WO2019116034A1

WO2019116034A1 - Microbial enrichment method

Info

Publication number: WO2019116034A1
Application number: PCT/GB2018/053610
Authority: WO
Inventors: Shay SENDEROVICH
Original assignee: Cell Therapy Catapult Limited
Priority date: 2017-12-12
Filing date: 2018-12-12
Publication date: 2019-06-20

Abstract

The invention provides a method of enriching microbial nucleic acids in a sample wherein said sample comprises microbial and mammalian cells, comprising the steps of: (a) incubating said sample with a hypotonic solution, (b) agitating said sample and hypotonic solution at a speed of at least 2000rpm, or a force equivalent thereto, (c) optionally repeating step (a) or steps (a) and (b) at least one time, and (d) incubating said sample with a nucleic acid inactivation agent, wherein said nucleic acid inactivation agent is added prior to, simultaneously to and/or sequentially to step (a)and/or separating mammalian nucleic acids from microbial cells in the sample. The invention further provides a method for determining whether a sample comprises microbial nucleic acids comprising the steps of: (a) incubating said sample with a hypotonic solution, (b) agitating said sample and hypotonic solution at a speed of at least 2000rpm, or a force equivalent thereto, (c) optionally repeating step (a) or steps (a) and (b) at least one time, (d) incubating said sample with a nucleic acid inactivation agent, wherein said nucleic acid inactivation agent is added prior to, simultaneous to and/or sequentially to step (a) and/or separating mammalian nucleic acids from microbial cells in the sample, (e) optionally removing the inactivation agent from the sample, (f) exposing the sample to microbial cell lysis conditions, and (g) assaying the sample for microbial nucleic acids. The invention also provides a kit for enriching microbial nucleic acids in a sample comprising a hypotonic solution, a nucleic acid inactivation agent, a chemical means capable of causing microbial cell lysis and instructions for agitating the sample at a speed of at least 2000rpm or a force equivalent thereto. Further, the invention provides a method for enriching microbial nucleic acids in a sample, wherein said sample comprises microbial and mammalian cells comprising the steps of (a) exposing said sample to conditions which are capable of causing mammalian cell lysis but not microbial cell lysis;(b) incubating said sample with an endonuclease, wherein said endonuclease is added prior to, simultaneously to or sequentially to step (a); and(c) incubating said sample and endonuclease with an endonuclease inactivation agent and an endonuclease cleavage agent after step (b).

Description

Microbial enrichment method

The present invention relates generally to methods for enriching microbial nucleic acids (e.g. DNA) in a sample comprising both microbial and mammalian nucleic acids, e.g. DNA, particularly comprised within cells. More particularly, the invention relates to methods which employ the differential lysis of mammalian and microbial cells, wherein mammalian cells are lysed with a hypotonic solution and are subjected to a step of agitation. Most particularly, the invention relates to methods for determining the presence of microbial nucleic acids (e.g. DNA) in a sample, and methods for sterility testing a sample. The invention further relates to methods for removing nucleic acids from a sample and methods for inactivating an endonuclease.

The ability to reliably and accurately isolate and detect microbial nucleic acids (e.g. DNA) in a sample, which may additionally comprise mammalian cells, is important for a variety of different applications, including the sterility testing of medicaments and reagents and the diagnosis of disease. Although techniques are available to distinguish between mammalian (e.g. human) nucleic acids (e.g. DNA) and microbial nucleic acids (e.g. DNA) present in a sample during microbial nucleic acid (e.g. DNA) detection, the presence of mammalian nucleic acids, particularly mammalian DNA, can reduce the sensitivity of microbial detection assays and their removal has been shown to enhance the detection of microbial nucleic acids (e.g. DNA). The removal of mammalian nucleic acids and particularly mammalian DNA from a sample prior to detection of microbial nucleic acids (e.g. DNA) may therefore result in a more sensitive and reliable assay, particularly where mammalian cell contamination is high or where microbial presence is low.

Several assays are known in the art, which allow the enrichment of microbial DNA in a sample by removal of mammalian DNA. These methods usually either rely on differences between microbial and mammalian DNA to allow separation of the mammalian DNA and thus the enrichment of microbial DNA present in a sample or employ differential lysis techniques which allow the mammalian and microbial

DNA to be released from contaminating cells in a staged manner (mammalian DNA initially released may be degraded prior to release of microbial DNA).

Feehery et al (PLOS One, 8(10), e76096, 2013), incorporated herein by reference, discloses a method where a methyl-CpG binding domain (MBD) is used to separate methylated host DNA from microbial DNA based on differences in CpG methylation density, where cell lysis is achieved using a lysis buffer comprising Tris, EDTA and SDS. A further method, namely Pureprover, is additionally discussed which uses conventionally extracted microbial/host DNA and a protein to bind non- methylated CpG motifs in bacterial DNA.

Trung ef a/ (BMC Infectious Diseases, 16(235), pp1 -9, 2016, incorporated herein by reference) discloses a method to enrich bacterial DNA in a sample contaminated with human cells, primarily for diagnosing sepsis, where the method employs a polar detergent and requires adjustment of the pH to lyse mammalian cells and to simultaneously degrade the released DNA, providing an assay where DNase is not necessary. Particularly, the use of a buffer having a pH of 9.8 and comprising 2M Na₂C0₂ and 1% Triton-X100 is disclosed.

WO2015/169933 (incorporated herein by reference) concerns a method of enriching microbial DNA in a sample, involving passing a sample through a filter with pore sizes small enough to retain microbial cells, lysing microbial cells on the filter, binding released nucleic acids to the filter and subsequently eluting the DNA. The method can optionally also include initial steps of lysing higher eukaryotic cells with a buffer comprising a chaotropic agent, degrading nucleic acids released from those cells and optionally degrading proteins released.

The MoLysis assay (Molzym GmbH) can be used to enrich microbial DNA in a sample and works on the concept of differential lysis of mammalian and microbial cells. In this regard, the assay employs a chaotropic lysis buffer which is capable of lysing mammalian cells but not microbial cells. A DNase treatment then follows to degrade any DNA which is released from any lysed mammalian cells in the sample. Subsequently, the microbial cells are lysed with a different buffer and the DNA released is analysed, e.g. using PCR.

However, although as discussed above, assays are available for enriching microbial DNA in a sample many of the assays have drawbacks. Particularly, the requirement to use expensive lysis buffers can make assays unaffordable, for example, in a sterility testing environment where large numbers of samples may need to be tested. Further, some of the assays have been found to take several hours to run, which is again problematic when a large throughput of samples is required. Hypotonic shock is known as a lysis treatment in the art, but is

considered to be unreliable owing to variability in effectiveness In fully releasing and exposing DNA and other cellular nucleic acids. There is therefore a need for a rapid, cost effective microbial enrichment assay which would allow the sensitive detection of microbial nucleic acids (e.g. DNA and/or RNA) and would be particularly useful for sterility testing large numbers of samples.

In this respect, the present invention is based upon the surprising finding that a hypotonic solution, together with a step of agitation of at least 2000rpm can induce lysis of mammalian cells and result in the release of a significant amount of mammalian nucleic acids (determined by DNA release), which can subsequently be inactivated, without inducing lysis of microbial cells present in the sample. The amount of mammalian DNA and therefore mammalian nucleic acids which are released by the method (and which can then be inactivated) results in the significant enrichment of microbial nucleic acids (e.g. DNA) in a sample, which can then be used in a highly sensitive detection assay. Thus, the present invention advantageously replaces expensive mammalian lysis buffers used in several prior art assays with a hypotonic solution and a specific agitation step, which results in an assay which can be performed in a few minutes, in contrast to many of those of the art which may take several hours. The present inventor has particularly identified that the use of a specific step of agitation together with the addition of a hypotonic solution is critical in the provision of a highly sensitive assay for microbial detection. The absence of the specific agitation step and incubation with hypotonic solution alone was not sufficient to lyse all contaminating mammalian cells in a sample or to release all contaminating mammalian DNA. Under such conditions less than 25% of mammalian DNA was released from cells. Further, the application of a moderate agitation at 1200 rpm had no effect on the release of DNA from mammalian cells. The present invention has thus identified specific conditions employing the use of a hypotonic solution and specific agitation which can result in the lysis and release of sufficient mammalian nucleic acids and particularly DNA from contaminating mammalian cells to allow the development of a sensitive assay, e.g. for sterility testing.

In one embodiment, the present invention provides a method of enriching microbial nucleic acids, particularly DNA, in a sample wherein said sample comprises microbial and mammalian cells, comprising the steps of:

(a) incubating said sample with a hypotonic solution,

(b) agitating said sample and hypotonic solution at a speed of at least

2000rpm, or a force equivalent thereto,

(c) optionally repeating step (a) or steps (a) and (b) at least one time, and (d) incubating said sample with a nucleic acid inactivation agent, particularly a DNA inactivation agent, wherein said nucleic acid inactivation agent, particularly a DNA inactivation agent, is added prior to, simultaneously to and/or sequentially to step (a), and/or separating mammalian nucleic acids, particularly DNA, from microbial cells in said sample.

Thus, the method of enrichment of the present invention, allows the enrichment of microbial nucleic acids, e.g. DNA and/or RNA, in a sample by the inactivation or removal of mammalian nucleic acids (e.g. DNA and/or RNA) present. The present method allows background contaminating mammalian nucleic acids (e.g. DNA and/or RNA) (e.g. present in cells) in a sample to be reduced allowing sensitive detection of microbial nucleic acids (e.g. DNA and/or RNA) present. It will be appreciated that when it is desired to enrich microbial DNA, removal and/or inactivation of at least mammalian DNA may be carried out and when it is desired to enrich microbial RNA, removal and/or inactivation of at least mammalian RNA may be carried out. As mammalian nucleic acids (e.g. DNA and/or RNA) may be present within mammalian cells in the sample, in addition to any free nucleic acids (e.g. DNA) in the sample (i.e. extracellular DNA/RNA within the sample), the above method requires an initial step of incubating the sample with a hypotonic solution, which may be capable of selectively entering mammalian cells by osmosis and causing at least a proportion of the mammalian cells in the sample to swell or lyse. The hypotonic solution has minimal effect on microbial cells present within the sample, in view of the presence of a cell wall. The use of a hypotonic solution alone is however not effective to remove sufficient mammalian nucleic acids (and particularly DNA) from mammalian cells to allow the sensitive detection of microbial nucleic acids (e.g. DNA) present and thus step (b) of the method of the invention is carried out, applying a specific agitational force to the sample to release nucleic acids (e.g. DNA) which remain within lysed mammalian cells and to lyse swollen unlysed cells. As discussed in further detail below, the method may optionally provide for the repetition of step (a) or steps (a) and (b), which may be desirable under particular conditions, for example, where mammalian nucleic acid (e.g. DNA) contamination is particularly high. Finally, the method requires a step of inactivation of the mammalian nucleic acids (e.g. DNA and/or RNA) which have been released from mammalian cells (e.g. removal of the mammalian DNA and/or RNA) and/or a step of separating microbial cells present from released mammalian nucleic acids (e.g. DNA), to prevent the mammalian nucleic acids (e.g. mammalian DNA and/or RNA) from reducing the sensitivity of any subsequent detection steps which may be carried out in relation to the detection of microbial nucleic acids (e.g. DNA and/or RNA). As discussed above, when enrichment of microbial DNA is required, removal and/or inactivation of at least mammalian DNA may be desirable and when enrichment of microbial RNA is required, removal and/or inactivation of at least mammalian RNA may be desirable. Thus, method steps (a) to (d) of the invention generally allow for the lysis of mammalian cells and inactivation or removal of mammalian nucleic acids (e.g. DNA) from a sample, without affecting the integrity of microbial cells which may be present or microbial nucleic acids (e.g. DNA) present within those cells, and provide a rapid and inexpensive assay.

Reference to“enriching” as used herein, may refer to an increase in the amount of microbial nucleic acids, e.g. DNA and/or RNA, in a sample which can be detected, e.g. by PCR or RT-PCR, (i.e. the amount which could be detected in the sample after step (d) as compared to before step (d)). The amount of microbial nucleic acids (e.g. DNA and/or RNA) in a sample which can be detected may increase by at least 10, 20, 30, 40, 50, 60, 70, 80 or 90% and amounts of microbial nucleic acids (e.g. DNA and/or RNA) present may be determined using PCR or RT- PCR, e.g. 16S, 18S and/or 23S rRNA gene PCR. It will be appreciated that the actual amount of microbial nucleic acids (e.g. DNA and/or RNA) within a sample may not increase during a method of the invention, but that the amount available for detection may increase. Further, it will be appreciated that for samples which are heavily contaminated with mammalian nucleic acids (DNA/genomes), e.g. where the mammalian nucleic acids are in excess of the microbial nucleic acids, e.g. the mammalian DNA is in excess of microbial DNA (e.g. where there is at least 100 fold, 1000 fold, 10000 fold or 100000 fold more mammalian nucleic acids to microbial nucleic acids, e.g. mammalian DNA to microbial DNA), although the enrichment methods of the invention will greatly reduce the amount of mammalian nucleic acids (e.g. DNA/genomes) present, there may still be more mammalian nucleic acids (e.g. DNA/genomes) present than microbial nucleic acids (e.g.

DNA/genomes).

It will be appreciated that any increase in the amount of microbial nucleic acids (e.g. DNA and/or RNA) in a sample which are detectable by PCR, which is achieved by carrying out the method of the invention, may be due to a decrease in the amount of mammalian nucleic acids (e.g. DNA and/or RNA) present in a form which could be identified using PCR, e.g. a decrease of at least 50, 60, 70, 80, 90, 95, 96, 97, 98 or 99%. Thus, the amount of mammalian DNA, RNA, or DNA and RNA present may decrease by at least 50, 60, 70, 80, 90, 95, 96, 97, 98 or 99%. In one embodiment, the mammalian nucleic acids (DNA, RNA, or DNA and RNA) present in a form which could be identified using PCR, in the treated sample may decrease by 100%, i.e. all mammalian DNA, all mammalian RNA or all mammalian DNA and RNA originally present in the sample may be inactivated or removed by the method of the invention.

