WO2019135238A1 - Milieux de cellules souches pluripotentes naïves - Google Patents

Milieux de cellules souches pluripotentes naïves Download PDF

Info

Publication number
WO2019135238A1
WO2019135238A1 PCT/IL2019/050024 IL2019050024W WO2019135238A1 WO 2019135238 A1 WO2019135238 A1 WO 2019135238A1 IL 2019050024 W IL2019050024 W IL 2019050024W WO 2019135238 A1 WO2019135238 A1 WO 2019135238A1
Authority
WO
WIPO (PCT)
Prior art keywords
ras
inhibitor
media
cell
stem cell
Prior art date
Application number
PCT/IL2019/050024
Other languages
English (en)
Inventor
Ruby Shalom-Feuerstein
Anna ALTSHULER
Mila VERBUK
Original Assignee
Technion Research & Development Foundation Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Technion Research & Development Foundation Limited filed Critical Technion Research & Development Foundation Limited
Publication of WO2019135238A1 publication Critical patent/WO2019135238A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/0018—Culture media for cell or tissue culture
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0603—Embryonic cells ; Embryoid bodies
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/40—Regulators of development
    • C12N2501/405—Cell cycle regulated proteins, e.g. cyclins, cyclin-dependant kinases

Definitions

  • the present invention is in the field of pluripotent stem cells
  • Pluripotency defined as the ability of a cell to generate all cell types in the adult organism, is a transient feature of early embryonic development. It has been shown that pluripotency may exist in at least two fundamentally distinct states, namely, a“naive” and a “primed” state. Although both naive and primed pluripotent stem cells (PSCs) are able to form the three germ layers in vitro and in teratoma assay, only naive PSCs are able to efficiently contribute to the formation of chimeric animals.
  • Naive state culture of murine ESCs (mESCs) can be sustained in the presence of serum and leukemia inhibitory factor (FCS/LIF). However, a more uniform “ground state” culture that mirrors better the undifferentiated transcriptional and epigenetic landscape of pre-implantation epiblast cells can be achieved in the presence of a combination of LIF and inhibitors of MEK and GSK (2i/FIF).
  • hPSCs human PSCs
  • mPSCs mouse PSCs
  • hPSCs human PSCs
  • mPSCs mouse PSCs
  • hPSCs human PSCs
  • RAS proteins act as molecular switches, alternating between an inactive guanosine diphosphate (GDP) bound state and an active guanosine triphosphate (GTP) bound state.
  • GDP inactive guanosine diphosphate
  • GTP active guanosine triphosphate
  • Ras effector proteins Among these are the mitogen activated protein kinase (MAPK) and the phosphatidylinositol 3-kinase (PI3K) that regulate a cascade of signals leading to a wide range of cellular responses, including growth, differentiation, inflammation, survival and apoptosis.
  • MAPK mitogen activated protein kinase
  • PI3K phosphatidylinositol 3-kinase
  • the present invention provides tissue culture media, kits comprising a RAS- inhibitor. Methods of culturing and maintaining pluripotent stem cells (PSCs) in a naive state as well as reprograming cells to generate PSCs in a naive state are also provided.
  • PSCs pluripotent stem cells
  • tissue culture media comprising a RAS inhibitor and characterized in that it does not contain an animal derived component.
  • tissue culture media comprising a RAS inhibitor and characterized in that it does not contain an animal derived component.
  • a kit comprising tissue culture media and a RAS -inhibitor.
  • a method of maintaining a pluripotent stem cell (PSC) in a naive state comprising inhibiting RAS in the PSC.
  • PSC pluripotent stem cell
  • a method of generating a PSC in a naive state comprising providing a cell that is not a PSC in a naive state and inhibiting RAS is the cell.
  • the RAS inhibitor is selected from a pan-RAS inhibitor, a K-RAS inhibitor, an H-RAS inhibitor and an N-RAS inhibitor.
  • the RAS inhibitor is selected from a small molecule inhibitor and an inhibitory RNA.
  • the small molecule inhibitor is farnesylthiosalicyclic acid.
  • the inhibitory RNA is a small inhibitory RNA selected from an shRNA, an siRNA, and a miRNA.
  • the tissue culture media is suitable for culturing a stem cell.
  • the stem cell is a pluripotent stem cell (PSC).
  • the PSC is selected from an induced PSC (iPSC), a cell of a pluripotent cell line, and a primary embryonic stem cell.
  • the media of the invention further comprises at least one of leukemia inhibitory factor (Lif), a mitogen activated protein kinase (MAPK) inhibitor and a phosphatidylinositol 3-kinase (PI3K) inhibitor.
  • Lif leukemia inhibitory factor
  • MAPK mitogen activated protein kinase
  • PI3K phosphatidylinositol 3-kinase
  • the media of the invention is devoid of at least one of Lif, a MAPK inhibitor and a PI3K inhibitor.
  • inhibiting RAS comprises administering a RAS inhibitor.
  • administering a RAS inhibitor comprises culturing the cell in media comprising a RAS inhibitor.
  • the cell that is not a pluripotent stem cell in a naive state is a pluripotent stem cell in a primed state.
  • the pluripotent stem cell in a primed state is selected from an induced pluripotent stem cell (iPSC), a cell of a pluripotent stem cell line, and a primary embryonic stem cell.
  • the cell that is not a pluripotent stem cell in a naive state is an adult stem cell.
  • the method of the invention further comprises culturing the cell that is not a pluripotent stem cell in a naive state in media comprising a
  • RAS inhibitor for an amount of time sufficient for the cell to acquire at least one characteristic of a pluripotent stem cell in a naive state.
  • the characteristic is selected from: a. increased expression relative to expression before the culturing, of a naivety marker selected from octamer-binding transcription factor 4 (Oct4), Nanog, stage-specific embryonic antigen 1 (Sseal), kruppel-like factor 4 (Klf4), Stella and E-Cadherin (E-Cad); b.
  • a naivety marker selected from octamer-binding transcription factor 4 (Oct4), Nanog, stage-specific embryonic antigen 1 (Sseal), kruppel-like factor 4 (Klf4), Stella and E-Cadherin (E-Cad); b.
  • a primed marker selected from fibroblast growth factor 5 (Fgf5), DNA methyltransferase 3b (Dnmt3b), Histone 3 tri-methyl lysine 9 (H3K9me3) and N-Cadherin (N-Cad);
  • Fgf5 fibroblast growth factor 5
  • Dnmt3b DNA methyltransferase 3b
  • Histone 3 tri-methyl lysine 9 H3K9me3
  • N-Cadherin N-Cadherin
  • the decreased glycolysis is characterized by decreased extracellular acidification rate (ECAR).
  • ECAR extracellular acidification rate
  • the media is the tissue culture media of the invention.
  • the method of the invention further comprises at least one of: a. administering LIF to the media; b. inhibiting MAPK, PI3K or both in the cell; and c. activating Wnt, bone morphogenic protein 4 (Bmp4), or both in the cell.
  • a. administering LIF to the media b. inhibiting MAPK, PI3K or both in the cell
  • Bmp4 bone morphogenic protein 4
  • the tissue culture media, the RAS-inhibitor or both are identified for use together.
