WO2019117700A1

WO2019117700A1 - Process for the expression of recombinant proteins in microalgae using viral vectors

Info

Publication number: WO2019117700A1
Application number: PCT/MX2018/050030
Authority: WO
Inventors: Sergio ROSALES MENDOZA; Bernardo BAÑUELOS HERNANDEZ; Carlos Eliud ANGULO VALADEZ
Original assignee: Centro De Investigaciones Biologicas Del Noroeste, S.C.; Universidad Autonoma De San Luis Potosi
Priority date: 2017-12-15
Filing date: 2018-12-13
Publication date: 2019-06-20
Also published as: MX2018000828A

Abstract

The invention relates to a process for the expression of recombinant proteins, comprising the use of a viral DNA vector in order to induce expression and protocols in order to obtain transient expression in said microalgae. The process is characterised in that it comprises the use of Schizochytrium sp. strain ATCC 20888 and Chlamydomonas reinhardtii as expression hosts, and Agrobacterium tumefaciens GV3101 as a viral DNA delivery vector, by means of its inclusion in a binary vector. The invention also relates to the construction and use of a viral vector that includes the replication origin Ori of the geminivirus Ageratum enation virus (AgEV). The process of the invention is used to produce recombinant proteins of biopharmaceutical interest, including those from Zaire ebolavirus and Escherichia coli, which can be used to develop vaccines for use by living beings that need same and/or in bioprocesses in which they are required.

Description

PROCESS FOR THE EXPRESSION OF RECOMBINANT PROTEINS IN MICROALOGS THROUGH VIRAL VECTORS

TECHNICAL FIELD

The present invention relates to the technical field of Biotechnology, as it relates to a process for the expression of recombinant proteins, which comprises the use of a viral DNA vector to induce expression and protocols to achieve transient expression said microalgae The process is characterized by including the use of Schizochytrium sp. strain ATCC 20888 and Chlamydomonas reinhardtii as expression hosts, Agrobacterium tumefaciens GV3101 as vector for delivery of viral DNA by inclusion in a binary vector. It also includes the construction and use of a viral vector that includes the Ori origin of the geminivirus Ageratum enantion virus (AgEV). The process of the present invention is used for the production of recombinant proteins of biopharmaceutical interest useful in the preparation of vaccines for use in living beings that need them and / or in bioprocesses that require it. Among the recombinant proteins that can be obtained by the process of the present invention, those coming from Zaire ebolavirus and / or Escherichia coli stand out, as application examples, without limiting its application in other recombinant proteins useful in the industry.

BACKGROUND

The use of microalgae for the production of proteins of interest is gaining relevance in the field of biotechnology. Several functional vaccine antigens, antibodies and other therapeutic proteins; as well as enzymes for industrial use, have been produced in microalgae (Scranton 2015, Rosales-Mendoza 2016a). The highest yields, observed so far, were achieved in photosynthetic microalgae transformed in the chloroplast genome; with yields of up to 3 mg / L of culture (1, 86% of total soluble protein (TSP), Gimpel et al., 2015). Do not However, the development of transplastomic clones requires a laborious construction of species-specific vectors and the system is unable to carry out complex post-translational modifications (eg, glycosylation) or secrete the recombinant protein. In the case of nuclear expression, genetic engineering faces two challenges: the improvement of yields and the genetic stability of transformed clones (Rosales-Mendoza 2016b). In an effort to overcome these obstacles, in the state of the art, the mutagenesis induced by UV light has been used to generate strains of Chlamydomonas reinhardtii that present an improvement in the expression (with yields of up to 0.2% of TSP) (Neupert et al., 2009; Kurniasih et al., 2016). Strategies based on the secretion of the recombinant protein have also been applied to the culture medium, achieving yields of up to 10 mg of secreted protein per liter of culture (Lauersen et al., 2013).

Viral vectors have been widely applied in the expression of heterologous proteins in plants (Salazar-González et al., 2015, Dugdale et al., 2013; Chen, et al; 201 1; Lico et al., 2008; Gleba et al. ., 2007). For example, the Magnifection system described ten years ago became a powerful tool for the transient expression of recombinant proteins in higher plants (Gleba et al., 2013, Marillonnet et al., 2005). In the case of microalgae, some viral elements have been used to innovate approaches to genetic engineering. For example, the picornaviral 2A sequence has allowed the expression of policistrons (Rasala 2012) and the use of synthetic promoters has led to improved expression (Scranton 2016).

In addition to the aforementioned, references have been identified in the state of the art on various processes for the expression of recombinant proteins, such as documents TW201224145, WO2013182484, KR20130006178, US2014127254, US2015164965, MX / a / 2010/01 151 1 , US20130295607 and the MX304364.

TW201224145 integrates an expression vector that includes a protein expression cassette and at least two recombinant DNA homologous fragments flanking the protein expression cassette, which comprises a first marker of selection, promoters, a multiple cloning site adjacent to backflow of the promoter and a second selection marker, wherein the promoter comprises a 356S promoter of Cauliflower mosaic virus (CAMV). It contemplates a promoter of Ribulose bisphosphate carboxylase, an adenine methyltransferase (AMT) promoter, a nitrate reductase promoter or a combination thereof.