Thus, in this respect, reference to“enriching” as used herein may refer to an increase in the ratio of microbial nucleic acids: mammalian nucleic acids (e.g.

microbial DNA: mammalian DNA, or microbial RNA: mammalian RNA) which is present in the sample in a form which could be identified using PCR after step (d) of the method, as compared to the ratio present in the sample prior to step (a) (or alternatively viewed, prior to step (d)) of the method of the invention. It will be appreciated that“enrichment” may include enriching only microbial DNA, only microbial RNA or both microbial DNA and RNA. If enrichment of microbial DNA is required, then at least mammalian DNA may be inactivated and/or removed. If enrichment of microbial RNA is required, then at least mammalian RNA may be inactivated and/or removed. In a particular embodiment, inactivation of both mammalian DNA and RNA may allow the enrichment of microbial DNA and RNA. It will be appreciated that inactivation and/or removal of either mammalian DNA or RNA will result in an enrichment of microbial nucleic acids present perse.

Alternatively viewed,“enriching” the microbial nucleic acids (e.g. DNA and/or RNA) in a sample may simply refer to the inactivation of mammalian nucleic acids (e.g. DNA and/or RNA) within a sample or reduction of background mammalian nucleic acids (e.g. DNA and/or RNA) in a sample, e.g. inactivation of at least 50, 60, 70, 80, 90, 95, 96, 97, 98 or 99% of the mammalian DNA and/or RNA present in the sample prior to step (a) (or at least prior to step (d)) as compared to after step (d) of the method or reduction of at least 50, 60, 70, 80, 90, 95, 96, 97, 98 or 99% of the background mammalian DNA and/or RNA present in the sample prior to step (a) (or at least prior to step (d)) as compared to after step (d) of the method. Particularly, inactivation or reduction of 100% or all of the mammalian DNA and/or RNA present in a sample prior to step (a) or (d) may occur after step (d) of the method. Thus, the present invention could alternatively be defined as a method for inactivating mammalian nucleic acids (e.g. DNA and/or RNA) in a sample, comprising (a) incubating said sample with a hypotonic solution, (b) agitating said sample and hypotonic solution at a speed of at least 2000rpm, or a force equivalent thereto, (c) optionally repeating step (a) or steps (a) and (b) at least one time, and (d) incubating said sample with a nucleic acid (e.g. DNA and/or RNA) inactivation agent, wherein said nucleic acid (e.g. DNA and/or RNA) inactivation agent is added prior to, simultaneously to and/or sequentially to step (a). Further, the invention may encompass a method for lysing mammalian cells in a sample, comprising (a) incubating said sample with a hypotonic solution, (b) agitating said sample and hypotonic solution at a speed of at least 2000rpm, or a force equivalent thereto, and

(c) optionally repeating step (a) or steps (a) and (b) at least one time.

The enrichment of microbial nucleic acids (e.g. DNA and/or RNA) in a sample can be determined by carrying out a quantitative detection assay (e.g. PCR or RT-PCR) for mammalian nucleic acids (e.g. DNA and/or RNA) after the step of incubation with a nucleic acid inactivation agent and/or separating mammalian nucleic acids (e.g. step (d)) of the method of the invention and comparing this to the amount of mammalian nucleic acids (e.g. DNA and/or RNA) detected using the same quantitative detection assay in the sample where only steps (a)-(c) are carried out. For example, mammalian DNA present can be identified by detecting the presence of any gene which is present within a mammalian genome but not in a microbial genome (e.g. TERT). Mammalian RNA present can be identified by detecting the presence of RNA present in a mammalian cell but not in a microbial cell, e.g. 18S RNA is present in eukaryotes but not in prokaryotes. A reduction in the amount of mammalian DNA and/or RNA detected in a sample after steps (a)-

(d) have been carried out as compared to a sample after steps (a)-(b) or (a)-(c) have been carried out is indicative of enrichment of microbial nucleic acids (e.g. DNA and/or RNA), as discussed above. Alternatively, an enrichment of microbial nucleic acids (e.g. DNA and/or RNA) can be determined by detecting microbial nucleic acids (e.g. DNA and/or RNA) in a sample after steps (a)-(d) have been carried out (e.g. by PCR performed on lysed microbial cells) and comparing this to microbial nucleic acids (e.g. DNA and/or RNA) detected using the same detection assay after steps (a)-(b) or (a)-(c) have been carried out, together with a step of microbial cell lysis, but in the absence of step (d). Any increase in the amount of microbial nucleic acids (e.g. DNA and/or RNA) detected is indicative of microbial nucleic acid (e.g. DNA and/or RNA) enrichment in view of the reduction of contaminating background mammalian nucleic acids e.g. DNA and/or RNA.

Particular detection assays for microbial nucleic acids (e.g. DNA and/or RNA) are described further below (e.g. based on the detection of 16S, 18S and/or 23S rRNA or encoding genes therefor).

The microbial nucleic acids (e.g. DNA and/or RNA) enriched by a method of the invention refers to microbial DNA and/or RNA within and/or released from microbial cells, depending on whether additional method steps have been carried out after method step (d). It will be appreciated by a skilled person that carrying out method steps (a)-(d) of the method of the invention will generally enrich microbial nucleic acids (e.g. DNA and/or RNA) within microbial cells, since method steps (a)-

(d) have minimal impact on the integrity of microbes, i.e. the hypotonic solution and agitation generally result in release of mammalian nucleic acids e.g. DNA and/or RNA from mammalian cells. A further subsequent step of microbial cell lysis may be carried out after step (d) in the method of the invention, to allow release of microbial nucleic acids (e.g. DNA) from microbial cells. The employment of such a step will result in an enrichment of extracellular microbial nucleic acids (e.g. DNA).

In this aspect, the invention further provides a method of enriching microbial nucleic acids, particularly DNA, in a sample wherein said sample comprises microbial and mammalian cells, comprising the steps of:

(a) incubating said sample with a hypotonic solution,

(b) agitating said sample and hypotonic solution at a speed of at least

2000rpm, or a force equivalent thereto,

(c) optionally repeating step (a) or steps (a) and (b) at least one time,

(d) incubating said sample with a nucleic acid (e.g. DNA) inactivation agent, wherein said nucleic acid (e.g. DNA) inactivation agent is added prior to, simultaneously to and/or sequentially to step (a) and/or separating mammalian nucleic acids (e.g. DNA) from microbial cells in said sample,

(e) optionally removing the inactivation agent from the sample and

(f) exposing the sample to microbial cell lysis conditions.

Thus, subsequent to the steps of incubating the sample with a hypotonic solution/agitation (i.e. to lyse mammalian cells), and inactivating and/or removing mammalian nucleic acids (e.g. DNA) from a sample, the sample may be subjected to a step of exposure to microbial cell lysis conditions which may be capable of lysing at least a proportion of microbial cells present within the sample or at least a proportion of the microbial cell type or types which it may be desired to detect, e.g. at least 50, 60, 70, 80, 90, 95, 96, 97, 98, or 99% of microbial cells present or of the desired microbial cell type. As discussed above, microbial cell lysis may result in the release of microbial nucleic acids (e.g. DNA and/or RNA) from microbial cells, allowing a further step of detecting microbial nucleic acids (e.g. DNA and/or RNA) to be carried out if desired.

An optional step of removing the inactivation agent from the sample may be carried out before any step of microbial cell lysis, for example, by centrifugation of the sample to form a microbial cell pellet and removal of the supernatant. The requirement to carry out this step may depend on the inactivation agent used in method step (d) of the invention and on whether a microbial cell separation step has been carried out in step (d). If an inactivation agent is used which is saturated by mammalian nucleic acids (e.g. DNA) present in the sample, there may be no requirement to remove the inactivation agent from the sample, as there may be no agent available to interact with released microbial nucleic acids (e.g. DNA and/or RNA). However, if any inactivation agent used is not saturated by mammalian nucleic acids (e.g. DNA) and is present in an active form in the sample after step (d), then its removal may be desirable. In this instance, at least 80, 90, 95, 96, 97, 98, or 99% of the inactivation agent may be removed. As discussed above, this may be carried out by any method known in the art including centrifugation and/or filtration. Centrifugation may be carried out in a suitable container, typically at at least 13000g, resulting in the formation of a microbial cell pellet and a supernatant comprising lysed mammalian cells and the nucleic acid (e.g. DNA) inactivation agent. Filtration may be used by passing the sample through a filter comprising pore sizes that allow effective separation of microbial cells from lysed cell components and the nucleic acid (e.g. DNA) inactivation agent. Suitable filters may be available from Sartorius (e.g. with pore sizes of 0.2-0.45pm). A skilled person will appreciate that any microbial cells separated from the inactivation agent may be subjected to one or more washing steps. Further, it will be appreciated that removal of the inactivation agent from the sample may also result in the removal of lysed mammalian cells and/or inactivated mammalian nucleic acids (e.g. DNA) from the sample. Thus, removal of the inactivation agent may result in only or mainly microbial cells being present in the sample, e.g. at least 80, 85, 90, 95, 96, 97, 98 or 99% of the cells remaining may be microbial.

A skilled person will appreciate that if a separation step is carried out in step (d) (either alone or after the addition of a nucleic acid (e.g. DNA) inactivation agent), that the optional removal step (e) may not be carried out. Figure 1 shows an exemplary schematic of the invention in regards to the enrichment of microbial DNA. It will be appreciated that the same method steps could be appropriately adapted to enrich microbial nucleic acids (e.g. RNA or DNA and RNA) as described herein. Figure 9 shows a specific process of the invention, and Figure 10 an optimised process. Figure 11 shows a process for microbial nucleic acid (particularly microbial DNA) purification that may optionally be used according to the invention, typically prior to detection of microbial nucleic acids (particularly DNA).

“Microbial cells” as used herein refers to a diverse group of organisms which naturally exist as single cells or as a cell cluster, and which generally possess a cell wall. These can therefore be distinguished from mammalian cells which as described below do not possess a cell wall, and which do not generally occur in nature as single cells. The terms“microbial cells”,“microbes” and“microorganism” are used interchangeably herein.

Microbial cells include prokaryotic cells, such as bacteria or archaebacteria and also some eukaryotic cells such as fungi, yeasts and moulds, which possess a cell wall. A prokaryotic cell is a cell which belongs to the Archaea or Bacteria phylogenetic group and includes both Gram positive and Gram negative bacteria, for example bacteria of the genera Enterococcus, Staphylococcus, Mycobacterium, Streptococcus, Salmonella, Chlamydia, Pseudomonas, Legionella, Yersinia, Bacillus, Clostridium, Shigella, Vibrio, Haemophilus, Listeria, Bordetella,

Helicobacter and Cornyebacterium.

Fungal microbial cells which may be enriched by a method of the invention include fungi from the genera Aspergillus (e.g. A.niduians, A.niger, AJumigatus, A.fiavus), Basidiobolus (e.g. B.microsporus, B.ranarum), Candida (e.g. C. Albicans), Cephalosporium (e.g. C.gregatum, C.coremioides, C.chrysogenum, C.diospyri), Mucor, Entomophthora, Alternaria, Absidia, Skopuiariopsis, Curvularia, Botrytis, Rhizopus, Hemispora, Chyrososporium, Phoma, Nigrospora, Helmithosporium, Syncephalastrum or Thielavia.

Particuarly, examples of microbes which can be enriched and/or detected using a method of the invention can be seen in Table 1

Table 1- exemplary microbes

Microbial cells which may be enriched further include algae and amoeba.

It will be appreciated by a skilled person that a sample may comprise one or more different types of microbial cell and thus at least one, two, three or more types of microbial cell may be present. A sample may comprise for example, both prokaryotic bacterial cells and fungal cells. It will further be appreciated that the amount of microbial nucleic acids (e.g. DNA) and/or microbial cells present within a sample may vary from sample to sample. Thus, a sample may comprise for example, only a few microbial cells or microbial genomes, (e.g. less than 500, 100, 50, 20 or 10 or may comprise a single microbial cell or genome), or may comprise at least 1000, 2000, 10³, 10⁴, 10⁵, 10⁶, 10⁷, 10⁸ or 10⁹ cells or genomes/ml. Where the method of the invention is used for the purpose of sterility testing, the amount or concentration of microbial cells or genomes present in a sample may be relatively low and may typically be below the amount or concentration that could be seen with the human eye, e.g. less than 10³ or 10² cells or genomes/ml. Where the method of the invention is used for the purposes of diagnostic testing of a sample, the amount of microbial cells or genomes present may be dependent on, for example, the stage of an infection. As discussed further below, where the enrichment method of the invention is performed as part of a sterility test or diagnostic test, it is possible that the sample may not comprise microbial cells or genomes, as not all tested samples will have microbial contamination.

“Mammalian cells” as used herein refer to cells which are derived from mammals, which have a cell membrane but do not have a cell wall. Mammalian cells may be derived from primates, e.g. monkeys, chimpanzees, etc, dogs, cats, rats, mice, rabbits, horses, cattle, sheep, pigs but are preferably derived from humans. The amount of mammalian cells and mammalian nucleic acids (e.g. DNA or genomes) present within a sample may vary, as discussed above in relation to microbial cells. If a sample has been obtained for sterility testing, e.g. a sample of media etc, the level of contaminating mammalian nucleic acids (e.g. DNA or genomes/cells) present may be relatively low, e.g. less than 10³ /ml. However, if a sample has been obtained for disease or infection diagnosis purposes, it is possible that the amount of mammalian cells/nucleic acids (e.g. DNA/genomes) present may be high, e.g. more than 10⁷ /ml or 2x10⁷ /ml. Further, although a sample which is for sterility testing may likely comprise mammalian cells of a single mammalian type, e.g. human cells, a sample which is for diagnostic purposes may comprise mammalian cells of different types, e.g. mammalian cells from the potential disease host, together with human cells from the handler of the sample.

