WO2019124478A1 - Agent for the prevention and treatment for parkinson's disease - Google Patents

Abstract

Provided is a means for preventing or treating Parkinson's disease. Provided is an agent for the prevention or treatment of Parkinson's disease, containing, for example, dabrafenib or a salt thereof.

Description

Parkinson's disease preventive or therapeutic agent

The present invention relates to agents for preventing or treating Parkinson's disease and the like.

Parkinson's disease is a progressive neurodegenerative disease that presents with extrapyramidal symptoms that cause movement disorders such as hand tremors, movements and difficulty walking.

Parkinson's disease kills or does not function normally in neurons that produce dopamine in the substantia nigra compacta that controls muscle movement. However, the cause of nerve cell injury is unknown. Usually, individuals around the age of 60 suffer from Parkinson's disease, but may develop earlier. Although immobility is the main symptom of Parkinson's disease, it usually results in a gradual decline in motor function, accompanied by a decrease in exercise, a slowing of exercise performance and a loss of motor ability.

Patients with Parkinson's disease show a characteristic increase in muscle tone and eventually develop resting tremor. As the symptoms are amplified, Parkinson's patients have difficulty walking, talking or performing simple tasks.

Parkinson's disease patients may also present with depressive disorders, sleep disorders, as well as cognitive and autonomic disorders.

It is generally recognized that the symptoms of Parkinson's disease are only manifested after 50% of the dopaminergic neurons in the substantia nigra are destroyed. In addition to these 50% disrupted neurons, it is believed that 15% to 20% are silent, ie, morphologically intact but no longer produce dopamine or produce little dopamine.

Currently used drugs are mainly various forms of L-dopa and dopaminergic antagonists. Although these agents can alleviate the symptoms of Parkinson's disease, they can not stop the progression of the disease and even not regenerate the function of damaged neurons.
Also, these agents cause various peripheral side effects, in particular hypotension and nausea. More seriously, after 5 to 10 years of treatment, in contrast to the steady-state release of physiological dopamine, repeated administration of these molecules with a few daily intakes usually results in very intolerable fluctuations in motor symptoms There is the fact that (motor fluctuations) is triggered. Therefore, it should be kept in mind that these molecules only act symptomatic and do not slow down the degeneration process.

Humans, monkeys, mice, etc. administered with MPTP (1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine: 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine) These animals are known to cause the dropout of dopamine neurons seen in patients with Parkinson's disease, and are widely used for producing Parkinson's disease model animals. MPTP is a substrate for monoamine oxidase and is metabolized in the body to MPP ⁺ (1-methyl-4-phenylpyridinium ion), and MPP ⁺ is taken up by dopamine neurons by the dopamine uptake mechanism, resulting in neurotoxicity (eg, reduction of dopamine) And degeneration of neurons).

Therefore, it is considered that the possibility of preventing and treating Parkinson's disease will be opened if a means capable of preventing the withdrawal of dopamine neurons can be found despite the administration of MPTP or MPP ⁺ .

International Publication No. 2015/099094

An object of the present invention is to provide means for preventing or treating Parkinson's disease.

The present inventors have found that administration of dabrafenib can suppress neurotoxicity despite the administration of MPTP or MPP ⁺ , and further improvement has been made to complete the present invention.

The present invention includes, for example, the subject matters described in the following sections.
Item 1.
An agent for preventing or treating Parkinson's disease, which comprises dabrafenib or a salt thereof.
Item 2.
An agent for preventing or treating Parkinson's disease, which comprises dabrafenib mesylate.
Item 1a.
An agent for inhibiting neurodegeneration, which comprises a BRAF activator (preferably, dabrafenib, vemurafenib, encorafenib, or a salt thereof).
Item 2a.
The neurodegenerative inhibitor according to Item 1a, wherein the BRAF activator comprises dabrafenib or a salt thereof (particularly preferably dabrafenib mesylate salt).
Item 3a.
The neurodegenerative inhibitor according to Item 1a or 2a, wherein the agent for inhibiting neurodegeneration is a preventive or therapeutic agent for Parkinson's disease.
Item 1b.
An agent for inhibiting neurodegeneration, comprising an ERK activator (preferably, dabrafenib, vemurafenib, encorafenib, or a salt thereof).
Item 2b.
The neurodegenerative inhibitor according to item 1 b, wherein the ERK activator comprises dabrafenib or a salt thereof (particularly preferably dabrafenib mesylate salt).
Item 3b.
The neurodegenerative inhibitor according to Item 1b or 2b, wherein the agent for inhibiting neurodegeneration is a prophylactic or therapeutic agent for Parkinson's disease.

