WO2019133950A1 - Smad7 for treatment and prevention of posterior capsule opacification - Google Patents

Abstract

Methods and compositions for the treatment and prevention of posterior capsular opacification are provided. The methods include administering a therapeutically effective amount of a Smad7 protein construct to a subject suffering from or at risk of developing posterior capsule opacification.

Description

SMAD7 FOR TREATMENT AND PREVENTION OF POSTERIOR CAPSULE

OPACIFICATION

CROSS REFERENCE TO RELATED APPLICAT ON

This application claims the benefit of U S. Provisional Patent Application Serial No. 82/812,441 , filed December 30, 2017, which is incorporated herein by reference.

STATEMENT OF FEDERALLY SPONSORED RESEARCH

This invention was made with government support under grant numbers EY005856 and EY028147 and R44DE024659 awarded by the National Institutes of Health. The U.S. government has certain rights in the invention.

TECHNICAL FIELD

This invention relates generally to the treatment of fibrotic eye disorders, for example TGF^-mediated fibrotic (including tissue-contraction) disorders of the lens, capsular bag, cornea, conjunctiva, sclera, retina and other tissues or structures of the eye, particularly but not exclusively fibrotic complications such as posterior capsular opacification following eye surgery.

BACKGROUND

Age-related cataract accounts for 50% of blindness worldwide. The most common complication of cataract surgery is posterior capsular opacification (PCO), which results from the proliferation, migration and epithelial-mesenchymal trans-differentiation of lens epithelial cells that remain in the eye lens capsular bag after surgery. PCO leads to capsule wrinkling, loss of transparency and the need for further surgery.

Cataract is an extremely prevalent disease and although there have been advances in the design of intraocular lenses to reduce posterior capsular opacification (PCO), a pharmacological solution to prevent PCO in conjunction with existing technology is desirable.

Fibrotic disorders of the eye are common complications arising from surgical treatment of disorders including glaucoma, pterygia, and cataract. Many of the underlying mechanisms giving rise to these fibrotic disorders are likely to share common pathways. For example, PCO is the most common fibrotic complication following cataract or other ocular lens replacement surgery. This condition is caused by regrowth of the lens epithelial cells which, despite the surgeon's best efforts, typically remain on the anterior capsule after the surgery. The cellular regrowth typically invades denuded surfaces of the anterior capsule, the implanted intraocular lens and the previously cell-free posterior capsule. The epithelial cells on the posterior capsule surface give rise to contraction of the tissue matrix, leading to opacification of the posterior capsule and reduction in vision quality. Transforming growth factor b (TGF-b) has been implicated in fibrotic disorders of the lens, capsular bag, cornea, conjunctiva, sclera and other tissues or structures of the eye. For example, TGF-b has been shown to induce anterior subcapsular cataract (ASC) in a rat lens culture model. TGF-b has also been implicated as a causative factor in PCO (Saika, S. et al., Graefes. Arch. Clin. Exp. Ophthalmol. (2000) 238, pages 283-293; Wormstone, I. M. et al., Invest. Ophthalmol. Vis. (2002) 43, pages 2301-2308). It has been reported that, after trauma (e.g. surgery), active levels of all TGF-b isoforms can be elevated (Ohta, K. et al., Invest. Ophthalmol. Vis. Sci. (2000) 41 , pages 2591-2599).

There is therefore a need for an inhibitor of fibrosis and epithelial cell proliferation for treatment and prevention of PCO, particularly in diabetic patients and in patients undergoing eye surgery, such as cataract surgery.

SUMMARY

In response to surgical trauma during cataract surgery, the eye produces a variety of cytokines and growth factors as part of the wound response. TGF-b is considered one of the most important growth factors involved in the ocular response to cataract extraction. TGF-b conveys its information by engaging cell surface receptor complexes, which then transmit their signal through the cell membrane to activate signaling pathways in the cytoplasm and nucleus. In lens epithelial cells (LEC), one of the major signaling pathways used by TGF-b involves the Smad proteins, which act by increasing the transcription of a battery of genes involved in epithelial-mesenchymal transition (EMT). The inventors have made the surprising discovery that Smad7, an inhibitory member of the Smad protein family, can effectively suppress TGF-b induced signaling in the lens. As there is currently no approved medical therapy for prevention of PCO, the methods and materials of this disclosure close this gap. Because PCO inhibitors can be delivered directly to the capsular bag at the time of cataract surgery, the toxicity or unwanted side effects associated with systemic drug administration may be avoided. Thus, our technology addresses a currently unmet clinical need: the treatment or prevention of PCO using one or more drugs that suppress the growth factor signaling pathway responsible for transitioning lens epithelial cells to a myofibroblast phenotype and PCO.

Thus, the present disclosure provides methods of treating and/or reducing the incidence or risk of a fibrotic disorder of the eye, such as posterior capsular opacification (PCO), where the subject, including a human subject, is at heightened risk of developing a fibrotic disorder of the eye. The Smad7 protein used in these methods may be a biologically active fusion protein or fragment, derivative, prodrug, or analog thereof.

This disclosure provides a method of treating or reducing the incidence of a fibrotic disorder of the eye by administering a therapeutically effective amount of a Smad7 protein to a subject suffering from or at risk of developing a fibrotic disorder of the eye. The fibrotic disorder of the eye may be posterior capsule opacification (PCO). In these methods, the subject may be a diabetic subject. In these methods, the subject may be undergoing an eye surgery or have undergone an eye surgery within the last 10 days. In these methods, the eye surgery may be cataract surgery. In these methods, the subject is typically a human subject.

The Smad7 protein used in these methods may be a derivative, variant, fragment, prodrug, or analog of the full-length human Smad7 protein that retains one or more biological activities of Smad7. The Smad7 protein may be a fusion protein comprising a Smad7 derivative, variant, fragment, prodrug, or analog of the full-length human Smad7 protein covalently linked to a protein transduction domain (PTD). The PTD may be a TAT protein or derivative thereof. The PTD may be fused to the Smad7 protein by a peptide linker.

An exemplary Smad 7 protein for use in these methods includes the full-length human Smad7 amino acid sequence (SEQ ID NO: 1 ).

Other exemplary Smad7 proteins for use in these methods include amino acids 259- 426 of the amino acid sequence set forth in SEQ ID NO: 1 , and/or amino acids 203-217 of the amino acid sequence set forth in SEQ ID NO:1 , wherein the Smad7 protein fragment maintains one or more biological activities of the Smad7 functional domain in a subject.

Another exemplary Smad7 protein for use in these methods includes amino acids 203-426 of the amino acid sequence set forth in SEQ ID NO: 1 , wherein the Smad7 protein fragment maintains one or more biological activities of the Smad7 functional domain in a subject. Thus, in some embodiments, the human Smad7 amino acid sequence may comprise or consist of an amino acid sequence set forth in any one of SEQ ID NOs: 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 80, 82, 84, 86, 88, 90, 91 , 94, 96, and 100. In some

embodiments, the Smad7 nucleotide sequence may be any one of the nucleotide sequences in SEQ ID NOs: 57, 59, 61 , 63, 65, 67, 69, 71 , 73, 75, 79, 81 , 83, 85, 87, 89, 92, 93, 95, 97, 98, 99, 101 , 102, 103, 104, and 105. In some embodiments, a codon-optimized human Smad7 nucleotide sequence may be in any one of the nucleotide sequences set forth in SEQ ID NOs: 57, 59, 90, 92, 93, 95, 98, 99, 101 , 102, 103, 104, and 105.

Additional useful Smad7 fusion protein constructs for use in these methods may include protein fusion constructs composed of any one of the amino acid sequences, or fragments thereof, or nucleic acid molecules encoding the same, set forth at pages 40-90 of this disclosure, wherein the Smad7 protein fragment maintains one or more biological activities of the Smad7 functional domain in a subject.

In these methods, the Smad7 protein may be administered topically to the eye of the subject. The Smad7 protein may be administered during surgery to insert an intraocular lens.

This disclosure also provides for the use of a Smad7 protein for the manufacture of a medicament for the treatment or prevention of posterior capsule opacification. The present disclosure also provides the use of a Smad7 protein for the manufacture of a medicament for the treatment or prevention of a fibrosis disorder of the eye, such as posterior capsular opacification.

This Summary is neither intended nor should it be construed as being representative of the full extent and scope of the present invention. Moreover, references made herein to "the present disclosure," or aspects thereof, should be understood to mean certain embodiments of the present disclosure and should not necessarily be construed as limiting all embodiments to a particular description. The present invention is set forth in various levels of detail in this Summary as well as in the attached drawings and the Detailed Description and no limitation as to the scope of the present disclosure is intended by either the inclusion or non-inclusion of elements, components, etc. in this Summary. Additional aspects of the present disclosure will become more readily apparent from the Detailed Description, particularly when taken together with the drawings.

This disclosure includes the following sequences (peptides are displayed using the single-letter amino acid abbreviations). This table provides a partial list of sequences of this disclosure:

BRIEF DESCRIPTION OF FIGURES

FIG. 1 depicts exemplary Smad7 protein fusion constructs useful in the methods of this disclosure. As indicated, these fusion proteins may include a fusion protein partner, for example, GST, MBP, or Trx; a protein transduction domain (PTD), such as Tat or PEP; a tag specific for antibody staining or Western blotting, such as HA or V5; and a tag for protein purification, such as 6XHis.