A“sample” as used herein refers to any sample which could potentially comprise both mammalian and microbial DNA, e.g. within mammalian and microbial cells, respectively. In one embodiment, the sample may be a sample which would desirably be sterile, i.e. which would desirably not comprise microbial cells.

Examples of such samples include medicaments for administration to a subject, particularly medicaments for administration to a human subject, e.g. medicaments for intravenous, intramuscular, oral or topical administration. Other examples of samples which would desirably be sterile include laboratory reagents such as cell culture media, enzymes, buffers etc. Samples of such reagents/medicament may be sterility tested according to a method of the invention, to determine whether the reagents/medicaments comprise microbial cells and thus whether the

reagents/medicaments are suitable for use. The contamination of samples with human cells/nucleic acids (e.g. DNA) during handling commonly occurs, thus resulting in the requirement of a method of the invention for enriching any microbial nucleic acids (e.g. DNA) present before a step of detecting microbial nucleic acids (e.g. DNA) is carried out.

A sample also includes any biological samples that may be obtained from a mammal, e.g. the sample may be blood or a blood product or component (e.g. PBMCs), tissue, urine, CSF, mucosal secretion, faecal or an aspirate, e.g. obtained from a joint, the eye or a bronchial-alveolar lavage or a tissue for transplant.

Further included are food or drink samples in which it may be desirable for example to identify the presence of microbial cells. Particularly, it may be desirable to determine whether microbial cells/nucleic acids (e.g. DNA) are present in particular amounts or at particular concentrations in food/drink samples.

In a particular embodiment, a sample may be processed prior to use in a method of the present invention. Thus, for example, where a sample is liquid, a step of separating any microbial and mammalian cells present from the supernatant may be carried out. Such a separation step may be carried out by any known method, e.g. by centrifugation (e.g. at at least 13000g, 16000g or 18000g), by filtration or by binding to a solid support (e.g. to beads or a column which specifically bind the desired cells). In a further embodiment, it may be desirable to process a solid sample such as food or solid tissue e.g. by dissociating into single cells by mechanical and/or enzymatic means such as by using a pestle and mortar, collagenase or trypsin enzymatic dissociation of cells. A sample according to the present invention therefore encompasses samples which have been processed and for example, may comprise or consist of a cell pellet (e.g. of any mammalian or microbial cells which were present in the pre-processed sample) or a resuspended cell pellet, as well as unprocessed samples. In one embodiment, the methods of the invention may include a step of processing a sample, e.g. separating cells from supernatant e.g. by centrifugation or filtration as described previously. Thus, it will be appreciated that a sample may be pre-processed to remove free (i.e.

extracellular) nucleic acid (e.g. DNA, RNA or DNA and RNA) pre-existing in the sample prior to use of the sample in a method of the invention. In one embodiment, therefore, any method of the invention may further comprises a step of removing free nucleic acid (e.g. DNA, RNA or DNA and RNA) from the sample prior to step (a) of the method. Such processing may remove sufficient free nucleic acid (e.g. DNA, RNA or DNA and RNA) from the sample to allow differential lysis and effective enrichment, detection and/or diagnosis of microbial nucleic acids

(particularly DNA) using the methods of the invention. For example, typically at least 60, 70, 80, 90, 95, 96, 97, 98 or 99% of the free nucleic acids (e.g. DNA and/or RNA) present within a sample may be removed by such processing before it is used in a method of the invention. Any appropriate means may be used to remove the free nucleic acid (e.g. DNA, RNA or DNA and RNA) from a sample prior to its use in a method of the invention. Suitable means are described herein in the context of inactivation of the mammalian nucleic acid (e.g. DNA, RNA or DNA and RNA) in the methods of the invention, and such means may be used to pre-process the sample to remove the free nucleic acid (e.g. DNA, RNA or DNA and RNA). Particularly, a nucleic acid (e.g. DNA and/or RNA) inactivation agent (such as benzonase) may be used to remove the free nucleic acid (DNA, RNA or DNA and RNA) from a sample prior to its use in a method of the invention, or in an initial step prior to step (a) of any of the methods of the invention. This may be followed by removal (e.g. by centrifugation) of the inactivation agent and the inactivated free nucleic acid (e.g. DNA, RNA or DNA and RNA) from the sample prior to its use in a method of the invention. Thus, any method of the invention may comprise the steps of (i) incubating said sample with a nucleic acid (e.g. DNA) inactivation agent (such as benzonase); and optionally (ii) removing the inactivation agent from said sample; prior to step (a) of the method of the invention.

As discussed above, the method of the invention comprises a step (a) of incubating a sample with a hypotonic solution. A hypotonic solution is a solution which has a lower osmotic pressure than the cytosol of a mammalian cell, particularly of a mammalian cell, e.g. a human cell, comprised within a sample of the invention. A hypotonic solution therefore generally comprises less solutes than the cytosol of a mammalian cell, e.g. comprised within a sample of the invention. Particularly, in accordance with the present invention, a hypotonic solution is one which is capable of entering mammalian cells by osmosis and which may increase the pressure inside cells causing mammalian cells to swell and/or to lyse. A particularly preferred hypotonic solution to be used in the present invention is water, e.g. RNAse and DNAse free water. Water for use in the methods of the invention can be obtained commercially, e.g. from Thermofisher (Catalogue

#11538646).

It may be desirable in particular circumstances to adjust the tonicity of the hypotonic solution, e.g. water, by adding, for example, glycerol. A reduction in tonicity may be desirable to balance lysis of mammalian cells and particular microbes, or to retain some mammalian cells within the sample, which may be beneficial for microbial pellet formation as discussed further below.

Specifically, the hypotonic solution of the invention would not be considered to be chaotropic and/or would not comprise a chaotropic agent, e.g. an agent which is capable of disrupting the hydrogen bonding network of water molecules, such as guanidine hydrochloride, guanidine isothiocyanate, sodium perchlorate, sodium iodide, trichloroacetate, urea or rhodanite salt. Particularly, a hypotonic solution will generally not be capable of entering a microbial cell by osmosis and increasing the pressure within a microbial cell resulting in cell lysis. The hypotonic solution of the invention would not be considered to be a surfactant or detergent and/or would not comprise a surfactant (e.g. an agent which is capable of lowering the surface tension or interfacial tension between two liquids, such as a saponin, sodium dodecyl sulfate (SDS), Triton X-100, 3-[(3- cholamidopropyl)dimethylammonio]-1-propanesulfonate (CHAPS) or

cetyltrimethylammonium bromide (CTAE3)). Particularly, a hypotonic solution will generally not be capable of disorganising the lipid bilayer of cellular membranes, resulting in cell lysis (i.e. will not be capable of acting as a detergent).

Typically the hypotonic solution of the invention is not chaotropic and also not a surfactant/detergent, and/or would not comprise a chaotropic agent or a surfactant/detergent as described above.

“Cell lysis” refers to the breakdown of an intact cell by disruption of the cell membrane and/or the cell wall. In the present invention, cell lysis may be caused in mammalian cells by increased cell pressure from the entry of hypotonic solution by osmosis.

Typically, the % of mammalian cells which may be lysed by incubation with a hypotonic solution will depend on various factors, including the concentration of mammalian cells or genomes in the sample, the volume of hypotonic solution added, and the tonicity of the hypotonic solution (i.e. the amount of solutes present in the hypotonic solution). Although a single incubation step with hypotonic solution may be sufficient to result in microbial enrichment in a sample which comprises low concentrations of mammalian cells/genomes, additional incubation steps may be desirable for samples comprising higher concentrations of mammalian

cells/genomes. Indeed, the present inventor has identified that a particularly preferred method of the invention may comprise further steps of incubation with a hypotonic solution, for example, in relation to samples which comprise or are expected to comprise a large amount or concentration of mammalian

cells/genomes. Particularly, at least two incubation steps with hypotonic solution may be used, e.g. 2, 3, 4 or more. Typically, at least one additional incubation may be carried out with hypotonic solution when the concentration of mammalian cells/genomes within a sample is greater than 10⁷/ml. The amount or concentration of mammalian cells/genomes within a sample may be determined by counting mammalian cells using any known technique in the art (e.g. manual counting using a microscope or by using an automated cell counter, such as a Countless II Automated Cell Counter (Thermofisher Scientific)). It will be appreciated by a skilled person that the amount of mammalian cells/genomes present in particular samples, e.g. those for sterility testing, may be dependent on the number of manual production steps that were used. Thus, standard or estimated amounts of likely mammalian cell/genome contamination may be developed for particular samples by assessing the number of manual processing steps that are employed.

If at least one further or additional incubation step is carried out with hypotonic solution in accordance with step (c), it may be possible to omit agitation step (b) for the additional incubation steps. Alternatively, desired agitation can be carried out as for the original incubation with hypotonic solution. Thus, in this respect, at least the initial original incubation with hypotonic solution is carried out in conjunction with agitation, although any further desired incubations may or may not be agitated.

In the event of more than one incubation being carried out in a method of the invention, it may be desirable to separate (or alternatively viewed, concentrate) remaining cells in the sample before adding any subsequent measures of hypotonic solution. Thus, an additional step may be carried out between steps (b) and (c), of separating (or concentrating) remaining microbial and mammalian cells from solution by any known technique, e.g. by centrifugation and/or filtration, as described herein.

Although any volume of hypotonic solution may be added to the sample in the method of the invention, usually, the volume added will depend on the volume of the sample which is to be microbially enriched. Thus, typically, the volume of hypotonic solution added to the sample will be from 1 to 100 times the volume of the sample (e.g. a cell pellet), e.g. from 5-100, 10-100, 20-100, 30-100, 40-100, 50- 100, or 60-100 times the volume of the sample. Alternatively viewed, the volume of hypotonic solution added may be from 100-5000% of the volume of the sample, e.g. from 200-4000, 300-3000, 500-2000 or 500-1000%. The volume of hypotonic solution added will be limited additionally by the size of the sample container, and thus the maximal volume which may be added may not be greater than the volume of the sample container.

In a particularly preferred embodiment, the total volume of sample and hypotonic solution present within a sample container is typically less than 50% of the volume of the container, most preferably less than 40, 30, 25,20 or 15 % of the volume of the container. Thus, the present inventor has identified that the lysis of mammalian cells and release of mammalian nucleic acids (e.g. DNA) therefrom may be optimal, where the total volume of sample and hypotonic solution to be subjected to agitation is not greater than 50% of the volume of the container, and preferably is not greater than 25% of the volume of the container (e.g. not more than 20% or not more than 15% of the volume of the container).

The incubation of hypotonic solution with sample generally results in rapid swelling/lysis of mammalian cells and thus the incubation step (a) may only be carried out for a short period of time, e.g. for less than 10, 5, 4, 3, 2 or 1 minute. However, the total amount of incubation time of the sample with hypotonic solution further includes the amount of time which is taken for agitation step (b). The total amount of time for steps (a) and (b) and thus total incubation time of the sample with the hypotonic solution may be 20, 15, 10, 5, 4, 3, 2 or 1 minute or less.

Although the sample may be incubated with hypotonic solution for much longer periods of time if convenient, the method of the invention results in a rapid assay and thus long incubations are not necessary. Further, although a sample may be incubated in step (a) for a time period as discussed prior to step (b), in a particular embodiment, step (b) may be carried out immediately after addition of hypotonic solution to the sample in step (a). Considering the agitation step (b) above, the sample may be agitated for 10, 5, 4, 3, 2 or 1 minute or less. Alternatively viewed, the sample may be agitated for between 0.5-10 minutes, 0.5-5 minutes, 0.5-4 minutes, 0.5-3 minutes, 0.5-2 or 0.5-1 minute. Typically short bursts or pulses of agitation, such as those intended merely for mixing purposes, e.g. to mix a sample with one or more reagents, are excluded from the invention. Such short bursts may be defined as pulses or bursts of about 0-5 or 0-10 seconds. As discussed previously, step (b) of the methods of the invention defines a step of agitation of the sample and hypotonic solution, where the agitation step, together with the addition of hypotonic solution, is sufficient to allow the swelling/lysis of mammalian cells in the sample without affecting, or only minimally affecting microbial cells present. Particularly, agitation at a speed of at least 2000rpm, or a force equivalent thereof, is necessary to result in the lysis of mammalian cells and the release of mammalian nucleic acids (e.g. DNA) from the mammalian cells. The agitation step of the invention may exclude agitation which is used for the mixing of samples, e.g. which is generally carried out at speeds less than 2000rpm, and which does not provide sufficient agitation to result in the release of a sufficient amount of mammalian nucleic acids (e.g. DNA) from mammalian cells. Thus, agitation according to step (b) may be carried out at speeds of at least 2000, 2100, 2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, 3000, 3100, 3200, 3300, 3400, 3500, 3600, 3700, 3800, 3900, 4000, 4500, or 5000 rpm. Although higher speeds may be used to result in sufficient release of mammalian nucleic acids (e.g. DNA) from mammalian cells, these may not be necessary, as full recovery can generally be achieved when using a speed range from 2000-5000rpm. Additionally, the higher speeds of agitation which are adopted, the greater the chance of damage being caused to microbial cells present in the sample and thus resulting in a less sensitive assay.

It is preferable in the present invention that solid supports such as beads are not added to the sample during or prior to the agitation step, since the presence of such solid supports may damage the integrity of microbial cells.