WO2013182484, refers to a method for the expression and secretion of a fully assembled and functional protein complex having medical or biotechnological utility in microalgae, wherein the protein complex is an antibody, an enzyme, hormone or vaccine and said complex it is secreted in a medium. The micro alga used is Phaeodactylum tricornutum.

Document KR20130006178 claims a method for preparing a target protein using a recombinant vector for transforming fungi, provided to express and obtain various proteins in fungi, especially Pleurotus eryngii. Constitution: A recombinant vector for transforming fungi comprising: CaMV 35S (cauliflower mosaic virus 35S) promoter; CaMV 35S 5'- untranslated sequence (UTS); CaMV 35S 3'-UTS; NOS (nopaline synthase) terminator; and a nucleotide sequence that encodes a target protein. The method for preparing the fungal target protein comprises: a step to transform a fungus conidium with a recombinant vector to transform the fungi; and a step to grow mushroom conidia and collect mushroom mycelia. The white protein is bovine growth hormone and the method further comprises the step of growing the mycelium.

US2014127254 claims a system for releasing a biologically active protein to a host animal comprising an algal cell transformed by an expression vector and the expression vector comprising a nucleotide sequence encoding the biologically active protein, operably linked to a promoter. The algae is suspended in water for immersion in the host animal, the release system is selected from hormones and antimicrobial peptides. The algae is mixed with a sample or food for the animal host The animal is selected from mammals, fish, birds and crustaceans. The protein is a peptide derived from bactericidal proteins, insecticidal proteins, growth hormones and antigens. The antigen delivery system comprises an algal cell transformed by an expression vector, and the expression vector comprises a nucleotide sequence encoding a determinant antigen and the expression vector further comprises a promoter operably linked to the nucleotide sequence encoding for the determinant antigen. The algal cell expresses the determinant antigen in an area selected from the group consisting of nucleus, chloroplast, mitochondria, periplasmic space, cell membrane or cell wall. The algal cell is Chlamydomonas reinhardtii.

US2015164965, for its part, claims a transgenic eukaryotic microalgae comprising an expression cassette comprising at least one transcriptable polynucleotide encoding an exogenous biologically active protein expressed within a subcellular compartment of the microalgae cell. The compartment is selected from cellular vacuole, endoplasmic reticulum, Golgi system, Lisosome and peroxisome. The cassette further comprises a polynucleotide which encodes a peptide directed to vacuoles, which improves the consumption of the exogenous protein expressed by a xenogenetic cell or tissue. The microalga used is of marine origin and is selected from: Phaeodactylum tricornutum, Dunaliella spp.,

Nannochloropsis spp., Nannochloris spp., Tetraselmis spp., Isochrysis galbana; Pavlova spp .; Amphiprora hyaline; Chaetoceros muellerr, and Neochloris oleoabundans.

The document MX201001 151 1, claims a method for generating genotypic variation in a genome of a plant, the method characterized in that it comprises introducing into the plant at least one viral expression vector encoding at least one chimeric nuclease comprising a DNA domain. DNA binding, a nuclease and a localization signal to an organelle containing DNA, where the DNA binding domain mediates the specific nuclease direction to the plant genome, in order to generate genotypic variation in the genome of plant. The method for treating a plant infection by a pathogen, the method characterized in that it comprises introducing into the plant at least one viral expression vector encoding at least one chimeric nuclease comprising a DNA binding domain and a nuclease, in where the DNA binding domain mediates the nuclease's address to the pathogen's genome, in order to prevent or treat an infection of the plant by a pathogen. It also claims a plant viral expression vector, comprising a nucleic acid sequence encoding at least one chimeric nuclease comprising a DNA binding domain, a nuclease and a location signal to an organelle containing DNA. An expression vector based on pTRV, comprising a nucleic acid sequence encoding at least two heterologous polypeptide sequences. A transgenic plant, characterized in that it comprises the aforementioned plant viral expression vector, the generation of genotypic variation is transient. The viral expression vector comprises a Tobacco Rattle virus (TRV) expression vector.

US20130295607, claims a method of producing a protein, comprising: cultivating a recombinant microorganism of the order Thraustochytrols in a medium, comprising a molecule isolated from nucleic acid and a gene that encodes the protein to produce the protein and the recovery of the protein. The microorganism is of the selected species of the group: Schizochytrium sp., Schizochytrium aggregatum, Schizochytrium iimacinum, Schizochytrium minutum, Thraustochytrium sp., Thraustochytrium striatum, Thraustochytrium aureum, Thraustochytrium roseum, and Japonochytrium sp.