FIGS. 2A-2C show the uptake of Tat-Smad7 in lens epithelial cells (LEC). Exposure of LEC to Tat-Smad7 for 1 hour led to reductions in TGF^-induced activation of Smad2 (FIG. 2A). Exposure of LEC to Tat-Smad7 or Tat-C-Smad7 led to reductions in TGF-b- induced expression of aSMA (FIG. 2B. Exogenous Tat-Smad7 was detected by

immunostaining for the V5 affinity epitope in LEC treated with Tat-Smad7 (+) or vehicle control 1 (-) (FIG. 2C).

FIG. 3 shows a-SMA expression in lens capsular bag following extracapsular lens extraction (ECLE). Outline of the capsular bag is shown in dotted line. aSMA, a biomarker for PCO, was significantly lower inside the capsular bag of eyes treated with Tat-PY-C- Smad7 (FIG. 1) at the time of cataract surgery.

FIG. 4 shows the reduction of PCO gene expression by Smad7 therapy as measured for qPCR for aSMA gene transcripts. Gene transcripts for aSMA rose over 30-fold in sham- treated lens capsules following ECLE. Tat-PY-C-Smad7 therapy significantly reduced this increase (p<0.001).

FIGS. 5A and 5B show a dose escalation study. Using intensity of a-SMA

immunostaining (green signal) in the postsurgical capsule as an index of Smad7 efficacy against PCO, much more pronounced suppression of a-SMA is observed in animals treated with 6 pg Tat-PY-C-Smad7 (FIG. 5A) as compared with 1.5 pg (FIG. 5B).

FIG. 6 shows the results of treating human lens epithelial cells with TGF-b alone or in combination with either TAT-PY-C-Smad7 or the synthetic peptide containing Smad7 PY domain fused to TAT (“TAT-PY”; SEQ ID NO:77). Other controls included a peptide containing the Smad7 PY domain alone (“PY”; SEQ ID NO:78) and a peptide containing the TAT tag alone (“TAT”; SEQ ID NO:6). Expression of the EMT marker aSMA under these conditions was measured by semi-quantitative Western blotting. Expression levels were normalized to an internal loading standard (glyceraldehyde 3-phosphate dehydrogenase, GAPDH) for comparison of treatment groups.

DETAILED DESCRIPTION

This disclosure provides methods of treating or preventing a fibrotic disorder of the eye, or the preparation of a medicament therefor, by administration of an active Smad7 protein to the eye. The particular disorder to be treated or prevented may be a TGF-b mediated disorder of the lens, capsular bag, cornea, conjunctiva, sclera, retina or other tissue or structure of the eye, for example the posterior lens capsule of the eye. Examples of disorders treated or prevented by these methods are fibrotic complications of surgery, for example glaucoma surgery (e.g. glaucoma filtration surgery), cataract surgery or other ocular lens replacement surgery, or pterygia surgery, particularly PCO following cataract surgery.

A. Smad7 proteins

In the methods of this disclosure, any Smad7 protein or derivative thereof that is useful in treating, preventing, or inhibiting posterior capsular opacification may be used and administered in compositions, including liquid formulations, described herein.

Mothers against decapentaplegic homolog 7 (Smad7) was previously identified as an antagonist of TGF-b signaling by several mechanisms including: (a) blockade of TGF-b receptor-mediated phosphorylation and nuclear translocation of signaling Smads; (b) increased degradation of TGF-b receptors and signaling Smads through specific ubiquitin- proteasome pathways; and (c) inhibition of signaling Smads for their binding to Smad binding elements (SBEs). Smad7 also antagonizes other signaling pathways, like the NF-KB pathway.

Smad7 protein is encoded by the SMAD7 gene. Like many other TGF-b family members, Smad7 is involved in cell signaling. It is a TGF-b type 1 receptor antagonist. It blocks TGF-bI and activin associating with the receptor, blocking access to Smad2. It is an inhibitory Smad (l-SMAD) and is enhanced by SMURF2. Smad7 also enhances muscle differentiation.

The terms "polypeptide," "peptide," and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to naturally occurring amino acid polymers as well as amino acid polymers in which one or more amino acid residues is a non- naturally occurring amino acid, for example, an amino acid analog. As used herein, the terms encompass amino acid chains of any length, including full length proteins, wherein the amino acid residues are linked by covalent peptide bonds.

The methods of this disclosure include the administration of Smad7 protein compositions. In addition to the entire Smad7 molecule, the present technology also relates to the use of truncated portions and fragments of the polypeptide that retain one or more of the activities associated with Smad7, such as, but not limited to, increasing proliferation, reducing or inhibiting cell death, reducing excessive inflammation, preventing DNA damage, and/or increasing cell migration, as well as treating or preventing one or more disease or disorders in which such treatment would be helpful as further discussed herein. Such activities can be assessed using one or more assays including, but not limited to, the ability to block phosphorylation of Smad2 and/or nuclear translocation of the NF-kB p50 subunit, increase cell proliferation, reduce apoptosis and/or radiation-induced DNA damage, reduce inflammation and/or angiogenesis, promote healing in oral mucositis, surgical wounds, diabetes wounds, and/or wounds associated with chronic inflammation in mice.

Protein fragments may be generated by genetic engineering of translation stop sites within the coding region. Alternatively, treatment of the Smad7 molecule with proteolytic enzymes, known as proteases, can produce a variety of N-terminal, C-terminal and internal fragments. These fragments may be purified according to known methods, such as precipitation (e.g., ammonium sulfate), HPLC, ion exchange chromatography, affinity chromatography (including immunoaffinity chromatography) or various size separations (sedimentation, gel electrophoresis, gel filtration).

As used herein, reference to an isolated protein or polypeptide includes full-length proteins, fusion proteins, chimeric proteins, or any fragment (truncated form, portion) or homologue of such a protein. More specifically, an isolated protein can be a protein

(including a polypeptide or peptide) that has been removed from its natural milieu (/.e., that has been subject to human manipulation), and can include, but is not limited to, purified proteins, partially purified proteins, recombinantly produced proteins, proteins complexed with lipids, soluble proteins, synthetically produced proteins, and isolated proteins associated with other proteins. As such, "isolated" does not reflect the extent to which the protein has been purified. Preferably, an isolated protein is produced recombinantly.

Variants of Smad7 may also be used - these can be substitutional, insertional or deletion variants. Deletion variants lack one or more residues of the native protein that are not essential for activity, including the truncation mutants described above and herein.

Substitutional variants typically contain the exchange of one amino acid for another at one or more sites within the protein and may be designed to modulate one or more properties of the polypeptide, such as stability against proteolytic cleavage and/or translation and/or transcription (protein expression), without the loss of other functions or properties.

Substitutions of this kind preferably are conservative, that is, one amino acid is replaced with one of similar shape and charge. Conservative substitutions are well known in the art. In making substitutional variants, the hydropathic index, hydrophilicity, charge and size are normally considered.

Specifically-contemplated deletion variants of Smad7 include truncations and fragments, for example, including polypeptide molecules having N-terminal sequences, but not C-terminal sequences, having C-terminal sequences but not N-terminal sequences, or having internal sequences but not N-terminal or C-terminal sequences. Specifically- contemplated Smad7 polypeptide truncations or fragments include, but are not limited to, molecules including amino acid residues 259-426, and/or 203-258, and/or 203-217, corresponding to the native human Smad7 protein sequence (SEQ ID NO:1). Specifically- contemplated Smad7 polypeptide truncations, fragments, or variants including, but not limited to, molecules comprising or consisting of any one of SEQ ID NOs: 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 80, 82, 84, 86, 88, 90, 91 , 94, 96, and 100. Specifically contemplated Smad7 polypeptides also include, but are not limited to, molecules including the full length human Smad7 protein sequence set forth in SEQ ID NO: 1 , functional variants, and truncations/fragments thereof.

The term“truncated” and grammatical variants thereof, as used herein in reference to protein sequences refers to a molecule that contains the natural N-terminus of a

corresponding protein (with or without a cleaved leader sequence), but lacks one or more amino acids starting from the C-terminus of the molecule, or a molecule that contains the natural C-terminus of a corresponding protein (with or without a cleaved leader sequence), but lacks one or more amino acids starting from the N-terminus of the molecule. In some embodiments, molecules lacking at least about 25, at least about 50, at least about 75, at least about 100, at least about 125, at least about 150, at least about 200, at least about 250, at least about 300, or at least about 350, or at least about 400 amino acids from one or the other terminus are specifically provided. A“truncated” molecule is biologically active, having one or more of the Smad7 activities described herein.

The term“fragment” as used herein in reference to polypeptide sequences refers to a molecule containing contiguous residues of a full-length sequence but lacking some N- terminal and/or C-terminal residues of the full-length sequence. A“fragment” includes a portion of one or more of the full-length sequences described herein. The“fragment” does not include sequences encoding either the N-terminal or the C-terminal, but only internal fragments. A“fragment” encodes a polypeptide that is biologically active, having one or more of the Smad7 activities described herein. In some embodiments, polypeptide fragments have at least about 15, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100,150, 200,

250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050,

1100, or 1150 amino acids.