Agitation at the speeds described above may be carried out by vortexing, e.g. using BR-2000 vortexer (Bio-rad), Vortexer (Heathrow Scientific) or a Genie Disruptor (Fisher Scientific). The agitation may occur in any direction, e.g. in one or more directions, and in one embodiment, multi-directional agitation may be employed (e.g. using a Genie disruptor, Fisher Scientific).

For the avoidance of doubt, it will be understood that agitation as described herein does not encompass centrifugation. Agitation creates turbulent flow, whereas centrifugation creates a centrifugal force perpendicular to a fixed axis of spin

As indicated above, the sample and hypotonic solution may be agitated by any means which are sufficient to impart an equivalent force as agitation at a speed of at least 2000rpm (e.g. by vortexing). Thus, as long as the cells in the sample are subjected to an equivalent shear force to that imparted by agitation at at least 2000rpm, any means of agitation may be used. The term“equivalent force” means a force which results in a shear force on the cells in the sample of at least 90, 95,

96, 97, 98 or 99% of the shear force created when agitating at a speed of at least 2000rpm. An equivalent force may be imparted by agitating a sample and hypotonic solution using, for example, pipetting or sonication, e.g. sonication at a frequency which is capable of disrupting mammalian cells but not microbial cells after exposure to hypotonic solution. Alternatively, homogenisation can be used, for example, using a Geno grinder (Spex SamplePrep). Such techniques may be automated, so that an equivalent force can be imparted on the cells present in the sample. An equivalent force could be calculated using calculations known in the art (e.g. Marcus, J. Fluid Mech., 1990, vol 215, pp393-430).

Typically, the amount of mammalian nucleic acids (e.g. DNA and/or RNA) released from mammalian cells present in the sample by steps (a)-(b) or steps (a)- (c), are at least 60, 70, 80, 90, 95, 96, 97, 98 or 99% of the mammalian nucleic acids (e.g. DNA and/or RNA) present within mammalian cells in the sample prior to step (a). Mammalian nucleic acids (e.g. DNA) released from mammalian cells refers to nucleic acids (e.g. DNA) which is no longer intracellular (i.e. which is extracellular) and/or which is no longer bound to or associated with mammalian cells. In one embodiment, all of the mammalian nucleic acids (e.g. DNA and/or RNA) present in mammalian cells prior to step (a) (i.e. 100% of the mammalian DNA and/or RNA) may be released from the cells after steps (a)-(b) or (a)-(c).

Although it may be preferred for at least 60, 70, 80, 90, 95, 96, 97, 98 or 99% of both mammalian DNA and RNA to be released from mammalian cells, it is only necessary for at least 60, 70, 80, 90, 95, 96, 97, 98 or 99% of mammalian DNA to be released from mammalian cells (and particularly subsequently removed and/or inactivated) when microbial DNA enrichment is required. Thus, when microbial DNA enrichment is required, mammalian RNA release from mammalian cells and/or mammalian RNA inactivation and/or removal may not be necessary. Conversely, it may only be necessary for at least 60, 70, 80, 90, 95, 96, 97, 98 or 99% of mammalian RNA to be released from mammalian cells (and particularly

subsequently removed and/or inactivated) when microbial RNA enrichment is required. Thus, when microbial RNA enrichment is required, mammalian DNA release from mammalian cells and/or mammalian DNA inactivation and/or removal may not be necessary (although may be preferred as discussed above).

Alternatively viewed, at least 60, 70, 80, 90, 95, 96, 97, 98 or 99% of mammalian cells may be lysed after steps (a)-(b) or (a)-(c) of the methods of the invention. Particularly, 100% of mammalian cells may be lysed after steps (a)-(b) or (a)-(c). The amount of mammalian cells or nucleic acids (e.g. DNA) within a sample may be measured using known techniques (e.g. mammalian cells may be measured by staining with a cell surface marker and using flow cytometry, or by counting, e.g. manually or by using a cell counter. Mammalian nucleic acids (e.g. DNA) may be measured using PCR of mammalian specific gene, e.g. TERT, or RNASEP as described previously). In a specific embodiment, it may be desirable in particular circumstances to retain a low amount of unlysed mammalian cells within the sample after step (b) or (c) and/or a low amount of mammalian cell debris. In this regard, it has been shown that in particular circumstances, the retention of a low amount of mammalian cells or mammalian cell debris may help with microbial pellet formation during centrifugation. Thus, in methods where a step of microbial cell separation is carried out after step (b), e.g. as part of step (d) or (e), it may be desirable to retain a few mammalian cells or a low amount of cell debris in the sample. In such an embodiment, the method of the invention may be adapted to allow lysis of at least 95, 96, 97, 98 or 99% of mammalian cells present in the sample, whilst allowing 5,

4, 3, 2, or 1 % or less of mammalian cells to remain unlysed. Particularly, between 1-2% of mammalian cells originally present in the sample (i.e. before step (a)) may remain unlysed. Alternatively viewed, between 1-5, particularly 1-4, 1-3, or 1-2% of the cells present in the sample after step (d) may be mammalian. As described previously, mammalian cell lysis may be controlled by controlling the tonicity of the hypotonic buffer, e.g. by modifying the tonicity of a hypotonic buffer to increase the concentration of glycerol, e.g. to at least 1.5 or 2%, or by modifying the salt concentration of the hypotonic buffer, e.g. the concentration of NaCI₂ or MgCI₂.

Further, particularly, steps (a)-(b) or (a)-(c) of the invention may have no or minimal effect on the integrity of microbial cells present within the sample (i.e. steps (a)-(b) or (a)-(c) preferably do not cause lysis or cause minimal lysis of microbial cells present in the sample). Thus, steps (a)-(b) or (a)-(c) may cause lysis in less than 30, 20, 10, 5, 4, 3, 2 or 1 % of microbial cells present. The % of microbial cells present can be determined by growing and counting microbial colonies on solid media, e.g. in plates, e.g. before and after mammalian cell lysis (steps (a)-(b) or (a)- (c)). It will be appreciated that any appropriate solid media can be used, e.g.

bacteria may grow on nutrient agar and yeast on yeast extract media agar plates. The temperature at which steps (a)-(b) or (a)-(c) are carried is not thought to be critical to the method of the invention. For convenience, the method may be carried out at room temperature e.g. from 18-30°C.

The methods of the invention may be carried out in any type and/or size of suitable container. For example, samples may be provided in individual tubes (e.g. eppendorfs or screw cap tubes of any size), or may be presented in plates, e.g. for automated processing, (e.g. 6, 12, 24, 48, 96 or even 384 well plates). The term“nucleic acid inactivation agent” refers to any agent which is capable of preventing DNA, and/or RNA from being identified using a standard detection assay, such as PCR. The nucleic acid inactivation agent may be a“DNA inactivation agent” or“DNA inactivating agent” as used interchangeably herein which refers to any agent which is capable of preventing DNA from being identified using a standard detection assay, such as PCR, and/or a“RNA inactivation agent” which is capable of preventing RNA from being identified using a standard detection assay, such as RT-PCR. As discussed below, some nucleic acid inactivation agents may be both DNA and RNA inactivation agents, e.g. an endonuclease capable of cleaving both DNA and RNA, and therefore may be capable of preventing both DNA and RNA from being identified using standard detection methods.

Thus, any agent which degrades RNA, affects the structure of RNA or which binds to RNA to prevent its identification using standard procedures is

encompassed by the term RNA inactivation agent. The RNA inactivation agent may not be specific for the inactivation of mammalian RNA and may be able to inactivate any type of RNA, e.g. including microbial RNA. Thus, as discussed previously, if a RNA inactivation agent used in the methods of the invention is not saturated by mammalian DNA in steps (a)-(c), hence rendering it unavailable for the inactivation of subsequently released microbial RNA, removal of the inactivation agent may be necessary prior to any microbial cell lysis. There are several different types of RNA inactivation agent which may be used in the present invention, including RNase A, RNase I and RNase H.

Any agent which degrades DNA, affects the structure of DNA or which binds to DNA to prevent its identification using standard procedures is encompassed by the term DNA inactivation agent. The DNA inactivation agent may not be specific for the inactivation of mammalian DNA and may be able to inactivate any type of DNA, e.g. including microbial DNA. Thus, as discussed previously above, if a DNA inactivation agent used in the methods of the invention is not saturated by mammalian DNA in steps (a)-(c), hence rendering it unavailable for the inactivation of subsequently released microbial DNA, removal of the inactivation agent may be necessary prior to any microbial cell lysis.

There are several different types of DNA inactivation agent that may be used in the present invention. The DNA inactivation agent may have enzymatic activity and be capable of degrading DNA, for example the DNA inactivation agent may have deoxyribonuclease (DNase) activity and be capable of catalysing the hydrolytic cleavage of phosphodiester linkages in the DNA backbone. Enzymes with DNase activity are able to therefore cleave single stranded, double stranded and partially double stranded DNA into smaller units or monomers. DNase I, which is commercially available from several sources, e.g. New England Biolabs, may therefore be used as a DNA inactivation agent in the methods of the present invention, or DNase II (e.g. DNase II alpha or beta) could be used. Typically, incubation with a DNase, for example DNase I, may result in degradation of any free (i.e. non-cellular) DNA after a period of approximately 10 minutes at 37°C. Particularly, dsDNASE from Arctic zyme may be used in the present invention. However, other time periods and temperatures may be employed to achieve the effect.

Other bacteria-derived endonucleases may also be used as DNA inactivation agents. Particularly, endonuclease I from Escherichia coli, Vibrio cholerae, Erwinia chrysanthemi and Aeromonas hydrophilia may be used to degrade DNA in the invention, as described in US 7893251 (incorporated herein by reference). Endonuclease I (EndA) from E.coii is available from various suppliers (e.g. from Molzym GmbG & Co KG, Bremen, Germany). Denarase nuclease (c-L- Ecta) may also be used as a DNA inactivation agent in the present invention.

A nucleic acid inactivating agent may have RNA degrading activity together with the DNA degrading activity as discussed above (i.e. may be a nucleic acid inactivation agent which is both a DNA and a RNA inactivating agent), e.g. an endonuclease capable of degrading both DNA and RNA. Such endonucleases may require the presence of Mg²⁺ and/or Mn²⁺ for enzymatic function and may be reversibly inactivated in the presence of Mg²⁺ and/or Mn²⁺ chelators. In this regard, benzonase nuclease may be a nucleic acid inactivating agent which is both a DNA inactivating agent and a RNA inactivating agent, which can be used in the methods of the invention. Benzonase nuclease may be obtained commercially from any of several different sources (e.g. Sigma-Aldrich, Merck).

A skilled person will appreciate that for enzymatic degradation of DNA, incubation at 37°C may result in optimal degradation.

Where the nucleic acid inactivation agent (e.g. DNA inactivating agent or RNA inactivation agent) used is capable of enzymatically degrading DNA and/or RNA (e.g. is an endonuclease), it may be desirable to carry out a step of removing the nucleic acid inactivation agent (e.g. DNA or RNA inactivating agent) prior to lysing the remaining microbial cells in the methods, as discussed previously.

Particularly, a subsequent step of endonuclease inactivation may be carried out, for example with a Mg²⁺ and/or Mn²⁺ chelator, e.g. EDTA, and/or a step of

endonuclease cleavage may be carried out, for example, with Proteinase K or a functionally equivalent compound, when an endonuclease (for example, an endonuclease requiring the presence of Mg²⁺ and/or Mn²⁺ for enzymatic function, e.g. benzonase) is used as a nucleic acid inactivation agent. Thus, the step of removing the nucleic acid inactivation agent, e.g. benzonase, may comprise incubation of the sample with either an endonuclease inactivation agent, such as EDTA (for example, when benzonase is used as the nucleic acid inactivation agent), and/or an endonuclease cleavage agent, such as Proteinase K or a functionally equivalent compound.

“An endonuclease inactivation agent” is an agent which is capable of reducing the enzymatic function of an endonuclease, e.g. of reducing its ability to degrade DNA and/or RNA. An endonuclease inactivation agent may reduce the enzymatic function of an endonuclease by at least 30, 40, 50, 60, 70, 80, 90, 95 or 99%. In one embodiment, an endonuclease inactivation agent may completely remove the enzymatic function of an endonuclease. The reduction of enzymatic function can be determined by incubation of an endonuclease with DNA and/or RNA and by determining the amount of DNA and/or RNA present in the sample after incubation, e.g. by PCR. An endonuclease inactivation agent may reduce enzymatic function of an endonuclease in a reversible manner. For example, the endonuclease inactivation agent may chelate or remove compounds from the sample which are required for endonuclease function. The addition of such compounds to the sample may therefore restore endonuclease function.

The endonuclease inactivation agent to be used may be dependent on the endonuclease which is employed as a nucleic acid inactivation agent in a method of the invention. As mentioned above, in a particular embodiment of the invention, the endonuclease inactivation agent may be an agent which chelates metal ions (e.g. Mg²⁺ and/or Mn²⁺), for example, if an endonuclease which requires such metal ions for function ( e.g. Mg²⁺ and/or Mn²⁺) is used as a nucleic acid inactivation agent (e.g. benzonase). In a particular embodiment, an endonuclease inactivation agent which chelates Mg²⁺ and/or Mn²⁺ may be used, particularly EDTA, e.g. where the nucleic acid inactivation agent is an endonuclease which requires Mg²⁺ and/or Mn²⁺ for function, e.g. benzonase. As discussed in greater detail below, it may be desirable to use EDTA which is within a pH range of 7-9, for example, 7.5-8.5 and most particularly EDTA which is about or is at pH 8. The endonuclease inactivation agent may be added to the sample in any amount, but preferably in a ratio of 5:1 to 1 :5 sample:endonuclease inactivation agent (e.g. EDTA), for example 4:1 to 1 :4,

3:1 to 1 :3, 2:1 to 1 :2, or 1 :1. Further, the endonuclease inactivation agent to be used may be at a concentration of at least 1 mM, for example at a concentration greater than 1 , 2, 3, 4, 5, 10, 50, 100, 150, 200 or 250mM.