  • FIGS 1A-E RAS activity is induced in early differentiation.
  • (1A) Real time PCR analysis showing the relative expression of markers of pluripotency (NANOG, OCT4) and markers of the three germ layers (BRACH, TBX5, FOXA2, GATA4, K18, NESTIN) at the indicated days of embryoid body (EB) differentiation, compared to undifferentiated cells.
  • IB Differentiated cells (EBs) were lysed at the indicated days.
  • RAS-GTP pulldown assay followed by Western blot analysis of active pan-RAS (RAS-GTP) or Western blot analysis of OCT4 or AKT (protein loading) is shown.
  • RAS-GTP Western blot analysis of active pan-RAS
  • AKT protein loading
  • pan-RAS pan-RAS
  • H-RAS pan-RAS
  • K-RAS H-RAS
  • N-RAS isoform
  • FIG. 2A-H RAS repression by LIF prevents early differentiation.
  • 2A-2C mESCs were differentiated in the absence of LIF for 72 h and in the presence of the RAS inhibitor famesylthiosalicyclic acid (RASi, at the indicated concentrations or 75 mM if not mentioned) or vehicle (Veh) as control.
  • RASi famesylthiosalicyclic acid
  • 2A The relative RAS-GTP or total RAS protein levels were analyzed in cells treated with the indicated concentration of RASi.
  • (2B Western blots of OCT4 and AKT (loading control).
  • (2C) mESCs or Rexl-YFP expressing mESCs were differentiated in the absence of LIF and in the presence of RASi (75 mM) or vehicle (Veh) for 72h. Cells were stained for SSEA1 and OCT4, or YFP fluorescence was measured by flow cytometry. Table shows mean fluorescence of each staining or YFP.
  • (2D-2F) mESCs were infected with shRNAs against the indicated RAS isoform (+) or control shRNA
  • FIGS 3A- J RAS activity is induced in primed ESCs.
  • DAPI is shown in C-D.
  • RAS-GTP pull down assay was followed by Western blot analysis using pan-RAS antibody (RAS-GTP) or using the indicated RAS-isoform specific antibodies (H-RAS-GTP, K-RAS- GTP, N-RAS-GTP).
  • the total expression of pan-RAS (RAS) or of each isoform (H-RAS, K-RAS, N-RAS) was examined by Western blot.
  • 3H-I Bar graph or real-time qPCR and (31) western blot of RAS-GTP pull down assay with pan- RAS antibody performed on naive and primed hESCs.
  • AKT was used as a loading control.
  • 3J The levels of RAS-GTP or AKT (loading control) was examined in cell lysates from different mouse and human cell lines that were grown in 2i/LIF or in KSR/bFGF.
  • 3E-3J Values represent densitometry analysis of three independent experiments. Asterisks indicate P value ⁇ 0.05 relative to control (Student’s 2-tailed t-test).
  • FIGS 4A-I RAS regulates the transition from naive to primed ESCs.
  • (4A-4D) mESCs grown in 2i/LIF medium were transfected with a plasmid encoding for GFP fused to H-RAS (GFP-H-RAS) or GFP alone. Cells were subjected to immunostaining (4A-4B),
  • mESCs were grown in KSR/bFGF and infected with lentiviral vectors containing the indicated shRNAs against the different RAS isoforms together with nuclear GFP reporter.
  • FIG. 5A-H RAS controls the switch in CADHERIN expression in the transition to the primed state.
  • mESCs grown in 2i/LIF were switched to KSR/bFGF, grown for 10 passages, and subjected to Western blot analysis (5A) and immunofluorescent staining (5B) of E-CADHERIN (E-CAD) or N- CADHERIN (N-CAD).
  • E-CAD E-CADHERIN
  • N-CADHERIN N-CADHERIN
  • 5C-5E mESCs were grown in 2i/LIF conditions and transfected with a plasmid encoding for GFP fused to H-Ras (GFP-H-RAS) or GFP alone. Immunostaining (5C-5D) or Western blot analysis (5E) of the indicated protein is shown.
  • 5F-5H mESCs were grown in KSR/bFGF in the presence of RASi (75 mM) or vehicle (Veh) for 48 h and then subjected to (5F-G) immunostaining or (5H) western blot analysis of the indicated CADHERIN.
  • 5B, 5E and 5H Values represent densitometry analysis of three independent experiments. Asterisks indicate P value ⁇ 0.05 relative to control (Student’s 2-tailed t-test). Scale bar 50pm.
  • FIGS 6A-D RAS induces glycolysis of mESCs.
  • (6A) mESCs were grown in the indicated media (2i/LIF or KSR/bFGF) or in KSR/bFGF in the presence of RASi (75 pM) or control vehicle (Veh). Extracellular acidification rate (ECAR) was recorded before and following the addition of glucose, oligomycin (inhibitor of ATP synthase which blocks OxPhos) or 2-deoxyglucose (2-DG, inhibitor of glycolysis).
  • (6B) mESCs were grown in 2i/LIF conditions and transfected with a plasmid encoding for GFP fused to H-RAS (GFP- H-RAS) or GFP alone.
  • ECAR was recorded before and following the addition of glucose, oligomycin or 2-DG.
  • PKC, RAF, MEK, P38 and JNK that are positioned upstream or downstream to Ras signaling pathway, were targeted by pharmacological inhibitors in order to stabilize human cells in naive state.
  • RAS controls a large set of crucial signaling protein, its targeting may be useful approach for reprogramming human cells into naive state.
  • FIGS 7A-G RAS family proteins and RAS-downstream effectors may have differential potency in the induction of mESC differentiation.
  • (7A) Micrographs of mESCs transfected with GFP-KRAS and stained for OCT4.
  • (7C) Western blot of OCT4 expression in primed mESCs in the presence of various inhibitors.
  • (7D Micrographs of E-RAS expression in naive and primed mESCs.
  • FIG. 8 Quantification of Oct4 and SSEA1 expression. Micrographs of cells differentiated for the indicated time points in the absence of LIF, and immunostained using the indicated antibodies. Representative images are shown. Scale bar 50 pm. Data shown represent 3 independent experiments.
  • FIGS 9A-C Lentiviral infection with virus containing shRNA against RAS isoforms.
  • mESCs were grown in KSR/bFGF and infected with the indicated virus against H-RAS (shHRAS), K-RAS (shKRAS) or NRAS (shNRAS), or control shRNA (shCtl) which contained nuclear GFP reporter.
  • Infected cells were (9A) imaged by bright field fluorescent microscopy and (9B) examined by flow cytometry analysis showing high infection rates.
  • (9C) Bright field image of mESCs that were grown in KSR/bFGF in the presence of the RAS inhibitor (75pM) or vehicle (Veh) as control for 48h. Scale bar 50pm. Data shown represent 3 independent experiments.
  • FIGS 10A-B Over expression of RAS. mESCs were grown in 2i/LIF and transfected with a plasmid encoding for GFP fused to H-RAS (GFP-H-RAS) or GFP alone. (10A) Micrographs of fluorescent microscopy and (10B) flow cytometry analysis show high transfection rates. Scale bar 50pm. Data shown represent 3 independent experiments. [034] Figures 11A-D: RAS is induced during the transition from the naive (FCS/LIF) to the primed state. mESCs which were grown in FCS/LIF were switched to KSR/bFGF medium and grown for 10 passages and then subjected to (11A) real time PCR analysis,
  • Figures 12A-F Quantification of immunofluorescent staining.
  • mESCs were (12A-B) grown in 2i/LIF and transfected with the indicated plasmids, or (12C-D) grown in KSR/bFGF and infected with the indicated viral vectors that also contained nuclear GFP reporter.
  • Immunostaining DNMT3B and H3K9me3 was performed (shown in Fig. 4A-B and in Fig. 4E-F) and quantification shown here was performed using Nikon Nis-elements D, as detailed in Material and Methods.