A specialized type of variant is the fusion protein. This molecule generally has all or a substantial portion of the native molecule, linked at the N- or C-terminus, to all or a portion of a second polypeptide. The fusion protein may include any one of the fragments and/or truncated (N-terminal, C-terminal) Smad7 proteins described throughout this disclosure. For example, fusions may employ leader sequences from other species to permit the

recombinant expression of a protein in a heterologous host. Another useful fusion includes the addition of an optional functionally active domain, such as, but not limited to, an antibody epitope and/or a purification tag (e.g., V5: GKPIPNPLLGLDST (SEQ ID NO: 3); Flag:

KYKDDDDK (SEQ ID NO: 4); HA: YPYDVPDYA (SEQ ID NO: 5)). Another type of fusion includes attaching a domain that can act as the target for an activating or inactivating ligand, thereby permitting control of the fusion protein’s function once delivered to a subject. Such domains include, for example, steroid ligand binding (e.g., ER, PR, GR), which can be activated by small molecules, e.g., 4-hydroxyl tamoxifen or RU486 that are either uniquely able to activate those steroid ligand binding domains and/or do not exist in nature and will therefore enable full control of the Smad7 function by the presence of these small molecules.

Another form of a fusion protein is a fusion of a Smad7 protein, including Smad7 fragments, with a protein transduction domain (PTD), also called a cell delivery domain or cell transduction domain. Such domains have been described in the art and are generally characterized as short amphipathic or cationic peptides and peptide derivatives, often containing multiple lysine and arginine resides (Fischer, Med. Res. Rev. 27:755-795 (2007)). PTDs are short peptide sequences that can be fused to proteins to enable rapid delivery into cells. Several potential mechanisms may explain the ability of PTDs to enable or enhance cell entry. PTDs may be effective for delivery of therapeutic proteins to target tissues. The PTD may be one or more variants of TAT protein from HIV (GRKKRRQRRR (SEQ ID NO:

6), YGRKKRRQRRR (SEQ ID NO: 7), or GRKKRRQ (SEQ ID NO: 8)) or alternatively, HSV VP16. Alternate forms of Tat may be used. A linker may be used to connect one or more PTDs and the Smad7 protein. The PTD (optionally Tat) is fused or linked in frame to the N- terminal and/or C-terminal end of any one of the Smad7 full-length, fragments, and/or truncated (N-terminal, C-terminal) proteins described above. Other examples of PTDs useful as fusion proteins with Smad7 proteins in the methods of this disclosure are shown in the following table:

PROTEIN TRANSDUCTION DOMAINS _

SEQ ID SEQ ID NO: NO:

GALFLGWLGAAGSTMGAKK 9 QAATATRGRSAASRPTERPR 30

KRKV APARSASRPRRPVE

RQIKIWF QNRRMKWKK 10 MGLGLHLLVLAAALQGAKS 31

KRKV

RRMKWKK 11 AAV ALLP A VLL ALL AP A A A 32

NYKKPKL

RRWRRWWRRWWRRWRR 12 MANLGYWLLALFVTMWTD 33

VGLCKKRPKP

RGGRLSYSRRRFSTSTGR 13 LGTYTQDFNKFHTFPQTAIG 34

VGAP

YGRKKRRQRRR 7 DPKGDPKGVTVTVTVTVTG 35

KGDPXPD

RKKRRQRRR 14 PPPPPPPPPPPPPP 36

YARAAARQARA 15 VRLPPPVRLPPPVRLPPP 37

RRRRRRRR 16 PRPLPPPRPG 38

KKKKKKKK 17 SVRRRPRPPYLPRPRPPPFFPP 39

RLPPRIPP

GWTLN S AGYLLGKINLKALA 18 TRSSRAGLQFPVGRVHRLLR 40

ALAKXIL K

LLILLRRRIRKQANAHSK 19 GIGKFLHS AKKF GKAFV GEI 41

MNS

SRRHHCRSKAKRSRHH 20 KWKLFKKIEKV GQNIRDGII 42

KAGPAVAVVGQATQIAK

NRARRNRRRVR 21 ALWMTLLKKVLKAAAKAA 43

LNAVLVGANA PROTEIN TRANSDUCTION DOMAINS

RQLRIAGRRLRGRSR 22 GIGAVLKVLTTGLPALISWIK 44

RKRQQ

KLIKGRTPIKFGK 23 INLKALAALAKKIL 45

RRIPNRRPRR 24 GFFALIPKIISSPLPKTLLSAV 46

GSALGGSGGQE

KLALKLALKALKAALKLA 25 LAKWALKQGFAKLKS 47

KLAKLAKKLAKLAK 26 SMAQDIISTIGDLVKWIIQTV 48

NXFTKK

GALFLGFLGAAGSTNGAW S Q 27 LLGDFFRKSKEKIGKEFKRIV 49

PKKKRKV QRIKQRIKDFLANLVPRTES

KETWWETWWTEWSQPKKKR 28 PAWRKAFRWAWRMLKKAA 50

KV

LKKLLKKLLKKLLKKLLKKL 29 KLKLKLKLKLKLKLKLKL 51

This disclosure also provides sequence variants of Smad7 in which one or more residues have been altered. For example, the methionine residue found at position 216 of the human Smad7 sequence may be modified to a leucine residue (encoded as an ATG to CTG change in the nucleic acid encoding the protein).

The various truncated forms and fragments of Smad7 protein useful in the methods of this disclosure retain one or more of the biological activities of full-length human Smad7, such as, but not limited to, increasing proliferation, reducing or inhibiting cell death, reducing excessive inflammation, preventing DNA damage, and/or increasing cell migration, as well as treating or preventing one or more disease or disorders in which such treatment would be helpful as further discussed herein. Such activities can be assessed using one or more assays including, but not limited to, the ability to block phosphorylation of Smad2 and/or nuclear translocation of the NF-kB p50 subunit, increase cell proliferation, reduce apoptosis and/or radiation-induced DNA damage, reduce inflammation and/or angiogenesis, promote healing in oral mucositis, surgical wounds, diabetes wounds, and/or wounds associated with chronic inflammation in mice.

These various truncated forms and fragments of Smad7 protein may retain only a subset of the activities of full-length human Smad7. For example, the C-terminal MH2 domain of Smad7 may primarily mediate the anti-inflammatory effect of Smad7. Smad7 peptides having this anti-inflammatory function may be sufficient, and optionally an improvement, for treating or preventing fibrotic disorders of the eye. The N-terminal MH1 domain may primarily mediate cell migration and/or blocking TGF^-induced growth arrest and/or fibrotic response. Smad7 peptides having this cell migration and proliferation function may be sufficient, and optionally an improvement, for enhancing healing that is not associated with excessive inflammation. Types of wounds to an eye that might benefit from this form of treatment include, but are not limited to, surgical wounds, fibrotic scarring, and wounds associated with complications of diabetes, and defective healing and/or scarring, among others. An exemplary Smad7 fusion protein that is useful in the methods of this disclosure includes a protein transduction domain and a Smad7 protein domain comprising amino acids 2-258 of the amino acid sequence set forth in SEQ ID NO: 1. Another exemplary Smad7 fusion protein that is useful in the methods of this disclosure includes a protein transduction domain fused with a Smad7 protein domain comprising amino acids 259-426 of the amino acid sequence set forth in SEQ ID NO: 1. In these fusion proteins, the Smad7 protein fragment maintains one or more biological activities of the Smad7 functional domain in a subject.

This disclosure also contemplates the use of nucleic acid molecules (optionally codon-optimized nucleic acid molecules) encoding fragments or truncated forms of Smad7 protein described above, in the treatment or prevention of fibrotic disorders of the eye, such as PCO.

These fragments and/or truncated forms of Smad7 protein may retain one or more or all of the activities of full-length human Smad7 protein. Thus, this disclosure also

contemplates the use of nucleic acid sequences encoding the N-terminal portion of the Smad7 protein, or the C-terminal portion of the Smad7 protein, or nucleotide positions 4-774 of the cDNA encoding human Smad7 (SEQ ID NO:2) (encoding amino acids 2-258 of the human Smad7 protein), or nucleotide positions 775-1278 of SEQ ID NO:2 (encoding amino acids 259-426 of the human Smad7 protein), or nucleotide positions 610-774 of SEQ ID NO:2 (encoding amino acids 203-258 of the human Smad7 protein, SEQ ID NO:1), or any one of the nucleotide sequences set forth in SEQ ID NOs: 57, 59, 61 , 63, 65, 67, 69, 71 , 73, 75, 79, 81 , 83, 85, 87, 89, 92, 93, 95, 97, 98, 99, 101 , 102, 103, 104, and 105. This disclosure also contemplates the use of nucleic acid sequences encoding the full length human Smad7 protein.

The term“truncated” as used herein in reference to nucleic acid molecules refers to a molecule that contains nucleotide sequences encoding the natural N-terminus of a corresponding protein (with or without a cleaved leader sequence), but lacks one or more nucleotides starting from the C-terminus-encoding portion of the molecule, or a molecule that contains nucleotide sequences encoding the natural C-terminus of a corresponding protein (with or without a cleaved leader sequence), but lacks one or more nucleotides starting from the N-terminus-encoding portion of the molecule. In some embodiments, molecules lacking nucleotides encoding at least about 25, at least about 50, at least about 75, at least about 100, at least about 125, at least about 150, at least about 200, at least about 250, at least about 300, or at least about 350, or at least about 400 amino acids from one or the other terminus are specifically provided. Similarly, the term“truncated” may also be used in reference to protein molecules encoded by truncated nucleic acid molecules. In some embodiments, a“truncated” molecule is biologically active, having (or encoding a polypeptide having) one or more of the Smad7 biological activities described herein.