According to the present invention, diseases caused by neurodegeneration (particularly, Parkinson's disease) can be prevented or treated.

The result of having investigated the MPP ^<+> neurotoxicity inhibitory effect by a BRAF activator (specifically Dabrafenib) by LDH assay and MTS assay is shown. The result of having analyzed the expression of activated caspase-9 or caspase-3 by Western blotting, in order to investigate the MPP ⁺ neurotoxic inhibitory effect by a BRAF activator (specifically Dabrafenib) is shown. The administration schedule of the experiment which investigates whether the formation of a Parkinson's disease model mouse by MPTP administration is inhibited by intracerebroventricular administration of a BRAF activator (specifically, dabrafenib) is shown. Neurons positive for both TH (tyrosine hydroxylase) and rough endoplasmic reticulum (Nissl body) in the midbrain substantia nigra pars compacta in brain sections of mice administered with dabrafenib mesylate and MPTP according to the schedule in FIG. 3a The graph shows the result of counting the number of. The left side shows the brain slice observation image, and the right side shows the dopamine neuron count number. The expression level of phosphorylated ERK was anti-phosphorylated ERK for SH-SY5Y cells, SH-SY5Y cells in which the RIT2 gene was knocked out, and cells in which the RIT2 gene expression vector was integrated into the SH-SY5Y cells in which the RIT2 gene was knocked out The result analyzed by Western blotting using a specific antibody is shown. The expression level of phosphorylated ERK is anti-phosphorylated ERK-specific antibody for SH-SY5Y cells, SH-SY5Y cells in which RIT2 gene is knocked out, and cells in which dabrafenib is added to SH-SY5Y cells in which RIT2 gene is knocked out The result analyzed by Western blotting using is shown.

Hereinafter, each embodiment of the present invention will be described in more detail.
There are three types of paralogs in humans, A-RAF, B-RAF, and C-RAF, in RAF which is a serine / threonine protein kinase. RAS, a small GTP binding protein, activates RAF upon activation. The action of RAF sequentially activates the second protein kinase MEK and then the third protein kinase ERK (extracellular signal-regulated kinase).

The neurodegenerative inhibitors included in the present invention include BRAF activators that activate the function of B-RAF (v-raf murine sarcoma viral oncogene homolog B1) (hereinafter "BRAF").

Known BRAF activators can be used. For example, dabrafenib, vemurafenib, encolafenib, or salts thereof, and the like can be mentioned. The salt is not particularly limited, and pharmaceutically acceptable ones can be suitably selected and used preferably. As a salt, for example, hydrohalide such as hydrofluoric acid, hydrochloride, hydrobromide, hydroiodide, etc .; hydrochloride, nitrate, perchlorate, sulfate, phosphate Inorganic acid salts such as mesylate (methane sulfonate), lower alkane sulfonates such as trifluoromethane sulfonate, ethane sulfonate, etc .; aryl sulfonates such as benzene sulfonate, p-toluene sulfonate Salts; organic acid salts such as acetate, malate, fumarate, succinate, citrate, ascorbate, tartrate, oxalate, maleate and the like; sodium salts, potassium salts, lithium salts etc. Alkaline metal salts such as calcium salts and magnesium salts; metal salts such as aluminum salts and iron salts; inorganic salts such as ammonium salts; t-octylamine salts Dibenzylamine salt, morpholine salt, glucosamine salt, phenylglycine alkyl ester salt, ethylenediamine salt, N-methylglucamine salt, guanidine salt, diethylamine salt, triethylamine salt, dicyclohexylamine salt, N, N'-dibenzylethylenediamine salt, Amine salts such as organic salts such as chloroprocaine salt, procaine salt, diethanolamine salt, N-benzylphenethylamine salt, piperazine salt, tetramethylammonium salt, tris (hydroxymethyl) aminomethane salt; glycine salt, lysine salt, arginine salt, And ornithine salts, amino acid salts such as glutamate and aspartate, and the like.

Although there is no particular limitation, more preferable salts used as BRAF activators include, for example, dabrafenib mesylate.