“An endonuclease cleavage agent” is an agent which is capable of cleaving an endonuclease at one or more positions. Cleavage of an endonuclease will generally reduce or eliminate its function and thus its ability to remove DNA and/or RNA. An endonuclease cleavage agent may reduce the enzymatic function of an endonuclease by at least 30, 40, 50, 60, 70, 80, 90, 95 or 99%. In one

embodiment, an endonuclease cleavage agent may completely remove the enzymatic function of an endonuclease. The reduction of enzymatic function can be determined by incubation of an endonuclease with DNA and/or RNA and by determining the amount of DNA and/or RNA present in the sample after incubation, e.g. by PCR. In contrast to an endonuclease inactivation agent, an endonuclease cleavage agent may permanently reduce or remove the function of an

endonuclease. An endonuclease cleavage agent may be a protease which is capable of cleaving proteins such as an endonuclease, for example a serine protease. Particularly, the endonuclease cleavage agent may be a member of the Peptidase family S8, for example Proteinase K, or a functionally equivalent compound (e.g. a compound which has at least 50, 60, 70, 80, 90, 95 or 99% of the protease activity of Proteinase K, or has equivalent protease activity to Proteinase K, where function can be determined by incubation of a compound with a sample comprising an endonuclease and DNA and/or RNA, and subsequent assessment of the amount of DNA and/or RNA remaining in the sample after incubation, e.g. by PCR or RT-PCR. Comparison can be made with a sample comprising the same endonuclease and DNA/RNA after incubation with Proteinase K).

Particularly, when the nucleic acid inactivation agent used is benzonase, a subsequent step of benzonase inactivation and/or cleavage, using a Mg ²⁺ or Mn²⁺ (particularly Mg²⁺) chelator, most particularly EDTA, and/or Proteinase K or a functionally equivalent compound, may be employed. As discussed below in further detail, the use of benzonase may be preferable where a large amount of mammalian nucleic acids (e.g. DNA) are present within a sample, and the subsequent use of EDTA and proteinase K may result in a particularly optimal assay. Specifically, the use of EDTA prevents the degradation of microbial nucleic acids (e.g. DNA) in the sample, which may occur when benzonase treatment is followed by a treatment step of proteinase K alone.

Alternatively, the DNA inactivating agent may be a compound that binds to or intercalates with DNA to prevent its identification by PCR. For example, the DNA inactivating agent may be propidium monoazide (PMA), ethidium monoazide or PMA maxx. PMA is capable of fixating to double stranded DNA after exposure to light and is capable of blocking DNA from polymerisation in PCR. PMA is commercially available from Biotium.

As discussed above, the nucleic acid (e.g. DNA) inactivating agent may be added to the sample prior to, simultaneous to and/or after step (a) of the method of the invention. Thus, the nucleic acid (e.g. DNA) inactivating agent may be added to the sample before the hypotonic solution has been added to the sample. However, it will be appreciated that prior to the addition of the hypotonic solution, most of the nucleic acids (e.g. DNA (particularly most of the mammalian DNA)) will be intracellular and thus may not be available for interaction with the nucleic acid (e.g. DNA) inactivating agent. Once the hypotonic solution is added in step (a) nucleic acids (e.g. DNA) will begin to be released from mammalian cells present and will begin to be available for interaction with the nucleic acid (e.g. DNA) inactivating agent. The completion of steps (b) and/or (c) may allow most or all of the mammalian nucleic acids (e.g. DNA) present in the sample to be extracellular (“free”) and thus to be available for interaction with the nucleic acid (e.g. DNA) inactivation agent. In a particular embodiment therefore, the nucleic acid (e.g.

DNA) inactivating agent may be added to the sample during step (a), e.g. at the same time as the hypotonic solution. The nucleic acid (e.g. DNA) inactivating agent may be added to the sample separately to the hypotonic solution or may be added to the hypotonic solution prior to its addition to the sample. Thus, the hypotonic solution may comprise the nucleic acid (e.g. DNA) inactivating agent. In this way, the nucleic acid (e.g. DNA) inactivating agent may begin inactivating mammalian nucleic acids (e.g. DNA) as soon as they become extracellular.

Alternatively, the nucleic acid (e.g. DNA) inactivating agent may be added to the sample and hypotonic solution after step (a) has been carried out, i.e. after addition of the hypotonic solution. Hence, the nucleic acid (e.g. DNA) inactivating agent may be added immediately after step (a), i.e. before step (b) is carried out, during step (b) or after steps (a) and (b) or (a), (b) and (c) have been carried out. Where multiple incubations with hypotonic solution are used (i.e. where step (c) is carried out), the nucleic acid (e.g. DNA) inactivating agent may be added during each incubation prior to, during or after step (a), as indicated above. Alternatively, the nucleic acid (e.g. DNA) inactivation agent may be added once after all incubation and agitation steps have been completed.

It will further be appreciated that the nucleic acid inactivation agent (e.g. DNA inactivation agent) may be added to the sample at more than one point during the assay. Thus, for example, the nucleic acid activation agent may be added to the sample both prior to the step of hypotonic solution incubation (e.g. step (a)) and simultaneously to the incubation with hypotonic solution (e.g. step (a)). Further, it may be possible to incubate with nucleic acid inactivation agent simultaneously to incubation with hypotonic solution (e.g. step (a)) and also after incubation with hypotonic solution (e.g. after step (a), e.g. during step (b)). In a particular embodiment, where the nucleic acid inactivation agent is benzonase, incubation may occur before step (a) and during step (a) or during step (a) and after step (a).

The amount of nucleic acid (e.g. DNA) inactivation agent to be added to the sample will depend on various factors, including, for example, the concentration of cells present in the sample, the volume of the sample etc. In the case where an enzymatic nucleic acid (e.g. DNA) inactivation agent is added, it will be appreciated that a longer incubation could be applied in samples with high concentrations of mammalian cells, instead of increasing the amount of nucleic acid (e.g. DNA) inactivation agent that is added. With respect to DNA intercalating agents, e.g. PMA, a skilled person may vary the amount to be added to the sample, depending on for example whether an additional wash step will be carried out before microbial cell lysis. If a further step is not planned, then a skilled person may tailor the amount of PMA added to be saturated by the mammalian DNA present (i.e. so that no PMA remains to intercalate with any released microbial DNA).

In some embodiments, a step of separating microbial cells, from

supernatant comprising mammalian cell debris may be carried out in place of (or as well as) an incubation with a nucleic acid (e.g. DNA) inactivation agent. Thus, it may be possible to separate microbial cells from mammalian nucleic acids (e.g. DNA) and lysed mammalian cells after steps (a)-(b) or (a)-(c) have been carried out. This may be carried out as previously described, e.g. by centrifugation at at least 13000g or at least 16000g, by filtration or binding to a solid support. Particularly, centrifugation will allow the formation of a microbial cell pellet and the removal of mammalian nucleic acids (e.g. DNA)/cell debris in the supernatant. A step of resuspending any cell pellet formed may further be carried out, e.g. prior to microbial cell lysis. Thus, in this embodiment, a step of incubation with a nucleic acid (e.g. DNA) inactivation agent may be excluded or not carried out. Typically, a step of separating mammalian nucleic acids (e.g. DNA and/or RNA) and/or cell debris from microbial cells in a sample may be carried out with the exclusion of the use of a nucleic acid (e.g. DNA) inactivation agent if the sample has been exposed to more than one incubation with hypotonic solution. In this embodiment, the invention may specifically provide a method of enriching microbial nucleic acids (e.g. DNA) in a sample wherein said sample comprises microbial and mammalian cells, comprising the steps of:

(a) incubating said sample with a hypotonic solution,

(b) agitating said sample and hypotonic solution at a speed of at least

2000rpm, or a force equivalent thereto,

(c) repeating step (a) or steps (a) and (b) at least one time, and

(d) separating mammalian nucleic acids (e.g. DNA) from microbial cells in said sample.

A step of separating mammalian nucleic acids (e.g. DNA) from microbial cells may also be carried out between steps (b) and (c) of the above method.

In a particular embodiment, at least 80, 90, 95, 96, 97, 98, 99 or 100% of mammalian nucleic acids (e.g. at least 80, 90, 95, 96, 97, 98, 99 or 100% of DNA, RNA, or DNA and RNA together) released from mammalian cells after steps (a)-(b) or (a)-(c) may be inactivated by the nucleic acid (e.g. DNA) inactivation agent or separated from microbial cells in step (d). As discussed previously, the amount of mammalian nucleic acids (e.g. DNA or RNA) present may be determined by PCR or RT-PCR of mammalian genes (i.e. genes which are not present in microbial cells), such as TERT or RNASEP. In this regard, the amount of mammalian nucleic acid (e.g. DNA, RNA, or DNA and RNA) present may be determined prior to step (d) but after steps (a)-(b) or (a)-(c), and after step (d) and a comparison made.

Although several different nucleic acid inactivation agents and/or a mammalian nucleic acid separation step may be employed in the methods of the invention, the present inventor has identified that when a large amount of contaminating mammalian nucleic acids, and particularly DNA, are present in a sample (for example, greater than 1x 10⁷ cells), it may be preferable to use an endonuclease, particularly benzonase, as the nucleic acid inactivation agent to remove the mammalian nucleic acids from the sample. Other nucleic acid inactivation agents, or other nucleic acid removal methods may not be as effective at removing large amounts of mammalian nucleic acids as compared to the use of an endonuclease (and particularly benzonase) as the nucleic acid inactivation agent. As previously discussed, if the contaminating mammalian nucleic acids, and particularly DNA, (which may be present in a large amount) are not sufficiently reduced, this may affect the ability to sensitively and accurately detect any microbial nucleic acids present in the sample in any desired subsequent steps. Further, to prevent undesirable removal of microbial nucleic acids (e.g. DNA, RNA, or DNA and RNA) from the sample, any endonuclease used as a nucleic acid (e.g. DNA) inactivation agent (e.g. benzonase) must be inactivated and/or cleaved prior to microbial cell lysis. Whilst as discussed above, an endonuclease cleavage agent may be used to achieve endonuclease cleavage, this is not straightforward in the context of a method of enriching microbial nucleic acids in a sample. Proteinase K has been used in the art for the cleavage of benzonase, and commercial kits are available which utilise both benzonase and proteinase K in methods for enriching and detecting the presence of microbial DNA (e.g. QiaAmp DNA Microbiome Kit, Qiagen). However, proteinase K can cause microbial cell lysis (at a faster rate than it can cleave benzonase) and thus may result in the loss of microbial nucleic acids in a sample by benzonase activity, which may affect the sensitivity of the assay and the detection of microbial nucleic acids in later steps. The inventor has determined that the loss of microbial nucleic acids by benzonase can be prevented by the use of an endonuclease inactivation agent (e.g. a Mg ²⁺ and/or Mn²⁺ (particularly Mg²⁺) chelator, e.g. EDTA) instead of the endonuclease cleavage agent (e.g. Proteinase K or a functionally equivalent compound), or preferably by the use of an

endonuclease inactivation agent (e.g. a Mg ²⁺ and/or Mn²⁺ (particularly Mg²⁺) chelator, e.g. EDTA) together with an endonuclease cleavage agent (e.g.

Proteinase K or a functionally equivalent compound). Particularly, the use of EDTA and Proteinase K together to inactivate and cleave benzonase has been found to result in a particularly clean sample and thus allows the specific and sensitive detection of microbial nucleic acids without loss of microbial nucleic acids present. Specifically, the use of EDTA at a concentration of at least 5mM (e.g. at at least a concentration of 100, 200 or 250mM), and at a pH range of 7-9, and particularly at a pH range of 7.5-8.5, and most particularly at a pH of about 8, may allow the isolation of an optimally clean sample after incubation (and preferably washing). To the inventor’s knowledge, there is no suggestion or disclosure in the prior art to use both an endonuclease inactivation agent, such as EDTA, together with an endonuclease cleavage agent, such as proteinase K, to allow the development of an optimally sensitive assay, and to address the issue with microbial cell lysis when using an endonuclease cleavage agent, such as proteinase K alone.

In this respect, the present invention further provides a method for inactivating an endonuclease, comprising incubating said endonuclease with an endonuclease inactivation agent and an endonuclease cleavage agent.

Particularly, the invention provides a method for inactivating an endonuclease which requires the presence of Mg ²⁺ and/or Mn²⁺ for enzymatic function, comprising incubating said endonuclease with a chelator of Mg ²⁺ and/or Mn²⁺ and a protease.

In a more particular embodiment, the invention provides a method for inactivating benzonase comprising incubating benzonase with a chelator of Mg ²⁺ or Mn²⁺ (such as EDTA) and a protease (such as proteinase K or a functionally equivalent compound).

Alternatively viewed, the present invention provides a method for removing nucleic acids from a sample comprising a) incubating said sample with an endonuclease and b) incubating said sample and endonuclease with an

endonuclease inactivation agent and an endonuclease cleavage agent.

Particularly, the invention provides a method for removing nucleic acids from a sample, comprising a) incubating said sample with an endonuclease which requires the presence of Mg ²⁺ or Mn²⁺ and b) incubating said sample and endonuclease with a chelator of Mg ²⁺ or Mn²⁺ and a protease. Further, the invention provides a method for removing nucleic acids from a sample, comprising a) incubating said sample with benzonase and b) incubating said sample and benzonase with a chelator of Mg ²⁺ or Mn²⁺ (such as EDTA) and a protease (such as proteinase K or a functionally equivalent compound). In the above embodiments, the nucleic acids for removal may be mammalian DNA, mammalian RNA, or mammalian DNA and RNA (e.g. obtained by the lysis of mammalian cells). Further, the sample may comprise microbial cells.