  • E-CADHERIN E-CAD
  • N-CADHERIN N-CAD
  • FIG. 13 Quantitative Real Time PCR of combinations of inhibitors of MEK and GSKp (2i) together with Ras depletion.
  • mESCs were grown in KSR/bFGF and treated with RASi (75 pM), GSKp (CHIR9902l -3pM), MEKi (PD032590l-lpM), combination of MEKi with GSKP or combination of RASi together with MEKi and GSKP for 7 days.
  • Quantitative Real Time PCR analysis were performed for the indicated markers. Data shown are mean ⁇ standard deviation from 3 independent experiments.
  • the present invention in some embodiments, provides tissue culture media for use in maintaining pluripotent stem cells (PSCs) in a naive state or for reprograming stem cells into a pluripotent and naive state.
  • PSCs pluripotent stem cells
  • the present invention further concerns method of maintaining PSCs in a naive state and methods of generating PSCs in a naive state comprising inhibiting RAS as well as kits comprising tissue culture media and a RAS- inhibitor.
  • This invention is based on the surprising finding that all three RAS isoforms are activated upon early ESC differentiation. While low RAS activity hallmarks the naive state of pluripotency, RAS activation is necessary and sufficient to induce key features of differentiation, indicating that RAS is located at a key junction of this process. Inhibition of
  • RAS significantly attenuates differentiation, while its ectopic expression is sufficient to induce differentiation, suggesting that RAS plays a role at early embryogenesis and that it can serve as a key target for cellular reprogramming into the naive state.
  • a media comprising a RAS inhibitor.
  • kits comprising media and a RAS inhibitor.
  • the media is a tissue culture media.
  • the media is a stem cell media.
  • the media is suitable for culturing a stem cell.
  • the media is an embryonic stem cell media.
  • the media is a PSC media.
  • the media is an adult stem cell media.
  • the media is a somatic stem cell media.
  • the media is a feeder free media.
  • the stem cell is a PSC. In some embodiments, the stem cell is an embryonic stem cell. In some embodiments, the stem cell is an induced PSC (iPSC). In some embodiments, the stem cell is a primary cell. In some embodiments, the stem cell is a cell of a cell line. In some embodiments, the PSC is selected from an iPSC, a cell of a PSC cell line and a primary embryonic PSC.
  • iPSC induced PSC
  • pluripotent stem cell refers to cells capable of differentiating or being differentiated by means known to one ordinary in the art, into cells of any lineage.
  • embryonic stem cell refers to stem cells derived from the undifferentiated inner mass of an embryo. Such cells are pluripotent, and capable of differentiating, or being differentiated by means known to one ordinary in the art, into cells of any lineage. In order for a ESC to be considered undifferentiated, it must continue to express stem cell markers or not express markers of differentiated cells.
  • PSC refers to pluripotent stem cells regardless of their derivation
  • the term PSC encompasses the terms ESC and iPSC, as well as the term embryonic germ stem cells (EGSC), which are another example of a PSC.
  • ESC and iPSC
  • EGSC embryonic germ stem cells
  • PSCs may be in the form of an established cell line, they may be obtained directly from primary embryonic tissue, or they may be derived from a somatic cell. PSCs can be target cells of the methods described herein.
  • ESC lines are listed in the NIH Human Embryonic Stem Cell Registry, e.g. hESBGN-01, hESBGN-02, hESBGN-03, hESBGN-04 (BresaGen, Inc.); HES-1, HES-2, HES-3, HES-4, HES-5, HES-6 (ES Cell International); Miz-hESl (MizMedi Hospital-Seoul National University); HSF-1 , HSF-6 (University of California at San Francisco); and HI, H7, H9, HI 3, H14 (Wisconsin Alumni Research Foundation (WiCell Research Institute)).
  • Stem cells of interest also include embryonic stem cells from other primates, such as Rhesus ste cells and marmoset stem cells.
  • the stem cells may be obtained from any mammalian species, e.g. human, equine, bovine, porcine, canine, feline, rodent, e.g. mice, rats, hamster, primate, etc. (Thomson et al. (1998) Science 282: 1 145; Thomson et al. (1995) Proc. Natl. Acad. Sei USA 92:7844; Thomson et al. (1996) Biol. Reprod. 55:254; Shamblott et al., Proc. Natl. Acad. Sci. USA 95:13726, 1998).
  • ESCs In culture, ESCs typically grow as flat colonies with large nucleo-cytoplasmic ratios, defined borders and prominent nucleoli. In addition, ESCs express SSEA-3, SSEA-4, TRA-1-60, TRA-1-81, and Alkaline Phosphatase, but not 58EA- 1. Examples of methods of generating and characterizing ESCs may be found in, for example, US Patent No. 7,029,913, US Patent No. 5,843,780, and US Patent No. 6,200,806. Methods for proliferating hESCs in the undifferentiated form are described in WO 99/20741 , WO 01/51616, and WO 03/020920.
  • EGSC embryonic germ stem cell
  • EG cell a PSC that is derived from germ cells and/or germ cell progenitors, e.g. primordial germ cells, i.e. those that would become sperm and eggs.
  • Embryonic germ cells EG cells
  • Examples of methods of generating and characterizing EG cells may be found in, for example, US Patent No. 7,153,684; Matsui, Y., et al., (1992) Cell 70:841; Shamblott, M., et al. (2001) Proc. Natl. Acad. Sci.
  • iPSC induced pluripotent stem cell
  • PSC induced pluripotent stem cell
  • iPSCs can be derived from multiple different cell types, including terminally differentiated cells. iPSCs have an ES cell-like morphology, growing as flat colonies with large nucleo-cytoplasmic ratios, defined borders and prominent nuclei.
  • iPSCs express one or more key pluripotency markers known by one of ordinary skill in the ait, including but not limited to Alkaline Phosphatase, SSEA3, SSEA4, Sox2, Oct3/4, Nanog, TRA160, TRA181, TDGF 1, Dnm ⁇ 3b, FoxD3, GDF3, Cyp26al, TERT, and zfp42.
  • Examples of methods of generating and characterizing iPSCs may be found in, for example U.S Patent Publication Nos. US20090047263, US20090068742, US20090191159, US20090227032, US20090246875, and US20090304646.
  • somatic cells are provided with reprogramming factors (e.g. Qct4, SQX2, KLF4, MYC, Nanog, Lin28, etc.) known in the art to reprogram the somatic cells to become pluripotent stem cells.
  • reprogramming factors e.g. Qct4, SQX2, KLF4, MYC, Nanog, Lin28, etc.
  • somatic cell it is meant any cell in an organism that, in the absence of experimental manipulation, does not ordinarily give rise to all types of cells in an organism.
  • somatic cells are cells that have differentiated sufficiently that they will not naturally generate cells of all three germ layers of the body, i.e. ectoderm, mesoderm and endoder .
  • somatic cells would include both neurons and neural progenitors, the latter of which may be able to naturally give rise to all or some cell types of the central nervous system but cannot give rise to cells of the mesoderm or endoderm lineages.