By the way, these agents are used as BRAF inhibitors due to the ATP antagonistic RAF inhibitory effect. However, these agents work as BRAF inhibitors only for mutant BRAF having a mutation that BRAF expresses constitutively (especially BRAF V600E mutation), and for normal (wild-type) BRAF When used, BRAF is activated by dimerization of the RAF protein in a RAS GTPase-dependent manner and activation of the subunit to which the BRAF inhibitor is bound, the other subunit. That is, for normal BRAF, these agents act as BRAF activators.

The BRAF activators may be used alone or in combination of two or more. For example, it contains at least one compound selected from the group consisting of dabrafenib, vemurafenib, encorafenib, and salts thereof.

The activation of BRAF means that BRAF is phosphorylated, and the activation can be confirmed, for example, by analysis using a phosphorylated BRAF-specific antibody (for example, western blotting analysis).

The neurodegenerative inhibitors included in the present invention include ERK activators that activate the action of Extracellular Signal-regulated Kinase (ERK). ERK may be ERK1, ERK2, ERK1 / 2.

Known ERK activators can be used. For example, dabrafenib, vemurafenib, encolafenib, or salts thereof, and the like can be mentioned. The salt is not particularly limited, and pharmaceutically acceptable ones can be suitably selected and used preferably. Examples of the salt include those described above.

Although there is no particular limitation, more preferable salts used as ERK activators include, for example, dabrafenib mesylate.

By the way, as mentioned above, these agents act as BRAF activators for normal BRAF. As slightly mentioned above, in the MAP kinase cascade, activation of BRAF eventually activates ERK1 / 2. Thus, in general, substances that act as BRAF activators can be used as ERK activators.

The ERK activators may be used alone or in combination of two or more. For example, it contains at least one compound selected from the group consisting of dabrafenib, vemurafenib, encorafenib, and salts thereof.

That ERK is activated means that ERK is phosphorylated, and activation can be confirmed, for example, by analysis (for example, western blotting analysis) using a phosphorylated ERK-specific antibody.

The neurodegenerative inhibitor included in the present invention is prepared by diluting the active ingredient BRAF inhibitor or ERK activator with a pharmaceutically acceptable solvent such as water, physiological saline or buffer. It can be dissolved, dispersed, or the like to provide a pharmaceutical form for administration to a subject. The neurodegenerative inhibitor may be formulated in any dosage form. As the dosage form, for example, tablets, capsules, granules, fine granules, powders, sustained release formulations, solutions, suspensions, emulsions, syrups, oral preparations such as elixirs, injections, suppositories And other parenteral agents. In formulation, for example, pharmacologically such as excipients, binders, disintegrants, lubricants, buffers, stabilizers, flavoring agents, odorants, coloring agents, flavors, diluents, surfactants, etc. Acceptable additives can be used.

The concentration of the active ingredient (BRAF inhibitor or ERK activator) in the neurodegenerative inhibitor is not particularly limited as far as it can suppress neurodegeneration (particularly preferably, it can prevent or treat Parkinson's disease). It can set suitably according to conditions, such as a kind, a dosage form, an administration aspect. For example, it may be 90, 80, 70, 60, 50, 40, 30, 20, 10, or 5% (w / w) or less. For example, it may be 0.01, 0.1, or 1% (w / w) or more. When the active ingredient is a compound salt, the concentration is calculated by compound conversion.

By administering the neurodegenerative inhibitor of the present invention to a subject, it is possible to suppress neurodegeneration. Therefore, the neurodegenerative inhibitor of the present invention can be used as a medicine for the prevention and / or treatment of a disease caused by neurodegeneration (neurodegenerative disease). In addition, the present invention suppresses (prevents and / or treats neurodegenerative diseases) by administering the agent for suppressing the neurodegeneration of the present invention to a subject including a mammal such as human in need of treatment or prevention of neurodegenerative diseases. Also includes the method of Examples of neurodegenerative diseases include, for example, Parkinson's disease, amyotrophic lateral sclerosis and the like, and particularly preferably Parkinson's disease.

The dose of the neurodegenerative inhibitor of the present invention can be appropriately set according to various conditions such as the content of the active ingredient, usage, age, sex, degree of symptoms and the like. For example, it can be about 10 to 1000 mg / day. Also, it can be divided and administered once or multiple times (eg, 2 or 3 times) daily. The dose at each administration may be constant or may be different in terms of the dose of the active ingredient. The mode of administration is preferably, for example, oral administration or intravenous administration.

In the present specification, the term "comprising" also includes "consisting essentially of" and "consisting of" (The term "comprising" includes "consisting essentially of" and "consisting of.").