The document MX304364 claims a process to produce one or more proteins of interest, characterized in that it comprises

a) Provide a plant or plant cell comprising:

i. In a nuclear chromosome a first heterologous nucleotide sequence comprising: a nucleotide sequence encoding an RNA replicon, and a first inducible promoter operably linked to the nucleotide sequence which encodes said RNA replicon; the RNA does not code for a protein that provides cell-to-cell movement of the RNA replicon in the plant; the RNA replicon codes for a polymerase to replicate the RNA replicon and the one or more of a protein of interest; Y

ii. A second heterologous nucleotide sequence comprising a sequence encoding a protein that enables cell-to-cell movement of the RNA replicon, wherein the second heterologous nucleotide sequence comprises a second inducible promoter operably linked to the sequence encoding the protein that enables the cell to cell movement of the DNA replicon; and

a) Inducing, in the plant or plant cell of step (a), the first and second inducible promoters thereby producing one or more of a protein of interest in the plant or in the cell of the plant, respectively.

The RNA replicon is derived from a positive strand single-stranded RNA virus, belonging to the tobacco mosaic virus or the potato X virus.

As can be seen, in none of the aforementioned documents, a method for expression of recombinant proteins in microalgae through viral vectors with the characteristics of the present invention is described, evidenced or suggested. That is why, it was determined that the use of viral vectors has not been explored in microalgae biotechnology until now. In this sense, the expression of recombinant proteins using a viral vector in microalgae is shown in the present invention, with a performance above that described in the state of the art, which is presented as an improved option for the production of recombinant proteins. Although microalgae have been used to produce recombinant proteins in different species and with different genetic elements, the use of expression vectors based on viral replicons is something new in the referred state of the art. BRIEF DESCRIPTION OF THE FIGURES

Figure 1 . It shows the map of the viral vector of the present invention (pAlgevir).

Figure 2. Shows the detection of replicons by inverse PCR.

Figure 3. Shows the immunodetection by means of Western blot of the recombinant proteins GP1 (A) and LTB (B) produced in Shizochrytrium sp.

Figure 4. Shows yields of the recombinant proteins produced in Shizochrytrium sp. with the process of the present invention (Algevir).

Figure 5. Restriction profile of the Algevir vector.

DETAILED DESCRIPTION OF THE INVENTION

The present invention relates to a process for the expression of recombinant proteins in microalgae through viral DNA vectors, to induce the expression that is delivered through Agrobaterium tumefaciens; as well as protocols to achieve transient expression in microalgae.

The invention comprises the use of viral vectors that, through an efficient transient transformation, lead to an accumulation of the recombinant protein at high levels (up to 1.25 mg / g in fresh weight), at the same time, the expression process is inducible by ethanol , which allows to phase out the moment of transformation with that of the beginning of the expression. The process has been validated both in photosynthetic freshwater microalgae and in non-photosynthetic marine microalgae.

The process for the expression of recombinant proteins of the present invention in microalgae, comprises the use of:

i) At least one photosynthetic freshwater microalgae and / or a non-photosynthetic marine microalgae as an expression host. As a preferred use, it is selected from the species: Schizochytrium sp. and / or Chlamydomonas reinhardtir, ii) The use of Agrobacterium tumefaciens as a vector for the delivery of viral DNA through its inclusion in a binary vector; iii) At least one recombinant protein (z) of biopharmaceutical interest related to a disease that affects a living being, or in bioprocesses that require it, as a molecule of interest, such as antigens for the preparation of vaccines, hormones or enzymes .

As well as the construction and use of a viral vector, referred to in the subsequent pAlgevir, referred to and illustrated in Figure 1, which has a physical map that includes, in order of mention, the genetic elements:

(1) A 35S Promoter of the Cauliflower Mosaic Virus (VMC),

(2) An AlcR gene from Aspergillus nidulans.

(3) A Terminator of the Nopalina Sintasa (nos ter)

(4) An "Ori" origin of replication of the geminivirus Ageratum enation virus (AgEV)

(5) An AlcA promoter from Aspergillus nidulans with Smal (5 ^' ) restriction sites and

BamHI and Pstl (3 ^' ) in which a gene of interest can be introduced,

(6) A 35S Terminator,

(7) An Ori origin of replication (repeated), an AlcA promoter, and an AgEV Rep protein gene; and a Terminator Nos,

The elements of (1) to (7) are included in the context of the binary vector pB1121 which allows the transfer of the expression cassettes by Agrobacterium tumefaciens.

The process for the expression of recombinant proteins in microalgae through viral vectors of the present invention, comprising the steps of: a) Construct the vector of Figure 1, which has as a base structure a functional binary vector in Agrobacterium tumefaciens; b) Transiently transform a microalga host expression by inoculating Agrobacterium tumefaciens, in a medium supplemented with 100 pM Acetosyringone and a subsequent addition of 250 mg / L cefotaxime. It is suggested, but not limited to the use of Chlamydomonas reinhardtii and / or Schizochytrium sp., Indistinctly); c) Express the gene of interest (may be GP1, from Zaire ebolavirus or LTB from E. coli, or a recombinant protein (z) in which antigens may be included for the preparation of vaccines, hormones or enzymes, (to cite some examples) in the transiently transformed microalga of step b) by the addition of a solution of an alcohol. The use of absolute ethanol is preferred, or in a 1% aqueous solution; and, d) Obtain the recombinant protein of interest that is efficiently expressed thanks to the location of the coding gene (it may be of viral or bacterial origin, for example, of Zaire ebolavirus or of Escherichia coli), between the Ori elements of the vector of the Figure 1, and by generating and replicating circular DNA molecules that contain the expression cassette for the gene of interest of vector iv).