  • mitotic cell it is meant a cell undergoing mitosis. Mitosis is the process by which a eukaryotic cell separates the chromosomes in its nucleus into two identical sets in two separate nuclei. It is generally followed immediately by cytokinesis, which divides the nuclei, cytoplasm, organelles and cell membrane into two cells containing roughly equal shares of these cellular components.
  • post-mitotic cell it is meant a cell that has exited from mitosis, i.e., it is "quiescent", i.e. it is no longer undergoing divisions. This quiescent state may be temporary, i.e. reversible, or it may be permanent.
  • meiotic cell it is meant a cell that is undergoing meiosis.
  • Meiosis is the process by which a cell divides its nuclear material for the purpose of producing gametes or spores. Unlike mitosis, in meiosis, the chromosomes undergo a recombination step which shuffles genetic material between chromosomes.
  • the media is characterized in that it does not contain an animal derived component. In some embodiments, the media is devoid of an animal derived component. In some embodiments, the media is chemically defined media. As used herein, the term“chemically defined medium” refers to growth medium in which all the chemical components are known. In some embodiments, the media is protein-free media. In some embodiments, the media is protein-low media. In some embodiments, low protein is less than 500, 400, 300, 200, 100, 80, 60, 50, 40, 20, 10, 5, 3, 2, 1, 0.5, 0.1, 0.05, 0.01 or 0.001 ug protein per mL of media. Each possibility represents a separate embodiment of the invention.
  • the media contains synthetic proteins.
  • the media contains proteins not from an animal source.
  • An example of a synthetic protein is a recombinant protein.
  • the media is low in or devoid of naturally occurring proteins but is supplemented with synthetic proteins.
  • the media is serum free.
  • the animal is a bovine.
  • the animal is a non-human animal. In some embodiments, the animal is a human.
  • Examples of media that may be used include, but are not limited to, DMEM, F12, DMEM/F12, RPMI, MEM, RSeT medium, TeSR medium, mTeSR medium, N2B27, KSR, LPM media, StemFlex media and Essential 8 media.
  • the media is DMEM/F12 media.
  • the media is N2B27 media.
  • the media is KSR media. These media are well known in the art and can be purchased and/or recipes for their production can be found online.
  • DMEM/F12 media refers to Dulbecco’s Modified Eagle Medium/Nutrient Mixture F-12.
  • N2B27 media refers to a mix (generally of equal amounts) of DMEM/F12 with N2 medium and neurobasal media with B27 media. A recipe for this media can be found on the Cold Spring Harbors Protocols website.
  • KSR media refers to KnockOut Serum Replacement media, which can be purchased from Thermo Fisher Scientific, and a recipe for which can be found on the Cold Spring Harbors Protocols website.
  • the media further comprises a factor that promotes a PSC naive state.
  • the factor is selected from leukemia inhibitory factor (Lif), a mitogen activated protein kinase (MAPK) inhibitor and a phosphatidylinositol 3- kinase (PI3K) inhibitor.
  • Lif leukemia inhibitory factor
  • MAPK mitogen activated protein kinase
  • PI3K phosphatidylinositol 3- kinase
  • the media further comprises Lif.
  • the media further comprises a MAPK inhibitor.
  • the media further comprises a PI3K inhibitor.
  • the media further comprises at least one of Lif, a MAPK inhibitor and a PI3K inhibitor.
  • the media is devoid of at least one of Lif, a MAPK inhibitor and a PI3K inhibitor. In some embodiments, the media further comprises Lif, a MAPK inhibitor and a PI3K inhibitor. In some embodiments, the inhibitor is a small molecule. In some embodiments, the inhibitor is a recombinant protein. In some embodiments, the inhibitor is an inhibitory RNA. In some embodiments, the media further comprises another molecule that promotes the PSC naive state. In some embodiments, the molecule that promotes the PSC naive state is selected from a Wnt activator/agonist and a BMP activator agonist. In some embodiments, BMP is BMP4.
  • the PSC naive state is characterized by a characteristic of a PSC in a naive state.
  • the characteristic is selected from: a. increased expression of a naivety marker b. decreased expression of a primed marker; c. decreased glycolysis; d. increased oxidative phosphorylation; e. an increased epithelial phenotype; f. a decreased mesenchymal phenotype g. increased euchromatin; and h. reactivation of the X chromosome.
  • the characteristic is a, b, c, d, e, f, g or h. Each possibility represents a separate embodiment of the invention.
  • increased is increased with respect to expression in a primed PSC.
  • decreased is decreased with respect to expression in a primed PSC.
  • the expression is protein expression.
  • the expression is mRNA expression.
  • the expression is protein and/or mRNA expression.
  • the naivety marker is a marker that is significantly higher in naive PSCs vs primed PSCs.
  • the naivety marker is selected from octamer-binding transcription factor 4 (Oct4), Nanog, stage- specific embryonic antigen 1 (Sseal), kruppel-like factor 4 (Klf4), Stella and E-Cadherin (E-Cad).
  • the primed marker is a marker that is significantly higher in primed PSCs vs naive PSCs.
  • the primed marker is selected from fibroblast growth factor 5 (Fgf5), DNA methyltransferase 3b (Dnmt3b), Histone 3 tri-methyl lysine 9 (H3K9me3) and N- Cadherin (N-Cad).
  • Fgf5 fibroblast growth factor 5
  • Dnmt3b DNA methyltransferase 3b
  • Histone 3 tri-methyl lysine 9 H3K9me3
  • N-Cad N- Cadherin
  • the decreased glycolysis and/or increased oxidative phosphorylation is characterized by decreased extracellular acidification rate (ECAR).
  • the decreased ECAR is following the addition of glucose, oligomycin and/or 2-deoxyglucose. Measuring respiration in cells is well known, with many well- defined assays and kits available. Examples include the MitoTox (OXPHOS) assay kit (Abeam), the Mitochondrial ToxGlo assay kit (Promega), and the glycolysis assay (Abeam), to name but a few.
  • increased epithelial phenotype and/or decreased mesenchymal phenotype is a reversal of the epithelial to mesenchymal transition (EMT).
  • EMT epithelial to mesenchymal transition
  • a marker of epithelial phenotype is increased E-Cad expression.
  • a marker of mesenchymal phenotype is decreased N-Cad expression. Markers of EMT and its reversal are well known in the art. Examples of markers of an epithelial phenotype include, but are not limited to E-Cad, ZO-l, cytokeratin, alphal (IV) collagen, laminin 1 and the miR-200 family of microRNAs.
  • markers of a mesenchymal phenotype include, but are not limited to N-Cad, alpha5 beta 1 integrin, syndecan-l, FSP1, vimentin, beta-catenin, fibronectin, laminin 5, snaill, , Twist, Ets-l, FOXC2, miR-2l, and miR-lOb.
