WO2019151836A1 - Oncolytic vaccinia virus expressing an immune checkpoint protein antagonist to treat cancer - Google Patents

Abstract

The present invention provides replicative oncolytic vaccinia virus expressing and an immune checkpoint protein inhibitor as well as methods of using the virus for treating and/or preventing cancer. Also provided are pharmaceutical compositions as well as kits comprising a pharmaceutical composition for using in methods for treating and/or preventing cancer.

Description

ONCOLYTIC VACCINIA VIRUS EXPRESSING AN IMMUNE CHECKPOINT PROTEIN ANTAGONIST TO TREAT CANCER

This application claims the benefit of U.S. Provisional Patent Application No. 62/626,587, filed on February 5, 2018, all of which is incorporated herein by reference in its entirety.

The present invention relates to a replicative oncolytic vaccinia virus expressing an immune checkpoint protein antagonist(s), and methods and compositions for using such vaccinia viruses in the treatment of cancer.

Normal tissue homeostasis is a highly regulated process of cell proliferation and cell death. An imbalance of either cell proliferation or cell death can develop into a cancerous state. For example, cervical, kidney, lung, pancreatic, colorectal, and brain cancer are just a few examples of the many cancers that can result. In fact, the occurrence of cancer is so high that over 500,000 deaths per year are attributed to cancer in the United States alone.

Replication-selective oncolytic viruses hold promise for the treatment of cancer. These viruses can cause tumor cell death through direct replication-dependent and/or viral gene expression-dependent oncolytic effects. However, immune suppression by tumors and premature clearance of the virus often result in only weak tumor-specific immune responses, limiting the potential of these viruses as a cancer therapeutic.

There remains a need for improved oncolytic virus cancer therapies, in particular those expressing immune checkpoint protein antagonists (e.g., immune checkpoint protein inhibitors).

The present invention provides a replicative oncolytic vaccinia virus expressing an immune checkpoint protein antagonist(s), and methods for using such vaccinia viruses in the treatment of cancer.

The present invention provides method for treating cancer in a subject in need thereof comprising administering to the subject an effective amount of a replicative oncolytic vaccinia virus expressing an immune checkpoint protein antagonist(s), wherein the antagonist is a PD-1 antagonist or a PD-L1 antagonist, and wherein the antagonist is capable of binding to a protein expressed in the subject.

The present invention also provides a pharmaceutical composition for using in methods for treating cancer in a subject, comprising a replicative oncolytic vaccinia virus expressing an immune checkpoint protein antagonist(s), wherein the antagonist is a PD-1 antagonist or a PD-L1 antagonist, and wherein the antagonist is capable of binding to a protein expressed in the subject.

In some embodiments, the immune checkpoint antagonist is an antibody.

In some embodiments, the antagonist is an anti-PD-1 antibody or PD-1 binding protein.

In some embodiments, the anti-PD-1 antibody or PD-1 binding protein comprises:

a) a heavy chain variable region comprising:

i) a first CDR comprising SEQ ID NO: 2;

ii) a second CDR comprising SEQ ID NO: 3;

iii) a third CDR comprising SEQ ID NO: 4; and

b) a light chain variable region comprising:

i) a first CDR comprising SEQ ID NO: 6;

ii) a second CDR comprising SEQ ID NO: 7;

iii) a third CDR comprising SEQ ID NO: 8.

In some embodiments, the heavy chain comprises SEQ ID NO: 1. In some embodiments, the light chain comprises SEQ ID NO: 5. In some embodiments, the heavy chain comprises SEQ ID NO:1 and the light chain comprises SEQ ID NO: 5.

In some embodiments, the anti-PD-1 antibody or PD-1 binding protein comprises:

a) a heavy chain variable region comprising:

i) a first CDR comprising SEQ ID NO: 10;

ii) a second CDR comprising SEQ ID NO: 11;

iii) a third CDR comprising SEQ ID NO: 12; and

b) a light chain variable region comprising:

i) a first CDR comprising SEQ ID NO: 14;

ii) a second CDR comprising SEQ ID NO: 15;

iii) a third CDR comprising SEQ ID NO: 16.

In some embodiments, the heavy chain comprises SEQ ID NO: 9. In some embodiments, the light chain comprises SEQ ID NO: 13. In some embodiments, the heavy chain comprises SEQ ID NO: 9 and the light chain comprises SEQ ID NO: 13.

In some embodiments, the anti-PD-1 antibody or PD-1 binding protein comprises:

a) a heavy chain variable region comprising:

i) a first CDR comprising SEQ ID NO: 18;

ii) a second CDR comprising SEQ ID NO: 19;

iii) a third CDR comprising SEQ ID NO: 20; and

b) a light chain variable region comprising:

i) a first CDR comprising SEQ ID NO: 22;

ii) a second CDR comprising SEQ ID NO: 23;

iii) a third CDR comprising SEQ ID NO: 24.

In some embodiments, the heavy chain comprises SEQ ID NO: 17. In some embodiments, the light chain comprises SEQ ID NO: 21. In some embodiments, the heavy chain comprises SEQ ID NO: 17 and the light chain comprises SEQ ID NO: 21.

In some embodiments, the antagonist is an anti-PD-L1 antibody or PD-L1 binding protein.

In some embodiments, the anti-PD-L1 antibody or PD-L1 binding protein comprises:

a) a heavy chain variable region comprising:

i) a first CDR comprising SEQ ID NO: 26;

ii) a second CDR comprising SEQ ID NO: 27;

iii) a third CDR comprising SEQ ID NO: 28; and

b) a light chain variable region comprising:

i) a first CDR comprising SEQ ID NO: 30;

ii) a second CDR comprising SEQ ID NO: 31;

iii) a third CDR comprising SEQ ID NO: 32.

In some embodiments, the heavy chain comprises SEQ ID NO: 25. In some embodiments, the light chain comprises SEQ ID NO: 29. In some embodiments, the heavy chain comprises SEQ ID NO: 25 and the light chain comprises SEQ ID NO: 29.

In some embodiments, the oncolytic vaccinia virus expresses an antagonist(s) of PD-1 and an antagonist of PD-L1 in an infected cell.

In some embodiments, the immune checkpoint antagonist is a single chain variable fragment (scFv). In some embodiments, the scFV comprises a linker. In some embodiments, the linker is selected from the group consisting of GLGGLGGGGSGGGGSGGSSGVGS, GGGGS, GGGGSGGGGS, GGGGSGGGGSGGGGS, and (GGGGS)n, wherein n is an integer from 1 to 5. In some embodiments, the scFv is an anti PD-1 scFv (2B9) encoded by SEQ ID NO: 49. In some embodiments, the scFv is an anti PD-L1 scFv (4F5) encoded by SEQ ID NO: 50.

In some embodiments, the immune checkpoint protein antagonist is expressed as a secretory protein or as a membrane bound protein comprising a transmembrane domain from a PDGF receptor or other type 1 membrane proteins for the purpose of displaying the antagonist on the surface of cells.

In some embodiments, the membrane bound protein is a single chain variable fragment (scFv) blocking PD-1.

In some embodiments, the membrane bound protein is a single chain variable fragment (scFv) blocking PD-L1.

In some embodiments, the oncolytic vaccinia virus expresses an antibody or binding fragment to TCR thereof. An anti-CD3 antibody or binding fragment comprises a transmembrane domain, for example, a transmembrane domain from a PDGF receptor or CD8 for the purpose of protruding the protein or fragment embedded in a cell membrane.

In some embodiments, the oncolytic vaccinia virus expresses B7 protein or its active fragment or CD40 or its active fragment. B7 protein or CD40 or their active fragment comprises a transmembrane domain, for example, a transmembrane domain from a PDGF receptor or CD8 for the purpose of protruding the protein or fragment embedded in a cell membrane.

In some embodiments, the expression of the antagonist by the vaccinia virus is under the control of a posttranscriptional regulatory element (PRE), preferably Woodchuck Hepatitis virus PRE or Hepatitis B virus PRE.

In some embodiments, the vaccinia virus also expresses a cytokine selected from GM-CSF, IL-2, IL-4, IL-5 IL-7, IL-12, IL-15, IL-21, IFN-γ, TNF-α, preferably selected from IFN-γ, TNF-α, IL-2, GM-CSF and IL-12.

In some embodiments, the vaccinia virus also expresses a tumor antigen selected from BAGE, GAGE-1, GAGE-2, CEA, AIM2, CDK4, BMI1, COX-2, MUM-1, MUC-1, TRP-1 TRP-2, GP100, EGFRvIII, EZH2, LICAM, Livin, Livinβ, MRP-3, Nestin, OLIG2 , SOX2, human papillomavirus-E6, human papillomavirus-E7, ART1, ART4, SART1, SART2, SART3, B-cyclin, β-catenin, Gli1, Cav-1, cathepsin B, CD74, E-cadherin, EphA2/Eck, Fra-1/Fosl 1, Ganglioside/GD2, GnT-V, β1,6-N, Her2/neu, Ki67, Ku70/80, IL-13Ra2, MAGE-1, MAGE-3, NY-ESO-1, MART-1, PROX1, PSCA, SOX10, SOX11, Survivin, caspase-8, UPAR, CA-125, PSA, p185HER2, CD5, IL-2R, Fap-α, tenascin, melanoma-associated antigen p97, and WT-1.

In some embodiments, the oncolytic vaccinia virus is TK-deficient. In some embodiments, the oncolytic vaccinia virus comprises a VGF deletion. In some embodiments, the oncolytic vaccinia virus is a Western Reserve (WR), Wyeth, Copenhagen or Lister strain. In some embodiments, the oncolytic vaccinia virus is a WR strain, preferably TK-deficient and/or comprising a VGF deletion. In some embodiments, the oncolytic vaccinia virus is a Wyeth strain, preferably TK-deficient.

In some embodiments, the cancer is selected from the group consisting of melanoma, hepatocellular carcinoma, renal cancer, head and neck cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, mesothelioma, gastrointestinal cancer, leukemia, colorectal, and thyroid cancer.

In some embodiments, the subject has failed at least one previous chemotherapy or immunotherapy treatment.

In some embodiments, the subject has a cancer that is refractory to an immune checkpoint inhibitor therapy.

In some embodiments, the subject is identified as a candidate for an immune checkpoint inhibitor therapy.

In some embodiments, the method comprises administering to the subject an additional therapy selected from chemotherapy (alkylating agents, nucleoside analogs, cytoskeleton modifiers, cytostatic agents) and radiotherapy.

In some embodiments, the method comprises administering to the subject an additional oncolytic virus therapy (e.g., rhabdovirus, Semliki Forest Virus).

In some embodiments, the method comprises measuring the level of at least one Th1 biomarker (e.g., IL-2, IL-12, IFN-γ) in a sample (e.g., blood) obtained from the subject before administering a first dose of the oncolytic vaccinia virus to the subject and in at least two samples obtained from the subject at a first time point and a second time point after administering a first dose of the oncolytic vaccinia virus to the subject. In some embodiments, an increase in the level of at least one Th1 biomarker in a sample obtained from the subject at the first or second time point compared to the level of at least one Th1 biomarker in a sample obtained from the subject before administering a first dose of the oncolytic vaccinia virus indicates that the subject is responding to the oncolytic vaccinia virus therapy. In some embodiments, an increase in the level of at least one Th1 biomarker in a sample obtained from the subject at the second time point compared to the level of at least one Th1 biomarker in a sample obtained from the subject at the first time point indicates that the subject is responding to the oncolytic vaccinia virus therapy.

Figure 1. Schematic diagram of vaccinia virus encoding anti-PD-(L)1 scFv was illustrated. The vaccinia virus was derived from a commonly used vaccinia strain, Wyeth (Wy) or Western Reserve (WR). The entire vaccinia thymidine kinase (J2R) gene was replaced by a transgene under the control of the vaccinia synthetic early/late promoter. All immune modulator genes, such as anti-PD-1 scFv or anti-PD-L1 scFv were inserted as the monomeric scFv fragment with an albumin leader sequence at their N-terminus and the scFvs followed by 6X-His tag.

TK gene was replaced with anti PD-L1 scFv or anti PD-1 scFv genes and resulted in viruses expressing scFv such as WR ΔTK-anti PD-1 scFv, WR ΔTK-anti PD-L1scFv, and Wy ΔTK-anti PD-1 scFv, Wy ΔTK-anti PD-L1 scFv. In addition, TK gene was replaced with anti PD-L1 scFv in the virus where 2 copies of VGF were completely removed to produce WR ΔTK, ΔVGF-anti PD-L1 scFv (see Exmaple 1).

Figure 2. The genomic DNA extracted from recombinant viral plaque was amplified by PCR reaction and loaded on 1% agarose gel to confirm the PCR product size. The PCR product band targeting J1R to J3R locus of WR ΔTK αPD-L1 scFv was displayed at the expected size (2.2 kb). The wild type backbone virus was used as a control and the band was detected at 1.7 kb, which is the expected size of J2R flanked by J1R and J3R. J1R to J2R locus of WR ΔTK αPD-L1 scFv was amplified and loaded on 1% agarose gel as well. Since the reverse primer was designed from J2R gene, no band signal was detected as expected and deletion of J2R region was confirmed (see Example 2).

Figure 3. To obtain precise sequence information of WR ΔTK αPD-1 scFv and WR ΔTK αPD-L1 scFv, genomic DNA extracted from recombinant viral plaque was amplified by PCR reaction (Forward: ctctagctaccaccgcaatagatcc, Reverse: gcgacctcatttgcactttctgg). Various sequencing primers were used as needed. All sequence data obtained were compared with given scFv sequences and transgene locus matched with the expected sequences of scFv. The inserting cassettes were resided in between J1R and J3R loci deleting whole J2R gene as designed (see Example 2).

Figure 4. The expression of secreted scFv protein was detected by anti His antibody. The host cell line U-2 OS was infected with WR ΔTK αPD-L1 scFv at 3 MOI and a culture supernatant was collected 24 hours post-infection. The wild type backbone virus was used as a control. The His tagged protein was detected by HRP conjugated primary antibody and the band was clearly visible at the expected size (25 - 35 kDa). The signal intensity of the bands of interest was quantified and the amount of scFv protein present in the culture supernatant was approximately 16 times higher than that in a cell pellet when it normalized to its expression from the cell pellet (see Example 3).

Figure 5. The secreted scFv protein from infected cells was quantified by His-tag ELISA (see Example 4).