The strain Schizochytrium sp. refers to strain ATCC 20888, Chlamydomonas reinhardtii refers to the strain available at: http://www.chlamycollection.org/product/cc-125-wild-type-mt-137c, and with respect to Agrobacterium tumefaciens refers to strain GV3101 available for consultation at: http://www.mpipz.mpg.de/koncz/publications. The process for the expression of recombinant proteins in microalgae through viral vectors of the present invention shows an expression yield of recombinant proteins of interest of at least 1.25 mg / g in fresh weight in some embodiments, however , yields of at least 0.12 mg / g in fresh weight can be obtained, depending on the nature and / or origin of the recombinant protein to be obtained.

In the following, an embodiment of the present invention is shown, where to illustrate the efficiency of the process, two model antigens related to viral diseases (Zaire ebolavirus glycoprotein, GP1) and bacterial (the B subunit of the thermolabile enterotoxin of Escherichia coli, LTB) relevant in vaccination.

The expression process of the present invention is functional and leads to the efficient expression of recombinant proteins.

What is illustrated below is in no way considered as limiting the application of the present invention.

Example 1 :

1. Design of the pAlgevir vector

An inducible vector was designed using the following elements in the following order (See Figure 1):

(1) 35S promoter of cauliflower mosaic virus,

(2) The AlcR gene

(3) Terminator of nopaline synthase (nos),

(4) The "Orí" origin of replication of the geminivirus Ageratum enation virus (AgEV). (5) AlcA promoter from Aspergillus nidulans with restriction sites Smal (5 ^' ) and BamHI and Pstl (3 ^' ) in which the gene of interest can be introduced.

(6) Terminator 35S

(7) Orí (repeated), Promoter AlcA, and Rep protein ORF of AgEV;

(8) Terminator nos.

This DNA cassette was synthesized by GenScript Inc. (New Jersey, USA) and subcloned into the binary vector pBI121 at the Xbal-Sacl sites through standard digestion-ligation procedures.

A positive clone identified by the restriction profile was used and sequencing was subsequently performed to confirm the integrity of the sequence. The construction was subsequently transferred to Agrobacterium tumefaciens (strain GV3101) by electroporation (Cangelosi et al., 1991). A clone carrying the expression vector was confirmed by polymerase chain reaction (PCR) and subsequently cultured overnight in Luria Bertani medium at 25 ° C and 200 rpm to perform expression assays.

2. Transient transformation of the microalgae

The marine microalga Schizochytrium sp. strain 20888 was obtained from ATCC (USA), cultured at 25 ° C in modified seawater medium (5 g / L of peptone, 1 g / L of yeast extract, 0.2 g / L of FeS04, g / L of agar and 35 g / L of NaCl). For liquid cultures, the 679BY medium (1 g / L of yeast extract, 1 g / L of peptone, 5 g / L of dextrose and 35 g / L of NaCl) was used. The freshwater microalgae Chlamydomonas reinhardtii was cultured in 100 ml of the TAP medium (tris-acetate-phosphates), at 25 ° C with 150 rpm stirring.

The transformation was carried out by inoculating Schizochytrium sp. (100 ml, Optical density (OD) 650nm = 0.7) or Chlamydomonas reinhardtii (100ml, OD 600595 nm = 0.7) with 1 mL of Agrobacterium tumefaciens culture (OD660 nm = 1.0). The medium is supplemented with 100 mM acetosyringone. Cefotaxime was added 16 h after the inoculation to a final concentration of 250 mg / L. The expression of the gene of interest in the transiently transformed microalgae was induced 20 h after inoculation by the addition of 1 mL of absolute ethanol (1% of the final concentration). Culture samples were collected before induction and 12, 24 and 48 h after induction. Samples were stored at -80 ° C until later use.

Inverse PCR

Circular DNA replicons were detected by inverse PCR using the following sets of primers:

For GP1, forward SEQ ID NO: 1 5 ^' CATCACCAAGATACCGGAGAAG and reverse (SEQ ID NO: 2) 5TTTAGTTTCCCAGAAGGCCC 3 ^' ; For LTB, forward (SEQ ID NO: 3) 5 ^' CATTTCCCTCTTTCCAGCCA and reverse (SEQ ID NO: 4) 5TTATGGAGAAACTCGAGCTTGT 3 ^' . The total DNA was isolated from cultures of Schizochytrium sp. According to Dellaporta et al. (1983). The PCR reaction mixtures (25pL) contained 1 ^c PCR buffer, 100 ng DNA, 1.5 mM magnesium chloride, 2.5 U Taq DNA polymerase, 1 mM dNTPs, and 1 pM of the corresponding set of primers. Cyclic conditions were: 94 ° C for 5 min (initial denaturation); 35 cycles at 94 ° C for 30 s, 55 ° C for 30 s, 72 ° C for 120 s, and a final extension at 72 ° C for 10 min. The PCR products were detected by electrophoresis in 1% agarose gels. The negative control consisted of 100 ng of culture DNA of Schizochytrium sp. Protein analysis

The integrity of the proteins obtained from Schizochytrium were evaluated by Western blot analysis. The cultures for sample were collected in different induction times (0, 12, 24, and 48 h), and the protein extracts were obtained as follows: 20 mg of fresh biomass was resuspended in 200 pL of an extraction buffer (750 mM Tris-Hydrochloric acid, pH 8, 15% sucrose, 100 mM b-mercaptoethanol, and 1 mM PMSF) and sonicated (4 pulses of 4 s with 4 s of delay each other) using an ultrasonic processor equipment with 24% amplitude (model GEX130PB).