The term“fragment” as used herein in reference to nucleic acid molecules refers to a molecule containing contiguous residues of a full-length sequence but lacking some 5’ and/or 3’ sequences of the full-length sequence. A“fragment” may include a portion of one or more of the full-length Smad7 sequences described herein. The“fragment” may encode only internal fragments of the Smad7 protein (i.e., does not include sequences encoding either the N-terminal or the C-terminal portions of the Smad7 protein). Thus, a“fragment” may encode a polypeptide that is biologically active, having one or more of the Smad7 activities described herein. In some embodiments, nucleic acid fragments may encode proteins having at least about 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100,150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150 amino acids. Similarly,“fragment” may also be used in reference to protein molecules comprising a portion of the Smad7 protein that is less than the full-length Smad7 protein (SEQ ID NO:1).

The term“N-terminal portion” as used herein refers to a fragment of a Smad7 protein that contains the protein’s N-terminus but lacks all sequences C-terminal to an internal residue. The term“C-terminal portion” as used herein refers to a fragment of a Smad7 protein that contains the protein’s C-terminus but lacks all sequences N-terminal to an internal residue.

Although not intending to be bound by theory, Smad7 protein activity is generally believed to be the result of interactions in both the cytoplasm and nucleus of a cell. For that reason, among others, Smad7 proteins have been developed as protein therapeutics as a fusion protein with a protein transduction domain (PTD). Thus, this disclosure also contemplates the use of a Smad7 nucleic acid sequence encoding a Smad7 protein (e.g., optionally any nucleic acid sequence described herein encoding Smad7 protein, including human wild-type and codon-optimized sequences, both full-length and biologically active fragments, or truncated portions) fused to a nucleic acid encoding a PTD. The PTD may be located at the 3’ end of the Smad7 nucleic acid sequence. Alternatively or additionally, the PTD may be located at the 5’ end of the Smad7 nucleic acid sequence. A linker sequence encoding 1 , 2, 3, 4, 5, 6, or more amino acids may be used to connect the PTD and the Smad7 nucleic acid sequence.

In some embodiments, the PTD nucleic acid sequence is a Tat nucleic acid sequence, for example: ggccgtaaaaaacgccgtcaacgccgccgt (SEQ ID NO: 52) encoding GRKKRRQRRR (SEQ ID NO: 6), tatggccgtaaaaaacgccgtcaacgccgccgt (SEQ ID NO: 53) encoding YGRKKRRQRRR (SEQ ID NO: 7), or ggccgtaaaaaacgccgtcaa (SEQ ID NO: 54) encoding GRKKRRQ (SEQ ID NO: 55). The nucleic acid sequence may also include a nucleotide sequence encoding one or more of an epitope tag or a purification tag. An exemplary epitope tag is V5. An exemplary purification tag is one or more of glutathione-S-transferase (GST) or 6-histidine (H6) (SEQ ID NO: 56).

The term“epitope tag” as used herein in reference to nucleic acid molecules refers to nucleotides encoding peptide sequences that are recognized and bound by the variable region of an antibody or fragment. The epitope tag may not be part of the native protein. The epitope tag may be removable. The epitope tag may or may not be intrinsic to the protein’s native biological activity. Exemplary epitope tags include, but are not limited to, V5.

The term“purification tag” as used herein in reference to nucleic acid molecules refers to nucleotides encoding peptide sequences that facilitate the purification of the protein, but are generally not necessary for the protein’s biological activity. Purification tags may be removed following protein purification. Exemplary purification tags include, but are not limited to, GST and H6.

Methods of making the Smad7 fusion protein and nucleic acid constructs of this disclosure are within the skill of one of skill in the art of molecular biology, and are explained in detail in US Patent Application No. 14/773,167, US Pub. No. US 2016/0039894, which is incorporated herein in its entirety for this purpose.

B. Compositions and Formulations

The formulations described herein contain a Smad7 protein described above and may generally be any liquid or semi-liquid formulation, including but not limited to solutions, suspensions, emulsions, and gels. For example, the Smad7 protein present in these formulations may be the PY domain of Smad7 (SEQ ID NO:78) or the PY domain fused to a protein transduction domain (PTD, as described in detail above), such as the PY domain fused to TAT (TAT-PY; SEQ ID NO:77).

Solutions of the Smad7 protein may be prepared in suitable diluents such as water, aqueous salt solutions (buffered and/or isotonic), ethanol, glycerol, liquid polyethylene glycol(s), various oils, and/or mixtures thereof, and others known to those skilled in the art.

The pharmaceutical forms suitable for injectable use include sterile solutions, dispersions, emulsions, and sterile powders. The final form must be stable under conditions of manufacture and storage. Furthermore, the final pharmaceutical form must be protected against contamination and must, therefore, be able to inhibit the growth of microorganisms such as bacteria or fungi. A single intravenous, intraperitoneal, or intraocular dose can be administered.

Sterile, injectable solutions are prepared by incorporating a compound in the required amount into one or more appropriate solvents to which other ingredients, known to those skilled in the art, may be added as required. Sterile injectable solutions are prepared by incorporating the Smad7 protein in the required amount in the appropriate solvent with various other ingredients as required. Sterilizing procedures, such as filtration, then follow. Typically, dispersions are made by incorporating the compound into a sterile vehicle which also contains the dispersion medium and the required other ingredients as indicated above.

In the case of a sterile powder, the preferred methods include vacuum drying or freeze drying to which any required ingredients are added.

In all cases the final form, as noted, must be sterile and must also be able to pass readily through an injection device such as a hollow needle. The proper viscosity may be achieved and maintained by the proper choice of solvents or excipients. Moreover, the use of molecular or particulate coatings such as lecithin, the proper selection of particle size in dispersions, or the use of materials with surfactant properties may be utilized.

Prevention or inhibition of growth of microorganisms may be achieved through the addition of one or more antimicrobial agents such as chlorobutanol, ascorbic acid, parabens, thimerosal, or the like. It may also be preferable to include agents that alter the tonicity such as sugars or salts.

The liquid formulations described herein may comprise a solubilizing agent component. In some embodiments the solubilizing agent component is a surfactant. Note that there is some overlap between components that may be solvents and solubilizing agents, and therefore the same component may in some systems be used as either a solvent or a solubilizing agent. A liquid formulation that comprises a Smad7 protein and a component that may be considered either a solvent or a solubilizing agent or surfactant will be considered a solvent if it is playing the role of a solvent; if the component is not playing the role of the solvent, the component may be considered a solubilizing agent or surfactant.

Generally, any solubilizing agent or combination of solubilizing agents may be used in the liquid formulations described herein. In some embodiments, the solubilizing agent is a surfactant or combination of surfactants. Many surfactants are possible. Combinations of surfactants, including combinations of various types of surfactants, may also be used. For instance, surfactants that are nonionic, anionic (i.e. soaps, sulfonates), cationic (i.e. CTAB), zwitterionic, polymeric or amphoteric may be used.

Surfactants that can be used may be determined by mixing a Smad7 protein of interest with a putative solvent and a putative surfactant, and observing the characteristics of the formulation after exposure to a medium. Examples of surfactants include but are not limited to fatty acid esters or amides or ether analogues, or hydrophilic derivatives thereof; monoesters or diesters, or hydrophilic derivatives thereof; or mixtures thereof;

monoglycerides or diglycerides, or hydrophilic derivatives thereof; or mixtures thereof;

mixtures having enriched mono- or/and diglycerides, or hydrophilic derivatives thereof;

surfactants with a partially derivatized with a hydrophilic moiety; monoesters or diesters or multiple-esters of other alcohols, polyols, saccharides or oligosaccharides or polysaccharides, oxyalkylene oligomers or polymers or block polymers, or hydrophilic derivatives thereof, or the amide analogues thereof; fatty acid derivatives of amines, polyamines, polyimines, aminoalcohols, aminosugars, hydroxyalkylamines,

hydroxypolyimines, peptides, polypeptides, or the ether analogues thereof.

Liquid formulations may optionally further comprise stabilizers, excipients, gelling agents, adjuvants, antioxidants, and/or other components as described herein.

Preferably, all components in the liquid formulation, other than the Smad7 protein, are liquid at room temperature.

The liquid formulation comprises a release modifying agent. The release modifying agent is a film-forming polymer component. The film-forming polymer component may comprise one or more film-forming polymers. Any film-forming polymer may be used in the excipient component. The film-forming polymer component comprises a water insoluble film forming polymer. The release modifying agent component comprises an acrylic polymer, including but not limited to polymethacrylate.

The Smad7 protein in the liquid formulation may comprise between about 0.01 to about 30% of the total weight of the composition. The Smad7 protein in the liquid formulation may comprise between about 0.001 to about 1.00% of the total weight of the composition.

The solvent component of the liquid formulation may comprise between about 0.01 to about 99.9% of the total weight of the composition, or between about 10 to about 20%.