A. The amount of His tagged scFv from U-2 OS cells, which were infected with WR ΔTK αPD-L1 scFv with 3 MOI at 24hpi was measured by ELISA. The culture supernatant and cells were harvested 24hpi and supernatant and cell lysates were applied to an ELISA plate which was coated with an antibody against His tag.

B. The amount of scFv secreted to the culture media was quantified at 72 hpi in HeLaS3 cells with a serial diluted virus starting from 3 MOI to 0.003 MOI by His tag ELISA.

C. The amount of secreted scFv was also quantified with several time points from 2 hpi to 96 hpi in HeLaS3 cells infected with WR ΔTK αPD-L1 scFv with 3 MOI and 0.03 MOI by His tag ELISA. B and C experimental results were obtained from 3 independent experiments.

Figure 6. A. A replication rate of vaccinia virus expressing anti PD-L1 scFv was evaluated by plaque assay. Viruses harvested from infected CT26, RENCA, and HeLaS3 cells at 2, 8, 24, 48, and 72 hpi were applied to U-2 OS cells and the number of plaque was counted. The replication rate of WR ΔTK anti PD-L1 scFv was compared with those of Vaccinia virus (Western Reserve strain) with TK deletion expressing mGM-CSF-GFP or hGM-CSF-GFP in addition to wild type Vaccinia virus WR strain. B. Cell viability of H460 infected by WR ΔTK anti PD-L1scFv with a serial dilution of the virus at 24, 48, and 72hpi was assessed using Cell Counting Kit-8 (see Example 5).

Figure 7. Proteins from each of the purification steps were analyzed by SDS-PAGE followed by Coomassie blue staining. To demonstrate the purification processes of anti PD-L1 scFv from infected HeLaS3 cells using His column, the media and lysates of HeLaS3 cells, which were infected with MOI=0.03 at 72 hpi, were passed through a His TALON column. The column was washed with a washing buffer and the bound scFv was eluted from the column with the buffer containing imidazole. Small amounts of each sample were aliquoted and ran on SDS-PAGE followed by Coomassie blue staining. Lane 1: whole cell lysate, Lane 2: filtrate, Lane 3: 1^st washing, Lane 4: 2^nd washing, Lanes 5-9: eluted samples, Lane 10: sample after desalting with PD-10 column, and Lane 11: sample after filtration with 0.22um filter (see Example 6).

Figure 8. The purified anti PD-L1 scFv (A) and anti PD-1 scFv (B) were incubated with HEK293T cells, which were transfected with PD-L1 or PD-1 cDNA. The cells were fixed and incubated with a primary rabbit antibody against anti PD-L1 or anti PD-1 and a mouse antibody against His. The secondary antibodies, RFP and GFP conjugated antibodies against rabbit and mouse, were further incubated for detection of PD-L1 or PD-1 and his-tagged scFv, respectively. Arrows indicated the double labeled PD-L1 ligand and His tagged anti PD-L1 scFv, or the double labeled PD-1 ligand and His tagged anti PD-1 scFv (see Example 7).

Figure 9. The blocking activity of anti PD-L1 scFv or anti PD-1 scFv for PD-1/PD-L1 interaction was measured. Purified anti PD-L1 scFv (A) or anti PD-1 scFv (B) from virus infected HeLaS3 cells was incubated with pre-plated PD-L1 aAPC/CHO-K1 cells according to the Manufacturer’s instructions (Promega). PD-1 effector cells (Promega) were dispensed to each well and incubated afterward. The luminescence resulting from the blockade of PD-1/PD-L1 interaction by anti PD-L1 scFv or anti PD-1 scFv was measured. The blocking activity of scFv was compared with the corresponding whole antibody and anti PD-1 antibody provided by the manufacturer (Promega). The standard curve and EC₅₀ value were determined using the software, GraphPadPrism. The mean value of EC₅₀ was obtained from 3 independent experiments (see Example 8).

Figure 10. The effect of anti PD-L1 scFv on cytotoxicity of cancer cells was measured by luciferase activity in cancer cells. H460, A549, and PANC-1 cells, which were transfected with plasmid encoding anti-CD3 receptor, CD80, and luciferase genes, were co-cultured with CD8+ T cells with a 1:1 ratio of effector:target cells in the presence or absence of 100nM anti PD-L1 scFv for 24 hours. Luciferase activity was measured and converted to the percentage of lysed cells (see Example 9).

Figure 11. PD-1 antibody sequences. VH and VL sequences are shown for: A) PD1-45D6 heavy chain (SEQ ID NO: 1); B) PD1-45D6 light chain (SEQ ID NO: 5); C) PD1-49A2 heavy chain (SEQ ID NO: 9) and PD1-49A2 light chain (SEQ ID NO: 13); D) PD1-49A2_2B9 heavy chain (SEQ ID NO: 17); and E) PD1-49A2_2B9 light chain (SEQ ID NO: 21). CDR1, CDR2, and CDR3 sequences are identified for each chain.

Figure 12. PD-L1 antibody sequences. VH and VL sequences are shown for: A) PDL1-16E12(LS/4F5) heavy chain (SEQ ID NO: 25) and B) PDL1-16E12(LS/4F5) light chain (SEQ ID NO: 29). CDR1, CDR2, and CDR3 sequences are identified for each chain.

I. Introduction

The present invention provides replicative oncolytic vaccinia virus expressing an immune checkpoint protein inhibitor(s) (e.g., an immune checkpoint antagonist(s)), wherein the antagonist is a PD-1 (e.g., inhibitor) or a PD-L1 antagonist (e.g., inhibitor), as well as methods of using the virus for treating and/or preventing cancer by administering an effective amount of the replicative oncolytic vaccinia virus to a subject. In some embodiments, the PD-1 antagonist or a PD-L1 antagonist is capable of binding to a protein expressed in the subject. Also provided are pharmaceutical compositions as well as kits comprising the pharmaceutical composition for using in methods for treating and/or preventing cancer.

Other embodiments of the invention are discussed throughout this application. Any embodiment discussed with respect to one aspect of the invention applies to other aspects of the invention as well and vice versa. The embodiments in the Example section are understood to be embodiments of the invention that are applicable to all aspects of the invention.

Ⅱ. Select Definitions

The terms "inhibiting," "reducing," or "prevention," or any variation of these terms, when used in the claims and/or the specification includes any measurable decrease or complete inhibition to achieve a desired result.

As used herein, the term "combination" means the combined administration of more than one agents, for example, the oncolytic vaccinia virus and another anti-cancer agent which can be dosed independently or by the use of different fixed combinations with distinguished amounts of the combination partners. The term "combination" also defines a "kit" comprising the combination partners which are to be administered simultaneously. Preferably, the time intervals between consecutive simultaneous administrations of the combination partners are chosen such that the combination of agents shows a synergistic effect.

As used herein, the term "synergistic" or "synergy" means that the effect achieved is greater than the sum of the effects from a comparative experiment. For example, the results achieved from administration of the replicative oncolytic vaccinia virus expressing the PD-1 antagonist or the PD-L1 antagonist provides a greater effect that administration of the oncolytic vaccinia virus and/or the PD-1 antagonist alone and/or the PD-L1 antagonist alone. Advantageously, such synergy provides greater efficacy at the same doses, and/or prevents or delays the build-up of multi-drug resistance.

The term "refractory cancer," as used herein refers to cancer that either fails to respond favorably to an anti-neoplastic treatment, or alternatively, recurs or relapses after responding favorably to an antineoplastic treatment. Accordingly, "a cancer refractory to a treatment" as used herein means a cancer that fails to respond favorably to, or resistant to, the treatment, or alternatively, recurs or relapses after responding favorably to the treatment. For example, such a prior treatment may be a chemotherapy regimen or may be an immunotherapy regimen comprising administration of a monoclonal antibody that specifically binds to PD-1 and/or PD-L1. In some embodiments, the cancer to be treated is a cancer refractory to treatment with an anti-PD-1 antibody and/or an anti-PD-L1 antibody. In some embodiments, the cancer to be treated is a cancer refractory to treatment with an anti-PD-1 antibody. In some embodiments, the cancer to be treated is a cancer refractory to treatment with an anti-PD-L1 antibody.

The term "antibody" or "antibodies" and/or variants thereof as used herein encompasses naturally occurring and engineered antibodies as well as full length antibodies or functional fragments or analogs thereof that are capable of binding e.g., the target immune checkpoint or epitope (e.g., retaining the antigen-binding portion), including single chain Fv (scFv). In some embodiments, the immune checkpoint protein antagonist is an antibody. In some embodiments, the immune checkpoint protein antagonist is a binding protein or polypeptide comprising the CDRs as described herein.

The use of the word "a" or "an" when used in conjunction with the term "comprising" in the claims and/or the specification may mean "one," but it is also consistent with the meaning of "one or more," "at least one," and/or "one or more than one."

It is contemplated that any embodiment discussed herein can be implemented with respect to any method or composition of the invention, and vice versa. Furthermore, compositions and kits of the invention can be used to achieve methods of the invention.

Throughout this application, the term "about" is used to indicate that a value includes the standard deviation of error for the device or method being employed to determine the value.

The use of the term "or" in the claims is used to mean "and/or" unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive, although the disclosure supports a definition that refers to only alternatives and "and/or."

As used in this specification and claim(s), the words "comprising" (and any form of comprising, such as "comprise" and "comprises"), "having" (and any form of having, such as "have" and "has"), "including" (and any form of including, such as "includes" and "include") or "containing" (and any form of containing, such as "contains" and "contain") are inclusive or open-ended and do not exclude additional, unrecited elements or method steps.

Other objects, features and advantages of the present invention will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples, while indicating specific embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.

DETAILED DESCRIPTION OF THE INVENTION

It has been found that treatment with a replicative oncolytic vaccinia virus expressing checkpoint inhibitor(s), such as an anti-PD-1 antibody and/or and anti-PD-L1 antibody, can be used for the treatment of cancer. In some embodiments, treatment with a replicative oncolytic vaccinia virus expressing checkpoint inhibitor(s), such as an anti-PD-1 antibody and/or and anti-PD-L1 antibody, results in an unexpected improvement in the treatment of cancer. In some embodiments, treatment with a replicative oncolytic vaccinia virus expressing an immune checkpoint inhibitor(s), such as an anti-PD-1 antibody and/or and anti-PD-L1 antibody, results in a synergistic effect with regard to a cancer treatment, as compared to treatment with a replicative oncolytic virus not expressing a checkpoint inhibitor, an anti-PD-1 antibody, and/or an anti-PD-L1 antibody alone. In some embodiments, treatment with a replicative oncolytic vaccinia virus expressing an immune checkpoint inhibitor(s), such as an anti-PD-1 antibody and/or and anti-PD-L1 antibody, results in a synergistic effect with regard to a cancer treatment, as compared to treatment with a replicative oncolytic vaccinia virus not expressing an immune checkpoint inhibitor. In some embodiments, that treatment with a replicative oncolytic vaccinia virus expressing a checkpoint inhibitor(s), such as an anti-PD-1 antibody, and/or and anti-PD-L1 antibody, results in a synergistic effect with regard to a cancer treatment, as compared to treatment with an anti-PD-1 antibody and/or an anti-PD-L1 antibody alone.

In some embodiments, the tumor exhibits upregulated expression of PD-1 and/or PD-L1. In some embodiments, the tumor exhibits upregulated expression of PD-1 and/or PD-L1 in the presence of a replicative oncolytic vaccinia virus. In some embodiments, the tumor exhibits upregulated expression of PD-1 and/or PD-L1 in the presence of a replicative oncolytic vaccinia virus expressing an immune checkpoint inhibitor(s), such as an anti-PD-1 antibody and/or and anti-PD-L1 antibody.

ONCOLYTIC VACCINIA VIRUS

Vaccinia virus is a large, complex enveloped virus having a linear double-stranded DNA genome of about 190K bp and encoding for approximately 250 genes. Vaccinia is well-known for its role as a vaccine that eradicated smallpox. Post-eradication of smallpox, scientists have been exploring the use of vaccinia as a tool for delivering genes into biological tissues (gene therapy and genetic engineering). Vaccinia virus is unique among DNA viruses as it replicates only in the cytoplasm of the host cell. Therefore, the large genome is required to code for various enzymes and proteins needed for viral DNA replication. During replication, vaccinia produces several infectious forms which differ in their outer membranes: the intracellular mature virion (IMV), the intracellular enveloped virion (IEV), the cell-associated enveloped virion (CEV) and the extracellular enveloped virion (EEV). IMV is the most abundant infectious form and is thought to be responsible for spread between hosts. On the other hand, the CEV is believed to play a role in cell-to-cell spread and the EEV is thought to be important for long range dissemination within the host organism.

Any known oncolytic strain of vaccinia virus may be employed as the replicative oncolytic vaccinia virus expressing an immune checkpoint protein antagonist(s), wherein the antagonist is a PD-1 antagonist or a PD-L1 antagonist, as herein described. In some embodiments, the replicative oncolytic vaccinia virus is a Copenhagen, Western Reserve, Lister, or Wyeth strain, and in some embodiments a Western Reserve or Wyeth strain. The genome of the Western Reserve vaccinia strain has been sequenced (Accession number AY243312). In some embodiments, the replicative oncolytic vaccinia virus is a Copenhagen strain. In some embodiments, the replicative oncolytic vaccinia virus is a Western Reserve strain. In some embodiments, the replicative oncolytic vaccinia virus is a Lister strain. In some embodiments, the replicative oncolytic vaccinia virus is a Wyeth strain.