Hereinafter, the present invention will be described more specifically, but the present invention is not limited to the following examples. The sources of each reagent used in the study are as follows. As a mouse, C57BL / 6J mice were purchased from Charles River and used.

Dabraphenylb: Cayman Chemical Company (Ann Arbor, MI, USA) and Selleck Chemicals (Houston, TX, USA)
MPP ⁺ : Sigma-Aldrich (St. Louis, MO, USA).
・ Anti-activated caspase-3 antibody (# 9665, 1: 1,000), Anti-activated caspase-9 antibody (# 7237, 1: 1,000), Anti-ERK 1/2 antibody (# 4695, 1: 1) 1,000), anti-phospho-ERK 1/2 antibody (# 4370, 1: 2,000), and above Cell Signaling Technology (Beverly, MA, USA).
・ Anti-β-actin antibody (A1978, 1: 2,000) (Sigma-Aldrich)
Anti-tyrosine hydroxylase (TH) antibody (657012, 1: 5,000) Calbiochem (San Diego, CA, USA).

Examination of neurotoxic inhibitory effect (in vitro)
Seed human neuroblastoma cells SH-SY5Y cells in a 96-well plate and add BRAF activator (specifically, dabrafenib) (final concentration 0, 0.2, 1, or 5 μM), 24 After incubation for a time, MPP ⁺ (1-methyl-4-phenylpyridinium ion) was added to a final concentration of 3 mM. After culturing for another 24 hours, cell viability or cell damage was measured by LDH assay or MTS assay.

The number of cells seeded in one well was 2 × 10 ^4, and culture was performed at 37 ° C. and 5% CO ₂ concentration using FBS-free DMEM medium.

The LDH assay was performed using Cytotoxicity Detection kit (Roche Applied Science, Indianapolis, Ind., USA). The assay measures cytotoxicity by measuring lactate dehydrogenase (LDH) released from damaged cells. More specifically, released LDH oxidizes lactic acid to pyruvate, thereby reducing NAD ⁺ to NADH ⁺ / H ⁺ . The catalyst (Diaphorase) then transfers H / H ⁺ from NADH ⁺ / H ⁺ to a yellow tetrazolium salt, which is reduced to formazan with an absorption of 490 nm. Therefore, LDH activity can be examined by measuring the amount of absorbance at 490 nm.

The MTS assay was performed using Cell Titer 96 Aqueous One solution cell proliferation assay (Promega, Madison, WI, USA). In the assay, 3- (4,5-dimethylthiazol-2-yl) -5- (3-carboxymethoxyphenyl) -2- (4-sulfophenyl) -2H-tetrazolium, inner salt (MTS) is reduced by living cells. It is characterized in that it is converted to a colored formazan product soluble in the culture medium, and the formazan quantitative value at 490 nm reflects the number of living cells in the culture medium.

These results are shown in FIG. 1 graphically as relative values when the control (without the addition of dabrafenib mesylate and MPP ⁺ ) is 0% (LDH assay) or 100% (MTS assay). The LDH assay results are shown on the left of FIG. 1, and the MTS assay results are shown on the right of FIG. 1b. In the figure, ** indicates P <0.01.

In addition, expression of activated caspase-9 or caspase-3 was expressed by western blotting using anti-activated caspase-9 antibody and anti-activated caspase-3 antibody for SH-SY5Y cells cultured under the same conditions as above. It analyzed. Activated caspase-9 and caspase-3 are both apoptosis-related enzymes, and their increased expression reflects the increase in cells undergoing apoptosis. The results are shown in FIG. Fig. 2 shows the results of Western blotting analysis on the upper side, and the graph shows the intensity of the caspase-9 or caspase-3 band detected by this analysis as a ratio to the intensity of the detection band of β-actin in Fig. 2 on the lower side. Shown in. ** in the figure indicates P <0.01.

From these results, it was found that dabrafenib suppresses cytotoxicity by MPP ⁺ . And, it is strongly suggested that Dabrafenib is particularly effective for the prevention and treatment of Parkinson's disease, since MPP ⁺ causes dopamine neuron injury seen in patients with Parkinson's disease.