The solubilizing agent component of the liquid formulation may comprise, for instance, between about 0.01 to about 30% of the total weight of the composition.

The liquid formulations described herein may have a viscosity of between 40% and 120% centipoise.

The liquid formulations described herein may be administered with or further comprise a viscosity modifying agent. One exemplary viscosity modifying agent that may be used is hyaluronic acid. Hyaluronic acid is a glycosaminoglycan. It is made of a repetitive sequence of glucuronic acid and glucosamine. Hyaluronic acid is present in many tissues and organs of the body, and contributes to the viscosity and consistency of such tissues and organs. Hyaluronic acid is present in the eye, including the vitreous of the eye, and along with collagen contributes to the viscosity thereof. The liquid formulations described herein may further comprise or be administered with hyaluronic acid. Other nonlimiting examples of viscosity modifying agents include polyalkylene oxides, glycerol, carboxymethyl cellulose, sodium alginate, chitosan, dextran, dextran sulfate and collagen. These viscosity-modifying agents can be chemically modified.

In some embodiments, the liquid formulations described herein comprise a Smad7 protein and a solvent component. The solvent component may comprise a single solvent or a combination of solvents. Exemplary solvents include glycerin, N-methylpyrrolidone (NMP), dimethyl acetamide (DMA), dimethyl formamide, dimethyl sulfoxide (DMSO), glycerol formal, ethoxy diglycol, triethylene glycol dimethyl ether, triacetin, diacetin, corn oil, acetyl triethyl citrate (ATC), ethyl lactate, polyglycolated capryl glyceride, g-butyrolactone, dimethyl isosorbide, benzyl alcohol, ethanol, isopropyl alcohol, propylene glycol (PG), polyethylene glycol (PEG) of various molecular weights, including but not limited to PEG 300 and PEG 40 pi, or a mixture of one or more thereof. The solvent may be a polyethoxylated castor oil (e.g., Cremophor (PEG 35 castor oil)), monoglycerides and/or diglycerides of caprylic acid (e.g., Capmul MCM (C8)), nonionic polymer of the alkyl aryl polyether alcohol (e.g., tyloxapol (ethoxylated p-tert-octylphenol formaldehyde polymer)), 50% phosphatidylcholine in propylene glycol/ethanol carrier (e.g., Phosal® 50PG), propylene glycol monolaurate, propylene glycol dicaprylate/dicaprate, macrogol 15 hydroxy stearate, ethanol, or a mixture of one or more thereof. In some variation, the solvent may comprise a combination of at least two solvents. In some embodiments, the at least two solvents comprising a first solvent such as polyethoxylated castor oil (e.g., Cremophor (PEG 35 castor oil)), propylene glycol monolaurate, propylene glycol dicaprylate/dicaprate, macrogol 15 hydroxystearate, or nonionic polymer of the alkyl aryl polyether alcohol (e.g., tyloxapol (ethoxylated p-tert- octylphenol formaldehyde polymer)) and a second solvent such as monoglycerides and/or diglycerides of caprylic acid (e.g., Capmul MCM (C8)). The solvent may further comprise ethanol. The solvent may further comprise water, for instance, between about 0.01 to about 99.9% of the total weight of the composition.

The liquid formulations described herein may be formulated as suspensions, comprising a Smad7 protein and a diluent component. The diluent component may comprise one or more components listed herein as solvents or solubilizing agents, wherein the resulting mixture is a suspension.

Generally, the Smad7 protein may be formulated in any composition or formulation capable of delivery of a therapeutically effective amount of the Smad7 protein to a subject or to the eye of a subject for the required delivery period.

The formulations described herein may be provided in one or more unit dosage forms, wherein the unit dose form contains an amount of a liquid formulation described herein that is effective to treat or prevent the disease or condition for which it is being administered. In some embodiments, the formulations described herein are provided in one or more unit dosage forms, wherein the unit dose form contains an amount of a liquid Smad7 protein formulation described herein that is effective to treat or prevent PCO.

The unit dose form may be prepared in the concentration at which it will be administered. The unit dose form may be diluted prior to administration to a subject. A liquid formulation described herein may be diluted in an aqueous medium prior to administration to a subject. The aqueous medium may be an isotonic medium. A liquid formulation described herein may be diluted in a non-aqueous medium prior to administration to a subject.

Compositions useful in the methods of this disclosure include a therapeutically active amount of a Smad7 protein or nucleic acid encoding a Smad7 protein.

These compositions may also include additional active agents. Exemplary additional active agents include analgesics, anesthetics, or anti-inflammatory agents. In some embodiments, active agents that may be used in the liquid formulations are anti

inflammatory agents (such as hydrocortisone, dexamethasone, fluocinolone, prednisone, prednisolone, methylprednisolone, fluorometholone, betamethasone and triamcinolone), ACE-inhibitors, endogenous cytokines, agents that influence basement membrane, agents that influence the growth of endothelial cells, adrenergic agonists or blockers, cholinergic agonists or blockers, aldose reductase inhibitors, antibiotics (such as tetracycline, chlortetracycline, bacitracin, neomycin, polymyxin, gramicidin, cephalexin, oxytetracycline, chloramphenicol, rifampicin, ciprofloxacin, aminosides, gentamycin, erythromycin, penicillin, quinolone, ceftazidime, vancomycin, imipeneme, sulfonamides, sulfadiazine, sulfacetamide, sulfamethizole, sulfisoxazole, nitrofurazone and sodium propionate), antifungals (such as amphotericin B, fluconazole, ketoconazole and miconazole), anti-allergies (such as sodium cromoglycate, antazoline, methapyriline, chlorpheniramine, cetirizine, pyrilamine and prophenpyridamine), antihypertensives, pressors, antiprotozoal agents, antiviral agents, antifungal agents, anti-infective agents, antitumor agents, antimetabolites, and

antiangiogenic agents.

The Smad7 protein, used in combination with an additional active agent, may be administered simultaneously (i.e. , simultaneous administration), sequentially (i.e. , sequential administration), or independently of the additional active agents. The Smad7 protein and additional active agent may both be administered during one visit with a medical

professional. The Smad7 protein and additional active agent may both be administered during the same visit with a medical professional or during more than one visit with a medical professional. The Smad7 protein and the additional active agent may be administered by the same route of administration or by different routes of administration.

The combination of administration of Smad7 protein and administration of additional active agent(s) may reduce the dose administered (e.g., dose volume, dose concentration, or amount of Smad7 protein) of one or both agents, as compared to the amount or effect when used as a monotherapy. The combination of Smad7 protein and additional active agent increases or prolongs the time between administrations and/or decreases the frequency of administrations of one or both agents.

D. Methods of Treatment The Smad7 proteins, formulations, including liquid formulations, and methods described herein may be used to prevent a fibrotic disorder of the eye, such as PCO, where the subject, including a human subject, is at heightened risk of developing a fibrotic disorder of the eye. A subject with a heightened risk of developing a fibrotic disorder of the eye is a subject with one or more indications that a fibrotic disorder of the eye is likely to develop in the particular subject, such as a subject undergoing cataract surgery, or having recently underdone cataract surgery, or a diabetic subject.

Posterior capsular opacification (PCO) is a disorder characterized by hyperplasia and migration of posterior capsular cells, showing up as a thickening, opacification and clouding of the posterior lens capsule, which is left behind when the cataract was removed, for placement of the intraocular lens (IOL). This may compromise visual acuity. Currently there is no method or drug for preventing development of PCO. The current standard treatment of PCO is use of an Nd-YAG laser (neodymium-yttrium-aluminum-garnet) to disrupt and clear the central portion of the opacified posterior lens capsule. In very thick opacified posterior capsules, a manual surgical procedure may be necessary to remove the opacification.

As used herein, to“treat” a fibrotic disorder of the eye such as PCO by administration of a Smad7 protein means that the progress of at least one detectable physical characteristic or symptom of PCO is slowed, stopped, or reversed following administration of the Smad7 protein. Exemplary detectable physical characteristics or symptoms of PCO include, without limitation, hyperplasia of posterior capsular cells and loss of visual acuity.

As used herein, to“inhibit” a fibrotic disorder of the eye such as PCO by

administration of a Smad7 protein means that the progress of at least one detectable physical characteristic or symptom of PCO is slowed or stopped following administration of the Smad7 protein.

As used herein, to“prevent” a fibrotic disorder of the eye such as PCO by

administration of a Smad7 protein means that detectable physical characteristics or symptoms of PCO do not develop following administration of the Smad7 protein. 10-20% of cataract patients typically develop PCO over a period of up to 12 months after eye surgery. The incidence of PCO may increase up to a 40% incidence over a longer period of 4 years following surgery. Thus, preventing a fibrotic disorder of the eye, such as PCO, in subjects treated with the Smad7 protein may encompass reducing the incidence of such fibrotic disorders of the eye in such subjects to less than 20%, or less than 10%, within 12 months of following an eye surgery.

A subject, including but not limited to a human subject, having a predisposition or in need of prevention may be identified by the skilled practitioner by established methods and criteria in the field given the teachings herein. The skilled practitioner may also readily diagnose individuals in need of inhibition or treatment based upon established criteria in the field for identifying fibrotic disorders of the eye, or a predisposition to fibrotic disorders of the eye given the teachings herein.