The replicative oncolytic vaccinia virus may be engineered to lack one or more functional genes in order to increase the cancer selectivity of the virus. In some embodiments, the oncolytic vaccinia virus is engineered to lack thymidine kinase (TK) activity. A TK-deficient vaccinia virus requires thymidine triphosphate for DNA synthesis, which leads to preferential replication in dividing cells (particularly cancer cells). In some embodiments, the oncolytic vaccinia virus may be engineered to lack vaccinia virus growth factor (VGF). This secreted protein is produced early in the infection process, acting as a mitogen to prime surrounding cells for infection. In another aspect, the oncolytic vaccinia virus may be engineered to lack both VFG and TK activity. In some embodiments, the oncolytic vaccinia virus may be engineered to lack one or more genes involved in evading host interferon (IFN) response such as E3L, K3L, B18R, or B8R. In some embodiments, the replicative oncolytic vaccinia virus is a Western Reserve, Copenhagen, Lister or Wyeth strain and lacks a functional TK gene. In some embodiments, the replicative oncolytic vaccinia virus is a Western Reserve strain and lacks a functional TK gene. In some embodiments, the replicative oncolytic vaccinia virus is a Copenhagen strain and lacks a functional TK gene. In some embodiments, the replicative oncolytic vaccinia virus is a Lister strain and lacks a functional TK gene. In some embodiments, the replicative oncolytic vaccinia virus is a Wyeth strain and lacks a functional TK gene. In some embodiments, the oncolytic vaccinia virus is a Western Reserve, Copenhagen, Lister or Wyeth strain lacking a functional B18R and/or B8R gene. In some embodiments, the oncolytic vaccinia virus is a Western Reserve strain lacking a functional B18R and/or B8R gene. In some embodiments, the oncolytic vaccinia virus is a Copenhagen strain lacking a functional B18R and/or B8R gene. In some embodiments, the oncolytic vaccinia virus is a Lister strain lacking a functional B18R and/or B8R gene. In some embodiments, the oncolytic vaccinia virus is a Wyeth strain lacking a functional B18R and/or B8R gene. In some embodiments, the replicative oncolytic vaccinia virus is a Western Reserve, Copenhagen, Lister or Wyeth strain and lacks a functional TK gene as well as lacking a functional B18R and/or B8R gene. In some embodiments, the replicative oncolytic vaccinia virus comprises functional 14L and/or F4L genes. In some embodiments, the replicative oncolytic vaccinia virus does not express a chemokine (e.g., the vaccinia virus does not express CXCL-11).

Heterologous sequence (e.g., encoding a cytokine and/or a tumor antigen) can be placed under the control of a vaccinia virus promoter and integrated into the genome of the vaccinia virus. Alternatively, expression of the heterologous sequence can be achieved by transfecting a shuttle vector or plasmid such as those found in Table 1 of Current Techniques in Molecular Biology, (Ed. Ausubel, et al.) Unit 16.17.4 (1998) containing the vaccinia promoter-controlled sequence into a cell that has been infected with vaccinia virus and introducing the heterologous sequence by homologous recombination. Strong late vaccinia virus promoters are preferred when high levels of expression are desired. Early and intermediate-stage promoters can also be utilized. In some embodiments, the heterologous sequence is under the control of a vaccinia virus promoter containing early and late promoter elements. Suitable early promoters include without limitation, a promoter of vaccinia virus gene coding for 42K, 19K or 25K polypeptide. Suitable early late promoters include, without limitation, a promoter of vaccinia virus gene coding for 7.5K polypeptide. Suitable late promoters include, without limitation, a promoter of vaccinia virus gene coding for 11K or 28K polypeptide. In some embodiments, the heterologous sequence is inserted into a TK and/or VGF sequence to inactivate the TK and/or VGF sequence.

Replicative oncolytic vaccinia viruses described herein are administered intratumorally. Intratumoral administration generally entails injection into a tumor mass or into tumor associated vasculature. In certain aspects, the tumor is imaged prior to or during administration of the virus.

Oncolytic vaccinia viruses as described herein may be administered in a single administration or multiple administrations (e.g., 2, 3, 4, 5, 6, 7, 8 or more times). The virus may be administered at dosage of 1 x 10⁵ plaque forming units (PFU), 5 x 10⁵ PFU, 1 x 10⁶ PFU, at least 1 x 10⁶ PFU, 5 x 10⁶ or about 5 x 10⁶ PFU, 1 x 10⁷, at least 1 x 10⁷ PFU, 1 x 10⁸ or about 1 x 10⁸ PFU, at least 1 x 10⁸ PFU, about or at least 5 x 10⁸ PFU, 1 x 10⁹ or at least 1 x 10⁹ PFU, 5 x 10⁹ or at least 5 x 10⁹ PFU, 1 x 10¹⁰ PFU or at least 1 x 10¹⁰ PFU, 5 x 10¹⁰ or at least 5 x 10¹⁰ PFU, 1 x 10¹¹ or at least 1 x10¹¹, 1 x 10¹² or at least 1 x 10¹², 1 x 10¹³ or at least 1 x 10¹³. For example, the virus may be administered at a dosage of between about 10⁶-10¹³ pfu, between about 10⁷-10¹³ pfu, between about 10⁸-10¹³ pfu, between about 10⁹-10¹² pfu, between about 10⁸-10¹² pfu, between about 10⁷-10¹² pfu, between about 10⁶-10¹² pfu, between about 10⁶-10⁹ pfu, between about 10⁶-10⁸ pfu, between about 10⁷-10¹⁰ pfu, between about 10⁷-10⁹ pfu, between about 10⁸-10¹⁰ pfu, or between about 10⁸-10⁹ pfu. Preferably, the virus is administered at a dosage of at least 10⁷ pfu, between 10⁷ and 10¹⁰ pfu, between 10⁷-10⁹ pfu, between 10⁷-10⁸ pfu, between 10⁸-10¹⁰ pfu, between 10⁸-10⁹ pfu or between 10⁹ and 10¹⁰ pfu.

It is contemplated that a single dose of virus refers to the amount administered to a subject or a tumor over a 0.1, 0.5, 1, 2, 5, 10, 15, 20, or 24-hour period, including all values there between. The dose may be spread over time or by separate injection. Typically, multiple doses are administered to the same general target region, such as in the proximity of a tumor. In certain aspects, the viral dose is delivered by injection apparatus comprising a syringer or single port needle or multiple ports in a single needle or multiple prongs coupled to a syringe, or a combination thereof. A single dose of the vaccinia virus may be administered or the multiple doses may be administered over a treatment period which may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 or more weeks. For example, the vaccinia virus may be administered every other day, weekly, every other week, every third week for a period of 1, 2, 3, 4, 5, 6 or more months.

Vaccinia virus may be propagated using the methods described by Earl and Moss in Ausubel et al., 1994 or the methods described in WIPO Publication No. WO2013/022764, both of which are incorporated herein by reference.

IMMUNE CHECKPOINT INHIBITORS

Immune checkpoint proteins interact with specific ligands which send a signal into T cells that inhibits T cell function. Cancer cells exploit this by driving high level expression of checkpoint proteins on their surface, thereby suppressing the anti-cancer immune response.

An immune checkpoint inhibitor for use in the replicative oncolytic vaccinia virus expressing the immune checkpoint protein antagonist (e.g., immune checkpoint inhibitor) and pharmaceutical combinations including the oncolytic vaccinia virus, herein described can include any compound capable of inhibiting the function of an immune checkpoint protein. Inhibition includes reduction of function as well as full blockade. In particular, the immune checkpoint protein is a human checkpoint protein. In some embodiments, the immune checkpoint inhibitor is an inhibitor of a human immune checkpoint. In some embodiments, the immune checkpoint inhibitor includes PD-1 antagonist and its ligand PD-L1 antagonist.

In some embodiments, the PD-1 antagonist or PD-L1 antagonist expressed by the replicative oncolytic vaccinia virus is an antibody. The term "antibody" as used herein encompasses naturally occurring and engineered antibodies as well as full length antibodies or functional fragments or analogs thereof that are capable of binding e.g., the target immune checkpoint or epitope (e.g., retaining the antigen-binding portion), including single chain Fv (scFv). The antibody for use according to the methods described herein may be from any origin including, without limitation, human, humanized, animal or chimeric and may be of any isotype. In some embodiments, the isotype is and IgG1, IgG2, IgG3, and IgG4. In some embodiments, the isotype is IgG1 or IgG4. In some embodiments, the antibody may be glycosylated or non-glycosylated. The term antibody also includes bispecific or multispecific antibodies so long as they exhibit the binding specificity herein described. Humanized antibodies refer to non-human (e.g., murine, rat, etc.) antibody whose protein sequence has been modified to increase similarity to a human antibody. Chimeric antibodies refer to antibodies comprising one or more element(s) of one species and one or more element(s) of another specifies, for example a non-human antibody comprising at least a portion of a constant region (Fc) of a human immunoglobulin. Another type of Ig domain of the heavy chain is the hinge region. By "hinge" or "hinge region" or "antibody hinge region" or "immunoglobulin hinge region" herein is meant the flexible polypeptide comprising the amino acids between the first and second constant domains of an antibody. Structurally, the IgG CH1 domain ends at EU position 220, and the IgG CH2 domain begins at residue EU position 237. Thus for IgG the antibody hinge is herein defined to include positions 221 (D221 in IgG1) to 236 (G236 in IgG1), wherein the numbering is according to the EU index as in Kabat. In some embodiments, for example in the context of an Fc region, the lower hinge is included, with the "lower hinge" generally referring to positions 226 or 230. In some embodiments, optional substitutions in the hinge region can be employed.

Many forms of antibody can be engineered for use in the combination of the invention, representative examples of which include an Fab fragment (monovalent fragment consisting of the VL, VH, CL and CH1 domains), an F(ab′)2 fragment (bivalent fragment comprising two Fab fragments linked by at least one disulfide bridge at the hinge region), a Fd fragment (consisting of the VH and CH1 domains), a Fv fragment (consisting of the VL and VH domains of a single arm of an antibody), a dAb fragment (consisting of a single variable domain fragment (VH or VL domain), a single chain Fv (scFv) comprising the two domains of a Fv fragment, VL and VH, that are fused together, and in some embodiments, with a linker to make a single protein chain. In some embodiments, the scFv is an anti PD-1 scFv (2B9) encoded by SEQ ID NO: 49. In some embodiments, the scFv is an anti PD-L1 scFv (4F5) encoded by SEQ ID NO: 50.

In some embodiments, the PD-1 antagonist or a PD-L1 antagonist expressed by the replicative oncolytic vaccinia virus is an antibody or fragment thereof. In some embodiments, the PD-1 antagonist or a PD-L1 antagonist comprises a sequence as provided in the Table of Sequences and/or in Figures 11 and 12. In some embodiments, the PD-1 antagonist or PD-L1 antagonist comprises a polypeptide comprising CDR1, CDR2, and CDR3 of the VL which is attached to a polypeptide comprising CD1, CDR2 and CDR3 of the VH. In some embodiments, the PD-1 antagonist or PD-L1 antagonist comprises a polypeptide comprising CDR1, CDR2, and CDR3 of the VL which is attached to a polypeptide comprising CD1, CDR2 and CDR3 of the VH via a linker. In some embodiments, the PD-1 antagonist or PD-L1 antagonist comprises a polypeptide comprising CDR1, CDR2, and CDR3 of the VL which is attached to a polypeptide comprising CD1, CDR2 and CDR3 of the VH without a linker. In some embodiments, the VL and VH are attached via a linker. In some embodiments, the PD-1 antagonist or PD-L1 antagonist comprises the VL and VH attached together via a linker to form a scFv. In some embodiments, the VL and VH are not attached via a linker. In some embodiments, the VL and VH are noncovalently attached. In some embodiments, the VL and VH are attached via a linker.

In some embodiments, the anti-PD-1 antibody or PD-1 binding protein comprises:

a) a heavy chain variable region comprising:

i) a first CDR comprising SEQ ID NO: 2;

ii) a second CDR comprising SEQ ID NO: 3;

iii) a third CDR comprising SEQ ID NO: 4; and

b) a light chain variable region comprising:

i) a first CDR comprising SEQ ID NO: 6;

ii) a second CDR comprising SEQ ID NO: 7;

iii) a third CDR comprising SEQ ID NO: 8.

In some embodiments, the anti-PD-1 heavy chain comprises SEQ ID NO: 1. In some embodiments, the anti-PD-1 light chain comprises SEQ ID NO: 5. In some embodiments, the anti-PD-1 heavy chain comprises SEQ ID NO: 1 and the anti-PD-1 light chain comprises SEQ ID NO: 5.

In some embodiments, the anti-PD-1 antibody or PD-1 binding protein comprises:

a) a heavy chain variable region comprising:

i) a first CDR comprising SEQ ID NO: 10;

ii) a second CDR comprising SEQ ID NO: 11;

iii) a third CDR comprising SEQ ID NO: 12; and

b) a light chain variable region comprising:

i) a first CDR comprising SEQ ID NO: 14;

ii) a second CDR comprising SEQ ID NO: 15;

iii) a third CDR comprising SEQ ID NO: 16.

In some embodiments, the anti-PD-1 heavy chain comprises SEQ ID NO: 9. In some embodiments, the anti-PD-1 light chain comprises SEQ ID NO: 13. In some embodiments, the anti-PD-1 heavy chain comprises SEQ ID NO: 9 and the anti-PD-1 light chain comprises SEQ ID NO: 13.

In some embodiments, the anti-PD-1 antibody or PD-1 binding protein comprises:

a) a heavy chain variable region comprising:

i) a first CDR comprising SEQ ID NO: 18;

ii) a second CDR comprising SEQ ID NO: 19;

iii) a third CDR comprising SEQ ID NO: 20; and

b) a light chain variable region comprising:

i) a first CDR comprising SEQ ID NO: 22;

ii) a second CDR comprising SEQ ID NO: 23;

iii) a third CDR comprising SEQ ID NO: 24.

In some embodiments, the anti-PD-1 heavy chain comprises SEQ ID NO: 17. In some embodiments, the anti-PD-1 light chain comprises SEQ ID NO: 21.

In some embodiments, the anti-PD-1 heavy chain comprises SEQ ID NO: 17 and the anti-PD-1 light chain comprises SEQ ID NO: 21.

In some embodiments, the anti-PD-L1 antibody or PD-L1 binding protein comprises:

a) a heavy chain variable region comprising:

i) a first CDR comprising SEQ ID NO: 26;

ii) a second CDR comprising SEQ ID NO: 27;

iii) a third CDR comprising SEQ ID NO: 28; and

b) a light chain variable region comprising:

i) a first CDR comprising SEQ ID NO: 30;

ii) a second CDR comprising SEQ ID NO: 31;

iii) a third CDR comprising SEQ ID NO: 32.

In some embodiments, the anti-PD-L1 heavy chain comprises SEQ ID NO: 25. In some embodiments, the anti-PD-L1 light chain comprises SEQ ID NO: 29. In some embodiments, the anti-PD-L1 heavy chain comprises SEQ ID NO: 25 and the anti-PD-L1 light chain comprises SEQ ID NO: 29.