In a particular embodiment, the invention provides a method for enriching microbial nucleic acids in a sample, wherein said sample is obtained by exposing a sample comprising mammalian and microbial cells to conditions which are capable of causing mammalian cell lysis but not microbial cell lysis comprising the steps of: a) incubating said sample with an endonuclease (e.g. an endonuclease which requires the presence of Mg ²⁺ and/or Mn²⁺ for function, such as benzonase); and

b) incubating said sample and endonuclease with an endonuclease

inactivation agent (e.g. a chelator of Mg ²⁺ and/or Mn²⁺, such as EDTA) and an endonuclease cleavage agent (e.g. a protease, such a proteinase K or a functionally equivalent compound).

In a further aspect, the present invention may also provide a method for enriching microbial nucleic acids in a sample, wherein said sample comprises microbial and mammalian cells comprising the steps of:

a) exposing said sample to conditions which are capable of causing

mammalian cell lysis but not microbial cell lysis;

b) incubating said sample with an endonuclease (e.g. an endonuclease which requires the presence of Mg ²⁺ and/or Mn²⁺ for function, such as benzonase), wherein said endonuclease is added prior to, simultaneously to or sequentially to step (a); and

c) incubating said sample and endonuclease with an endonuclease

inactivation agent (e.g. a chelator of Mg ²⁺ and/or Mn²⁺, such as EDTA) and an endonuclease cleavage agent (e.g. a protease, such a proteinase K or a functionally equivalent compound) after step (b).

As discussed extensively above, conditions which are capable of causing mammalian cell lysis but not microbial cell lysis may include exposure of a sample to a hypotonic solution, such as water, or exposure to any other known mammalian lysis buffer which is selective for mammalian cells but not for microbial cells (e.g. a chaotropic lysis buffer as used in the MoLysis assay (Molzym GmbH). Amounts of cell lysis (mammalian and microbial) which may be achieved using a mammalian cell lysis buffer are as discussed previously in relation to the use of a hypotonic solution.

The methods of the invention may further provide for an additional step of exposing the sample to microbial cell lysis conditions to be carried out. “Microbial cell lysis conditions” include any conditions which are known to be capable of causing the cell lysis of at least one type of microbial cell, as defined previously. Any known method can be used in the invention to achieve microbial cell lysis, including mechanical and chemical methods. Mechanical methods which may be used to achieve microbial cell lysis include sonication, agitation together with solid supports, e.g. beads, to allow homogenisation of the cells or the use of a French mill or cell mill. Particularly, in the present invention, beads may be used for mechanical disruption of microbial cells, e.g. an Omnilyser (Claremount Bio) may be used to achieve microbial cell lysis. Chemical methods which may be used include the addition of a microbial lysis buffer to the sample (e.g. to the microbial cell pellet, if a step of removing the nucleic acid (e.g. DNA) inactivating agent has been carried out), or the use of enzymes which are capable of degrading the cell wall and/or cell membranes of microbial cells.

Any microbial lysis buffer should be capable of causing lysis of microbial cells which are present within the sample. Particularly, the microbial lysis buffer may be capable of causing lysis of any microbial cell which is present in the sample, so that microbial nucleic acids (e.g. DNA) from all microbial sources may be detected if the enrichment method is used, e.g. for the purposes of sterility testing or for diagnostic purposes. However, where the enrichment method is used as part of a microbial detection method (discussed in detail below), where only specific microbes are to be detected, the enrichment method may only lyse the microbial cell types to be detected. Thus, in this instance, it may not be necessary to lyse all different types of microbial cells present, only those which it is desired to detect. Typically, the microbial lysis buffer may lyse at least 50, 60, 70, 80 or 90% of microbial cells present or of the microbial cell type which it is desired to detect.

The microbial lysis buffer may not be a hypotonic solution (e.g. as used in step (a) of some of the methods of the invention). Generally, it will be appreciated by a skilled person that the microbial lysis buffer which may be used (e.g. in step (f)) will be a buffer which is capable of affecting the integrity of the cell wall or of the cell wall and cell membrane of a microbial cell. Many microbial lysis buffers are available commercially, from various different suppliers, including for example, ThermoFisher Scientific, Gold Biotechnology and NZYTech. Further, chaotropic agents may be used to achieve microbial cell lysis, for example, if the concentration of chaotropic agent is greater than 4 or 5mol/l (e.g. guanidine hydrochloride or guanidine isocyanate).

Enzymatic methods for lysing microbial cells include the use of at least one enzyme that can disrupt the cell wall or the cell wall and membranes of at least one type of microbial cell. As discussed above in relation to the use of a microbial cell lysis buffer, in some instances, where the ultimate detection of one or more particular types of microbe is desired, it may only be necessary to lyse those microbial cell types. Microbes which are not to be specifically detected may or may not be subjected to lysis. Alternatively, where microbial presence perse is of interest, it may be desirable to lyse all microbial cells present, and thus it may be desirable to use one or more enzymes which are capable of lysing multiple types of microbes. A combination of enzymes may be used in the invention to ensure lysis of different microbial cell types which may be present and/or to ensure lysis of the cell wall and membrane.

Enzymes which can be used in the present invention for microbial cell lysis include lysozymes for prokaryotic cells, lyticase for yeasts, and chitinases for fungi. Proteases may be particularly employed for the degradation of both microbial prokaryotic and microbial eukaryotic cells. As discussed previously, proteinase K may be capable of microbial cell lysis.

Although one particular microbial cell lysis method may be sufficient to achieve lysis of microbial cells within the sample, a skilled person will appreciate that it would be possible to carry out one or more different types of method for microbial cell lysis, e.g. a combination of mechanical and chemical methods could be used if desirable.

Once microbial cell lysis has been carried out, the extracellular nucleic acids (e.g. DNA) present in the sample may be mainly microbial. Particularly, at least 80, 90, 95, 96, 97, 98 or 99% of the nucleic acids (e.g. of the DNA, RNA, or DNA and RNA) present may be microbial, and thus the sample may be considered to be enriched for microbial nucleic acids. As discussed previously, any enrichment of microbial DNA and/or RNA is representative of an enrichment in microbial nucleic acids in general.

The enrichment methods may be carried out as part of a method for determining whether a sample comprises microbial nucleic acids (e.g. DNA), or as part of a method for detecting the presence of microbial nucleic acids (e.g. DNA) in a sample (quantitative or qualitative). Either of these methods may be used for sterility testing purposes as previously described, i.e. to determine whether a sample is sterile or not, or for diagnostic purposes, i.e. to determine whether a subject (e.g. a human or animal subject) has an infection. The methods may further be used to test food or drink products for the presence of microbes, e.g. particularly for microbial cells which may be harmful to a subject upon ingestion. Levels or amounts of microbial cells present within a food or drink product may be determined and may be important for determining whether a product is fit for consumption. The methods of the invention may further be used to assess the microbial flora within a particular tissue in a subject, e.g. as a measure of health. Thus, it will be appreciated that particular levels of microbial cells of particular types may be beneficial in a subject, e.g. within the gut and the methods of the invention may be capable of assessing gut flora. In another embodiment, the methods of the invention may be used to enrich microbial cells or nucleic acids (e.g. DNA) in a sample for sequencing.

Thus, the methods may be used solely to determine the presence of any microbial nucleic acids (e.g. DNA, RNA, or both DNA and RNA) in a sample, and/or may additionally or alternatively be used to detect the presence of one or more particular microbes. A skilled person will appreciate that different microbes may be detected by established techniques such as PCR, or RT-PCR. The methods may also allow for the quantification of microbial nucleic acids (e.g. DNA, RNA, or both DNA and RNA) present, to determine the amount of microbial nucleic acids (for example of a particular type, e.g. DNA, or in total) within a sample, e.g. to determine the stage of infection of a subject, the amount of contaminating microbial nucleic acids (e.g. DNA) present or the health of a subject.

In a further embodiment, the present invention provides a method for determining whether a sample comprises microbial nucleic acids (e.g. DNA) comprising the steps of:

(a) incubating said sample with a hypotonic solution,

(b) agitating said sample and hypotonic solution at a speed of at least

2000rpm, or a force equivalent thereto,

(c) optionally repeating step (a) or steps (a) and (b) at least one time,

(d) incubating said sample with a nucleic acid (e.g. DNA) inactivation agent, wherein said nucleic acid (e.g. DNA) inactivation agent is added prior to, simultaneous to or sequentially to step (a) and/or separating mammalian nucleic acids (e.g. DNA) from microbial cells in the sample,

(e) optionally removing the inactivation agent,

(f) exposing the sample to microbial cell lysis conditions, and

(g) assaying the sample for microbial nucleic acids (e.g. DNA).

Alternatively, the present invention provides a method for determining whether a sample comprises microbial nucleic acids comprising the steps of:

a) exposing said sample to conditions which are capable of causing

mammalian cell lysis but not microbial cell lysis; b) incubating said sample with an endonuclease (e.g. an endonuclease which requires the presence of Mg ²⁺ and/or Mn²⁺ for function, such as

benzonase), wherein said endonuclease is added prior to, simultaneously to or sequentially to step (a);

c) incubating said sample and endonuclease with an endonuclease

inactivation agent (e.g. a chelator of Mg ²⁺ and/or Mn²⁺, such as EDTA) and an endonuclease cleavage agent (e.g. a protease, such a proteinase K or a functionally equivalent compound) after step (b);

d) exposing the sample to microbial cell lysis conditions and

e) assaying the sample for microbial nucleic acids.

The above methods therefore use the enrichment method for microbial DNA as set out and defined previously and provide an additional step of assaying the sample for microbial DNA. In this way, the methods are capable of determining whether microbial DNA is present within the sample. Hence, microbial DNA may or may not be present in a sample. It will be appreciated that one or more optional washing or DNA purification steps may be carried out (e.g. between steps (f) and (g) in the first method and between steps (d) and (e) in the second method), depending on the assay that is used to detect microbial DNA, using methods known in the art. For example, ZR columns (Sigma-Aldrich) may be used. A specific example of such a method of the invention is set out in Figure 14.

It will further be appreciated that assaying the sample for microbial nucleic acids may concern assaying the sample for microbial DNA, microbial RNA, or both of microbial DNA and RNA. Particularly, if microbial DNA is to be detected, it will be appreciated that the nucleic acid inactivation agent and/or separation step used or endonuclease used in the methods should be capable of inactivating and/or removing mammalian DNA, to allow for sensitive detection of the microbial DNA. In this instance, the nucleic acid inactivation agent and/or separation step, or endonuclease may additionally remove or inactivate mammalian RNA but this may not be necessary. Alternatively, if microbial RNA is to be detected, it will be appreciated that the nucleic acid inactivation agent and/or separation step or endonuclease used in the methods should be capable of inactivating and/or removing mammalian RNA, to allow for sensitive detection of the microbial RNA. In this instance, the nucleic acid inactivation agent and/or separation step, or endonuclease may or may not additionally remove or inactivate mammalian DNA.

In a particular embodiment, use of an endonuclease which removes mammalian DNA and RNA (e.g. benzonase) may allow detection of either microbial DNA and/or microbial RNA.

Assays which can be used for microbial nucleic acid (e.g. DNA) detection are well known in the art. Particularly, PCR can be used to detect microbial DNA. 16S rRNA, 18S rRNA and 23S rRNA gene PCRs are standard PCRs which are used to detect microbial DNA. Particularly, 16S and 23S rRNA gene PCRs are used in the art to detect bacterial DNA and 18S rRNA gene PCT is used in the art to detect fungi, yeast and mould. Any one or more of these PCRs may be employed in a step of assaying microbial nucleic acids of the invention (e.g. in step (g) or step (e) of the above methods of the invention). Microbial RNA may be detected using RT-PCR. As discussed previously, the step of assaying for microbial nucleic acids (e.g. steps (g) or (e) above) may be applied to determine whether one or more different types of microbial cell are present within a sample or may be used to determine whether any microbial cells are present within a sample. Thus, the detection method may specifically detect one or more microbial cell types or may generally detect the presence of microbial cells. Further, the method of detection may be quantitative or qualitative. Where specific detection of one or more particular types of microbial cell is required, the assay may involve a PCR which employs primers which bind to a DNA region associated with a particular type of microbial cell. Alternatively, where detection of any microbial cell is of interest, general PCR primers may be used. It may be desirable to carry out more than one assay in a step of assaying microbial nucleic acids of the invention (e.g. in step (g) or (e) of the above methods), e.g. where the detection of different types of microbial cell is required or where the result is required to be confirmed by different methods or where detection of both DNA and RNA is desired. As discussed above, the enrichment of any microbial cells present by the inactivation of contaminating mammalian nucleic acids (e.g. DNA) will result in a more sensitive detection step which may negate further assays from being run.

It will be appreciated in this instance, that it is possible that a sample may not comprise microbial cells. Thus, it is possible that a tested sample is sterile or that no infection has occurred.

The method of enriching microbial nucleic acids (e.g. DNA) in a sample can be used for the purpose of sterility testing or diagnostic testing as indicated previously. In this regard, the present invention further provides a method for sterility testing a sample comprising the steps of (a) incubating said sample with a hypotonic solution,

(b) agitating said sample and hypotonic solution at a speed of at least

2000rpm, or a force equivalent thereto,

(c) optionally repeating step (a) or steps (a) and (b) at least one time,

(e) optionally removing the inactivation agent from the sample,

(f) exposing the sample to microbial cell lysis conditions, and

(g) assaying the sample for microbial nucleic acids (e.g. DNA).