As used herein, a“subject” is generally any animal that may benefit from

administration of the Smad7 proteins and formulations described herein. The Smad7 proteins may be administered to a mammalian subject, such as a human subject.

The compositions, methods, and liquid formulations described herein deliver one or more Smad7 proteins to an eye of a subject, including but not limited to a human subject. These compositions, methods, and liquid formulations described herein may deliver one or more Smad7 proteins to an eye of a subject, including directly to the lens capsule, in an amount and for a duration effective to treat, prevent, or inhibit a fibrotic disorder of the eye, including PCO, particularly in a diabetic subject and/or a subject undergoing cataract surgery.

As a non-limiting example, the compositions, liquid formulations, and methods described in herein may be administered to the vitreous, aqueous humor, sclera,

conjunctiva, between the sclera and conjunctiva, the retina choroid tissues, macula, or other area in or proximate to the eye of a subject, either by direct administration to these tissues or by periocular routes, in amounts and for a duration effective to treat, prevent, or inhibit a fibrotic disorder of the eye, such as PCO. The effective amounts and durations may be different for each of treating, preventing, or inhibiting the fibrotic disorder, and for each of the different sites of delivery.

Intravitreal administration is more invasive than some other types of ocular procedures. Because of the potential risks of adverse effects, intravitreal administration may not be optimal for treatment of relatively healthy eyes. By contrast, periocular administration, such as subconjunctival administration, is much less invasive than intravitreal administration. When a Smad7 protein is delivered by a periocular route, it may be possible to treat patients with healthier eyes than could be treated using intravitreal administration. In some embodiments, subconjunctival injection is used to prevent or delay onset of a disease or condition of the eye, where the eye of the subject has visual acuity of 20/40 or better.

“Subconjunctival” placement or injection, as used herein, refers to placement or injection between the sclera and conjunctiva.

In the methods of this disclosure, the Smad7 protein may be administered prior to, concurrent with, or subsequent to surgical implantation of an intraocular lens. The Smad7 protein may be administered during surgery. In a related embodiment, the Smad7 protein may be administered locally during surgery followed by one or more subsequent doses of the same or different amount, either systemically or topically to the eye. The intraocular lens may be bathed in Smad7 protein prior to insertion. The intraocular lens may incorporate the Smad7 protein that provides a sustained and/or controlled release of the Smad7 protein from the intraocular lens into the capsular bag. Alternatively, or additionally, the Smad7 protein may be administered to the eye in the form of a cell (which may be an encapsulated cell) that has been modified to express a Smad7 protein-encoding nucleic acid of this disclosure, thereby secreting Smad7 into the eye. The cell (including encapsulated cells) may be removed at a later time when Smad7 therapy is no longer needed. The Smad7 protein may be administered once or in multiple doses.

Routes of administration that may be used to administer a liquid formulation include but are not limited to placement of the liquid formulation, for example by injection, into an aqueous medium in the subject, including but not limited to placement (such as by injection), into the eye of a subject, including a human subject. The liquid formulation may be administered systemically, including but not limited to the following delivery routes: infusion, intramuscular, intraperitoneal, intraarterial, intrathecal, intrabronchial, intracisternal, cutaneous, subcutaneous, intradermal, transdermal, intravenous, intracervical,

intraabdominal, intracranial, intraocular, intrapulmonary, intrathoracic, intratracheal, nasal, buccal, sublingual, oral, parenteral, rectal, vaginal, or nebulized, or aerosolized using aerosol propellants.

Compositions and liquid formulations comprising Smad7 protein can be administered directly to the eye using a variety of procedures including, but not limited to, procedures in which (1) the Smad7 protein is administered by injection using a syringe and hypodermic needle, (2) a specially designed device is used to inject the Smad7 protein, (3) prior to injection of the Smad7 protein, a pocket is surgically formed within the sclera to serve as a receptacle for the Smad7 protein or Smad7 protein composition. For example, in one administration procedure a surgeon forms a pocket within the sclera of the eye followed by injection of a solution or liquid formulation comprising the Smad7 protein into the pocket.

Other administration procedures include, but are not limited to, procedures in which (1) a formulation of the Smad7 protein is injected through a specially designed curved cannula to place the Smad7 protein directly against a portion of the eye, (2) a compressed form of the Smad7 protein is placed directly against a portion of the eye, (3) the Smad7 protein is inserted into the sclera by a specially designed injector or inserter, (4) a liquid formulation comprising the Smad7 protein may be incorporated within a polymer, (5) a surgeon may make a small conjunctival incision through which to pass a suture and any Smad7 protein delivery structure so as to secure the structure adjacent to the sclera, (6) a needle may be used for injection directly into the vitreous of an eye, or into any other site described.

The liquid formulations described herein may be used directly, for example, by injection, as an elixir, for topical administration including but not limited to via eye drops, or in minitablets. The liquid formulations may be administered by topical administration. The topical administration may be ocular topical administration. The ocular topical administration may include, but is not limited to, administration via eye drops, contacts, punctual plugs, or other ocular devices. The liquid formulation may be applied topically, including topically to the eye, any of about 1 , 2, 3, 4, or 5 times per day. The liquid formulation may be applied topically, including topically to the eye, about once or any of about every 1 , 2, 3, 4, 5, 6, 7, 10, 14, 21 , or 28 day(s). The liquid formulation may be applied topically, including topically to the eye, about once or less every 5-10 days.

The Smad7 protein may be administered parenterally, e.g., intravenously, intramuscularly, intravenously, subcutaneously, or intraperitoneally. The carrier or excipient or excipient mixture can be a solvent or a dispersive medium containing, for example, various polar or non-polar solvents, suitable mixtures thereof, or oils. As used herein“carrier” or“excipient” means a pharmaceutically acceptable carrier or excipient and includes any and all solvents, dispersive agents or media, coating(s), antimicrobial agents, iso/hypo/hypertonic agents, absorption-modifying agents, and the like. The use of such substances and the agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredient, use in therapeutic compositions is contemplated. Moreover, other or supplementary active ingredients can also be incorporated into the final composition.

Alternatively, a slow long-term infusion or multiple short-term daily infusions may be utilized, typically lasting from 1 to 8 days. Alternate day dosing, or dosing once every several days may also be utilized.

With mammals, including humans, the effective amounts can be determined by standard method and administered on the basis of body surface area. The interrelationship of dosages varies for animals of various sizes and species, and for humans (based on mg/m² of body surface) is described by E. J. Freireich et al. , Cancer Chemother. Rep., 50(4):219 (1966). Body surface area may be approximately determined from the height and weight of an individual (see, e.g., Scientific Tables, Geigy Pharmaceuticals, Ardsley, N.Y. pp. 537-538 (1970)). A suitable dose range is from 1 to 1000 mg of equivalent per m² body surface area of a Smad7 protein, for instance from 50 to 500 mg/m².

A total volume of a liquid formulation described herein may be topically administered to a subject's eye, including a human subject's eye, that is less than about 1000 pi, less than about 900 mI, less than about 800 mI, less than about 700 mI, less than about 600 mI, less than about 500 mI, less than about 400 mI, less than about 300 mI, less than about 200 mI, less than about 100 mI, less than about 90 mI, less than about 80 mI, less than about 70 mI, less than about 60 mI, less than about 50 mI, less than about 40 mI, less than about 30 mI, less than about 20 mI, less than about 10 mI, less than about 5 mI, less than about 3 mI, or less than about 1 mI.

A total amount of Smad7 protein administered topically is typically less than about 5 mg. For example, a total amount of the Smad7 protein administered topically may be less than about 1.0 mg. A volume of a formulation administered that contains an amount of Smad7 protein may be between about 20 pg and about 4000 pg. When a certain volume of a liquid formulation is administered, it is understood that there is some imprecision in the accuracy of various devices that may be used to administer the liquid formulation. Where a certain volume is specified, it is understood that this is the target volume. However, certain devices such as insulin syringes are inaccurate to greater than 10%, and sometimes inaccurate to greater than 20% or more. Hamilton HPLC type syringes are generally considered precise to within 10%, and are recommended for volumes below 10 pi that are to be injected.

An amount of Smad7 protein administered intravitreally may be between about 1 pg and about 1000 pg. A volume of a liquid formulation described herein may be administered subconjunctivally to a subject's eye, typically between about 0.1 mI and about 200 pi.

“Total amount of a Smad7 protein” as used herein refers to the total amount of a Smad7 protein administered during a single administration session by a patient and/or physician and/or other medical professional. A single administration session will involve a single administration of the Smad7 protein, or one administration session may include more than one administration of the Smad7 protein. One administration session may include a single route of administration.

One administration session also may include multiple routes of administration. Thus, portions of the total amount of the Smad7 protein may be administered separately during a single administration session. The portions of the total amount that are administered separately may be administered by the same and/or different routes of administration. In addition, portions of the total amount that are administered separately may be administered in the same and/or different formulations.

“Total volume of a liquid formulation” as used herein refers to the total volume of a liquid formulation administered during a single administration session by a patient and/or physician and/or other medical professional. In some embodiments, a single administration session will involve a single administration of the liquid formulation. In some embodiments, one administration session will include more than one administration of the liquid

formulation. In some embodiments, one administration session will include a single route of administration. In some embodiments, one administration session will include multiple, different routes of administration. Thus, in some embodiments, portions of the total volume are administered separately during a single administration session. In such embodiments, the portions of the total volume that are administered separately may be administered by the same and/or by different routes of administration.