Samples:

The samples were subsequently centrifuged at 8000 rpm for 15 min and the supernatants were transferred to new microtubes. The total concentration of soluble proteins was determined in the extracts by Lowry method and a volume corresponding to 80 pg of TSP (approximately 100 pL) was mixed with the same volume of 2x reducing buffer, and denatured by boiling for 5 min at 95 ° C , and subsequently subject to SDS-PAGE analysis. The gels were used to transfer the proteins to Bio-Rad nitrocellulose membranes of 0.45 L m (http://www.bio-rad.com). Protein transfer was performed using a TV100-EBK Electroblotter (AlphaMetrix Biotech, GER) for 1 h at 150 V in a methanol-based buffer. After blocking with 5% of fat-free milk (Carnation, Nestle) dissolved in PBS-0.1% Tween, the membranes were incubated with anti-mouse serum (1: 200 dilution) against both, LTB or GP1; which were produced in mice as previously described (Orellana-Escobedo et al., 2015). The membranes were washed and incubated with a secondary mouse anti-IgG antibody conjugated with goat radish peroxidase (1: 2,000 Sigma dilution) for 2 h at room temperature. Antigen detection was revealed by incubation of the membranes with SuperSignal West Dura solution, following the supplier's instructions (Thermo Scientific, http://www.thermoscientific.com) and exposing the film to standard procedures. The purified proteins LTB and GP1 (250 ng) produced in recombinant E. coli were used as positive controls.

For the ELISA quantification, a described protocol was applied (Ríos-Huerta et al., 2017). Briefly, the protein extracts were obtained as described below and diluted with 0.2 M carbonate buffer (pH = 9.6). The diluted mixture was added to an ELISA plate for protein adsorption at 4 ° C. After blocking with 5% solution of fat-free dry milk for 2 h at room temperature, the plates were incubated with mouse anti-LTB serum (1: 500 dilution) or anti-GP1 (1: 1000 dilution) overnight at 4 ° C. The plates were subsequently incubated with anti-mouse IgG conjugated with horseradish peroxidase (1: 2000 dilution) for 2 h at 25 ° C. A colorimetric reaction was induced by addition of ABTS substrate solution (0.6 mM ^{2,2'-azino-bis} (3-ethyl-6-sulfonic acid), 0.1 M citric acid, pH = 4.35, and 1 mM Peroxide), then After 30 min of incubation at 25 ° C, OD values were measured at 405 nm. Standard curves were constructed using pure LTB or GP1 to estimate expression levels.

Results:

1) The vector pAlgevir is delivered by Agrobacterium and replicated in microalgae.

Gene synthesis and molecular cloning techniques allowed the construction of the vector pAlgevir, whose physical map is shown in Figure 1, the restriction profile is shown in Figure 5 and the sequence expressed by the expression cassettes SEQ ID NO: 5 . The AlcR gene of Aspergillus nidulans is under the control of the 35s promoter of Cauliflower mosaic virus and the nos terminator, while the Rep protein is under control of the AlcA inducible promoter of Aspergillus nidulans and the nos terminator. The GP1 genes of Zaire ebolavirus or LTB of E. coli were expressed, inserted in the Sma I site at the 5 'end and any of the Bam Hl or Pst I sites at the 3' end, whose expression is under the control of the AlcA inducible promoter. After the induction of ethanol, the transcription factor AlcR is activated leading to the expression of the gene of interest and the Rep protein. The latter acts on the Ori elements and through the generation and replication of circular DNA molecules that carry the cassette. expression for the recombinant protein. (See figure 5).

2) Algevir allows the efficient expression of viral and bacterial antigens.

Expression studies were conducted to evaluate the efficiency of the Algevir process. The cultures of Schizochytrium sp. they were inoculated with recombinant agrobacteria and induced with ethanol 20 h after inoculation, with the subsequent analysis to determine the replication of the vector and the yields of the recombinant protein at different times after induction. First, the presence of DNA replicons was investigated through inverse PCR analysis to test the expression of functional Rep that leads to replication of the expression cassette. In this approach, the PCR oligonucleotides that line the flanks of the expression cassette in a divergent position allow the specific amplification of circular molecules that are generated by rolling circle replication. Transformed and induced cultures of Schizochytrium sp. showed a positive result at all post-induction experimental times, indicating that the pAlgevir vector mediates the generation of replicons by replication of the rolling circle (Figure 2).

