WO2019112996A1

WO2019112996A1 - Method and compositions for treating obesity and insulin resistance

Info

Publication number: WO2019112996A1
Application number: PCT/US2018/063740
Authority: WO
Inventors: Deepa SATHYASEELAN
Original assignee: Oklahoma Medical Research Foundation
Priority date: 2017-12-04
Filing date: 2018-12-04
Publication date: 2019-06-13

Abstract

The present invention provides a method of treating obesity in a patient by upregulation of mitochondrial chaperones comprising the steps of: providing a pharmaceutically effective amount of a cDNA composition encoding one or more cellular proteins to increase the one or more cellular proteins in the cell and reduced adiposity in the patient.

Description

METHOD AND COMPOSITIONS FOR TREATING OBESITY AND INSULIN

RESISTANCE

Technical Field of the Invention

The present invention relates generally to methods and compositions used to treat obesity and insulin resistance by the inhibition of Caseinolytic peptidase P.

Background Art

Patent Application Serial No PCT/US2017/022584 entitled, "Methods and compositions for treating obesity and/or diabetes and for identifying candidate treatment agents," discloses methods and compositions for identifying candidate agents for treatment of obesity and/or diabetes, e.g., contacting a mammalian cell or cell population with a test agent, and measuring an expression level and/or activity level of ClpP in the mammalian cell or in cells of the cell population. Also disclosed are methods and compositions for treating an individual (e.g., one who is obese and/or has diabetes) by administering an inhibitor of ClpP to the individual to prevent or reduce weight gain, to increase insulin sensitivity, and/or to increase glucose tolerance.

Mitochondria are critical for the normal function of eukaryotic cells through production of ATP by oxidative phosphorylation, maintenance of calcium homeostasis, regulation of programmed cell death and generation and control of reactive oxygen species (Wallace DC et al., 2010, Orrenius S et al., 2007). The mitochondrion has evolved its own quality control system consisting of proteases and chaperones that helps to maintain protein homeostasis within the organelle that in turn preserves mitochondrial integrity (Baker BM et al., 2011). The quality control (QC) proteases help to maintain mitochondrial proteo stasis through degradation of misfolded or damaged proteins. These proteases are present in the outer membrane (ubiquitin- proteasome system), inner mitochondrial membrane (PARL, OMA1, YME1L1, AFG3L2 and paraplegin), the intermembrane space (HtrA2) and mitochondrial matrix (Lon and ClpXP) (Voos W et al., 2016). Because of the critical role played by the QC proteases, it is not surprising that failure of the QC system has been linked to various neurological diseases and aging (Luce K et al., 2010, Casari G et al., 1998; Di Bella D et al., 2010; Jensen MB & Jasper H, 2014). Dysfunction of the mitochondrial QC system is also an important determinant of metabolic health (Held NM and Houtkooper RH, 20 IS). For example, the QC protease PARL is reduced in type 2 diabetic patients and elderly subjects and muscle-specific knockdown of PARL reduces mitochondrial content and impair insulin signaling (Civitarese AE et al., 2010). Similarly, loss of the inner mitochondrial membrane protease Omal causes obesity and defective thermogenesis in mice (Quiros PM et al., 2012). Caseinolytic peptidase P (ClpP) is a highly conserved protease from bacteria to humans. ClpP lacks ATPase activity and multimerizes with the mitochondrial chaperone and ATPase, ClpX to form the functional protease ClpXP. ClpP plays a critical role in the activation of mitochondrial unfolded protein response (UPR"*) in C. elegans, a retrograde signaling response that induces the expression of mitochondrial chaperones Hsp60 and Hsp6. The peptides generated through the proteolytic cleavage of unfolded proteins initiate the UPR"* response in C. elegans (Haynes CM et al., 2007, 2010). In mammalian cells, accumulation of unfolded proteins in mitochondrial matrix results in the transcriptional upregulation of mitochondrial stress proteins Hsp60, HsplO, Hsp40 and ClpP (Zhao Q et al., 2002; Houtkooper RH et al, 2013). While the role of ClpP in mammalian UPR"* is not clear, a potential involvement of ClpP in mitochondrial peptide release, similar to C. elegans has been suggested (Rath E et al., 2012). In addition to its proposed role in UPR"*, ClpP is known to be involved in other functions of the cell, e.g. knockdown of ClpP in muscle cells causes mitochondrial dysfunction and reduces cell proliferation (Deepa SS et al., 2016), and ClpP is also involved in the regulation of mitochondrial protein synthesis through mitochondrial ribosome assembly (Szczepanowska K et al., 2016). In agreement with the important roles of ClpP, ClpP deficiency in humans is associated with several neurodegenerative diseases such as spastic paraplegia, Friedreich's ataxia, Parkinson's disease, and recessive mutations in ClpP causes Perrault syndrome in humans, characterized by sensorineural deafness and ovarian failure (Hansen J et al.,2008; Guillon B et al., 2009; Jenkinson EM et al., 2013).