A Smad7 protein may be administered in multiple ocular locations. A Smad7 protein may be administered intravitreally and subconjunctivally. A Smad7 protein may be administered first intravitreally and at least one subsequent administration is administered subconjunctivally. A Smad7 protein may be administered first subconjunctivally and at least one subsequent administration is administered intravitreally. A Smad7 protein may be administered first intravitreally, subconjunctivally, or subtenonally and at least on subsequent administration is topically. The same (i.e. , identical) liquid formulation of the Smad7 protein may be used for the first and subsequent administrations. Alternatively, a different liquid formulation may be used for the first and subsequent administrations. Administration to multiple ocular locations occurs during one visit to the physician. Administration to multiple ocular locations may occur during separate visits to the physician.

The compositions and formulations described herein may be used to deliver amounts of the Smad7 proteins effective for treating, preventing, or inhibiting fibrotic disorders of the eye, such as PCO.

An“effective amount,” which is also referred to herein as a“therapeutically effective amount,” of a Smad7 protein for administration as described herein is that amount of the Smad7 protein that provides the therapeutic effect sought when administered to the subject including but not limited to, a human subject. The achieving of different therapeutic effects may require different effective amounts of Smad7 protein. For example, the therapeutically effective amount of a Smad7 protein used for preventing a disease or condition may be different from the therapeutically effective amount used for treating or inhibiting the disease or condition. In addition, the therapeutically effective amount may depend on the age, weight, and other health conditions of the subject as is well known to those versed in the disease or condition being addressed. Further, the therapeutically effective amount can depend upon the route of administration. Thus, the therapeutically effective amount may not be the same in every subject to which the Smad7 protein is administered.

An effective amount of a Smad7 protein for treating, preventing, or inhibiting a fibrotic disorder of the eye, such as PCO is also referred to as the amount of Smad7 protein effective to treat, prevent, or inhibit a symptom thereof.

To determine whether a level of Smad7 protein is a“therapeutically effective amount” to treat, prevent, or inhibit a fibrotic disorder of the eye, such as PCO, formulations may be administered in animal models for PCO, and the effects may be observed. In addition, dose ranging human clinical trials may be conducted to determine the therapeutically effective amount of a Smad7 protein.

D. Kits This disclosure also provides kits comprising one or more unit dose forms as described herein. The kit may comprise one or more of packaging and instructions for use to treat one or more diseases or conditions. The kit may comprise a diluent which is not in physical contact with the formulation or pharmaceutical formulation. The kit may comprise any of one or more unit dose forms described herein in one or more sealed vessels. The kit may comprise any of one or more sterile unit dose forms.

The unit dose form may be in a container, including but not limited to a sterile sealed container, such as a vial, ampule, or low volume applicator, such as a syringe. A low-volume applicator is pre-filled with Smad7 protein for treatment of a fibrotic disorder of the eye, such as PCO.

The kits may comprise one or more containers. A kit may comprise one or more low- volume applicators pre-filled with a formulation described herein comprising a Smad7 protein, and optionally further comprising one or more additional components. The kit may further comprise instructions for use in treating a fibrotic disorder of the eye, such as PCO.

EXAMPLES

Example 1

Smad7 suppression of PCO biomarkers in the mouse cataract model

In the mouse cataract model, extracapsular lens extractions are carried out using a central incision across the cornea and through the anterior capsule. A bent cannula is then placed under the anterior capsule and the lens fiber mass is hydrodissected with saline to detach the lens from the capsule for easy removal using fine forceps. Smad7 therapies (i.e. , Smad7 proteins of this disclosure and/or Smad7 protein-encoding nucleic acids of this disclosure) are introduced into the empty lens capsule, after which the eye is closed with a single nylon suture. Animals are euthanized after an appropriate postoperative time and the lens capsule recovered by dissection from the globe. For controls, the capsule-epithelium is recovered from the unoperated contralateral lens. At various times following surgery, eyes or lens capsules are recovered for immunohistology and measurement of gene transcripts by quantitative RT-PCR (qPCR) with particular focus on genes responsible for markers of EMT such as alpha smooth muscle actin, vimentin, a and b integrins, and E-cadherin.

Because of long-term safety issues, it can be desirable to administer Smad7 as a protein biologic. FIG. 1 depicts exemplary Smad7 protein fusion constructs tested in these methods. The use of these Tat-Smad7 fusion proteins may be delivered as a biologic when the lens epithelium is exposed during the lens extraction procedure and is therefore accessible for delivery of Smad7 therapy directly to the target tissue. Tat peptides efficiently deliver cargoes such as proteins, nucleic acids, and particles for therapeutic uses. To validate this strategy, the ability of Tat-Smad7 to enter LEC and attenuate TGF^-induced EMT was measured. Primary lens epithelial cell cultures from the mouse models were exposed to TAT-Smad7 fusion protein constructs of this disclosure. In addition to the Tat permeability sequence, these fusion constructs included the V5 affinity epitope to facilitate immunodetection. As shown in FIGS. 2A, 2B, and 2C, after 1 hour of exposure to 1 pg/ml Tat-Smad7 or Tat-C-Smad7 (FIG 2B), abundant quantities of the protein were detected in the cytoplasm and nucleus. TGF^-induced activation of Smad2 phosphorylation was substantially suppressed in cells treated with the Smad7 protein, as compared with vehicle- treated controls.

Smad7-induced suppression of Smad2-activation coincided with a reduction in a- SMA. FIGS. 2A-2C show the uptake of Tat-Smad7 in lens epithelial cells (LEC). Exposure of LEC to Tat-Smad7 or Tat-C-Smad7 for 1 hour led to reductions in TGF^-induced activation of Smad2 (FIG. 2A) and expression 1of a-SMA (FIG. 2B). Exogenous Tat-Smad7 was detected by immunostaining for the V5 affinity epitope in LEC treated with Tat-Smad7 (+) or vehicle control 1(-) (FIG. 2C). FIG. 3 shows a-SMA expression in lens capsular bag following extracapsular lens extraction (ECLE) (outline of the capsular bag is shown in dotted line). aSMA (green), a biomarker for PCO, was significantly lower inside the capsular bag of eyes treated with Tat-PY-C-Smad7 (FIG. 1) at the time of cataract surgery. FIG. 4 shows the reduction of PCO gene expression by Tat-PY-C-Smad7 therapy. Gene transcripts for aSMA rose over 30-fold in sham-treated lens capsules following ECLE. Tat-PY-C-Smad7 therapy significantly reduced this increase (p<0.001).

FIGS. 5A and 5B show a dose escalation study. Using intensity of a-SMA

immunostaining (green signal) in the postsurgical capsule as an index of Tat-PY-C-Smad7 efficacy against PCO, much more pronounced suppression of a-SMA is observed in animals treated with 6 pg Tat-PY-C-Smad7 (FIG. 5A) as compared with 1.5 pg (FIG. 5B).

These data indicate that Tat-PY-C-Smad7 will have the intended therapeutic effect on EMT in the lens.

Example 2

Inhibition of EMT markers by intraocular delivery of Smad7 in a PCO model

The ability of Tat-Smad7 to suppress ECLE-induced EMT markers will be tested in the mouse model. Purified recombinant Tat-Smad7 (100 ng in 50% glycerol/PBS) will be introduced into the capsule-epithelium at the time of ECLE surgery, followed by daily intraocular injections. Control mice will receive Tat-Cre as an irrelevant protein control fused to Tat. Treatment groups will consist of 8 mice (4 males, 4 females). Five days after surgery animals will be euthanized and capsule-epithelial tissue dissected from the eye and used to measure for EMT marker gene expression using qPCR and immunostaining. In addition to immunostaining for EMT markers, we will stain for the V5 epitope that will report on the distribution of the protein.

Example 3 Inhibition of EMT markers by intraocular delivery of Sorbinil in a PCO model

Mice will be divided into 2 groups each consisting of 4M and 4F. One group will receive Sorbinil (2 nmol in 2 pi) by daily intraocular injections, whereas the other group will receive PBS control. Five days following surgery, animals will be euthanized and capsule- epithelium tissue dissected from the eye and used to measure for EMT marker gene expression using qPCR and immunostaining. Because the majority of the lens mass is removed as part of the ECLE procedure, we will have a larger than usual volume of intraocular space and virtually no intraocular pressure, giving a reduced chance of nicking the capsule or losing injected material through the injection site.

As an internal measure of inhibitor activity, we will measure the levels of sorbitol, normally produced from glucose by aldose reductase (AR), which is characteristically reduced by Sorbinil. Sorbitol will be measured in capsule-epithelium dissected from the eye, using a standard enzymatic method (Chang, et al., (2016) Characterization of Emodin as a Therapeutic Agent for Diabetic Cataract. J. Nat. Prod. 79, 1439-44).