In some embodiments, the linker is a "domain linker," used to link any two domains as outlined herein together. While any suitable linker can be used, many embodiments utilize a glycine-serine polymer, including for example (GS)n, (GSGGS)n, (GGGGS)n, and (GGGS)n, where n is an integer of at least 0 (and generally from 0 to 1 to 2 to 3 to 4 to 5) as well as any peptide sequence that allows for recombinant attachment of the two domains with sufficient length and flexibility to allow each domain to retain its biological function. In certain cases, useful linkers include (GGGGS)₀ or (GGGGS)₁ or (GGGGS)₂. In some embodiments, a sequence useful for insertion of a restriction site that can be cleaved by a specific restriction enzyme can be included before and/or after the linker sequene. In some embodiments, the restriction site results in the insert of a GLGGL sequence (e.g., an SpiI cleavage site), before the linker sequence. In some embodiments, the restriction site results in the insert of a VGS sequence (e.g., an BstXI cleavage site), after the linker sequence.

In some embodiments, the antagonist is a PD-1 antagonist or a PD-L1 antagonist. In some embodiments, the antagonist is an anti-PD-1 antibody or binding fragment thereof. In some embodiments, the antagonist is an anti-PD-L1 antibody or binding fragment thereof. In some embodiments, the antagonist is a monoclonal antibody, a fully human antibody, a chimeric antibody, a humanized antibody or fragment thereof that is capable of at least partly antagonizing PD-1 or PD-L1. In some embodiments, the antagonist is a single chain variable fragment (also referred to as a "scFv"). In some embodiments, the scFv is an anti-PD-1 scFv (2B9) encoded by SEQ ID NO: 49. In some embodiments, the scFv is an anti-PD-L1 scFv (4F5) encoded by SEQ ID NO: 50.

In another preferred embodiment, the pharmaceutical combination comprises a Western Reserve, Wyeth, Lister or Copenhagen vaccinia virus strain and a PD-1 inhibitor, preferably a monoclonal antibody that specifically binds to (and inhibits) PD-1. The complete nucleotide and amino acid sequences of human PD-1 can be found under GenBank Accession No. U64863 and NP_005009.2. Monoclonal antibodies against PD-1 include, without limitation, lambrolizumab (e.g., disclosed as hPD109A and its humanized derivatives h409A11, h409A16 and h409A17 in U.S. Patent No. 8,354,509, incorporated herein by reference), Nivolumab (Opdivo®; Bristol-Myers Squibb; code name BMS-936558) disclosed in U.S. Patent No. 8,008,449, incorporated herein by reference, Pembrolizumab (Keytruda®) and Pidilizumab (CT-011; disclosed in Rosenblatt et al., Immunother. 34:409-418 (2011)) or an antibody comprising the heavy and light chain regions of these antibodies. Other anti-PD-1 antibodies are described in e.g., WO2004/004771, WO2004/056875, WO2006/121168, WO2008/156712, WO2009/014708, WO2009/114335, WO2013/043569 and WO2014/047350. In a related embodiment, the checkpoint inhibitor of the pharmaceutical combination is an anti-PD-1 fusion protein such as AMP-224 (composed of the extracellular domain of PD-L2 and the Fc region of human IgG1).

In another preferred embodiment, the pharmaceutical combination comprises a Western Reserve, Wyeth, Lister or Copenhagen vaccinia virus strain and a PD-L1 inhibitor, preferably a monoclonal antibody that specifically binds to (and inhibits) PD-L1. Monoclonal antibodies against PD-L1 include, without limitation, pembrolizumab (MK-3475, disclosed in WO2009/114335)), BMS-936559 (MDX-1105), Atezolizumab (Genentech/Roche; MPDL33280A) disclosed in U.S. Patent No. 8,217,149, the contents of which are incorporated herein by reference, Durvalumab (AstraZeneca/MedImmune; MEDI4736) disclosed in U.S. Patent No. 8,779,108, incorporated herein by reference, MIH1 (Affymetrix obtainable via eBioscience (16.5983.82)) and Avelumab (MSB0010718C; Merck KGaA) or an antibody comprising the heavy and light chain variable regions of any of these antibodies. In a related embodiment, the immune checkpoint inhibitor is an anti-PD-L1 fusion protein such as the PD-L2-Fc fusion protein known as AMP-224 (disclosed in Mkritchyan M., et al., J. Immunol., 189:2338-2347 (2010).

In another preferred embodiment, the pharmaceutical combination comprises a Western Reserve, Wyeth, Lister or Copenhagen vaccinia virus strain and a PD-L2 inhibitor such as MIH18 (described in Pfistershammer et al., Eur J Immunol. 36:1104-1113 (2006).

In other embodiments, the pharmaceutical combination comprises a Western Reserve, Wyeth, Lister or Copenhagen vaccinia virus strain and a LAG3 inhibitor such as soluble LAG3 (IMP321, or LAG3-Ig disclosed in U.S. Patent Application Publication No. 2011-0008331, incorporated herein by reference, and in Brignon et al., Clin. Cancer Res. 15:6225-6231 (2009)), IMP701 or other humanized antibodies blocking human LAG3 described in U.S. Patent Application Publication No. 2010-0233183, incorporated herein by reference, U.S. Patent No. 5,773,578, incorporated herein by reference, or BMS-986016 or other fully human antibodies blocking LAG3 described in U.S. Patent Application Publication No. 2011-0150892, incorporated herein by reference.

In other embodiments, the pharmaceutical combination comprises a Western Reserve, Wyeth, Lister or Copenhagen vaccinia virus strain and a BLTA inhibitor such as the antibody 4C7 disclosed in U.S. Patent No. 8,563,694, incorporated herein by reference.

In yet other embodiments, the pharmaceutical combination comprises a Western Reserve, Wyeth, Lister or Copenhagen vaccinia virus strain and a B7H4 checkpoint inhibitor such as an antibody as disclosed in U.S. Patent Application Publication No. 2014/0294861, incorporated herein by reference or a soluble recombinant form of B7H4 e.g., as disclosed in U.S. Patent Application Publication No. 20120177645, incorporated herein by reference.

In yet other embodiments, the pharmaceutical combination comprises a Western Reserve, Wyeth, Lister or Copenhagen vaccinia virus strain and a B7-H3 checkpoint inhibitor such as the antibody MGA271 disclosed as BRCA84D or a derivative as disclosed in U.S. Patent Application Publication No. 20120294796, incorporated herein by reference.

In yet other embodiments, the pharmaceutical combination comprises a Western Reserve, Wyeth, Lister or Copenhagen vaccinia virus strain and a TIM3 checkpoint inhibitor such as an antibody as disclosed in U.S. Patent No. 8,841,418, incorporated herein by reference or the anti-human TIM3 blocking antibody F38-2E2 disclosed by Jones et al., J. Exp. Med., 205(12):2763-2779 (2008).

In yet other embodiments, the pharmaceutical combination comprises a Western Reserve, Wyeth, Lister or Copenhagen vaccinia virus strain and a KIR checkpoint inhibitor such as the antibody lirilumab (described in Romagne et al., Blood, 114(13):2667-2677 (2009)).

In other embodiments, the pharmaceutical combination comprises a Western Reserve, Wyeth, Lister or Copenhagen vaccinia virus strain and a TIGIT inhibitor. TIGIT checkpoint inhibitors preferably inhibit interaction of TIGIT with a poliovirus receptor (CD155) and include, without limitation, antibodies targeting human TIGIT, such as those disclosed in U.S. Patent No. 9,499,596 (incorporated herein by reference) and U.S. Patent Application Publication Nos. 20160355589 and 20160176963 (incorporated herein by reference) and poliovirus receptor variants such as those disclosed in U.S. Patent No. 9,327,014 (incorporated herein by reference).

In other embodiments, the pharmaceutical combination comprises a Western Reserve, Wyeth, Lister or Copenhagen vaccinia virus strain and an IDO inhibitor. IDO is recognized as an immune checkpoint protein and its expression in tumor cells contributes to immune tolerance by shutting down effector T cells. IDO is thought to contribute to resistance of anti-CLTA-4 therapies. Inhibitors of IDO for use according to the methods described herein include, without limitation, tryptophan mimetics such as D-1MT (D isoform of 1-methyl-DL-tryptophan (MT)), L-1MT (L isoform of MT), MTH-Trp (methylthiohydantoin-dl-tryptophan; transcriptional suppressor of IDO), and β-carbolines, indole mimetics such as napthoquinone-based agents, S-allyl-brassinin, S-benzyl-brassinin, 5-Bromo-brassinin, as well as phenylimidazole-based agents, 4-phenylimidazole, exiguamine A, epacadostat, rosmarinic acid, norharmane and NSC401366. Preferred IDO inhibitors include INCB 024360 (epacadostat; 1,2,5-Oxadiazole-3-carboximidamide, 4-((2-((Aminosulfonyl)amino)ethyl)amino)-N-(3-bromo-4-fluorophenyl)-N'-hydroxy-, (C(Z))-; Incyte), indoximod (NLG2101; D-1MT; NewLink Genetics), IDO peptide vaccine (Copenhagen University) and NLG919 (NewLink Genetics).

As the skilled person will know, alternative and/or equivalent names may be in use for certain antibodies mentioned above. Such alternative and/or equivalent names are interchangeable in the context of the present invention.

In some aspects, the pharmaceutical combination described herein is an amount of a replicative oncolytic vaccinia virus expressing an immune checkpoint protein antagonist, wherein the antagonist is a PD-1 antagonist or a PD-L1 antagonist sufficient for administration to a subject.

CYTOKINES

In some embodiments, the replicative oncolytic vaccinia virus of the pharmaceutical combination comprises heterologous sequence encoding a cytokine, wherein the cytokine is expressed by the virus. In some embodiments, the replicative oncolytic vaccinia virus comprises a heterologous nucleic acid sequence encoding a cytokine. In some embodiments, the cytokine is expressed in a cell infected with the replicative oncolytic vaccinia virus. In some embodiments, the cell is a tumor cell.

In some embodiments, a replicative oncolytic vaccinia virus is provided that is engineered to express an a cytokine selected from the group consisting of granulocyte-macrophage colony stimulating factor (GM-CSF), interleukin-2 (IL-2), interleukin-4 (IL-4), interleukin-5 (IL-5), interleukin-7 (IL-7), interleukin-12 (IL-12), interleukin-15 (IL-15), interleukin-18 (IL-18), interleukin-21 (IL-21), interleukin-24 (IL-24), interferon-γ (IFN-γ, and tumor necrosis factor-α (TNF-α). In particularly preferred embodiments, the replicative oncolytic vaccinia virus is a Wyeth, Western Reserve, Copenhagen or Lister strain.

TUMOR ANTIGENS

In some embodiments, the replicative oncolytic vaccinia virus comprises a heterologous nucleic acid sequence encoding a tumor antigen. In some embodiments, the tumor antigen is expressed in a cell infected with the replicative oncolytic vaccinia virus. In some embodiments, the replicative oncolytic vaccinia virus comprises a heterologous nucleic acid sequence encoding a cytokine. In some embodiments, the cytokine is expressed in a cell infected with the replicative oncolytic vaccinia virus. In some embodiments, the replicative oncolytic vaccinia virus comprises a heterologous nucleic acid sequence encoding a tumor antigen and optionally a cytokine, wherein the tumor antigen and optionally the cytokine are expressed in a cell infected with the replicative oncolytic vaccinia virus. In some embodiments, the cell is a tumor cell.