Alternatively, the present invention provides a method for sterility testing a sample comprising the steps of:

a) exposing said sample to conditions which are capable of causing

mammalian cell lysis but not microbial cell lysis;

b) incubating said sample with an endonuclease (e.g. an endonuclease which requires the presence of Mg ²⁺ and/or Mn²⁺ for function, such as

benzonase), wherein said endonuclease is added prior to, simultaneously to and/or sequentially to step (a);

c) incubating said sample and endonuclease with an endonuclease

d) exposing the sample to microbial cell lysis conditions and

e) assaying the sample for microbial nucleic acids (e.g. DNA).

In these methods, the identification of microbial nucleic acids (e.g. DNA) in the sample indicates that the sample is not sterile, and the lack of identification of microbial nucleic acids (e.g. DNA) is indicative of a sterile sample.

The invention additionally provides a method of diagnosing a microbial infection in a subject comprising the steps of:

(a) incubating a sample obtained from a subject with a hypotonic solution,

(b) agitating said sample and hypotonic solution at a speed of at least

2000rpm, or a force equivalent thereto,

(c) optionally repeating step (a) or steps (a) and (b) at least one time, (d) incubating said sample with a nucleic acid (e.g. DNA) inactivation agent, wherein said nucleic acid (e.g. DNA) inactivation agent is added prior to, simultaneous to and/or sequentially to step (a) and/or separating mammalian nucleic acids (e.g. DNA) from microbial cells in the sample,

(e) optionally removing the inactivation agent from the sample,

(f) exposing the sample to microbial cell lysis conditions, and

(g) assaying the sample for microbial nucleic acids (e.g. DNA).

Alternatively, the present invention provides a method of diagnosing a microbial infection in a subject comprising the steps of:

a) exposing said sample to conditions which are capable of causing

mammalian cell lysis but not microbial cell lysis;

c) incubating said sample and endonuclease with an endonuclease

d) exposing the sample to microbial cell lysis conditions and

e) assaying the sample for microbial nucleic acids (e.g. DNA).

The presence of microbial nucleic acids (e.g. DNA) in the sample may be indicative of an infection. The method may include additional steps of obtaining a sample from a patient and/or diagnosing the presence of a microbial infection in the subject. The subject may be any subject from which a sample may be obtained, as defined previously.

It will be appreciated by a skilled person that microbial nucleic acids (e.g. DNA) may be purified (e.g. cleaned) prior to any step of assaying or detecting the microbial nucleic acids (e.g. DNA), e.g. using well known methods or kits available commercially, e.g. AMPure (AutoQ Biosciences).

The present invention may additionally provide a kit for enriching microbial nucleic acids (e.g. DNA) in a sample comprising: a hypotonic solution, a nucleic acid (e.g. DNA) inactivation agent (e.g. benzonase), a chemical means for causing microbial cell lysis, (e.g. a protease or a microbial cell lysis buffer), and instructions for agitating the sample at a speed of at least 2000rpm or a force equivalent thereto. Particularly, the kit may further comprise EDTA (e.g. at pH 8 and/or at a concentration greater than 1 mM) and/or proteinase K.

In a further embodiment, the present invention may additionally provide a kit for inactivating an endonuclease comprising EDTA (e.g. at pH 8 and/or at a concentration greater than 1mM) and/or proteinase K. A kit for removing nucleic acids (e.g. DNA) from a sample or for enriching microbial nucleic acids (e.g. DNA) in a sample is also provided for wherein said kit comprises benzonase, EDTA (e.g. at pH 8 and/or at a concentration greater than 1 mM) and proteinase K.

As used throughout the entire application, the terms "a" and "an" are used in the sense that they mean "at least one", "at least a first", "one or more" or "a plurality" of the referenced components or steps, except in instances wherein an upper limit is thereafter specifically stated. The documents cited herein are hereby incorporated by reference.

The invention will now be described in more detail by reference to the following Examples and Figures:

Figure 1 shows a schematic method of the invention, depicting various method steps which may be carried out.

Figure 2 shows DAPI staining of cells at 10X magnification in isotonic solution (PBS) or hypotonic solution (water) taken on an NC3000.

Figure 3 shows DNA extraction using water only (T=0), water and 1 minute agitation at 3000RPM (T=1), water and 2 minute agitation at 3000RPM (T=2), and Full DNA extraction by (near)boiling cells for 10 minutes at 100°C.

Figure 4 shows the amount of DNA released from human, bacterial or yeast cells at TO after addition of hypotonic solution, or after 1min of vortex at 1400rpm or 2850rpm or after 1 min of multi-directional vortex at 2850rpm.

Figure 5 shows the percentage of DNA released from human, bacterial or yeast cells at TO after addition of hypotonic solution, or after 1 min of vortex at 1400rpm or 2850rpm or after 1 min of multi-directional vortex at 2850rpm.

Figure 6 shows DNA release from cells as an indication of cell lysis: human cells (HEK 293 E6; 10⁶), B.cepacia biomass (approximately 0.2mg), C. albicans biomass (approximately 0.2mg), were spun into a pellet and resuspended in 300 pi water and lysed by vortex for 1 minute at 1000 rpm, 1500 rpm, 2000, rpm , 2500 rpm and 2850 rpm. DNA concentration in the solution was measured by a nanodrop.

Figure 7 shows DNA remaining in the cell pellets after exposure to hypotonic solution and agitation at either 1000, 1500, 2000, 2500 or 2850rpm for 1 minute.

Figure 8 shows DNA lost from cell pellets after exposure to hypotonic solution and agitation at either 1000, 1500, 2000, 2500 or 2850rpm for 1 minute.

Figure 9 shows a specific process that may be used in the present invention.

Figure 10 shows an optimised process method of the present invention.

Figure 11 shows a microbial DNA purification process that may be used in the methods of the invention, e.g. prior to microbial DNA detection.

Figure 12 shows that EDTA can block benzonase activity.

Figure 13 shows that benzonase can lyse DNA and that EDTA can block benzonase activity. BE- benzonase and EDTA; W- water; E - EDTA (250mM) and BW - benzonase (0.5U) in water. BW is the only experiment where DNA is degraded.

Figure 14 shows the method steps of an exemplary method of the invention which employs benzonase, EDTA and proteinase K.

Figure 15 shows the number of bacterial genomes identified in samples contaminated with different amounts of human DNA. The results show that when benzonase, EDTA and proteinase K treatments are employed in the methods, it is possible to detect bacterial genomes in samples contaminated with 2 x 10⁷ human genomes with a similar sensitivity as compared to the detection of bacterial genomes in samples having much lower human DNA contamination.

Figure 16A and B shows that yeast genomes can also be detected in samples contaminated with 2 x10⁷ human genomes, when benzonase, EDTA and proteinase K are employed.

Figure 17A shows the PCR plate layout for analysis by ddPCR. B shows an alternative PCR plate layout for analysis by ddPCR (Hu = human, BC = B. cepacia, CA = C. albicans, ext water = extracted water control).

Figure 18 shows the detection of 250CFU a gram positive S. aureus in a background of a mixed population of 2x10⁷ human white blood cells. Examples

Example 1 - The use of hypotonic solution to burst cells.

Human (Jurkat) cells were treated with PBS or with water, stained with DAPI solution and loaded on a NC3000 cell counter.

It was observed that hypotonic solution inflates the cells and the membranes becomes permeable to DAPI stain (see Figure 2). The result reduced detection of human cells by about 4 CTs as measured by quantitative PCR (as per Example 2), that equates to a reduction in signal of approximately 94%, i.e. 6% of the human cells remain intact, which is an unacceptable level of human contamination for the sensitive detection of microbial nucleic acids in applications such as sterility testing.

Example 2 - Understanding how much of the DNA is being released from hypotonic cell lysis

10⁵ Jurkat cells were placed in water or in PBS and the DNA concentration was measured by Qubit broad range machine. Equivalent cell populations were additionally subjected to boiling to release all DNA for comparison with cells placed in water or PBS without boiling.

Results:

Water: 3 ng/mI, 2.8 ng/mI, 3.6 ng/mI

PBS: 0.78ng/pl, 0.92 ng/mI, 0.75ng/pl

Boiling PBS: 20ng/pl, 21.Sng/mI, N/A

Boiling Water : 18.2 ng/mI, 20.4 ng/mI, 22.3ng/pl

Conclusion: Although the hypotonic solution lyses a majority of human cells, only about 1/6^th of the cellular DNA is released from the cells (the remainder being associated with cellular debris).

Treated sample were then reacted with Benzonase (BZ), an endonuclease that breaks single strand and double strand DNA and RNA. BZ treatment demonstrates how much of the DNA is accessible to enzymatic treatment, i.e. is extracellular.

Benzonase (BZ) (25U/ml) in 25mM MgCI₂ was added to the samples for 30 minutes, and DNA concentration was measured:

BZ remaining DNA after water 30 minute: 1.3 ng/mI, 0.89 ng/mI, 1.1 ng/mI

BZ remaining DNA after PBS treatment: 3.7 ng/mI, 3.3ng/pl 3.7ng/pl These results are in accord with previous PCR results suggesting that approximately 94% of the DNA is exposed by water treatment.

Example 3 - Specific agitation lyses human cells over bacteria and yeast Agitation was investigated to determine whether any improvement to lysis of human cells could be achieved, whilst having minimal impact on bacteria and yeast cells.

Vortexing using at 1200rpm using a standard bench top vortexer was shown not to increase human cell lysis or DNA release (data not shown).

A Genie vortex cell disruptor was additionally tested, which shakes at 3000

RPM. Glass/zirconium beads were omitted to avoid damage to microbial cells, and thus for the lysis of human cells, hypotonic solution bloated cells were tested (300 pi in safety lock Eppendorf DNA low binding 1.5ml tubes Catalog No. 0030108035 Eppendorf).

Three species of cells were tested:

1. Human HEK293 6E (10⁷ cells)

2. 100 mI of Yeast glycerol stock, Candida albicans 5x10⁶ cells/mI

3. 100 mI Bacteria glycerol stock, Burkholderia cepacia 10⁷ cells/mI (calculated by genome number in a glycerol stock) Each sample was placed in triplicate of tubes, centrifuged for 1 minute at

13,000 x g and re-suspended in 500mI of PCR grade, UV treated water.

T=0: 15 mI of sample was placed into a 96 well plate in row A

T=1 minute: 15 mI of sample was placed into a 96 well plate in row B

T=2 minute: 15 m I of sample was placed into a 96 well plate in row C

Full extraction by boiling for 10 minutes: 15 mI of sample was placed into a

96 well plate in row D.

Results :

Table 2 - The DNA was read by nanodrop in ng/mI

Result description:

Assumptions:

1. hypotonic solution does not release DNA from bacteria and yeast.

2. Boiling cells for 10 minutes releases all the DNA from human bacteria and yeast

3. Number of expected genomes were underestimated:

Table 3

calculated from Molysis™ extractions that are clearly an

underestimation, probably due to DNA loss through extraction and clean up processes. It is also not known how much of the DNA is from non- viable cells.

Conclusions: ln order to enrich for bacteria, yeast and fungi in a mixed species samples it was hypothesised that mammalian cells will be more sensitive to osmotic pressure than bacteria and fungi which have a cell wall. Thus, adding hypotonic solution (distilled water) causes human cells that have no cell wall to inflate and burst, but most of the DNA remains bound to the cells and is not released to the media. Further, inflated cells do not always lyse and release their contents. To further lyse human cells with minimal effect of disrupting bacteria and yeast cells, it was hypothesised that a regular benchtop vortex at 1200RPM would be effective.

However, surprisingly, this agitation had no effect on the lysis of human cells or on DNA release. In view of this, a strong vortex was investigated, where agitation needed to be sufficiently strong to lyse human cells and release DNA but not to damage microbial cells present or to cause minimal damage to microbial cells. In this regard, it was identified that agitation at 3000RPM provided shearing forces which were shown to be sufficient to break human cells but not bacteria and yeast but not bacteria and yeast (see Figure 3).

It was also identified that 1 minute of agitation was sufficient to extract the majority of DNA from human cells and only a minimal amount of the bacteria and yeast DNA. The identified agitation did not increase the concentration of DNA in bacteria and yeast samples, but increased the concentration of DNA in human samples.

The identified method of using hypotonic solution, together with a step of specifically defined agitation, combined with a DNA removal step by an enzyme such as DNASE, benzonase or PMA treatment appears to represent an effective method to enrich for microbial DNA in a mixed sample.

Example 4 - Agitation using Vortex and multi-directional vortex

The methods described in Example 3 were repeated to investigate DNA release from human, bacterial and yeast cells at different RPM (1400 and 2850) using standard vortexing and at 2850RPM using multi-directional agitation (Genie vortexer).

Table 4 - shows amounts of DNA released from cells in

Table 5 -shows % of DNA released

Thus, the results show that agitation at even 1400rpm was not sufficient to improve the release of DNA from human cells. It can be seen that both agitation using standard vortexing and using multi-directional agitation results in an increase in the amount of DNA released from human cells (see Figures 4 and 5). The difference between the amount of DNA released with 2850rpm agitation and from boiling for human cells, is hypothesised to be due to the use of a container with a different volume, where a ratio of at least 1 :5 of sample volume Tube volume may result in an optimal result. Example 5 - Agitation using different speeds

Materials used:

1. 10mg of frozen bacteria B. cepacia diluted in 1.5 ml of water,

2. 10mg of frozen biomass C. albicans diluted in 1.5 ml of water,

3. HEK293 E6 suspension cells (3.3million/ml)

Human cells were set in tubes and centrifuged at 13,000 xg for 1 minute.

In Eppendorf tubes, samples were investigated in triplicate at 5 speeds.