Figure 2 shows the detection of replicons by inverse PCR in DNA samples of Schizochrytrium sp. Transiently transformed with the vectors pAlgevir-GP1 (A) and pAlgevir-LTB (B); using oligonucleotides to detect circular replicons generated by the Rep protein. The lanes show the following: M, 1 Kb molecular weight marker (New England, biolabs); 1-5, Schizochrytrium DNA samples sp. transiently transformed with A. tumefaciens carrying the vector pAlgevir, taken at 0, 12, 24, 48 and 72 h post-induction, respectively; 6: DNA sample from Schizochrytrium sp. untransformed (WT); 7, negative control (water). The amplicons expected for the detection of the GP1 and LTB replicons are 1800 and 918 bp in length, respectively.

Amplification was also detected in the pre-induction phase, which suggested a basal transcription of the Rep protein. In terms of production of recombinant proteins, Schizochytrium sp. showed a minimum level of recombinant protein in the pre-induction phase. Subsequently, the levels of recombinant protein increased dramatically after induction with ethanol, reaching the highest levels 48 h after induction (Figure 3). Figure 3 shows the immunodetection by means of Western blot of the recombinant proteins GP1 (A) and LTB (B) produced in Schizochrytrium sp .; as well as the GP1 protein in Chlamydomonas reinhardtii (C), through the Algevir system. Positive controls consisted of 250 ng of GP1 or LTB.

According to the results of ELISA, the recombinant protein is produced 48 h after induction and reached values of up to 1.25 mg / g of fresh weight (FW) for GP1 (6 mg / L of culture) and 0.12 mg / g FW (0.6 mg / L culture) for LTB (Figure 4). Figure 4 shows the yields of the recombinant proteins produced in Schizochrytrium sp. with the process of the present invention (Algevir). A quantitative enzyme-linked immunosorbent assay (ELISA) was performed to determine the accumulation levels of Schizochrytrium sp proteins. at 48 h postinduction. Pure proteins were used to construct standard curves for GP1 (A) and LTB (B). Accumulation levels are expressed in milligrams of recombinant protein per gram of fresh microalgae biomass or milligrams of recombinant protein per liter of microalgae culture (C). The values presented are the mean of the triplicates ± standard deviation. (See. Figure 4). The quantitative ELISA analysis confirmed that 48 h after induction was the time point with maximum yields for the species Schizochytrium sp., Whereas in the microalga Chlamydomonas reinhardtii the highest concentration was obtained 24 hours after induction. In shorter or extended post-induction times they showed significantly lower protein yields. In the case of Chlamydomonas, the estimated yields for protein GP1 were up to 0.125 mg / g of fresh weight.

BIBLIOGRAPHY

one . Bayne, A.C., Boltz, D., Owen, C., Betz, Y., Maia, G., Azadi, P., Archer-Hartmann, S., Zirkle, R., and Lippmeier, J.C. (2013). Vaccination against influenza with recombinant hemagglutinin expressed by Schizochytrium sp. confers protective immunity. PLoS One 8 (4): e61790.

2. Bragaglio, A., Braghieri, A., Napolitano, F., De Rosa, G., Riviezzi, A.M., Surianello, F., Pacelli C. (2015). Omega-3 Supplementation, Milk Quality and Cow Immune-Competence. Italian J Agronomy 10, 9-14.

3. Cangelosi, G.A., Best, E.A., Martinetti, G., Nester, E.W. (1991). Genetic analysis of Agrobacterium. Methods Enzymol. 204, 384-97.

4. Chen, Q., He, J., Phoolcharoen, W., Mason, H.S. (201 1). Geminiviral vectors based on bean yellow dwarf virus for production of vaccine antigens and monoclonal antibodies in plants. Human vaccines 7 (3), 331 -338.

5. Dellaporta, S.L., Wood, J., Hicks, J.B. (1983). A plant DNA minipreparation: Version II. Plant Mol. Biol. Rep. 1, 19-21. In review

6. Dugdale, B., Mortimer, C.L., Kato, M., James, T.A., Harding, R.M., and Dale, J.L. (2013). In plant activation: an inducible, hyperexpression platform for recombinant protein production in plants. Plant Cell 25 (7), 2429-2443.

7. Gimpel, JA, Hyun, JS, Schoepp, NG, Mayfield, SP (2015). Production of recombinant proteins in microalgae at pilot greenhouse scale. Biotechnol. Bioeng. 1 12 (2), 339-345. 8. Gleba, Y., Klimyuk, V., Marillonnet, S. (2005). Magnifection- a new platform for expressing recombinant vaccines in plañís. Vaccine 23 (17), 2042-2048.

9. Gleba, Y., Klimyuk, V., Marillonnet, S. (2007). Viral vectors for the expression of proteins in plañís. Curr. Opin. Biotechnol. 18 (2), 134-141.

10. Gleba, Y., Tusé, D., Giritch, A. (2013). Plant viral vectors for delivery by Agrobacterium. In Plant Viral Vectors (pp. 155-192). Springer Berlin Heidelberg.