Tumor antigens encompass tumor-specific antigens and tumor-associated antigens. The replication-competent oncolytic vaccinia virus may express the full length tumor antigen or an immunogenic peptide thereof. In some embodiments, the tumor antigens include, but are not limited to, MAGE-1, MAGE-3, BAGE, GAGE-1, GAGE-2, N-acetylglucosaminyltransferase-V, p-15, gp100, MART-1/MelanA, TRP-1 (gp75), TRP-2, Tyrosinase, cyclin-dependent kinase 4, β-catenin, MUM-1, CDK4, HER-2/neu, human papillomavirus-E6, human papillomavirus E7, CD20, carcinoembryonic antigen (CEA), epidermal growth factor receptor, MUC-1, caspase-8, CD5, mucin-1, Lewisx, CA-125, p185HER2, IL-2R, Fap-α, tenascin, antigens associated with a metalloproteinase, and CAMPATH-1. In some embodiments, the tumor antigens include, but are not limited to, KS 1/4 pan-carcinoma antigen, ovarian carcinoma antigen (CA125), prostatic acid phosphate, prostate specific antigen, melanoma-associated antigen p97, melanoma antigen gp75, high molecular weight melanoma antigen (HMW-MAA), prostate specific membrane antigen, CEA, polymorphic epithelial mucin antigen, milk fat globule antigen, colorectal tumor-associated antigens (such as: CEA, TAG-72, CO17-1A, GICA 19-9, CTA-1 and LEA), Burkitt's lymphoma antigen-38.13, CD19, B-lymphoma antigen-CD20, CD33, melanoma specific antigens (such as ganglioside GD2, ganglioside GD3, ganglioside GM2, ganglioside GM3), tumor-specific transplantation type of cell-surface antigen (TSTA) (such as virally-induced tumor antigens including T-antigen DNA tumor viruses and Envelope antigens of RNA tumor viruses), oncofetal antigen-alpha-fetoprotein such as CEA of colon, bladder tumor oncofetal antigen, differentiation antigen (such as human lung carcinoma antigen L6 and L20), antigens of fibrosarcoma, leukemia T cell antigen-Gp37, neoglycoprotein, sphingolipids, breast cancer antigens (such as EGFR (Epidermal growth factor receptor), HER2 antigen (p185^HER2) and HER2 neu epitope), polymorphic epithelial mucin (PEM), malignant human lymphocyte antigen-APO-1, differentiation antigen (such as I antigen found in fetal erythrocytes, primary endoderm, I antigen found in adult erythrocytes, preimplantation embryos, I(Ma) found in gastric adenocarcinomas, M18, M39 found in breast epithelium, SSEA-1 found in myeloid cells, VEP8, VEP9, Myl, VIM-D5, D₁₅₆-22 found in colorectal cancer, TRA-1-85 (blood group H), C14 found in colonic adenocarcinoma, F3 found in lung adenocarcinoma, AH6 found in gastric cancer, Y hapten, Le^y found in embryonal carcinoma cells, TL5 (blood group A), EGF receptor found in A431 cells, E₁ series (blood group B) found in pancreatic cancer, FC10.2 found in embryonal carcinoma cells, gastric adenocarcinoma antigen, CO-514 (blood group Le^a) found in Adenocarcinoma, NS-10 found in adenocarcinomas, CO-43 (blood group Le^b), G49 found in EGF receptor of A431 cells, MH2 (blood group ALe^b/Le^y) found in colonic adenocarcinoma, 19.9 found in colon cancer, gastric cancer mucins, T₅A₇ found in myeloid cells, R₂₄ found in melanoma, 4.2, G_D3, D1.1, OFA-1, G_M2, OFA-2, G_D2, and M1:22:25:8 found in embryonal carcinoma cells, and SSEA-3 and SSEA-4 found in 4 to 8-cell stage embryos), T cell receptor derived peptide from a Cutaneous T cell Lymphoma, C-reactive protein (CRP), cancer antigen-50 (CA-50), cancer antigen 15-3 (CA15-3) associated with breast cancer, cancer antigen-19 (CA-19) and cancer antigen-242 associated with gastrointestinal cancers, carcinoma associated antigen (CAA), chromogranin A, epithelial mucin antigen (MC5), human epithelium specific antigen (E1A), Lewis(a)antigen, melanoma antigen, melanoma associated antigens 100, 25, and 150, mucin-like carcinoma-associated antigen, multidrug resistance related protein (MRPm6), multidrug resistance related protein (MRP41), Neu oncogene protein (C-erbB-2), neuron specific enolase (NSE), P-glycoprotein (mdr1 gene product), multidrug-resistance-related antigen, p170, multidrug-resistance-related antigen, prostate specific antigen (PSA), CD56, and NCAM. In some embodiments, other tumor antigens include, without limitation, AIM2 (absent in melanoma 2), BMI1 (BMI1 polycomb ring finger oncogene), COX-2 (cyclooxygenase-2), EGFRvIII (epidermal growth factor receptor variant III), EZH2 (enhancer of zeste homolog 2), LICAM (human L1 cell adhesion molecule), Livin, Livinβ, MRP-3 (multidrug resistance protein 3), Nestin, OLIG2 (oligodendrocyte transcription factor), SOX2 (SRY-related HMG-box 2), ART1 (antigen recognized by T cells 1), ART4 (antigen recognized by T cells 4), SART1 (squamous cell carcinoma antigen recognized by T cells 1), SART2, SART3, B-cyclin, Gli1 (glioma-associated oncogene homlog 1), Cav-1 (caveolin-1), cathepsin B, CD74 (cluster of Differentiation 74), E-cadherin (epithelial calcium-dependent adhesion), EphA2/Eck (EPH receptor A2/epithelial kinase), Fra-1/Fosl 1 (fos-related antigen 1), Ki67 (nuclear proliferation-associated antigen of antibody Ki67), Ku70/80 (human Ku heterodimer proteins subunits), IL-13Ra2 (interleukin-13 receptor subunit alpha-2), NY-ESO-1 (New York oesophageal squamos cell carcinoma 1), PROX1 (prospero homeobox protein 1), PSCA (prostate stem cell antigen), SOX10 (SRY-related HMG-box 10), SOX11, Survivin, UPAR (urokinase-type plasminogen activator receptor, and WT-1 (Wilms’ tumor protein 1).

TREATMENT REGIMENS AND PHARMACEUTICAL FORMULATIONS

In some embodiments, the replicative oncolytic vaccinia virus expressing an immune checkpoint protein antagonist, wherein the antagonist is a PD-1 antagonist or a PD-L1 antagonist delivered by intratumoral administration. Administration of the replicative oncolytic vaccinia virus expressing an immune checkpoint protein antagonist, wherein the antagonist is a PD-1 antagonist or a PD-L1 antagonist will follow general protocols for the administration of each particular therapy, taking into account the toxicity, if any, of the treatment. It is expected that the treatment cycles would be repeated as necessary. It is also contemplated that various standard therapies, as well as surgical intervention, may be applied according to the therapeutic administration methods of the invention.

Treatment regimens may vary and often depend on tumor type, tumor location, disease progression, and health and age of the subject. Certain types of tumor will require more aggressive treatment, while at the same time, certain subjects cannot tolerate more taxing protocols.

In certain embodiments, the tumor being treated may not, at least initially, be resectable. Treatment with a combination therapy of the invention may increase the resectability of the tumor due to shrinkage at the margins or by elimination of certain particularly invasive portions. Following treatment, resection may be possible. Additional treatments subsequent to resection will serve to eliminate microscopic residual disease at the tumor site.

Determining a synergistic interaction between one or more components, the optimum range for the effect and absolute dose ranges of each component for the effect may be definitively measured by administration of the components over different w/w ratio ranges and doses to subjects in need of treatment.

In certain aspects, the replicative oncolytic vaccinia virus expressing an immune checkpoint protein antagonist, wherein the antagonist is a PD-1 antagonist or a PD-L1 antagonist is used to treat and/or prevent cancer in a mammal. In some embodiments, the cancer is selected from the group consisting of brain cancer, head & neck cancer, esophageal cancer, skin cancer, lung cancer, thymic cancer, stomach cancer, colon cancer, liver cancer, ovarian cancer, uterine cancer, bladder cancer, renal cancer, testicular cancer, rectal cancer, breast cancer, and pancreatic cancer. In some embodiments, the replicative oncolytic vaccinia virus expressing an immune checkpoint protein antagonist, wherein the antagonist is a PD-1 antagonist or a PD-L1 antagonist, is used to treat and/or prevent a metastasis. In some embodiments, the replicative oncolytic vaccinia virus expressing an immune checkpoint protein antagonist, wherein the antagonist is a PD-1 antagonist or a PD-L1 antagonist, is used to treat a cancer selected from the group consisting of hepatocellular carcinoma, colorectal cancer, renal cell carcinoma, bladder cancer, lung cancer (including non-small cell lung cancer), stomach cancer, esophageal cancer, sarcoma, mesothelioma, melanoma, pancreatic cancer, head and neck cancer, ovarian cancer, cervical and liver cancer. In some embodiments, the replicative oncolytic vaccinia virus expressing an immune checkpoint protein antagonist, wherein the antagonist is a PD-1 antagonist or a PD-L1 antagonist, is used to treat colorectal cancer, particularly metastatic colorectal cancer. In another preferred aspect, the mammal to be treated is a human. In some embodiments, the replicative oncolytic vaccinia virus expressing an immune checkpoint protein antagonist, wherein the antagonist is a PD-1 antagonist or a PD-L1 antagonist, is used to treat a cancer that is resistant to one or more immune checkpoint inhibitors (e.g., the cancer is resistant to immunotherapy with PD-1 and/or PD-L1 inhibitors). In some embodiments, the replicative oncolytic vaccinia virus expressing an immune checkpoint protein antagonist, wherein the antagonist is a PD-1 antagonist or a PD-L1 antagonist, is used to treat a cancer that is resistant to immunotherapy with PD-1 and/or PD-L1 inhibitors. In some embodiments, the replicative oncolytic vaccinia virus expressing an immune checkpoint protein antagonist, wherein the antagonist is a PD-1 antagonist or a PD-L1 antagonist is used to treat a cancer that is resistant to immunotherapy with PD-1 inhibitors. In some embodiments, the replicative oncolytic vaccinia virus expressing an immune checkpoint protein antagonist, wherein the antagonist is a PD-1 antagonist or a PD-L1 antagonist is used to treat a cancer that is resistant to immunotherapy with PD-L1 inhibitors.

The methods include administering a therapeutically effective amount of a replicative oncolytic vaccinia virus expressing an immune checkpoint protein antagonist, wherein the antagonist is a PD-1 antagonist or a PD-L1 antagonist. A therapeutically effective amount of oncolytic virus is defined as an amount sufficient to induce oncolysis - the disruption or lysis of a cancer cell. In some embodiments, the therapeutically effective amount results in the slowing, inhibition, or reduction in the growth or size of a tumor and includes the eradication of the tumor in certain instances. In some embodiments, an effective amount of vaccinia virus results in systemic dissemination of the therapeutic virus to tumors, e.g., infection of non-injected tumors. In some embodiments, administration of the replicative oncolytic vaccinia virus expressing an immune checkpoint protein antagonist, wherein the antagonist is a PD-1 antagonist or a PD-L1 antagonist effects both the tumor it is administered to as well as other tumors with the subject to which it has been administered.

In some embodiments, the replicative oncolytic vaccinia virus expressing an immune checkpoint protein antagonist, wherein the antagonist is a PD-1 antagonist or a PD-L1 antagonist, is administered intravenously, intra-aterially, or intratumorally to the subject. In some embodiments, the replicative oncolytic vaccinia virus expressing an immune checkpoint protein antagonist, wherein the antagonist is a PD-1 antagonist or a PD-L1 antagonist, is delivered via intratumoral administration. In some embodiments, the replicative oncolytic vaccinia virus expressing an immune checkpoint protein antagonist, wherein the antagonist is a PD-1 antagonist or a PD-L1 antagonist, provides significantly improved antitumoral effects relative to administration of the replicative oncolytic vaccinia virus not expressing an immune checkpoint protein antagonist, wherein the antagonist is a PD-1 antagonist or a PD-L1 antagonist. In some embodiments, the replicative oncolytic vaccinia virus expressing an immune checkpoint protein antagonist, wherein the antagonist is a PD-1 antagonist or a PD-L1 antagonist, provides significantly improved antitumoral effects relative to administration of the PD-1 antagonist or the PD-L1 antagonist administered individually. In some embodiments, these effects are not prominently observed when the replicative oncolytic vaccinia virus expressing an immune checkpoint protein antagonist, wherein the antagonist is a PD-1 antagonist or a PD-L1 antagonist, is delivered by intravascular administration.

In some embodiments, the total amount of the replicative oncolytic vaccinia virus expressing an immune checkpoint protein antagonist, wherein the antagonist is a PD-1 antagonist or a PD-L1 antagonist to be administered in practicing a method of the invention, can be administered to a subject as a single dose, either as a bolus or by infusion over a relatively short period of time, or can be administered using a fractionated treatment protocol, in which multiple doses are administered over a prolonged period of time. One skilled in the art would know that the amount of the composition to treat a pathologic condition in a subject depends on many factors including the age and general health of the subject as well as the route of administration and the number of treatments to be administered. In view of these factors, the skilled artisan would adjust the particular dose as necessary.

Additional Anticancer Therapeutics

One or more additional chemotherapeutic agents may be administered with the oncolytic vaccinia virus of the invention, including, without limitation, 5-fluorouracil (FU), folinic acid (FA) (or leucovorin), methotrexate, capecitabine (Xeloda; an oral prodrug of 5-FU), oxaliplatin (Eloxatin), bevacizumab (Avastin), cetuximab (Erbitux) and panitumumab (Vectibix), in any combination. These agents may be administered according to known treatment protocols. Generally, the additional chemotherapeutic agent is administered intravenously, with the exception of capecitabine which is an oral formulation.

In other aspects, methods of the invention further comprise administering an additional cancer therapy such as radiotherapy, hormone therapy, surgery and combinations thereof.

Radiotherapy includes, without limitation, γ-rays, X-rays, and/or the directed delivery of radioisotopes to tumor cells. Other forms of DNA damaging factors are also contemplated such as microwaves and UV-irradiation. It is most likely that all of these factors effect a broad range of damage on DNA, on the precursors of DNA, on the replication and repair of DNA, and on the assembly and maintenance of chromosomes. Dosage ranges for X-rays range from daily doses of 50 to 200 roentgens for prolonged periods of time (3 to 4 wk), to single doses of 2000 to 6000 roentgens. Dosage ranges for radioisotopes vary widely, and depend on the half-life of the isotope, the strength and type of radiation emitted, and the uptake by the neoplastic cells.

Approximately 60% of persons with cancer will undergo surgery of some type, which includes preventative, diagnostic or staging, curative and palliative surgery. Curative surgery is a cancer treatment that may be used in conjunction with other therapies, such as the treatment of the present invention, chemotherapy, radiotherapy, hormonal therapy, gene therapy and/or alternative therapies.

Curative surgery includes resection in which all or part of cancerous tissue is physically removed, excised, and/or destroyed. Tumor resection refers to physical removal of at least part of a tumor. In addition to tumor resection, treatment by surgery includes laser surgery, cryosurgery, electrosurgery, and microscopically controlled surgery (Mohs surgery). It is further contemplated that the present invention may be used in conjunction with removal of superficial cancers, precancers, or incidental amounts of normal tissue.

Upon excision of part of or all of cancerous cells, tissue, or tumor, a cavity may be formed in the body. Treatment may be accomplished by perfusion, direct injection or local application of the area with an additional anti-cancer therapy. Such treatment may be repeated, for example, every 1, 2, 3, 4, 5, 6, or 7 days, or every 1, 2, 3, 4, and 5 weeks or every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months. These treatments may be of varying dosages as well.

Another form of therapy for use in conjunction with the current methods includes hyperthermia, which is a procedure in which a subject's tissue is exposed to high temperatures (up to 106˚F). External or internal heating devices may be involved in the application of local, regional, or whole-body hyperthermia. Local hyperthermia involves the application of heat to a small area, such as a tumor. Heat may be generated externally with high-frequency waves targeting a tumor from a device outside the body. Internal heat may involve a sterile probe, including thin, heated wires or hollow tubes filled with warm water, implanted microwave antennae, or radiofrequency electrodes.

A subject's organ or a limb is heated for regional therapy, which is accomplished using devices that produce high energy, such as magnets. Alternatively, some of the subject's blood may be removed and heated before being perfused into an area that will be internally heated. Whole-body heating may also be implemented in cases where cancer has spread throughout the body. Warm-water blankets, hot wax, inductive coils, and thermal chambers may be used for this purpose.

Hormonal therapy may also be used in conjunction with the oncolytic vaccinia viruses of the present invention or in combination with any other cancer therapy previously described. The use of hormones may be employed in the treatment of certain cancers such as breast, prostate, ovarian, or cervical cancer to lower the level or block the effects of certain hormones such as testosterone or estrogen.

In some embodiments, the therapeutic efficacy the ability of the replicative oncolytic vaccinia virus expressing an immune checkpoint protein antagonist, wherein the antagonist is a PD-1 antagonist or a PD-L1 antagonist to activate human T lymphocytes, induce cytokine release (e.g., IFN-γ secretion and/or IL-2 measurements) as well as to stimulate/increase T-cell proliferation can be measured. In some embodiments, these are measured in the context of an allogeneic mixed lymphocyte reaction (MLR).