Acquired obesity in humans is associated with an impaired UPR"* response in subcutaneous WAT (sWAT) suggesting a possible relationship between metabolic stress and UPR"* (Jukarainen S et al., 2016). Because ClpP is proposed to play an important role in UPR"*, we used mice deficient in ClpP ( ClpP-/- mice) to understand the role of UPR^-mediated proteostasis in metabolism. ClpP-/- mice recapitulate the phenotypes of Perrault syndrome in humans and are characterized by mild mitochondrial dysfunction, up-regulation of mitochondrial chaperones, and accumulation of ClpX and mtDNA in various tissues (Gispert S et al., 2013). We hypothesized that a defective UPR"* response and mitochondrial dysfunction due to ClpP deficiency will cause insulin resistance in ClpP-/- mice. In contrast, ClpP-/- mice fed ad libitum showed improved insulin sensitivity, have reduced adiposity and elevated mitochondrial respiration in WAT. When challenged with a metabolic stress such as high fat diet, ClpP-/- mice are protected from diet-induced obesity, hepatic steatosis, glucose intolerance and insulin resistance. Our findings suggest that compensatory responses due to ClpP-deficiency could contribute to the beneficial metabolic effects in ClpP-/- mice and raises new questions regarding the role of ClpP in the initiation of UPR"*. Disclosure of the Invention

Caseinolytic peptidase P (ClpP) is a quality control protease that is proposed to play an important role in the initiation of the mitochondrial unfolded protein response (UPR"*), a retrograde signaling response that helps to maintain mitochondrial function, in mammals. Mitochondrial dysfunction is associated with the development of metabolic disorders, and to understand the effect of a defective UPR"* on metabolism, ClpP knockout ClpP-/-) mice were used. ClpP-/- mice fed ad libitum have reduced adiposity and paradoxically improved insulin sensitivity. Absence of ClpP increased whole body energy expenditure and markers of mitochondrial biogenesis are selectively up-regulated in the white adipose tissue (WAT) of ClpP-/- mice. When challenged with a metabolic stress such as high fat diet, despite similar caloric intake, ClpP-/- mice are protected from diet-induced obesity, glucose intolerance, insulin resistance, and hepatic steatosis. Our results show that absence of ClpP triggers compensatory responses in mice and suggest that ClpP might be dispensable for mammalian UPR"*. Thus, we made an unexpected finding that deficiency of ClpP in mice is metabolically beneficial.

The present invention provides a method of treating obesity in a patient by upregulation of mitochondrial chaperones comprising the steps of: providing a pharmaceutically effective amount of a cDNA composition encoding one or more cellular proteins to increase the one or more cellular proteins in the cell and reduced adiposity in the patient The one or more cellular proteins may be selected from Lon protease, Hsp60, Hsp40, HsplO, ClpX, OPA1, PGC-la, Tfam, and VDAC.