15 human tubes in 300 mI of PCR grade water

15 yeast tubes and in 300 mI of PCR grade water

15 bacteria tubes in 300 mI of PCR grade water

Three tubes from each species were lysed in PCR grade water at 5 speeds.

A Genie digital vortex was set with a tube shaker head from a Genie Cell Disruptor (VWR), as the head can hold up to 12 tubes, the timer on the vortex was set to 1 minute and the speed to 1000 rpm.

This was repeated for 1500 rpm, 2000 rpm, 2500 rpm and 2850 rpm.

Immediately after a vortex step the samples were placed in a microcentrifuge and spun at 13,000 xg for 1 minute.

Each sample was transferred (100mI) into a 96 well PCR plate for a reading on a nano-drop to be taken. 2 pis were loaded on the pedestal of the nanodrop for reading.

The rest of the supernatant was discarded and the pellet was re-suspended again in 300 mI of water (300 mI).

The samples were then placed in a heat block for 10 minutes to lyse the cells in the pellet, then centrifuged at 13,000 xg for 3 minutes and DNA

concentration was measured on nanodrop.

Figures 6-8 show the results of the use of agitation at different speeds, where there appears to be a direct relation between vortex speed and DNA release in human cells. However, human cell lysis appears to cease at some point after addition of hypotonic solution, which is hypothesised to be due to salts being released from lysed cells. Thus, in some instances, it may be desirable to repeat the process.

Example 6 - Use of proteinase K and EDTA to inactivate benzonase

Human cell lysis - microbial enrichment step

Starting material: 1 mL samples with no more than 2x10⁷ human cells/mL in 1.5 locked cap Eppendorf tubes

1 mI_ Benzonase (Sigma- Aldrich) was directly added into each sample to digest cell free DNA and cells were centrifuged at >13,000 x g for 7 minutes. Media was aspirated without disturbing the pellet. 1 ml of human DNA removal solution was added to the pellet (1 ml water (ultra pure, Thermo Fisher, supplemented with 1 mI_ benzonase >250u/1 mI_) and samples were placed into a Genie cell disruptor at 2850 rpm for 1 minute. Tubes were incubated at 37°C for 10 minutes to allow the benzonase to lyse cell-free DNA, and were subsequently centrifuged (>13,000 x g for 7 minutes). The benzonase blocking solution (80mI EDTA 0.5M ultra pure and 20mI Proteinase K (>800U/ml)) was then added to each sample to stop benzonase activity. Samples were incubated for 10 minutes at 37°C and centrifuged briefly. Identification of optimal EDTA concentration for use in the benzonase blocking solution involved the testing of various EDTA concentrations in the method, e.g. from 5mM to 500mM. As shown in Figure 12, EDTA can block benzonase activity, and in Figure 13 that benzonase can inactivate DNA and that EDTA can block benzonase activity.

Microbial cell lysis

The sample was drawn into a Omni Lyse® cartridge (Gentaur) with attached syringe, in accordance with manufacturer’s instructions. The device was turned on and sample was withdrawn and infused in the device for 30 seconds to lyse cells. Samples were cleaned using a ZR mini kit (A63881 , Cambridge Bioscience), and DNA concentration measured using a Qubit dsDNA BR Assay (ThermoFisher). If necessary, DNA concentrations were adjusted to 10ng/mI. ddPCR preparation method PCR master mix preparation:

Three master mixes were used to test for human (RNASEP), bacteria (16S) and yeast (18S) nucleic acids:

PCR primers and probes

Name Sequence

FAM- TAK{GGTCGC}A{AG}-BHQ1

YGGCACCTTYCGAGAAATCAAA

GACCTGGTGAGTTTCCCCG

18S-001-F3 CGGCACCCGAAGAGAAATCTTT

RNaseP (TaqMan Copy Number 10535585 (Life-Technologies)

Reference Assay, human)

Table 6: PCR primers and probes. All primers and probes above are RP-FIPLC cleaned, obtained from Eurogentec, and reconstituted into TE buffer at 100mM concentration as a stock solution. {}- LNA (Locked Nucleic Acids). Letters represent nucleotides according to IUPAC degenerate code: A, Adenine. C, Cytosine. G, Guanine. T, Thymine. R, A or G. Y, C or T. S, G or C. W, A or T. K, G or T.

M, A or C. B, C or G or T. D, A or G or T. FI, A or C or T. V, A or C or G. FAM = 6-carboxyfluorescein. BFIQ1 = Black Hole Quencher-1.

The mastermix for RNASEP 20x was obtained from Life Technologies as shown in Table 6. Mastermixes for 16S and 18S detection were prepared as shown in tables 7 and 8.

Reagent Concentration Volume (500pL 20X stock)

Table 7: 18S-001 20X assay mix preparation _

Reagent Concentration Volume (500 L20X stock)

Water N/A 370pL

Table 8: 185-466 20X assay mix preparation 1.1 mI_ of each 20X master mix (Table 7 for 18S, Table 8 for 16S, RNaseP is ready 20X assay mix) was mixed separately with 11 mI_ of ddPCR Supermix

(BioRad) for every sample (Table 9) and placed into a well of a ddPCR plate.

Reagent Concentration 1 well 8 wells 24 wells 26 wells

20X assay mix (18S- 20C 1.1 mI_ 10mI_ 26mI_ 28.6mI_

001/16S-466/RNaseP

Table 9: ddPCR mastermix preparation

The master plate lay out can be seen in Figure 17A. 9.9mI_ of ultra-pure water (Invitrogen) was added into the wells in row A and 9.9mI_ of DNA samples was added to columns in rows B to G. 9. 9mI_ of positive control DNA was added to row H. An AutoDG Droplet Digital System (BioRad) was used to generate droplets for ddPCR in accordance with manufacturer’s instructions. An alternative master plate layout is shown in Figure 17B. This alternative layout includes two“in process” controls: water and extracted water. The latter is (commercially available) nuclease-free water which is run through the protocol as per Example 6 and then analysed by ddPCR with the other samples.

PCR conditions

The PCR plate was subsequently placed in a thermocycler (Veriti ABI) and the following PCR programme applied 10 minutes 95°C, 30 seconds 94°C, 15 seconds 59°C, and 45 seconds 72°C, for 45 cycles, then 98°C for 10 minutes and hold at 4°C. Ramp rate for the cycles was set to 50% on the Verity thermocycler 0.2ml 96well head, which is equivalent to 2°C/second. After PCR, the sealed 96- well plate was placed in a QX200 Droplet Reader to obtain the results. Example 7 - Use of proteinase K, EDTA and benzonase allows for sensitive detection of microbial nucleic acid from samples with high levels of mammalian nucleic acid contamination

Samples of increasing concentrations of bacterial cells were spiked with 2.5 x10⁶, 5 x10⁶, 1 x10⁷ or 2x10⁷ of human cells. Human cell lysis/microbial enrichment, followed by microbial cell lysis and ddPCR were carried out as in Example 6 and the number of bacterial genomes in each sample detected. As shown in Figure 15, using benzonase, EDTA and proteinase K treatment, it was possible to detect bacterial genomes in samples contaminated with 2x10⁷ of human cells with a similar sensitivity to the detection of bacterial genomes in samples with lower levels of human DNA contamination.

The experiment was repeated using a single concentration of human cell contaminants (2x10⁷ human cells) to detect yeast (C. albicans) genomes. As shown in Figure 16, using benzonase, EDTA and proteinase K treatment, it was possible to detect yeast genomes in samples contaminated with 2x10⁷ of human cells.

Example 8 - Use of proteinase K, EDTA and benzonase allows for sensitive detection of gram-positive bacterial nucleic acid from samples with high levels of mammalian nucleic acid contamination

Samples of S. aureus contaminated with non-clonal human white blood cells were tested according to the methods of Example 6.

A leukopak (Hemacare Corp.) was processed to remove red blood cells, platelets and plasma using a Lovo device (Fresenius Kabi) according to

manufacturer’s protocols. CD4/CD8⁺ cells were then selected using Miltenyi reagents and a CliniMACS plus device (both Miltenyi Biotech) according to the manufacturer’s protocol to obtain a mixed population of white blood cells.

A sample of 2x10⁷ cells from this white blood cell population was then spiked with 250 CFU of S. aureus and assayed according to the methods of Example 6.

As shown in Figure 18, using benzonase, EDTA and proteinase K treatment, it was possible to detect 250 CFU S. aureus in samples contaminated with a mixed population of 2x10⁷ of human white blood cells.

Claims

1. A method of enriching microbial nucleic acids, particularly DNA, in a sample wherein said sample comprises microbial and mammalian cells, comprising the steps of:

(a) incubating said sample with a hypotonic solution,

(b) agitating said sample and hypotonic solution at a speed of at least 2000rpm, or a force equivalent thereto,

(c) optionally repeating step (a) or steps (a) and (b) at least one time, and (d) incubating said sample with a nucleic acid inactivation agent, wherein said nucleic acid inactivation agent is added prior to, simultaneously to and/or sequentially to step (a), and/or separating mammalian nucleic acids from microbial cells in the sample.

2. The method according to claim 1 , wherein said method further comprises the steps of:

(e) optionally removing the inactivation agent from the sample, and

(f) exposing the sample to microbial cell lysis conditions.

3. A method for determining whether a sample comprises microbial nucleic acids, particularly DNA, comprising the steps of:

(a) incubating said sample with a hypotonic solution,

(c) optionally repeating step (a) or steps (a) and (b) at least one time,

(d) incubating said sample with a nucleic acid inactivation agent, wherein said nucleic acid inactivation agent is added prior to, simultaneous to and/or sequentially to step (a), and/or separating mammalian nucleic acids from microbial cells in the sample,

(e) optionally removing the inactivation agent from the sample,

(f) exposing the sample to microbial cell lysis conditions, and

(g) assaying the sample for microbial nucleic acids.

4. The method of claim 3 wherein said method is used to sterility test a sample or to diagnose a microbial infection in a subject.

5. The method of any one of claims 1 to 4, wherein said hypotonic solution is water.

6. The method of any one of claims 1 to 5, wherein step (c) is carried out one or two times.

7. The method of any one of claims 1 to 6, comprising a step of cell separation or concentration between steps (b) and (c) or (b) and (d).

8. The method of any one of claims 1 to 6 wherein said sample and hypotonic solution in step (b) have a volume of less than 25% of the volume of their container.

9. The method of any one of claims 1 to 8 wherein step (b) is carried out for between 1-5 minutes.

10. The method of any one of claims 1 to 9, wherein said sample and hypotonic solution is agitated at a speed of at least 2800rpm, or a force equivalent thereto.

11. The method of any one of claims 1 to 10, wherein said agitation of step (b) is multi-directional agitation.

12. The method of any one of claims 1 to 11 , wherein said agitation of step (b) is carried out by vortexing, or pipetting said sample and hypotonic solution.

13. The method of any one of claims 1 to 12, wherein between 1-2% of cells remaining after step (d) are mammalian.

14. The method of any one of claims 1 to 13, wherein said nucleic acid

inactivation agent is a DNA inactivation agent, particularly, an agent which degrades DNA or which intercalates with DNA.

15. The method of claim 14, wherein said DNA inactivation agent is a DNase, benzonase or PMA.

16. The method of any one of claims 2 to 15, wherein when said nucleic acid inactivation agent is benzonase, step (e) comprises incubating said sample with EDTA and/or proteinase K.

17. The method of claim 16 wherein step (e) comprises incubating said sample with EDTA and proteinase K.

18. The method of any one of claims 1 to 17, wherein said nucleic acid

inactivation agent is added to the hypotonic solution prior to addition to the sample.

19. The method of any one of claims 2 to 18, wherein said microbial cell lysis conditions are mechanical or chemical.

20. The method of claim 19, wherein mechanical cell lysis conditions are

selected from sonication, agitation together with solid supports, particularly beads, or the use of a French mill or cell mill.

21. The method of claim 19, wherein the chemical cell lysis conditions are

selected from the use of a microbial cell lysis buffer and/or at least one cell wall degrading enzyme.

22. The method of claim 3 or 4, wherein step (g) quantifies microbial nucleic acids, particularly DNA, and/or identifies one or more microbes from which the nucleic acids, particularly DNA, originated.

23. The method of any one of claims 3, 4 or 22, wherein the presence of

microbial DNA is determined by PCR and/or the presence of microbial RNA is determined by RT-PCR.

24. The method of anyone of claims 3 to 23, wherein i) when microbial DNA is assayed in step (g), said nucleic acid inactivation agent is a DNA inactivation agent and/or an agent which can inactivate DNA and RNA, or ii) when microbial RNA is assayed in step (g), said nucleic acid inactivation agent is a RNA inactivation agent and/or an agent which can inactivate DNA and RNA.

25. A kit for enriching microbial nucleic acids, particularly DNA, in a sample comprising a hypotonic solution, a nucleic acid inactivation agent, a chemical means capable of causing microbial cell lysis and instructions for agitating the sample at a speed of at least 2000rpm or a force equivalent thereto.

26. The kit of claim 24 wherein said nucleic acid inactivation agent is

benzonase.

27. The kit of claim 25 wherein said kit further comprises EDTA and proteinase

K.

28. A method for enriching microbial nucleic acids in a sample, wherein said sample comprises microbial and mammalian cells comprising the steps of: (a) exposing said sample to conditions which are capable of causing

mammalian cell lysis but not microbial cell lysis;

(b) incubating said sample with an endonuclease wherein said endonuclease is added prior to, simultaneously to and/or sequentially to step (a); and

(c) incubating said sample and endonuclease with an endonuclease

inactivation agent and an endonuclease cleavage agent after step (b).

29. The method of claim 28 wherein said endonuclease is benzonase, said endonuclease inactivation agent is EDTA and said endonuclease cleavage agent is proteinase K.