Example 4

Inhibiting EMT markers by intraocular delivery of Sorbinil and Smad7 in a PCO model

In preliminary studies we used pull down assays to show that AR interacts with Smad-2 and Smad-3 and that Sorbinil attenuates TGF-p-induced Smad-2 and Smad-3 activation. However, the exact mechanism is not yet understood. The mechanism behind Smad7 inhibition of Smad-2 and Smad-3 is thought to involve interference of R-Smad recruitment to the TGF-b receptor, stimulation of receptor degradation, and interference with Smad-mediated gene transcription. To test for synergistic effects at suppressing Smad signaling at two levels in the Smad signaling pathway, we will treat the ECLE mice with both Sorbinil and Tat-Smad7. Five days after surgery animals will be euthanized and capsule- epithelial tissue dissected from the eye and used to measure for EMT marker gene expression using qPCR and immunostaining for Tat-Smad7 using the V5 affinity epitope.

Sorbinil and Tat-Smad7 show protection against induced expression of EMT related genes in the ECLE model, and synergistic effects are observed with the combination therapy. Inhibition of AR by Sorbinil or deletion/knock down of the AR gene both result in a diminished but not complete inhibition of Smad-2 and Smad-3 activation or total elimination of EMT markers in cell culture models and in the mouse ECLE cataract model, suggesting that AR contributes to the TGF-b response but is not solely responsible for it. Synergistic effects in a lowering of EMT markers following a combination therapy involving Sorbinil and Smad7 are observed.

Example 5

Inhibiting TGF-p-induced activation of EMT in lens epithelial cells A synthetically synthesized Smad7 PY domain (ELESPPPPYSRYPMD; SEQ ID NO:78) was fused to a synthetically synthesized TAT protein transduction domain

(GRKKRRQRRR (SEQ ID NO:6)) to form a TAT-PY fusion protein construct (“TAT-PY”; GRKKRRQRRRELESPPPPYSRYPMD; SEQ ID NO:77). This TAT-PY fusion protein was evaluated for efficacy against TGF^-induced activation of EMT in a lens epithelial cells (LEC) culture model.

Efficacy of the TAT-PY protein construct against expression of TGF^-induced aSMA was demonstrated in LEC. For validation, TGF^-induced aSMA expression was measured in LEC co-treated with quantities of either recombinant TAT-PY-C-Smad7 or various control peptides. Semi-quantitative Western blots demonstrated that treatment of LEC with TAT-PY (15 mg/ml) inhibited TGF^-induced aSMA expression by 50%, similar to that observed with the TAT-PY-C-Smad7 recombinant protein at 0.5 mg/ml (58% inhibition) (FIG. 6). Therefore, the TAT-PY peptide significantly reduces TGF^-induced fibrotic changes in the lens epithelial cells. As expected, control peptides [PY without TAT (SEQ ID NO:78), or TAT without PY (SEQ ID NO:6)], each at 15 mg/ml, showed substantially less inhibition of TGF-b- induced aSMA expression.

The various features and processes described above may be used independently of one another, or may be combined in various ways. All possible combinations and

subcombinations are intended to fall within the scope of this disclosure. In addition, certain method or process blocks may be omitted in some implementations. The methods and processes described herein are also not limited to any particular sequence, and the blocks or states relating thereto can be performed in other sequences that are appropriate. For example, described blocks or states may be performed in an order other than that specifically disclosed, or multiple blocks or states may be combined in a single block or state. The example blocks or states may be performed in serial, in parallel, or in some other manner. Blocks or states may be added to or removed from the disclosed example embodiments. The example systems and components described herein may be configured differently than described. For example, elements may be added to, removed from, or rearranged compared to the disclosed example embodiments.

Conditional language used herein, such as, among others,“can,”“could,”“might,” “may,”“e.g.,” and the like, unless specifically stated otherwise, or otherwise understood within the context as used, is generally intended to convey that certain embodiments include, while other embodiments do not include, certain features, elements, and/or steps. Thus, such conditional language is not generally intended to imply that features, elements and/or steps are in any way required for one or more embodiments or that one or more

embodiments necessarily include logic for deciding, with or without author input or prompting, whether these features, elements and/or steps are included or are to be performed in any particular embodiment. The terms“comprising,”“including,”“having,” and the like are synonymous and are used inclusively, in an open-ended fashion, and do not exclude additional elements, features, acts, operations, and so forth. Also, the term“or” is used in its inclusive sense (and not in its exclusive sense) so that when used, for example, to connect a list of elements, the term“or” means one, some, or all of the elements in the list.

Whereas certain example embodiments have been described, these embodiments have been presented by way of example only, and are not intended to limit the scope of the inventions disclosed herein. Thus, nothing in the foregoing description is intended to imply that any particular feature, characteristic, step, module, or block is necessary or

indispensable. Indeed, the novel methods and systems described herein may be embodied in a variety of other forms; furthermore, various omissions, substitutions and changes in the form of the methods and systems described herein may be made without departing from the spirit of the inventions disclosed herein. The accompanying claims and their equivalents are intended to cover such forms or modifications as would fall within the scope and spirit of certain of the inventions disclosed herein.

Claims

What is claimed is:

1. A method of treating or reducing the incidence of a fibrotic disorder of the eye comprising administering a therapeutically effective amount of a Smad7 protein to a subject suffering from or at risk of developing a fibrotic disorder of the eye.

2. The method of claim 1 , wherein the fibrotic disorder of the eye is posterior capsule

opacification (PCO).

3. The method of claims 1 or 2, wherein the subject is a diabetic subject.

4. The method of any one of claims 1-3, wherein the subject is undergoing an eye surgery or has undergone an eye surgery within the last 10 days.

5. The method of any one of claims 1-4, wherein the eye surgery is cataract surgery.

6. The method of any one of claims 1-5, wherein the subject is a human subject.

7. The method of any one of claims 1-6, wherein the Smad7 protein is a derivative, variant, fragment, prodrug, or analog of the full length human Smad7 protein that retains one or more biological activities of Smad7.

8. The method of any one of claims 1-7, wherein the Smad7 protein is a fusion protein

comprising a Smad7 derivative, variant, fragment, prodrug, or analog of the full length human Smad7 protein covalently linked to a protein transduction domain (PTD).

9. The method of claim 8, wherein the PTD is a TAT protein or derivative thereof.

10. The method of claims 8 or 9, wherein the PTD is fused to the Smad7 protein by a

peptide linker.

11. The method of any one of claims 1-10, wherein the Smad 7 protein is comprises:

a) the full length human Smad7 amino acid sequence set forth in SEQ ID NO:1 , b) amino acids 259-426 of the amino acid sequence set forth in SEQ ID NO:1 , or c) amino acids 203-217 of the amino acid sequence set forth in SEQ ID NO:1 , wherein the Smad7 protein fragment maintains one or more biological activities of the Smad7 functional domain in a subject.

12. The method of any one of claims 1-10, wherein the Smad 7 protein comprises amino acids 203-426 of the amino acid sequence set forth in SEQ ID NO: 1 , wherein the Smad7 protein fragment maintains one or more biological activities of the Smad7 functional domain in a subject.

13. The method of claim 12, wherein the Smad 7 protein comprises or consists of an amino acid sequence set forth in any one of SEQ ID NOs: 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 80, 82, 84, 86, 88, 90, 91 , 94, 96, and 100.

14. The method of any one of claims 1-13, wherein the Smad7 protein is administered

topically to the eye of the subject.

15. The method of claim 14, wherein the Smad7 protein is administered during surgery to insert an intraocular lens.

16. Use of a Smad7 protein for the manufacture of a medicament for the treatment or

prevention of posterior capsule opacification.

17. The use of claim 16, wherein the fibrotic disorder of the eye is posterior capsule

opacification (PCO).

18. The use of claims 16 or 17, wherein the subject is a diabetic subject.

19. The use of any one of claims 16-18, wherein the subject is undergoing an eye surgery or has undergone an eye surgery within the last 10 days.

20. The use of claim 19, wherein the eye surgery is cataract surgery.

21. The use of any one of claims 16-20, wherein the subject is a human subject.

22. The use of any one of claims 16-21 , wherein the Smad7 protein is a derivative, variant, fragment, prodrug, or analog of the full length human Smad7 protein that retains one or more biological activities of Smad7.

23. The use of any one of claims 16-22, wherein the Smad7 protein is a fusion protein comprising a Smad7 derivative, variant, fragment, prodrug, or analog of the full length human Smad7 protein covalently linked to a protein transduction domain (PTD).

24. The use of claim 23, wherein the PTD is a TAT protein or derivative thereof.

25. The use of claims 23 or 24, wherein the PTD is fused to the Smad7 protein by a peptide linker.

26. The use of any one of claims 16-25, wherein the Smad 7 protein is comprises:

a) the full length human Smad7 amino acid sequence set forth in SEQ ID NO: 1 , or b) amino acids 259-426 of the amino acid sequence set forth in SEQ ID NO: 1 , c) amino acids 203-217 of the amino acid sequence set forth in SEQ ID NO:1 , wherein the Smad7 protein fragment maintains one or more biological activities of the Smad7 functional domain in a subject.

27. The use of any one of claims 16-25, wherein the Smad 7 protein comprises amino acids 203-426 of the amino acid sequence set forth in SEQ ID NO: 1 , wherein the Smad7 protein fragment maintains one or more biological activities of the Smad7 functional domain in a subject.

28. The use of claim 27, wherein the Smad 7 protein comprises or consists of an amino acid sequence set forth in any one of SEQ ID NOs: 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 80, 82, 84, 86, 88, 90, 91 , 94, 96, and 100.