  • euchromatin refers to an open chromatin conformation that is generally permissive for transcription. In some embodiments, euchromatin is not heterochromatin. In some embodiments, euchromatin is characterized by a decrease or low levels of H3K9me3. In some embodiments, euchromatin is characterized by an increase or high levels of Histone H3 lysine 4 trimethylation (H3K4me3). In some embodiments, euchromatin is characterized by an increase or high levels of H3K4me2. In some embodiments, euchromatin is characterized by a decrease or low levels of DNA methylation. In some embodiments, euchromatin is characterized by a decrease or low levels of heterochromatin protein 1 (HP1).
  • HP1 heterochromatin protein 1
  • X-reactivation and“reactivation of the X-chromosome” are synonymous and refer to active transcription of loci on a second X-chromosome that had previously been silenced.
  • X inactivation in XX cells is well known in the art and when cells are reprogrammed back to a pluripotent and naive state the silenced X-chromosome can become reactivated.
  • Markers of X-reactivation include increased transcription from previously silenced loci and decreased Xist and/or Tsix levels. Examples of genes with increased transcription upon X reactivation include, but are not limited to MeCP2, DDX3X, KIAA2022, USP9X, CDKL5, HDAC8, SMC1A and PGK1.
  • the media and/or kits of the invention are for use in culturing PSCs in a naive state. In some embodiments, the media and/or kits of the invention are for use in maintaining PSCs in a naive state. In some embodiments, the media and/or kits of the invention are for use in generating PSCs in a naive state.
  • RAS Inhibitors
  • RAS refers to the small GTPase RAS family of proteins.
  • RAS is mammalian RAS.
  • RAS is human RAS.
  • RAS is at least one of H-RAS, K-RAS, N-RAS and E-RAS.
  • RAS is at least one of H-RAS, K-RAS, and N-RAS.
  • RAS is H-RAS.
  • RAS is K-RAS.
  • RAS is N- RAS.
  • RAS is canonical RAS.
  • RAS is canonical and non-canonical RAS.
  • RAS is a mutated form of RAS.
  • RAS comprises a mutation such as is known in the art.
  • RAS is a constitutively active RAS.
  • K-RAS comprises the amino acid sequence of accession number XP 011518955.1, XP 006719132.1, NP_203524.l or NP_004976. l. Each possibility represents a separate embodiment of the invention.
  • K- RAS is any one of isoform a, isoform b, isoform XI and isoform X2.
  • mouse K-RAS is produced from a transcript with the sequence found in accession number NM_021284.6.
  • human K-RAS is produced from a transcript with the sequence found in accession number XM_0l 1520653.3, XM_006719069.4, NM_033360.3 or NM_004985.4.
  • H-RAS comprises the amino acid sequence of accession number NP_00l204983.l, NP_00l 123914.1, NP_789765. l or NP_005334.l. Each possibility represents a separate embodiment of the invention.
  • H- RAS is any one of isoform 1, isoform 2, and isoform 3.
  • mouse H- RAS is produced from a transcript with the sequence found in accession number NM_008284.2.
  • human H-RAS is produced from a transcript with the sequence found in accession number NM_005243.4, NM_00l318054.1, NM_00l 130442.2 or NM_l76795.4.
  • N-RAS comprises the amino acid sequence of accession number NP_0025l5.l.
  • mouse H-RAS is produced from a transcript with the sequence found in accession number NM_0l0937.2.
  • human H-RAS is produced from a transcript with the sequence found in accession number NM_002524.5.
  • a“RAS inhibitor” refers to any molecule that at least partially inhibits RAS function. An inhibitor need not completely shut off or inactivate RAS but need only partially inhibit RAS. In some embodiments, a RAS inhibitor significantly inhibits RAS. In some embodiments, a RAS inhibitor completely inhibits RAS. In some embodiments, a RAS inhibitor inhibits at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 97%,
  • RAS function is RAS activation.
  • a RAS inhibitor is specific to RAS.
  • a RAS inhibitor does not significantly inhibit a molecule that is not RAS.
  • a RAS inhibitor does not significantly inhibit a molecule that is not RAS.
  • RAS inhibitor is a RAS -specific inhibitor.
  • RAS inhibitors are known in the art and any molecule that effectively inhibits RAS function and/or RAS activation in a target cell may be employed.
  • the effectiveness of a RAS inhibitor may be determined by examining the activation of RAS effector proteins, activation of a pathway controlled by RAS or by a downstream output of RAS activation.
  • RAS effector proteins include, but are not limited to, PI3K/PDK1/AKT, RAF/MEK/ERK, RAL-GDS/RAL, RAC/RHO, JUN and P38.
  • Activation of these proteins can be measured by assaying their phosphorylation state, as activation is generally characterized by an increase in protein phosphorylation.
  • pathways activated by RAS include, but are not limited to, the RAF/MEK/ERK pathway, the PI3K/PDK1/AKT pathway, the mTOR pathway, the P38 pathway, and the JUN pathway.
  • the RAS inhibitor is a pan-RAS inhibitor.
  • a “pan-RAS inhibitor” refers to an inhibitor that inhibits at least two RAS isoforms.
  • a pan-RAS inhibitor inhibits three isoforms of RAS.
  • a pan-RAS inhibitor inhibits all three human RAS isoforms.
  • a pan-RAS inhibitor inhibits all canonical isoforms of RAS.
  • a pan-RAS inhibitor inhibits canonical and non-canonical forms of RAS.
  • a pan-RAS inhibitor need not inhibit all isoforms equally.
  • a pan-RAS inhibitor significantly inhibits the RAS isoforms it inhibits.
  • the RAS inhibitor is a K-RAS inhibitor.
  • the RAS inhibitor is a H-RAS inhibitor.
  • the RAS inhibitor is a N-RAS inhibitor.
  • the RAS inhibitor is a small molecule inhibitor.
  • the small molecule inhibitor is not a protein.
  • the small molecule inhibitor is farnesylthiosalicyclic acid.
  • Famesylthiosalicyclic acid is a chemical also known as RASi, FTS, S-trans,trans-Farnesylthiosalicylic acid, [3,7,11- Trimethyldodeca-2,6,l0-trienyl]-2-thiobenzoic acid and salirasib.
  • Farnesylthiosalicyclic acid has a pubchem CID of 5469318 and a CAS number of 162520-00-5.
  • the pan-RAS inhibitor is farnesylthiosalicyclic acid.
  • the RAS inhibitor is an anti-RAS antibody.
  • the antibody is a blocking antibody.
  • RAS inhibitors include, but are not limited to, farnesylthiosalicyclic acid, Fendiline, Rigosertib, Deltarasin, and Kobe0065.
  • the pan-RAS inhibitor is selected from farnesylthiosalicyclic acid, Rigosertib, Deltarasin, and Kobe0065.
  • an isoform specific RAS inhibitor is Fendiline.
  • a K-RAS inhibitor is Fendiline.
  • an antibody refers to a polypeptide or group of polypeptides that include at least one binding domain that is formed from the folding of polypeptide chains having three-dimensional binding spaces with internal surface shapes and charge distributions complementary to the features of an antigenic determinant of an antigen.
  • An antibody typically has a tetrameric form, comprising two identical pairs of polypeptide chains, each pair having one "light” and one "heavy” chain. The variable regions of each light/heavy chain pair form an antibody binding site.
  • An antibody may be oligoclonal, polyclonal, monoclonal, chimeric, camelised, CDR-grafted, multi- specific, bi-specific, catalytic, humanized, fully human, anti- idiotypic and antibodies that can be labeled in soluble or bound form as well as fragments, including epitope-binding fragments, variants or derivatives thereof, either alone or in combination with other amino acid sequences.