11. Kurniasih, S.D., Yamasaki, T., Kong, F., Okada, S., Widyaningrum, D., Ohama, T. (2016). UV-mediated Chlamydomonas mutants with nuclear enhanced transgene expression by disruption of DNA methylation-dependent and independent † silencing Systems. Plant Mol. Biol. 92 (6), 629-641.

12. Lauersen, K.J., Berger, H., Mussgnug, J.H., Kruse, O. (2013). Efficient recombinant protein production and secretion from nuclear transgenes in Chlamydomonas reinhardtii. J. Biotechnol. 167 (2), 101-110. Lico, C.,

13. Chen, Q., Santi, L. (2008). Viral vectors for production of recombinant proteins in plañís. J. Cell Physiol. 216 (2), 366-377.

14. Marillonnet, S., Thoeringer, C., Kandzia, R., Klimyuk, V., Gleba, Y. (2005). Systemic Agrobacterium tumefaciens-mediated transfection of viral replicons for efficient transient expression in plañís. Nat. Biotechnol. 23 (6), 718-723.

15. Neupert, J., Karcher, D., Bock, R. (2009). Generation of Chlamydomonas strains that express express nuclear transgenes. Plant J. 57 (6): 1140-1150. 16. Orellana-Escobedo, L, Rosales-Mendoza, S., Romero-Maldonado, A., Parsons, J., Decker, EL, Monreal-Escalante, E., Moreno-Fierros, L., Reski, R. ( 2015). An Env-derived multi In review epitope HIV chimeric protein produced in the moss Physcomitrella patens is immunogenic in mice. Plant Cell Rep. 34 (3), 425-433.

17. Qu, L, Ren, L.J., Li, J., Sun, G.N., Sun, L.N., Ji, X.J., Nie, Z.K., Huang, H. (2013). Biomass composition, lipid characterization, and metabolic profile analysis of the fed-batch fermentation process of two different docosahexanoic acid producing Schizochytrium sp. strains. Appl. Biochem. Biotechnol. 171 (7): 1865-1876.

18. Ramos-Martinez, E.M., Fimognari, L, Sakuragi, Y. (2017). High yield secretion of recombinant proteins from the microalga Chlamydomonas reinhardtii. Plant Biotechnol. J. doi: 10.11 11 / pbi.12710.

19. Rasala, B.A., Lee, P.A., Shen, Z., Briggs, S.P., Mendez, M., Mayfield, S.P. (2012). Robust expression and secretion of Xylanasel in Chlamydomonas reinhardtii by fusion to a selection gene and Processing with the FMDV 2A peptide. PLoS One 2012; 7 (8): e43349.

20. Rivers-Huerta R, Monreal-Escalante E, Govea-Alonso DO, Angulo C, Rosales-Mendoza S. (2017). Expression of an immunogenic LTB-based chimeric protein targeting Zaire ebolavirus epitopes from GP1 in plant cells. Plant Cell Rep. 36 (2), 355-365.

21. Rosales-Mendoza, S. (2016a). Perspectives for the algae-made biopharmaceuticals field. In: Algae-based biopharmaceuticals. Springer. 143-158 pp.

22. Rosales-Mendoza, S. (2016b) Genetic Engineering Approaches for Algae. In: Algae-Based. Biopharmaceuticals. Springer. 23. Salazar-González, JA, Bañuelos-Hernández, B., Rosales-Mendoza, S. (2015). Status of viral expression Systems in plants and perspectives for oral vaccines development. Plant Mol. Biol. 87 (3), 203-217.

24. Scranton, M.A., Ostrand, J.T., Fields, F.J., Mayfield, S.P. (2015). Chlamydomonas as a model for biofuels and bio-products production. Plant J. 82 (3), 523-31. 25. Scranton, M.A., Ostrand, J.T., Georgianna, D.R., Lofgren, S.M., Li, D., Bilis,

R.C., Carruthers, D.N., Dráger, A., Masica, D.L., Mayfield, S.P. (2016). Synthetic promoters capable of driving robust nuclear gene expression in the green alga Chlamydomonas reinhardtii. Algal Res. 15, 135-142. In review 26. Song, X., Zang, X., Zhang, X. (2015). Production of high docosahexaenoic acid by Schizochytrium sp. using low-cost raw materials from food industry. J. Oil. Sci. 64 (2), 197-204.

27. Sridhar, S. (2015). Clinical development of Ebola vaccines. Ther. Adv. Vaccines 3 (5-6), 125-138.

28. Zhang, W., Sack, D.A. (2015). Current Progress in Developing Subunit Vaccines against Enterotoxigenic Escherichia coli-Associated Diarrhea. Clin. Vaccine Immunol. 22 (9), 983-991.