In some embodiments, the therapeutic efficacy is measured by measuring the level of at least one Th1 biomarker (e.g., IL-2, IL-12, and/or IFN-γ) in a sample (e.g., blood) obtained from the subject before administering a first dose of the oncolytic vaccinia virus to the subject and in at least two samples obtained from the subject at a first time point and a second time point after administering a first dose of the oncolytic vaccinia virus to the subject. In some embodiments, an increase in the level of at least one Th1 biomarker in a sample obtained from the subject at the first or second time point compared to the level of at least one Th1 biomarker in a sample obtained from the subject before administering a first dose of the oncolytic vaccinia virus indicates that the subject is responding to the oncolytic vaccinia virus therapy. In some embodiments, an increase in the level of at least one Th1 biomarker in a sample obtained from the subject at the second time point compared to the level of at least one Th1 biomarker in a sample obtained from the subject at the first time point indicates that the subject is responding to the oncolytic vaccinia virus therapy.

Compositions And Formulations

The oncolytic vaccinia virus of the pharmaceutical composition is administered intratumorally to cancer or tumor cells and accordingly, the pharmaceutical compositions disclosed herein are formulated for intratumoral administration (e.g., by intratumoral injection).

Intratumoral injection of the oncolytic vaccinia virus may be by syringe or any other method used for injection of a solution, as long as the expression construct can pass through the particular gauge of needle required for injection. A novel needleless injection system has recently been described (U.S. Patent No. 5,846,233, incorporated herein by reference) having a nozzle defining an ampule chamber for holding the solution and an energy device for pushing the solution out of the nozzle to the site of delivery. A syringe system has also been described for use in gene therapy that permits multiple injections of predetermined quantities of a solution precisely at any depth (U.S. Patent No. 5,846,225, incorporated herein by reference).

Solutions of the active compounds as free base or pharmacologically acceptable salts may be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions may also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions (U.S. Patent No. 5,466,468, specifically incorporated herein by reference in its entirety). In all cases the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and/or vegetable oils. Proper fluidity may be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.

For intratumoral injection in an aqueous solution, for example, the solution may be suitably buffered if necessary and the liquid diluent first rendered isotonic with sufficient saline or glucose. In this connection, sterile aqueous media that can be employed will be known to those of skill in the art in light of the present disclosure. For example, one dosage may be dissolved in 1 ml of isotonic NaCl solution and either added to 1000 ml of hypodermoclysis fluid or injected at the proposed site of infusion, (see for example, "Remington's Pharmaceutical Sciences" 15^th Edition, pages 1035-1038 and 1570-1580). Some variation in dosage will necessarily occur depending on the condition of the subject being treated. The person responsible for administration will, in any event, determine the appropriate dose for the individual subject. Moreover, for human administration, preparations should meet sterility, pyrogenicity, general safety and purity standards as required by FDA Office of Biologics standards.

Sterile injectable solutions are prepared by incorporating the active compounds in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.

The compositions disclosed herein may be formulated in a neutral or salt form. Pharmaceutically-acceptable salts, include the acid addition salts (formed with the free amino groups of the protein) and which are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, mandelic, and the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, histidine, procaine and the like. Upon formulation, solutions will be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective. The formulations are easily administered in a variety of dosage forms such as injectable solutions, drug release capsules and the like.

As used herein, "carrier" includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredient, its use in the therapeutic compositions is contemplated. Supplementary active ingredients can also be incorporated into the compositions.

The phrase "pharmaceutically-acceptable" or "pharmacologically-acceptable" refers to molecular entities and compositions that do not produce an allergic or similar untoward reaction when administered to a human. The preparation of an aqueous composition that contains a protein as an active ingredient is well understood in the art. Typically, such compositions are prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, liquid prior to injection can also be prepared.

EXAMPLES

EXAMPLE 1

Construction of recombinant vaccinia virus expressing single-chain variable fragment (scFv) of immune checkpoint protein antagonist such as anti-PD-1, anti-PD-L1.

Introduction

A vaccinia virus expressing an immune checkpoint modulator was derived from its parental virus Wyeth or Western Reserve strain. Its thymidine kinase gene (TK, J2R) was deleted by inserting genes corresponding to immune checkpoint protein antagonist such as anti-PD-1 or anti-PD-L1 scFv. All immune modulator genes were inserted under the control of Vaccinia viral promoter such as synthetic E/L promoter. The scFv of immune checkpoint antagonist is started with an albumin leader sequene at their N-terminus and ended with a (His)6 tag at the C-terminus. These exogeneous genes were inserted at TK locus (J2R) by recombination (Figure 1).

The foreign gene of interest was cloned into the plasmid pMA-MC2 to be flanked by the vaccinia virus genome J1R and J3R to prepare transfer vector. Generation of the recombinant virus was conducted following the principles of homologous recombination. When backbone virus had intact TK, 143B cells used as host cells with the selection reagent 5-bromo-2’-deoxy uridine (BrdU) since in the presence of active TK, phosphorylated BrdU causes lethal mutations in viral DNA, thus theoretically permitting only recombinant virus to survive. Alternatively, a step-wise engineering approach was adopted to create fluorescence gene inserted virus at thymidine kinase locus and the fluorescence gene expression was used as marker when selecting colorless recombinant viruses.

Method

For homologous recombination, host cells such as 143B or U-2 OS cells were plated in a 6-well tissue culture plate in 2 mL of cell growth medium per well and incubated for 16 to 20 hours in 37℃ CO2 incubator. When the cells were 60 to 80% confluent, backbone virus with intact TK or fluorescence gene at TK locus was sonicated in iced-cup sonicator three times for 1 minute at full power. Virus inoculum was prepared by diluting a crude virus stock in infection medium, DMEM containing 2.5% fetal bovine serum to give a multiplicity of infection (MOI) of 0.05 plaque forming units (PFU) per cell. The virus inoculum was added after removing cell growth medium from the cultures and plates were placed in a 37℃ CO2 incubator for 2 hours. Transfer vector and transfection polymer nanocomplex was prepared approximately 15 minutes before transfer vector transfection. After 2 hours of virus adsorption period, virus inoculum was aspirated from host cell cultures and the cells were washed once with 2 mL of infection medium. 1 mL of infection medium was added on well and entire nanoparticle complex solution was dropped to the cells. Plates were rocked gently back and forth to mix and incubated in a 37℃ CO2 incubator for 4 hours. The nanoparticle complex was removed from cells by aspiration and 2 mL of fresh cell growth medium was replaced. The plates were returned to the 37℃ incubator and incubated for 72 hours. Infected/transfected cells were harvested from the well with a disposable rubber scraper or by pipetting repeatedly on top of the monolayer. The cell suspension was collected and progeny viruses were released from cells by repeated freezing-thawing and vortexing three times. The cell lysate was stored below -60℃ until plaque isolation was conducted.

The frozen cell lysate was thawed and sonicated in an iced-cup sonicator three times at full power until the material in the suspension was dispersed. To prepare the inoculums, dilutions of the cell lysate was made in cell infection medium. The host cells were plated in 6-well tissue culture plate and incubated in a 37℃ CO2 incubator for 16 to 20 hours until cells were approximately 90% confluent. The cell monolayer was infected with 1 mL of diluted lysate per well after aspirating growth medium from the well and incubated for 2 hours in a 37℃ CO2 incubator to allow virus adsorption. Before the end of the adsorption period, sterilized 2% low melting point agarose was warmed in a 37℃ water bath. To prepare selective plaque medium, 1/100 volume of 5 mg/mL BrdU was added to 2X DMEM containing 4% fetal bovine serum for TK selection with 143B cells and no additions made for fluorescence color screening with U-2 OS cells. Immediately before use, DMEM-agarose overlay was prepared by mixing equal volumes of the solutions and 3 mL of DMEM-agarose overlay medium was added after removing virus inoculum from each well. Plates were placed in a biosafety cabinet at room temperature to solidify agarose. Plates were incubated in a 37℃ CO2 incubator for 48 to 96 hours to allow for vaccinia plaque to develop. When plaque were clearly visible, well-separated plaque were picked with a pipette tip through the agarose medium all the way to the plastic. For color screening method with U-2 OS cells, green fluorescence or mCherry negative plaques were selected. To scrape and detach cells in the plaque, the pipette tip was rocked slightly and the agarose plug was aspirated gently. The plaques were transferred to microtube containing 0.5 mL of serum free medium. Each virus-containing tube was vortexed and freeze-thaw-vortex cycle was performed three times. Plaque isolation procedure was repeated for three to five rounds to ensure a clonally pure recombinant virus was collected. These purified plaque were ready for further confirmation analysis.

EXAMPLE 2

Confirmation of anti-PD-1, anti-PD-L1 single-chain variable fragment (scFv) gene insertion and thymidine kinase gene deletion by PCR and sequencing.

Method

To release genomic DNA from recombinant virus infected cell lysate, proteinase and lysis buffer were used to lyse the virus particle. 10 μL of plaque supernatant was mixed with 1 μL of proteinase K and 10 μL of lysis buffer and vortexed thoroughly for 15 seconds. The microtube with mixture was then incubated at 56℃ for 10 minutes, 98℃ for 10 minutes and cooled down to 4℃ for enzyme activation and denaturation. Primers specifically targeting both flanking side of J1R and J3R were designed and synthesized by Macrogen Inc. (Daejeon, Korea) (Forward primer: ttgcgatcaataaatggatcacaaccag, Reverse primer: ccgagtcagtctcatgttctcacc). PCR reaction mixture was prepared including 1 μL of 10X diluted virus lysate and the tubes were put into the thermocycler (Agilent Technologies, SureCycler 8800, G8800A) pre-programed with typical parameter. The PCR product was run into 1.0% agarose gel at 100 V for 30 to 40 minutes to confirm the size of PCR product.

With regards to the anti-PD-1 and anti-PD-L1 scFv gene insertion in vaccinia virus between J1R and J3R locus, the PCR product was sequenced using primers placed at various points along the DNA sequence that would allow for complete coverage of the entire transgene insertion region. The sequencing was conducted at Macrogen Inc. (Daejeon, Korea). All sequence data obtained were compared with given scFv sequences to determine the accuracy of the recombination. Sequence was assembled, edited, and analyzed using SnapGene software.

Result

The genomic DNA extracted from recombinant viral plaque was amplified by PCR reaction and loaded on SDS-PAGE gel to confirm the product size (Figure 2). The PCR product band targeting J1R to J3R locus of WR ΔTK αPD-L1 scFv was displayed at the expected size (2.2 kb). The wild type backbone virus was used as a control and the band was detected at 1.7 kb, which is the expected size of J2R flanked by J1R and J3R. To demonstrate thymidine gene deletion, J1R to J2R locus of WR ΔTK αPD-L1 scFv was amplified and loaded. Since reverse primer was designed from J2R gene, no band signal was detected as expected and the deletion of J2R region was confirmed.

To obtain precise sequence information of WR ΔTK αPD-1 scFv and WR ΔTK αPD-L1 scFv, genomic DNA extracted from recombinant viral plaque was amplified by PCR reaction (Forward: ctctagctaccaccgcaatagatcc, Reverse: gcgacctcatttgcactttctgg). Various sequencing primers were used as needed. All sequence data obtained were compared with given scFv sequences and transgene locus match the expected sequences of scFv (Figure 3). The inserting cassettes were resided in between J1R and J3R loci deleting whole J2R gene as designed.

EXAMPLE 3

Confirmation of anti-PD-1, anti-PD-L1 single-chain variable fragment (scFv) protein secretion by western blotting.

Introduction

When a specific gene was inserted to virus by recombination, plaque purification is conducted several times and a number of final viral plaque is collected. To confirm whether a new engineered virus expresses a corresponding protein translated from an inserted gene and evaluate its approximate quantity, western blot would be a proper analysis method. Also, this approach makes it easy to determine plaque expressing high level of expected size of protein.

Method

To prepare secreted scFv protein samples, target host cells e.g., mammalian cancer cells was infected with the recombinant vaccinia virus encoding anti-PD-1 scFv or anti-PD-L1 scFv and supernatant was collected. Prior to cell infection, titer of each virus was calculated following standard operating procedure. The host cells were seeded in 6-well tissue culture plate and incubated overnight in a 37℃ CO2 incubator. When the cells reached 100% confluency, 1mL of virus inoculum, which was prepared by diluting sonicated virus in the cell infection medium, was applied to cells at various MOIs. Cell growth media were aspirated and added 2 hours after infection and cells the plates were incubated until designated harvesting time point in a 37℃ CO2 incubator. At each harvesting time point, the culture supernatant was collected and centrifuged for 5 minutes at 1,000 rpm, 4℃. 1 part of sample was mixed with 3 part of sample buffer and heated at 95℃ for 5 minutes to reduce and denature sample. The microtubes with sample in buffer was placed on ice for 5 minutes and spun down. An equal amount of protein was loaded into the wells of the SDS-PAGE gel along with 5 μL of molecular weight marker and the gel was run at 100 V until the dye reached the bottom of the gel. A piece of PVDF membrane was cut and soaked in methanol for minutes. A transfer stack was assembled by sandwiching the membrane and gel between filter papers and sponges and run at 250mA for 1 hour. The membrane was incubated and blocked in 5% skim milk for 1 hour at room temperature, agitating gently on a rocker at 30 rpm and sequentially incubated with HRP enzyme conjugated primary antibody (Anti-6X His tag antibody, HRP conjugated) in blocking buffer for 1 to 2 hours at recommended concentration and temperature, agitating gently on a rocker at 30 rpm. The membrane was incubated with hydrogen peroxide and luminol substrate and the result was analyzed by acquiring image using chemiluminescence equipment (Core Bio, GS 700).

Result

The His tagged protein was detected by HRP conjugated primary antibody and the band was detected at the expected size (25-35 kDa) (Figure 4). The signal intensity of the bands of interest was quantified and the amount of scFv protein expression in the culture supernatant showed approximately 16 times higher than in the cell pellet when it normalized to its expression from the cell pellet.

EXAMPLE 4

Quantification of secreted anti-PD-1, anti-PD-L1 single-chain variable fragment (scFv) protein expressed from recombinant vaccinia virus by ELISA.