  • An antibody may be from any species.
  • the term antibody also includes binding fragments, including, but not limited to Fv, Fab, Fab', F(ab')2 single stranded antibody (svFC), dimeric variable region (Diabody) and disulphide-linked variable region (dsFv).
  • antibodies include immunoglobulin molecules and immunologically active fragments of immunoglobulin molecules, i.e., molecules that contain an antigen binding site.
  • Antibody fragments may or may not be fused to another immunoglobulin domain including but not limited to, an Fc region or fragment thereof.
  • Fc region or fragment thereof.
  • fusion products may be generated including but not limited to, scFv- Fc fusions, variable region (e.g., VF and VH) ⁇ Fc fusions and scFv-scFv-Fc fusions.
  • Immunoglobulin molecules can be of any type (e.g., IgG, IgE, IgM, IgD, IgA and IgY), class (e.g., IgGl, IgG2, IgG3, IgG4, IgAl and IgA2) or subclass.
  • the RAS inhibitor is an inhibitory RNA.
  • the RAS inhibitor is selected from a small molecule inhibitor and an inhibitory RNA.
  • the inhibitory RNA is small inhibitory RNA.
  • the inhibitory RNA is selected from an shRNA, an siRNA and a miRNA.
  • the inhibitory RNA is selected from an shRNA, and an siRNA.
  • the inhibitory RNA is an shRNA.
  • the inhibitory RNA is an siRNA.
  • the inhibitory RNA is a miRNA. Examples of inhibitory
  • RNAs against mouse RAS isoforms include SEQ ID NOs: 1-3. Generation of siRNAs and shRNAs for specific mRNAs and specific isoforms is routine in the art. Several websites exist for generating specific inhibitory RNAs such as RNAiWEB (maiweb.com),
  • GenScript design center (genscript.com/design_center.html) and Invivogen’s SiRNA
  • the inhibitory RNA inhibits at least 1, 2 or 3 isoforms of RAS. Each possibility represents a separate embodiment of the invention.
  • the inhibitory RNA inhibits a single isoform of RAS.
  • the inhibitory RNA inhibits H-RAS, K-RAS and N-RAS.
  • the inhibitory RNA is a pan-
  • a method of maintaining a PSC in a naive state comprising inhibiting RAS in the PSC, thereby maintaining a PSC in a naive state.
  • a method of generating a PSC in a naive state comprising providing a cell that in not a PSC in a naive state and inhibiting RAS in the cell that is not a PSC in a naive state, thereby generating a PSC in a naive state.
  • inhibiting RAS comprises administering a RAS inhibitor.
  • administering a RAS inhibitor comprises culturing the cell in media comprising a RAS inhibitor.
  • administering a RAS inhibitor comprises administering the RAS inhibitor to media in which the cell is growing.
  • the method is performed in vitro. In some embodiments, the method is performed in tissue culture. In some embodiments, the method is performed in a subject in need thereof.
  • the method is for reprogramming the cell that is not a PSC in a naive state. In some embodiments, the method is for reprogramming the cell into a PSC in a naive state.
  • the cell that is not a PSC in a naive state is a PSC in a primed state. In some embodiments, the cell that is not a PSC in a naive state is a stem cell. In some embodiments, the stem cell is an adult stem cell. In some embodiments, the stem cell is a somatic stem cell. In some embodiments, the cell that is not a PSC in a naive state is a somatic cell.
  • the PSC in a primed state is selected from an iPSC, a cell of a PSC cell line and a primary PSC. In some embodiments, the primary PSC is a primary ESC.
  • the method further comprises reprogramming a somatic/adult stem cell into an iPSC.
  • Methods of generating iPSCs are well known in the art, are described hereinabove and any method of generating an iPSC may be employed.
  • RAS is inhibited after reprogramming into an iPSC.
  • RAS is inhibited before reprogramming into an iPSC.
  • RAS is inhibited before or after reprogramming into an iPSC.
  • the method further comprises culturing the cell that is not a PSC in a naive state in media comprising a RAS inhibitor for an amount of time sufficient for the cell to acquire at least one characteristic of a PSC in a naive state.
  • increased is increased relative to before culturing in media comprising a RAS inhibitor and/or before RAS inhibition.
  • the media comprising a RAS inhibitor is the media of the invention.
  • the method further comprises at least one of: a. administering Lif to said media; b. inhibiting MAPK, PI3K or both in said cell; and c. activating Wnt, a bone morphogenic protein 4 (BMP), or both in said cell
  • the BMP is BMP4.
  • the media further comprises at least one of LIF, a MAPK inhibitor, a PI3K inhibitor, a Wnt activator/agonist and a BMP activator/agonist.
  • the media contains a MAPK inhibitor and a PI3K inhibitor.
  • the media contains a Lif, a MAPK inhibitor and a PI3K inhibitor.
  • inhibiting MAPK comprises administering a MAPK inhibitor and/or culturing in a media comprising a MAPK inhibitor.
  • inhibiting PI3K comprises administering a PI3K inhibitor and/or culturing in a media comprising a PI3K inhibitor.
  • activating Wnt and/or BMP comprises administering a Wnt and/or BMP4 agonist/activator and/or culturing in a media comprising a Wnt and/or BMP4 agonist/activator.
  • the activator is a recombinant protein.
  • MAPK is MAPKK. In some embodiments, MAPK is MEK1/2. In some embodiments, MAPK is MEK/ERK. In some embodiments, MAPK is MEK1/2. In some embodiments, MAPK is RAF/MEK/ERK. In some embodiments, the MAPK inhibitor is PD0325901. Examples of MAPK inhibitors include, but are not limited to PD0325901, PD184352, SB203580, SB590885, SB202190 and U0126. In some embodiments, PI3K is PI3K/AKT. In some embodiments, PI3K is PI3K/PDK1/AKT. In some embodiments, the PI3K inhibitor is an AKT inhibitor.
  • the PI3K inhibitor is an mTOR inhibitor. In some embodiments, the PI3K inhibitor is a GSK-3 inhibitor. In some embodiments, the PI3K inhibitor is CHIR99021. Examples of PI3K inhibitors include, but are not limited to, CHIR99021, GSK-2126458, and LY294002. MAPK and PI3K inhibitors are well known in the art. These inhibitors and media containing these inhibitors (also known as 2i media) are commercially available from companies such as abeam, Sigma- Aldrich, Invitrogen, Merck Millipore and Selleck Chemicals to name but a few.
  • Wnt activation and BMP activation are well known in the art and Wnt and BMP4 activators/agonists are commercially available from companies such as Santa Crux Biotechnology, Merck Millipore, and Enzo Life Sciences to name but a few.
  • a Wnt and/or BMP4 activator is a recombinant protein.
  • the Wnt activator is CHIR99021.
  • Wnt activators/agonists include, but are not limited to, CHIR99021, CAS 853220-52-7 and WAY 262611.
  • BMP activators include, but are not limited to, ventromorphins, 4 '-hydroxy chalcone and apigenin.
  • the media and RAS-inhibitor are for use together.
  • the media, RAS-inhibitor or both are identified for use together.
  • identified for use together is labeled for use together.
  • the label is for addition of the RAS-inhibitor to the media