Claims

one . A process for the expression of recombinant proteins in microalgae, characterized in that it comprises:

i) At least one photosynthetic freshwater microalgae and / or a non-photosynthetic marine microalgae as an expression host;

ii) At least one vector bacterium for the delivery of viral DNA by its inclusion in a binary vector;

iii) At least one recombinant protein (z) of biopharmaceutical interest related to a disease that affects a living being, and / or a bioprocess that requires it, as a molecule of interest; Y

iv) A viral vector comprising, in order of mention, the genetic elements: A 35S promoter of the Cauliflower mosaic virus (1), an AlcR gene of Aspergillus nidulans. (2), a terminator of nopaline synthase (nos ter) (3), the "Ori" origin of the geminivirus Ageratum enation virus (AgEV) (4), an AlcA promoter from Aspergillus nidulans with Smal restriction sites (5) ^' ) and BamHI and Pstl (3 ^' ) in which a gene of interest (5), a 35S Terminator (6), an Ori origin of replication (repeated), AlcA Promoter, and the Rep protein gene can be introduced. of AgEV (7), and a terminator Nos ter.

2. The process for the expression of recombinant proteins in microalgae of claim 1, characterized in that the microalga used as host for expression i) is preferably selected from: Schizochytrium sp., Chlamydomonas reinhardtii.

3. The process for the expression of recombinant proteins in microalgae of claim 1, characterized in that the vector bacterium for the delivery of viral DNA is Agrobacterium tumefaciens.

4. The process for the expression of recombinant proteins in microalgae of claim 1, characterized in that the recombinant protein (z) of interest iii) is selected from: antigens and / or hormones and / or enzymes.

5. The process for the expression of recombinant proteins in microalgae of claim 1, characterized in that the recombinant protein (z) of interest iii) is selected from: Zaire ebolavirus glycoprotein 1 (GP1) and / or the B subunit of the enterotoxin thermolabile of Escherichia coli (LTB).

6. The process for the expression of recombinant proteins in microalgae of claim 1, characterized in that the viral vector iv) has as a base structure a functional binary vector in Agrobacterium tumefaciens.

7. The process for the expression of recombinant proteins in microalgae of claims 1 to 6, characterized in that it comprises the steps:

a) Construct the vector iv);

b) Transiently transform a microalga host expression by inoculating Agrobacterium tumefaciens, in a medium supplemented with Acetosyringone and Cefotaxime;

c) Expressing the gene of interest in the transiently transformed microalga of step b) by adding a solution of an alcohol; Y,

d) Obtaining the recombinant protein of interest by introducing the protein of interest, on the Ori elements of vector iv), and by generating and replicating circular DNA molecules carrying the vector expression cassette iv).

8. The process for the expression of recombinant proteins in microalgae of claim 7, characterized in that the alga transiently transformed and used in step b) is selected from: Chlamydomonas reinhardtii and / or Schizochytrium sp.

9. The process for the expression of recombinant proteins in microalgae of claim 7, characterized in that the gene of interest in the transiently transformed microalga of step c) is selected from: antigens and / or hormones and / or enzymes.

10. The process for the expression of recombinant proteins in microalgae of claim 9, characterized in that the gene of interest in the transiently transformed microalga of step c) is selected from: Zaire ebolavirus and / or Escherichia coli.

eleven . The process for the expression of recombinant proteins in microalgae of claim 7, characterized in that the alcohol solution of step c) is in absolute degree, and / or in 1% solution.

12. The process for the expression of recombinant proteins in microalgae of claim 1, characterized in that the alcohol is ethanol.

13. The process for the expression of recombinant proteins in microalgae of claim 7, characterized in that the recombinant protein of interest d) is of biopharmaceutical interest related to a disease that affects a living being, and / or a bioprocess that requires it as molecule of interest.

14. The process for the expression of recombinant proteins in microalgae of claim 13, characterized in that the recombinant protein of biopharmaceutical interest related to a disease that affects a living being can be of Zaire ebolavirus and / or of Escherichia coli.

15. The process for the expression of recombinant proteins in microalgae of claims 1 to 14, characterized in that the replication is carried out by means of a rolling circle.

16. The process for the expression of recombinant proteins in microalgae of claims 1 to 14, characterized in that the induction in the Ori site is carried out with solutions of a 1% alcohol or absolute grade.

17. The process for the expression of recombinant proteins in microalgae of claim 16, characterized in that the alcohol is ethanol.

18. The process for the expression of recombinant proteins in microalgae of claims 1 to 17, characterized in that it shows a protein expression yield between 0.12 to 1.25 mg / g in fresh weight, depending on the nature and / or origin of the recombinant protein of interest to obtain.

19. The process for the expression of recombinant proteins in microalgae of claims 1 to 18, characterized in that it shows a protein expression yield of at least 0.12 mg / g when used to obtain recombinant Escherichia coli proteins.

20. The process for the expression of recombinant proteins in microalgae of claims 1 to 18, characterized in that it shows a protein expression yield of at least 1.25 mg / g fresh weight to obtain recombinant proteins of Zaire ebolavirus.

21. The use of a recombinant protein obtained through the process of subdivisions 1 to 20 in the preparation of a vaccine to treat a disease that affects a living being.

22. The use of a recombinant protein obtained by the process of claim 21 in the manufacture of a vaccine to treat the disease caused by Zaire ebolavirus.

23. The use of a recombinant protein obtained by the process of claim 21 in the manufacture of a vaccine to treat the disease caused by the enterotoxin of Escherichia coli.