Introduction

His tag is a tag with successive histidine (H) residues and is the most dominant tag, which is widely used in recombinant protein expression due to its small size, less interference in protein folding, and weak immunogenicity. The scFv sequence which is tagged with (His)6, at C-terminus is constructed and His tag antibody is a useful tool for the identification and quantification of His-tagged proteins with various methods particularly enzyme-linked immunosorbent assay (ELISA).

Method

The samples for ELISA assay were prepared as the sample was prepared for western blotting described above. Briefly, the host cells were seeded one day before virus application at various MOIs for 2 hours for virus adsorption and incubated until designated time point in a 37℃ CO2 incubator. At each harvesting time, the culture supernatant was collected and centrifuged for 5 minutes at 1,000 rpm, 4℃.

His Tag ELISA detection kit (GenStript, Cat.#L00436) was used to detect the quantity of His-tagged scFv protein and the reagents and plate strips were prepared as per the manufacturer’s instructions. The antibody tracer in this kit was conjugated with a horseradish peroxidase (HRP), and the His tagged protein in the sample ultimately can be detected with a TMB substrate and measured by a microplate reader at 450 nm. The 50 μL of test sample was equilibrated to room temperature and added to each well of His Tag Plate. 50 μL of anti-His Monoclonal Antibody was added to all the wells and the plate was incubated at room temperature for 30 minutes covered with plate sealer. The plate was washed four times with 260 μL of 1X wash solution and liquid in the wells was removed by patting the plate on paper towel. 100 μL of TMB substrate was added to all the wells and incubated at room temperature for 10 to 15 minutes. The absorbance of the plate was red on the microplate reader (BioTek, Synergy H1MF) at 450 nm after stopping the enzyme reaction with 50 μL of stop solution. A standard curve was generated by plotting the absorbance on the vertical axis versus the His-tagged standard concentration on the horizontal axis and the amount of His-tagged scFv protein in a sample was determined by extrapolating its OD value to the standard curve deducing molecular weights of His-tag protein standards (11 kDa), anti-PD-1 scFv (approximately 30 kDa) and anti-PD-L1 scFv (approximately 27 kDa) (Figure 5).

EXAMPLE 5

Evaluation of in vitro replication and oncolytic activities of recombinant viruses.

Method

The study was designed to analyze replication and production of infectious virus particle in vitro. To examine virus replication rate, different types of cells were seeded in a 24-well tissue culture plate with the optimized growing media for each cell type and incubated for 16 to 20 hours in a 37℃ CO2 incubator. The virus inoculum was sonicated and vortexed vigorously prior to use and diluted with an infection medium. The cells were infected with diluted virus at the MOI of 1 to 3 in a total volume of 200 μL and placed in a 37℃ CO2 incubator for 2 hours, rocking the plates manually every 15 minutes. The infected cells were washed twice with 500 μL of infection media and incubated for 24, 48 and 72 hours. At each designated harvesting day, the infected cells were detached from the well by scraping them into the media using the rubber part of the plunger of a syringe and collected in a microtube. The cell suspension was lysed by three times of freeze-thaw cycling and sonicated in iced-cup sonicator at full power. The production of infectious particle was determined by plaque assay in U-2 OS cells according to standard operating procedure (Figure 6A).

To characterize the susceptibility of cancer cells to virus in vitro, cancer cells were seeded at a concentration of 5.0E+04 cells per well in 96-well tissue culture plate in a volume of 100 μL of growth media and incubated for 16 to 20 hours in a 37℃ CO2 incubator. The cells were infected with recombinant viruses with a multiplicity of infection from 10 to 0.0001 pfu/cell. After 24, 48 and 72 hours post-infection, the cell viability was assessed using Cell Counting Kit-8 (Dojindo Molecular Technologies, Inc., Cat.#CK-04) in accordance with manufacturer’s instruction. The EC₅₀ value was calculated using GraphPad Prism® version 5 (Figure 6B).

Example 6

Purification and concentration of secreted anti-PD-1, anti-PD-L1 single-chain variable fragment (scFv) protein expressed from recombinant vaccinia virus.

Introduction

When the anti-PD-1 or anti-PD-L1 scFv secreted from recombinant vaccinia virus is purified, the efficacy thereof can be evaluated by various methods. One way to obtain pure His-tagged scFv proteins is to use a cobalt chelating resin, which binds His-tagged proteins and releases captured His-tagged proteins at high concentrations of imidazole.

Method

To purify the secreted scFv protein, HeLaS3 cells were seeded one day before virus application at 0.03 MOI for 2 hours for virus adsorption and cultured for 72 hours in a 37℃ CO₂ incubator. The culture supernatant was collected, and infected cells were harvested with a disposable rubber scraper. ScFv proteins were released from cells by repeated freezing-thawing and vortexing three times. The supernatant containing an scFv protein was collected by centrifugation at 1,000 rpm for 5 minutes.

HisTALON Gravity Column Purification Kit (Clontech, Cat. #635654) was used to purify the His-tagged scFv protein. The column and reagents were prepared as per the manufacturer’s instructions. Resin is a tetradentate chelator charged with cobalt and is specific for His-tagged proteins. The collected supernatant was passed through a column and the column was washed with an Equilibration Buffer containing 10 mM imidazole. The scFv protein was collected by an Elution Buffer containing 150 mM imidazole.

The scFv protein was desalted using a PD-10 Desalting Column (GE Healthcare, Cat. #17-0851-01). The column was placed in a 50 ml collection tube and filled with PBS buffer for equilibration. The PBS buffer was discarded by centrifugation at 1,000 × g for 2 minutes and the scFv protein solution was loaded onto the column. The purified scFv protein was collected by centrifugation (Figure 7).

To obtain a high concentration of the scFv protein, the purified scFv protein was concentrated using Macrosep Advance Centrifugal Devices (PALL, Cat. #MAP010C37). The molecular weight of the protein larger than the ultrafiltration cut-off was maintained in the sample reservoir, while the low molecular weight molecules and solution entered the filtrate receiver. The purified scFv protein was concentrated in the sample reservoir by centrifugation at 5,000 × g for 90 minutes.

EXAMPLE 7

Functionality evaluation of anti-PD-1 or anti-PD-L1 scFv by examining its binding activity to PD-1 or PD-L1 expressing cells.

Introduction

To confirm binding of anti-PD-1 or anti-PD-L1 scFv to the appropriate target protein, PD-1 or PD-L1, colocalization of scFv and its target protein can be observed using a fluorescence microscope. Two fluorescent antibodies are used in this method: red fluorescent antibodies capable of observing PD-1 or PD-L1 and green fluorescent antibodies capable of observing His-tagged PD-1 or PD-L1 scFv, respectively.

Method

In order to verify whether the purified anti-PD-1 or anti-PD-L1 scFv was able to bind to PD-1 or PD-L1, the binding of scFv to its target protein was observed using fluorescence-conjugated antibodies by a fluorescence microscopy. Coverslips were coated with 0.1% gelatin in a 12-well plate for 24 hours in a 37℃ CO2 incubator. HEK293T cells were seeded on coverslips and transfected with PD-1 or PD-L1 cDNA using lipofectamine 3000 (Thermo Fisher, Cat. L3000015). PD-1 or PD-L1 expressing cells were incubated with 100 ng/ml scFv for 6 hours and fixed with 4% paraformaldehyde for 20 minutes. The fixed cells were incubated with primary antibodies (anti-PD-1 or PD-L1 rabbit antibody for PD-1 or PD-L1 and anti-his mouse antibody for His-tagged scFv) followed by secondary antibodies (anti-rabbit RFP-conjugated antibody and anti-mouse GFP-conjugated antibody). Coverslips were detached from the 12 well plate using forceps and placed on a slide. Using a fluorescence microscope, the binding of anti-PD-1 or anti-PD-L1 scFv to each target protein, PD-1 or PD-L1 was examined by observation of colocalization of two colors (Figure 8).

EXAMPLE 8

Inhibitory concentrations for blockade of scFv binding to PD-L1 CHO-K1 cell.

Introduction

To demonstrate functional activity of scFvs expressed from cells infected with vaccinia viruses encoding scFvs of anti-PD-1 or anti PD-L1 antibodies, PD-1/PD-L1 Blockade Bioassay kit (Promega, Cat.#J4015), a commercial bioluminescent cell-based assay kit is used. The assay consists of two genetically engineered cell lines, PD-1 effector cells expressing human PD-1/ luciferase reporter driven by an NFAT response element and PD-L1 aAPC/CHO-K1 cells expressing human PD-L1/TCRs. When the two cell types are co-cultured, the PD-1/PD-L1 interaction inhibits TCR signaling and NFAT-RE-mediated luminescence. Addition of either an anti-PD-1 or anti-PD-L1 antibody that blocks the PD-1/PD-L1 interaction releases the inhibitory signal and resulted in TCR activation followed by NFAT-RE-mediated luminescence that can be quantified by a luminometer.

Method

To assess the blocking activity of the purified scFv molecules, PD-L1 aAPC/CHO-K1 cells were prepared and plated according to the manufacturer’s instructions (Promega, Technical Manual TM468) and a plate layout was designed. One vial of PD-L1 aAPC/CHO-K1 cells was thawed in a 37℃ water bath until just thawed and transferred to the conical tube containing 5 mL of cell recovery medium. The cell suspension was dispensed by 100 μL to each well in a 96-well, white, flat-bottom assay plates and incubated overnight in a 37℃ CO2 incubator. On the day of assay, 250 μL of stock samples and 3-fold serial dilutions with an assay buffer was added to a sterile clear 96-well plate. 95 μL of recovery medium was removed from the 96-well assay plate containing PD-L1 aAPC/CHO-K1 cells and 40 μL of the appropriate diluted samples were immediately added to the pre-plated PD-L1 aAPC/CHO-K1 cells. The assay plates were kept in ambient temperature covered with a lid while preparing the PD-1 effector cells. One vial of PD-1 effector cells was thawed and resuspended with assay buffer. 40 μL of cell suspension was dispensed to each wells of the assay plate and incubated for six hours in a 37℃ CO2 incubator. 80 μL of Bio-GloTM Reagent was added to each well of the assay plate and the plate was incubated at ambient temperature for 5 to 30 minutes. Then, the luminescence was measured using a luminescence microplate reader (BioTek, Synergy H1MF). The standard curve and EC50 value of blocking response of scFv molecule was determined using software, GraphPad Prism® version 5 (Figure 9).

EXAMPLE 9

Quantification of anti-CD3 receptor and CD80 on the surface of cancer cells and measurement of T cell activity in vitro.

Introduction

To measure the cytotoxic ability of T cells regardless of allogeneic reaction between human T cells and cancer cells, cancer cells need to be made recognizable by human T cells. The anti-CD3 receptor and CD80 expressing cancer cells can induce a TCR reaction in T cells. The TCR reaction is, however, reduced by interaction with PD-1 and PD-L1. Thus, blockade of the interaction by anti-PD-1 or anti-PD-L1 scFv can increase the TCR reaction. CD8+ T cells are able to kill target cells by the TCR reaction. The anti-PD-1 or anti-PD-L1 scFv blocking ability can be evaluated by co-culturing human CD8+ T cells in an anti-CD3 receptor and CD80 expressing cancer cells. In addition, cancer cells are transfected with the luciferase gene, and thus cell death of cancer cells by T cells is quantified by luciferase activity.

Method

To determine whether anti-PD-L1 scFv from cells infected with the recombinant virus reinvigorates the killing ability of human T lymphocytes, cytotoxicity was measured by a cytotoxic T lymphocyte assay. Human peripheral blood mononuclear cells (PBMCs) were isolated from human whole blood samples using Lymphoprep (STEMCELL, Cat. #07851) and CD8+ T cells were obtained from PBMCs using Dynabeads CD8 Positive Isolation Kit (Invitrogen, Cat. #11333D). Cancer cells such as H460, A549 and PANC-1 were transfected with cDNA encoding an anti-CD3 receptor, CD80, and luciferase genes. H460, A549, and PANC-1 cells have relatively high, intermediate, and low expression of PD-L1, respectively. CD8+ T cells were co-cultured in a 96 well plate with the transfected cancer cells at an effector-target (E/T) ratio of 1:1 and 100 nM of anti-PD-L1 scFv was added. The plate was incubated for 24 hours in a 37℃ CO₂ incubator. To measure the lysis of cancer cells by CD8+ T cells, luciferase activity in cancer cells was detected using the Bright-Glo Luciferase Assay System (Promega, Cat. #E2620). The luciferase detection reagent was added to each well at a volume equal to the cell culture medium. The plate was shaken for 10 minutes to react with the reagent and luminescence was measured in live cancer cells using a luminescence microplate reader (BioTek, Synergy H1MF) (Figure 10).

EXAMPLE 10

Anti-tumor activity of vaccinia virus encoding anti-PD-1 and anti-PD-L1 in syngeneic mouse solid tumor model.

Method

In order to determine whether the local expression of scFv could improve the antitumoral efficacy of vaccinia virus, syngeneic mouse solid tumor models are tested on tumor growth, animal survival and immune cell change in the tumor and serum by flow cytometry and immunohistochemistry.

CT-26 (murine colon carcinoma) cells (at 5.0E+05) or RENCA (murine renal cortical adenocarcinoma) cells (at 2.5E+06) are injected subcutaneously (SC) into the right flank of immunocompetent male BALB/c mice. When the tumor size reaches 100 mm3 (CT-26) or 50 to 100 mm3 (RENCA), the recombinant vaccinia virus encoding anti-PD-L1 scFv is injected into the tumor at 5.0E+07 plaque forming unit (PFU), four times with 3 days interval. Subsequent tumor burden is calculated by caliper measurement and mice are sacrificed when their tumor volume reaches 1,500 mm3. Tumor size and mice weight are measured twice every week. Data analysis is performed using software GraphPad Prism® version 5.

For immune cell phenotyping, tumor tissue are minced into 3-4 mm pieces and incubated with 1,000 U/mL of collagenase type IV for 30 minutes in a 37℃ CO2 incubator. The digested cells are filtered through 100 micron cell strainer to remove connective tissue of the outer membrane. The cell pellet is thoroughly re-suspended with RBC lysis buffer to lyse RBC cells and centrifuged for 5 minutes at room temperature. Fresh cold PBS is added to isolated cells and cells are stained with fixable viability dye FVS780 (BD HorizonTM) to distinguish live cells. For analysis of surface markers, cells are stained with CD3 (BD PharmingenTM, Alexa Flour® 647), CD4 (BD PharmingenTM, PerCP-CyTM5.5), CD8a (BD PharmingenTM, FITC), CD11b (BD PharmingenTM, PE) and Ly-6G/Ly6C (BD HorizonTM, V450) in accordance with the manufacturer’s instructions. Flow cytometry data are acquired on BD LSR Fortessa and analyzed using BD FACS Diva 8.0.1.