  • the term "identified for use together” refers to the fact that the agent appears with a label, and has received regulatory approval, to be used in combination with the other agent.
  • a first agent identified for use with a second agent may be sold and/or packaged separately or in combination with the second agent.
  • the term "about” when combined with a value refers to plus and minus 10% of the reference value. For example, a length of about 1000 nanometers (nm) refers to a length of 1000 nm+- 100 nm.
  • mESCs were grown in 2i/LIF medium (containing N2B27, Lif, CHIR99021 (3mM, Peprotech), and PD0325901 (ImM, Peprotech) were passed using trypsin.
  • mESCs that were grown in FSC/LIF medium containing 90% DMEM medium, Thermo), 10% FCS serum replacement (Hyclone), lmM Sodium Pyruvate (Biological Industries), lmM nonessential amino acids (Biological Industries), O. lmM b-mercaptoethanol (Thermo), Pen-Strep solution (1:1000, Biological Industries) and Lif), were grown on mitomycin-C-treated mouse embryonic fibroblasts (MEFs) feeder layer.
  • mESCs and iPSCs cell lines that were grown in KSR/bFGF medium (Biological Industries) containing 80% DMEM/F12 (1:1,
  • EBs differentiation was induced in differentiation medium containing 80% DMEM medium
  • H-Ras gene NM_008284.2 target sequence, GTGAGATTCGGCAGCATAAAT (SEQ ID NO: 1); K-Ras NMJ321284.6 gene target sequence, CTATACATTAGTCCGAGAAAT (SEQ ID NO: 2); N-Ras gene
  • NMJ310937.2 target sequence CGAAAGCAAGTGGTGATTGAT (SEQ ID NO: 3).
  • GFP + cells were sorted by a FACSAria (BD Biosciences).
  • mESCs Prior to differentiation through EBs or LIF removal, mESCs were grown on gelatin (0.1%) coated dishes for 1-2 passages. To initiate EBs differentiation, cells were cultured in hanging drops in FCS/LIF medium lacking LIF for 3 days, then EBs were transferred to grow in suspension in differentiation medium for another 3-6 days. To initiate early exiting from self-renewal, cells were washed with PBS and transferred to FCS/LIF medium lacking Lif for 4 or 48 h in the presence of the RASi farnesylthiosalicyclic acid (75 mM) or vehicle (0.1% DMSO). For differentiation from naive to primed state of pluripotency, CGR8 cells that were routinely grown in 2i/LIF were transferred to MEFs co-culture KSR/bFGF medium for 10 passages.
  • mice a-Pan-RAS (1 : 1500, Calbiochem
  • mouse a-K-RAS (1 : 100, Calbiochem
  • mouse a- H-RAS (1:80, Calbiochem
  • mouse a-N-RAS (1 : 100, Calbiochem
  • rabbit a-ERK (1:3500, Santa Cruz Biotechnology
  • mouse a-pERK (1 : 1000, Sigma)
  • rabbit a-AKT (1:3500, Cell Signaling Technology
  • rabbit a-pAKT (1 :200, Cell Signaling Technology
  • Protein bands were visualized with ECL kit (Biological Industries) and quantified by ImageJ software.
  • RAS-GTP pull-down was performed as follows: glutathione-agarose beads (Sigma, G4510) were coated with recombinant protein chimera of glutathione S-transferase (GST) fused to the RAS-binding domain of RAF (RBD). Lysates were incubated with GST-RBD beads and precipitates were probed by Western blot.
  • GST glutathione S-transferase
  • qPCR primers used in this study are listed in Table 1. Samples were cycled using StepOnePlus (Applied Biosystems) qPCR system. Relative gene expression was normalized to GAPDH and calculated according to the AACT method for qPCR. [098] Table 1: qPCR primers
  • Extracellular acidification rate (ECAR) measurements were done with optical fluorescent oxygen/hydrogen sensor XFe96 Seahorse analyzer. mESCs that were grown in 2i/Lif (100,000 cells) or in KSR/bFGF (40,000 cells) were seeded on lysed MEFs (0.5% Triton and 0.034% NH40H). The glycolysis stress kit was used to measure ECAR response using addition of glucose (lOmM), Oligomycin (2mM) and 2-DG (50mM). The data was normalized by modified Lowery method to quantify protein content after metabolite extraction.
  • Example 1 RAS regulates early differentiation of mESCs
  • mESCs CGR8 cells that were grown in self-renewal conditions in the presence of serum and LIF (FCS/LIF) were used.
  • FCS/LIF serum and LIF
  • EBs embryonic bodies
  • differentiation was accompanied by down regulation of pluripotency markers (OCT4 and NANOG), and increased expression of markers of the three germ layers (Fig. 1A).
  • OCT4 and NANOG pluripotency markers
  • Fig. 1A pluripotency markers
  • cell lysates were prepared for RAS-GTP pulldown assay followed by Western bolt analysis using pan-RAS antibody.
  • RAS inhibition was examined using a pharmacological inhibitor targeting all RAS isoforms.
  • the RAS inhibitor (RASi) farnesylthiosalicyclic acid disrupts RAS membrane anchorage and inhibits tumor cell growth.
  • doses of 50-100 mM significantly reduced the levels of RAS-GTP in mESCs (Fig. 2A).
  • RASi significantly attenuated OCT4 reduction following LIF withdrawal (Fig. 2B).
  • Example 2 RAS modulates the transition from naive to primed state [0103] To further test the role of RAS in early events of mESC differentiation, the possibility that RAS may be involved in the transition from naive ground state to primed state of pluripotency was checked. To address this possibility, mESCs that were grown in naive
  • KSR/bFGF cells underwent a switch to primed state that is accompanied by epigenetic repressive marks. Importantly, the activity of all three RAS isoforms was significantly enhanced following the transition to the primed state, while the total level of the three RAS isoforms remained unchanged (Fig. 3F).
  • the activity of the putative RAS effectors AKT, ERK, JUN and P38 was examined using specific antibodies that recognize the phosphorylated (active) form of these proteins (i.e.
  • RAS activity is general to cell priming and not restricted to a specific culture condition, mESCs that were grown for long term in FCS/LIF conditions were switched to primed
  • Example 3 Ras regulates EMT and changes in metabolism during the transition to the primed state
  • E-CADHERIN is essential to maintain naive pluripotency.
  • naive mESCs expressed high levels of E-CAD and low levels of N-CADHERIN (N-CAD), while primed cells displayed an opposite phenotype (Fig. 5A-B).
  • RAS may regulate EMT during the transition to the primed state.
  • transfection of naive cells with GFP-H-RAS plasmid resulted in a marked reduction in E-CAD and an elevation in the levels of N-CAD (Fig. 5C-E).
  • inhibition of RAS by RASi in primed cells significantly reduced N-CAD concomitant with an increase in E-CAD (Fig. 5F-H).
  • naive mESCs were transfected with plasmids encoding for green fluorescent protein (GFP) fused to each RAS isoform. 48 hours later, the cells were stained (Fig. 7A) and the expression of OCT4 was quantified (Fig. 7B). OCT4 expression was significantly reduced in all GFP-RAS expressing cells.
  • GFP green fluorescent protein
  • naive mESC were differentiated into primed state for 48 hours in the presence of specific inhibitors of MEK (MEKi), P38 (P38i), JUN (JUNi), or RAS (RASi) for comparison or vehicle (Veh) as control.
  • MEKi MEK
  • P38i P38
  • JUNi JUN
  • RAS RAS
  • Veh vehicle
  • E-RAS non-canonical embryonic RAS
  • Fig. 7D immunostaining
  • Fig. 7E Western blot