Examination of neurotoxic inhibitory effect (in vivo)
A BRAF activator (specifically, dabrafenib) or vehicle is administered to the cerebral ventricles of mice, and MPTP (1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine is administered daily for 2 days after that for 5 days 30 mg / kg of 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine) was administered. For administration to the ventricle, mice were anesthetized with pentobarbital sodium, and for administration, a 10 μL Hamilton syringe was used. Dabrafenib was administered at 150 μg / kg. In addition, 5% dimethyl sulfoxide and polyethylene glycol 300 were used as a vehicle.

Then, after rearing for 21 days, the mouse is fixed by perfusion with PBS (phosphate buffer solution) and 4% paraformaldehyde, the brain is taken out and immersed in 4% paraformaldehyde at 4 ° C. for 48 hours, 0.01% azide It was immersed in sodium-containing 30% sucrose / PBS for further 48 hours, and a 20 μm-thick brain section was prepared using a cryostat. The midbrain black ventricular compact area was immunostained using an anti-tyrosine hydroxylase (TH) antibody, and diaminobenzine (DAB) was used as a chromogenic substrate. The Nissl bodies were then stained bluish purple using cresyl violet. The neurons positive for both TH (tyrosine hydroxylase) and Nissl body (Nissyl body) present in the substantia nigra pars compacta were considered as dopamine neurons, and the number was counted.

The results are shown in FIG. The observation image of the brain section (immunostained: brown portion is dopamine neurons) is shown on the left side of FIG. 3, and the number of the neurons is shown on the right side of FIG. In the figure, ** indicates P <0.01. From the results, it was found that dabrafenib suppresses cell death by MPTP administration, and thus has an effect of inhibiting the creation of a Parkinson's disease model. This proves that dabrafenib is effective for the prevention and treatment of Parkinson's disease.

Examination of ERK activation The RIT2 (Ras like in CAAX 2) gene is a gene encoding the GTP binding protein Rit2, and it has been reported that the expression of the protein is reduced in the black chamber compact area of Parkinson's disease patient's brain (Koen Bossers, et. Al., Brain Pathology, 2009). The RIT2 gene in SH-SY5Y cells was knocked out by genome editing technology (Crisps / Cas9), and the degree of activation of ERK, that is, the degree of expression of phosphorylated ERK was examined.

RIT2 gene knockout was performed using Cas9 Smart Nuclease All-in-One vector (System Biosciences, Mountain View, CA, USA). PcDNA3.1 / myc-His A carrying the zeocin resistant gene (Invitrogen, Carlsbad, CA) with an All-in-One vector incorporating a CRISPR / Cas9 target sequence (GATTATCATGACCCTACTAT) for knockout of the RIT2 gene linked to the guide sequence SH-SY5Y cells were transfected using Lipofectamine 2000 (Thermo Fisher Scientific) with (20: 1 ratio) with (US, USA). RIT2 knockout cells were selected by Zeocin resistance screening, and the RIT2 gene sequence was sequenced to confirm knockout (c. 158_159delTA of exon 2).

The expression level of phosphorylated ERK was anti-phosphorylated ERK for SH-SY5Y cells, SH-SY5Y cells in which the RIT2 gene was knocked out, and cells in which the RIT2 gene expression vector was integrated into the SH-SY5Y cells in which the RIT2 gene was knocked out Analysis was performed by western blotting using a specific antibody. The results are shown in FIG. The western blotting image is shown on the upper side of FIG. 4, and the ratio of the intensity of the phosphorylated ERK band detected by Western blotting analysis to the intensity of the band of total ERK as a control is shown on the lower side of FIG. In the figure, * indicates P <0.05 and ** indicates P <0.01.

From the results, it was found that knockout of RIT2 gene suppresses activation of ERK, and expression of RIT2 results in activation of ERK.

Next, instead of cells in which the RIT2 gene expression vector was incorporated into SH-SY5Y cells in which the RIT2 gene was knocked out, cells in which Dabrafenib was applied (final concentration 5 μM) to SH-SY5Y cells in which the RIT2 gene was knocked out The same study as above was conducted. The results are shown in FIG. The western blotting image is shown on the upper side of FIG. 5, and the ratio of the density of the phosphorylated ERK band detected by Western blotting analysis to the density of the band of total ERK as a control is shown on the lower side of FIG. In the figure, * indicates P <0.05 and ** indicates P <0.01.

From the above results, it was confirmed that dabrafenib acts as an ERK activator in neuronal cells.

Claims (2)

1. An agent for preventing or treating Parkinson's disease, which comprises dabrafenib or a salt thereof.
2. An agent for preventing or treating Parkinson's disease, which comprises dabrafenib mesylate.

Images