integrin a6b4 have decreased after 24 hours. If fact the levels had already started to drop after 1 hour. This observation concurs with previous reports that the level integrin proteins decrease in the presence of extra cellular matrix A further experiment was carried out using a cell line (HDF) that doesn’t express integrin a6b4 as a control (Figure 18C).

Example 15

Quantification of integrin a6b4 levels on epithelial cancer celt lines

[00144] Cells were placed in a 4°C refrigerator for 15 minutes prior to removal of media and addition of 10OmI of reagent to each well of a 98 well plate. The plate was then replaced at 4°C for a further 15 minutes until the next reading.

[00145] The results were plotted and a tangent was drawn on the curve at 10 to 25 minutes (average 15 minutes). At this point of time a steady state appeared to have been established in the process of integrin binding and recycling interactions. After 25 minutes the fluorescence continues to increase, however, the rate is lower due to the depletion of aptamer in solution. Thus the intercept of the tangent with the y axis would yield the amount corresponding to the relative number of integrin receptors on the cell membrane at steady state. Applied to the curves of the MDA, MCF7 and DLD cells gave approximate values of 175, 220 and 220, respectively (Figure 19).

[00146] As it was reported by Berg et al [Berg K, Mol Ther

Nucleic Acids 5 (2016) e294] that no uptake and recycling of the aptamers occurs at 4°C, measurement of integrin levels using the present aptamer-GO system on cells at 4°C was expected to yield the relative basal number of integrin proteins on the cells. The values obtained for the cell lines at 15 minutes corresponded very well with the steady state levels calculated using the tangent method respectively (Figure 20)

[00147] It should be further appreciated by the person skilled in the art that variations and combinations of features described above, not being alternatives or substitutes, may be combined to form yet further embodiments falling within the intended scope of the invention.

Claims

Claims:

1. A method for determining a protein recycling rate of a target cell membrane protein comprising:

a) conjugating a fluorophore to a single stranded oligonucleotide having a high binding affinity and specificity to the target cell membrane protein;

b) applying a test mixture of a fluorescence quencher and the conjugated single stranded oligonucleotide to a predetermined density of cells;

c) exciting the cells with a light wavelength specific to the fluorophore;

d) measuring an emitted fluorescence at a longer wavelength than the light wavelength specific to the fluorophore within a range specific to the fluorescence emission of the fluorophore at predetermined time points;

e) plotting an amount of fluorescence measurements over time;

f) determining a value representing an amount of target protein present on the cell membrane; and

g) determining a rate of fluorescence change of a curve of the plotted fluorescence measurements wherein the rate of fluorescence change of the curve indicates the protein recycling rate of the target cell membrane.

2. The method according to claim 1 , wherein prior to f) the fluorescence measurements are normalized with a control emitted fluorescence at a longer wavelength than the light wavelength specific to the fluorophore within a range specific to the fluorescence emission of the fluorophore at predetermined time points in control cel! samples.

3. The method according to claim 2, wherein the control cell samples comprise a first control mixture of the fluorescence quencher and the predetermined density of cells.

4. The method according to claim 2 or 3, wherein the control cell samples comprise a second control mixture of the single stranded oligonucleotide having a high binding affinity and specificity to the target cell membrane protein conjugated to the fluorophore and the predetermined density of cells and a control emitted fluorescence is calculated as the emitted fluorescence measured in the second control mixture minus emitted fluorescence measured in a third control mixture of the predetermined density of cells in a physiological buffer.

5. The method according to claim 4, wherein the amount of fluorescence measurements is a percentage determined as the emitted fluorescence measured in d) minus the emitted fluorescence measured in the first control mixture, the divided by the control emitted fluorescence measured in claim 4 multiplied by 100.

6. The method according to claim 2, wherein the control ceil samples comprise a second control mixture of the single stranded oligonucleotide having a high binding affinity and specificity to the target cell membrane protein conjugated to the fluorophore and the predetermined density of cells and a second control emitted fluorescence is calculated as the emitted fluorescence measured in the second control mixture.

7. The method according to claim 6, wherein the amount of fluorescence measurements is a percentage determined as the emitted fluorescence measured in d) divided by the second control emitted fluorescence measured in claim 6 multiplied by 100.

8. The method according to any one of claims 1 to 7, further comprises

determining the optimum concentration of the fluorescence quencher.

9. The method according to any one of claims 1 to 8, wherein the fluorescence quencher is graphene oxide.

10. The method according to any one of claims 1 to 9, wherein the target protein is selected from the group consisting of integrin protein, ABC transporter protein, cell signaling protein, and check point receptor protein.

11. The method according to any one of claims 1 to 10, wherein the fluorophore comprises 5(6)-carboxyfluorescein, the light wavelength specific to the fluorophore for excitation is 480nm and the range specific to the fluorescence emission of the fluorophore is between 515nm to 525nm.

12. The method according to any one of claims 1 to 11 , wherein the single stranded oligonucleotide comprises a ribonucleic acid aptamer.

13. The method according to any one of claim 1 to 12, further comprising comparing the value representing an amount of target protein present on the cell membrane and the protein recycling rate of the target cell membrane protein between a test mixture and a test mixture with a test compound added thereto, wherein a difference in the value representing an amount of target protein present on the cell membrane and/or the protein recycling rate of the target cell membrane indicates the test compound is a substrate for the target cell membrane protein or a protein associated with the target cell membrane protein.

14. A system for determining a protein recycling rate of a target membrane protein comprising:

a) a complex of a single stranded oligonucleotide having a high binding affinity and specificity to the target cell membrane protein and a fluorophore conjugated thereto; b) a fluorescence quencher;

c) a light source for emitting a predetermined amount of light at a light wavelength specific to the fluorophore;

d) a fluorescence sensor for detecting the emitted fluorescence at a longer wavelength than the light wavelength specific to the fluorophore within a range specific to the fluorescence emission of the fluorophore; and

e) a processing unit operable to obtain a dataset of fluorescence measurements and plot the dataset over time determining a value representing an amount of target protein present on the cell membrane;

wherein the processing unit is further operable to determine a rate of fluorescence change of a curve of the plotted fluorescence measurements wherein the rate of fluorescence change of the curve indicates the protein recycling rate of the target cel! membrane.

15. The system of claim 14, further comprises a container for holding cells in proximity to the light source and the fluorescence sensor.

16. The system according to claims 14 or 15, wherein the fluorescence quencher is graphene oxide.

17. The system according to any one of claims 14 to 16, wherein the fluorophore comprises 5(6)-carboxyfluorescein, the light wavelength specific to the fluorophore for excitation is 480nm and the range specific to the fluorescence emission of the fluorophore is between 515nm to 525nm.

18. The system according to any one of claims 14 to 17, wherein the single stranded oligonucleotide comprises a ribonucleic acid aptamer.