For immunohistochemistry, tumor tissues are fixed in 1% paraformaldehyde for 5 hours and dehydrated in 20% sucrose in PBS for overnight at 4℃. Tissues are embedded in O.C.T. and frozen below -70℃. Frozen blocks are cryo-sectioned into 50 μm sections, permeabilized with 0.3% PBS-T for 3 minutes at room temperature and blocked with 5% goat serum for 1 hour at room temperature. Primary antibodies against Vaccinia (abcam, Cat.#ab35219), PD-L1 (eBioscience, Cat.#14-5982-82), caspase 3 (R&D systems, Cat.#AF835), CD8a (BD ParmingenTM, Cat.#558733), CD11b (BD ParmingenTM, Cat.#550282), CD11c (BD ParmingenTM, Cat.#550283), CD31 (Millipore, Cat.#MAB1398z) and DAPI (Invitrogen, Cat.#D3571) are incubated with tissue slides according to the manufacturer’s instructions. FITC (Jackson ImmunoResearch) and Cy3 (Jackson ImmunoResearch) conjugate antibodies are used as secondary antibody followed by washing with PBS. The tissue slides are mounted with a Fluorescence mounting medium (DAKO, Cat.#S3023) and visualized using a Confocal Laser Scanning Microscope (Zeiss LSM 700).

Separately to quantify local and systemic expression of anti-PD-L1 scFv, recombinant virus is injected intratumorally once at 5.0E+07 pfu to CT-26 or RENCA bearing BALB/c mice. Blood and tumors from mice are sampled at different time points ( day 1, 3 and 6). Plasma is collected by centrifugation of whole blood sample at 3,000 rpm, 4℃ for 10 minutes and stored at -20℃ until analysis. Isolated tumors are weighed, cut into small pieces and mechanically dissociated in a homogenizer (OMNI International, OMNI Beads Ruptor 24) with ceramic beads. The lysed tumor tissue is centrifuged and the supernatant was recovered, and stored at -20℃. The amount of scFv is determined using ELISA kit for His-tag (GenStript, Cat#L00436).

The examples set forth above are provided to give those of ordinary skill in the art a complete disclosure and description of how to make and use the embodiments of the compositions, systems and methods of the invention, and are not intended to limit the scope of what the inventors regard as their invention. Modifications of the above-described modes for carrying out the invention that are obvious to persons of skill in the art are intended to be within the scope of the following claims. All patents and publications mentioned in the specification are indicative of the levels of skill of those skilled in the art to which the invention pertains. All references cited in this disclosure are incorporated by reference to the same extent as if each reference had been incorporated by reference in its entirety individually.

All headings and section designations are used for clarity and reference purposes only and are not to be considered limiting in any way. For example, those of skill in the art will appreciate the usefulness of combining various aspects from different headings and sections as appropriate according to the spirit and scope of the invention described herein.

All references cited herein are hereby incorporated by reference herein in their entireties and for all purposes to the same extent as if each individual publication or patent or patent application was specifically and individually indicated to be incorporated by reference in its entirety for all purposes.

Many modifications and variations of this application can be made without departing from its spirit and scope, as will be apparent to those skilled in the art. The specific embodiments and examples described herein are offered by way of example only, and the application is to be limited only by the terms of the appended claims, along with the full scope of equivalents to which the claims are entitled.

Claims (49)

1. A method for treating cancer in a subject in need thereof comprising administering to the subject an effective amount of a replicative oncolytic vaccinia virus expressing an immune checkpoint protein antagonist(s), wherein the antagonist is a PD-1 antagonist or a PD-L1 antagonist, and wherein the antagonist is capable of binding to a protein expressed in the subject.
2. The method of any of the preceding claims, wherein the immune checkpoint antagonist is an antibody.
3. The method of any of the preceding claims, wherein the antagonist is an anti-PD-1 antibody or PD-1 binding protein.
4. The method of any one of claims 1 to 3, wherein the anti-PD-1 antibody or PD-1 binding protein comprises:

   a) a heavy chain variable region comprising:

   i) a first CDR comprising SEQ ID NO: 2;

   ii) a second CDR comprising SEQ ID NO: 3;

   iii) a third CDR comprising SEQ ID NO: 4; and

   b) a light chain variable region comprising:

   i) a first CDR comprising SEQ ID NO: 6;

   ii) a second CDR comprising SEQ ID NO: 7;

   iii) a third CDR comprising SEQ ID NO: 8.
5. The method of claim 4, wherein the heavy chain comprises SEQ ID NO: 1.
6. The method of claim 4, wherein the light chain comprises SEQ ID NO: 5.
7. The method of claim 4, wherein the heavy chain comprises SEQ ID NO: 1 and the light chain comprises SEQ ID NO: 5.
8. The method of any one of claims 1 to 3, wherein the anti-PD-1 antibody or PD-1 binding protein comprises:

   a) a heavy chain variable region comprising:

   i) a first CDR comprising SEQ ID NO: 10;

   ii) a second CDR comprising SEQ ID NO: 11;

   iii) a third CDR comprising SEQ ID NO: 12; and

   b) a light chain variable region comprising:

   i) a first CDR comprising SEQ ID NO: 14;

   ii) a second CDR comprising SEQ ID NO: 15;

   iii) a third CDR comprising SEQ ID NO: 16.
9. The method of claim 8, wherein the heavy chain comprises SEQ ID NO: 9.
10. The method of claim 8, wherein the light chain comprises SEQ ID NO: 13.
11. The method of claim 8, wherein the heavy chain comprises SEQ ID NO: 9 and the light chain comprises SEQ ID NO: 13.
12. The method of any one of claims 1 to 3, wherein the anti-PD-1 antibody or PD-1 binding protein comprises:

    a) a heavy chain variable region comprising:

    i) a first CDR comprising SEQ ID NO: 18;

    ii) a second CDR comprising SEQ ID NO: 19;

    iii) a third CDR comprising SEQ ID NO: 20; and

    b) a light chain variable region comprising:

    i) a first CDR comprising SEQ ID NO: 22;

    ii) a second CDR comprising SEQ ID NO: 23;

    iii) a third CDR comprising SEQ ID NO: 24.
13. The method of claim 12, wherein the heavy chain comprises SEQ ID NO: 17.
14. The method of claim 12, wherein the light chain comprises SEQ ID NO: 21.
15. The method of claim 12, wherein the heavy chain comprises SEQ ID NO: 17 and the light chain comprises SEQ ID NO: 21.
16. The method of any one of claims 1 to 3, wherein the antagonist is an anti-PD-L1 antibody or PD-L1 binding protein.
17. The method of claim 16, wherein the anti-PD-L1 antibody or PD-L1 binding protein comprises:

    a) a heavy chain variable region comprising:

    i) a first CDR comprising SEQ ID NO: 26;

    ii) a second CDR comprising SEQ ID NO: 27;

    iii) a third CDR comprising SEQ ID NO: 28; and

    b) a light chain variable region comprising:

    i) a first CDR comprising SEQ ID NO: 30;

    ii) a second CDR comprising SEQ ID NO: 31;

    iii) a third CDR comprising SEQ ID NO: 32.
18. The method of claim 17, wherein the heavy chain comprises SEQ ID NO: 25.
19. The method of claim 17, wherein the light chain comprises SEQ ID NO: 29.
20. The method of claim 17, wherein the heavy chain comprises SEQ ID NO: 25 and the light chain comprises SEQ ID NO: 29.
21. The method of any of the preceding claims, wherein the oncolytic vaccinia virus expresses an antagonist of PD-1 and an antagonist of PD-L1 in an infected cell.
22. The method of any of the preceding claims, wherein the immune checkpoint antagonist is a single chain variable fragment (scFv).
23. The method of any of the preceding claims, wherein the scFV comprises a linker.
24. The method of any of the preceding claims, wherein the linker is selected from the group consisting of GLGGLGGGGSGGGGSGGSSGVGS, GGGGS, GGGGSGGGGS, GGGGSGGGGSGGGGS, and (GGGGS)n, wherein n is an integer from 1 to 5.
25. The method of any of the preceding claims, wherein the scFv is an anti PD-1 scFv (2B9) encoded by SEQ ID NO: 49.
26. The method of any of the preceding claims, wherein the scFv is an anti PD-L1 scFv (4F5) encoded by SEQ ID NO: 50.
27. The method of any of the preceding claims, wherein the immune checkpoint protein antagonist is expressed as a secretory protein or as a membrane bound protein comprising a transmembrane domain from a PDGF receptor or other type 1 membrane proteins for the purpose of displaying the antagonist on the surface of cells.
28. The method of any of the preceding claims, wherein the membrane bound protein is a single chain variable fragment (scFv) blocking PD-1.
29. The method of any of the preceding claims, wherein the membrane bound protein is a single chain variable fragment (scFv) blocking PD-L1.
30. The method of any of the preceding claims, wherein the oncolytic vaccinia virus expresses an anti-CD3 antibody or binding fragment to TCR thereof, and an anti-CD3 antibody or binding fragment comprises a transmembrane domain, for example, a transmembrane domain from a PDGF receptor or CD8 for the purpose of protruding the protein or fragment embedded in a cell membrane.
31. The method of any of the preceding claims, wherein the oncolytic vaccinia virus expresses B7 protein or its active fragment or CD40 or its active fragment, and B7 protein or CD40 or their active fragment comprises a transmembrane domain, for example, a transmembrane domain from a PDGF receptor or CD8 for the purpose of protruding the protein or fragment embedded in a cell membrane.
32. The method of any of the preceding claims, wherein expression of the antagonist by the vaccinia virus is under the control of a posttranscriptional regulatory element (PRE), preferably Woodchuck Hepatitis virus PRE or Hepatitis B virus PRE.
33. The method of any of the preceding claims, wherein the vaccinia virus also expresses a cytokine selected from GM-CSF, IL-2, IL-4, IL-5 IL-7, IL-12, IL-15, IL-21, IFN-γ, and TNF-α, preferably selected from IFN-γ, TNF-α, IL-2, GM-CSF and IL-12.
34. The method of any of the preceding claims, wherein the vaccinia virus also expresses a tumor antigen selected from BAGE, GAGE-1, GAGE-2, CEA, AIM2, CDK4, BMI1, COX-2 , MUM-1, MUC-1, TRP-1 TRP-2, GP100, EGFRvIII, EZH2, LICAM, Livin, Livinβ, MRP-3, Nestin, OLIG2 , SOX2, human papillomavirus-E6, human papillomavirus-E7, ART1, ART4, SART1, SART2, SART3, B-cyclin, β-catenin, Gli1, Cav-1, cathepsin B, CD74, E-cadherin, EphA2/Eck, Fra-1/Fosl 1, Ganglioside/GD2, GnT-V, β1,6-N, Her2/neu, Ki67, Ku70/80, IL-13Ra2, MAGE-1, MAGE-3, NY-ESO-1, MART-1, PROX1, PSCA, SOX10, SOX11, Survivin, caspase-8, UPAR, CA-125, PSA, p185HER2, CD5, IL-2R, Fap-α, tenascin, melanoma-associated antigen p97, and WT-1.
35. The method of any of the preceding claims, wherein the oncolytic vaccinia virus is TK-deficient.
36. The method of any of the preceding claims, wherein the oncolytic vaccinia virus comprises a VGF deletion.
37. The method of any of the preceding claims, wherein the oncolytic vaccinia virus is a Western Reserve (WR), Wyeth, Copenhagen or Lister strain.
38. The method of claim 37, wherein the oncolytic vaccinia virus is a WR strain, preferably TK-deficient and/or comprising a VGF deletion.
39. The method of claim 37, wherein the oncolytic vaccinia virus is a Wyeth strain, preferably TK-deficient.
40. The method of any of the preceding claims, wherein the cancer is selected from the group consisting of melanoma, hepatocellular carcinoma, renal cancer, head and neck cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, mesothelioma, gastrointestinal cancer, leukemia, colorectal, and thyroid cancer.
41. The method of any of the preceding claims, wherein the subject has failed at least one previous chemotherapy or immunotherapy treatment.
42. The method of any of the preceding claims, wherein the subject has a cancer that is refractory to an immune checkpoint inhibitor therapy.
43. The method of any of the preceding claims, wherein the subject is identified as a candidate for an immune checkpoint inhibitor therapy.
44. The method of any of the preceding claims, comprising administering to the subject an additional therapy selected from chemotherapy (alkylating agents, nucleoside analogs, cytoskeleton modifiers, cytostatic agents) and radiotherapy.
45. The method of any of the preceding claims, comprising administering to the subject an additional oncolytic virus therapy (e.g., rhabdovirus, Semliki Forest Virus).
46. The method of any of the preceding claims, comprising measuring the level of at least one Th1 biomarker (e.g., IL-2, IL-12, IFN-γ) in a sample (e.g., blood) obtained from the subject before administering a first dose of the oncolytic vaccinia virus to the subject and in at least two samples obtained from the subject at a first time point and a second time point after administering a first dose of the oncolytic vaccinia virus to the subject.
47. The method of claim 46, wherein an increase in the level of at least one Th1 biomarker in a sample obtained from the subject at the first or second time point compared to the level of at least one Th1 biomarker in a sample obtained from the subject before administering a first dose of the oncolytic vaccinia virus indicates that the subject is responding to the oncolytic vaccinia virus therapy.
48. The method of claim 46, wherein an increase in the level of at least one Th1 biomarker in a sample obtained from the subject at the second time point compared to the level of at least one Th1 biomarker in a sample obtained from the subject at the first time point indicates that the subject is responding to the oncolytic vaccinia virus therapy.
49. A pharmaceutical composition for using in a method for treating cancer, comprising a replicative oncolytic vaccinia virus expressing an immune checkpoint protein antagonist(s), wherein the antagonist is a PD-1 antagonist or a PD-L1 antagonist, and wherein the antagonist is capable of binding to a protein expressed in the subject.

Images