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Reproductive Health (AREA)
  • Developmental Biology & Embryology (AREA)
  • Gynecology & Obstetrics (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne des milieux comprenant un inhibiteur RAS. L'invention concerne également des procédés de maintien de cellules souches pluripotentes dans un état naïf et des procédés de génération de cellules souches pluripotentes dans un état naïf, ainsi que des kits comprenant les milieux et un inhibiteur RAS.
PCT/IL2019/050024 2018-01-03 2019-01-03 Milieux de cellules souches pluripotentes naïves WO2019135238A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201862613103P 2018-01-03 2018-01-03
US62/613,103 2018-01-03

Publications (1)

Publication Number Publication Date
WO2019135238A1 true WO2019135238A1 (fr) 2019-07-11

Family

ID=67143923

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IL2019/050024 WO2019135238A1 (fr) 2018-01-03 2019-01-03 Milieux de cellules souches pluripotentes naïves

Country Status (1)

Country Link
WO (1) WO2019135238A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021102500A1 (fr) * 2019-11-26 2021-06-03 The University Of Western Australia Procédés de reprogrammation d'une cellule

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20140273095A1 (en) * 2013-03-15 2014-09-18 Regeneron Pharmaceuticals, Inc. Serum-Free Cell Culture Medium
US20150272996A1 (en) * 2009-02-03 2015-10-01 Children's Medical Center Corporation Methods for enhancing hematopoietic stem/progenitor cell engraftment

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150272996A1 (en) * 2009-02-03 2015-10-01 Children's Medical Center Corporation Methods for enhancing hematopoietic stem/progenitor cell engraftment
US20140273095A1 (en) * 2013-03-15 2014-09-18 Regeneron Pharmaceuticals, Inc. Serum-Free Cell Culture Medium

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
SACCO, E. ET AL.: "Novel RasGRFl-derived Tat-fused peptides inhibiting Ras-dependent proliferation and migration in mouse and human cancer cells", BIOTECHNOLOGY ADVANCES, vol. 30, no. 1, 1 January 2012 (2012-01-01), pages 233 - 243, XP028439174, DOI: doi:10.1016/j.biotechadv.2011.05.011 *
SACCO, E. ET AL.: "Novel RasGRFl-derived Tat-fused peptides inhibiting Ras-dependent proliferation and migration in mouse and human cancer cells", BIOTECHNOLOGY ADVANCES, vol. 30, no. 1, 1 January 2012 (2012-01-01), pages 233 - 243, XP028439174, doi:10.1016/j.biotechadv.2011.05.011 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021102500A1 (fr) * 2019-11-26 2021-06-03 The University Of Western Australia Procédés de reprogrammation d'une cellule

Similar Documents

Publication Publication Date Title
US11560546B2 (en) Methods for neural conversion of human embryonic stem cells
US11898161B2 (en) Stem cell culture medium and method
JP7356658B2 (ja) ドーパミン産生神経前駆細胞の製造方法
AU2014316100B2 (en) New method for inducing dopamine-producing neural precursor cells
Murayama et al. Successful reprogramming of epiblast stem cells by blocking nuclear localization of β-catenin
Abdelalim et al. Knockdown of p53 suppresses Nanog expression in embryonic stem cells
US20200362303A1 (en) Maintenance-and-amplification method and differentiation induction method for primordial germ cells/primordial germ cell-like cells
Muchkaeva et al. Generation of iPS cells from human hair follice dermal papilla cells
Bertacchi et al. Activin/nodal signaling supports retinal progenitor specification in a narrow time window during pluripotent stem cell neuralization
Sherman et al. Foxd4 is essential for establishing neural cell fate and for neuronal differentiation
WO2023147009A1 (fr) Progéniteurs thérapeutiques de qualité clinique générés à partir de banques de cellules souches pluripotentes inhibées par la tankyrase/parp
JP7079017B2 (ja) 多能性幹細胞から生殖系列幹細胞様細胞への分化誘導方法
WO2019135238A1 (fr) Milieux de cellules souches pluripotentes naïves
Liu et al. Inhibition of Wnt/β-catenin signaling by IWR1 induces expression of Foxd3 to promote mouse epiblast stem cell self-renewal
Chen et al. Central and peripheral nervous system progenitors derived from human pluripotent stem cells reveal a unique temporal and cell-type specific expression of PMCAs
WO2014174047A1 (fr) Différentiation dirigée par cycle cellulaire de cellules pluripotentes
EP2497825A1 (fr) Nouveau procédé de génération rapide et efficace de cellules neuroectodermiques et neurones périphériques provenant de cellules souches pluripotentes
WO2022191335A1 (fr) Procédé d'induction de cellules souches multipotentes de type premières dans des cellules souches multipotentes de type naïves, procédé de fabrication de cellules souches multipotentes de type naïves, kit d'induction de cellules souches multipotentes de type naïves, et agent d'induction de cellules souches multipotentes de type naïves
김성민 Shp2 activity balances Naïve and Primed pluripotency by regulating MAPK and Jak/Stat3 pathway in Mouse Embryonic Stem Cells
Ripoll Glycogen Synthase Kinase 3 (GSK-3) involvement in regulation of mouse embryonic stem cell fate
Murayama et al. and Hiromitsu Nakauchi
Murayama et al. Successful reprogramming of epiblast stem cells by blocking nuclear localization of β
Chap Sprouty4 regulates the balance between pluripotency and trophectoderm differentiation in mouse embryonic stem cells
Kingham Investigation of phosphoinositide 3-kinase dependent signalling in the regulation of embryonic stem cell fate

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19735703

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 19735703

Country of ref document: EP

Kind code of ref document: A1