The present invention provides a method of treating obesity in a patient by down-regulation of one or more mitochondrial proteases comprising the steps of: providing a pharmaceutically effective amount of a mitochondrial protease antagonist to the patient, wherein the mitochondrial protease antagonist interacts to reduce the level of mitochondrial protease in a patient; and reducing the availability of the mitochondrial protease and increasing the levels of one or more cellular proteins and reduce adiposity in the patient. The one or more cellular proteins may be mitochondrial chaperones and the mitochondrial protease. The one or more cellular proteins may be selected from Lon protease, Hsp60, Hsp40, HsplO, ClpX, OPA1, PGC-la, Tfam, and VDAC. The mitochondrial protease antagonist may be a cDNA composition encoding a peptide that down regulates the mitochondrial protease. The mitochondrial protease antagonist may be a cDNA composition encoding a peptide that binds the mitochondrial protease. The mitochondrial protease may be a mitochondrial matrix protease. The mitochondrial protease may be a caseinolytic peptidase. The mitochondrial protease interacts to reduce a caseinolytic peptidase multimerization with a mitochondrial chaperone. The mitochondrial protease interacts to reduce the formation of a ClpXP protease. The present invention provides a cDNA composition encoding a peptide selected from Lon protease, Hsp60, Hsp40, HsplO, ClpX, OPA1, PGC-la, Tfam, and VDAC.

The present invention provides a method of treating a disease in a patient by ^regulation of mitochondrial chaperones comprising the steps of: providing a pharmaceutically effective amount of a cDNA composition encoding one or more cellular proteins to increase the one or more cellular proteins in the cell and reduced one or more symptom of the disease in the patient The disease may be obesity, diabetes, hepatic steatosis, glucose intolerance, insulin resistance.

The present invention provides a method for promoting weight loss or facilitating maintenance of a stable weight, the method comprising administering to an obese or overweight human individual in need thereof a pharmaceutically effective amount of a mitochondrial chaperone antagonist, whereby weight loss is promoted or maintenance of a stable weight is facilitated.

Description of the Drawings

For a more complete understanding of the features and advantages of the present invention, reference is now made to the detailed description of the invention along with the accompanying figures and in which:

FIGS. 1A-1H illustrate ClpP-/- mice have reduced adiposity and elevated respiration in WAT.

FIG. 2A shows a plot showing fat mass and lean mass in WT and ClpP-/- male mice, assessed by QMR imaging. FIG. 2B is a plot showing body weights of WT, ClpP+/- and ClpP-/- female mice fed ad libitum at 5 months of age. FIG. 2C is a plot showing fat mass and lean mass in WT, ClpP+/- and ClpP-/- mice, assessed by QMR imaging and normalized to body weight FIG. 2D is a plot showing Transcript levels of PPARy, aP2 and CEBPa in gWAT of WT, ClpP+/- and ClpP-/- male mice fed ad libitum at 5 months of age. FIG. 2E is a western blot showing protein expression of ClpP and β-tubulin in differentiated 3T3-L1 control or ClpP knockdown (KD) adipocytes (left panel). Quantification of ClpP normalized to β-tubulin is shown in the right panel. FIG. 2F is a plot showing cellular bioenergetics in differentiated 3T3-L1 control or ClpP KD adipocytes measured using the Seahorse Bioscience XF24 Extracellular Flux Analyzer mitostress assay (left panel). Graphical representation of the obtained values normalized to protein concentration per well (right panel).

FIGS. 3A-3H illustrate that markers of mitochondrial biogenesis, mitochondrial chaperones, and mitochondrial fission/fusion regulator OPA1 are elevated in gWAT of ClpP-/- mice.

FIGS. 4A-4C show in each left panel: Immunoblots of sWAT and BAT extracts from WT and ClpP-/- mice for Lon, Hsp60, Hsp40, and

FIGS. 4A-4C show in

each right panels: graphical representation of quantified blots normalized to P-tubulin/p-actin. WT-white bars, ClpP+/- -grey bars, ClpP-/- -black bars.

FIGS. SA-SH depict that absence of ClpP increases whole body energy expenditure, and increases mitochondrial uncoupling and alters expression of metabolic enzymes in gWAT

FIG. 6A shows results for markers of browning/beiging in sWAT. FIG. 6B shows Western blotting to assess protein expression of UCP1 in BAT showed no significant change in UCP1 expression.

FIGS. 7A - 7H demonstrate that ClpP-/- mice exhibit improved insulin sensitivity.

FIG. 8 A shows representative images of WT and ClpP-/- mice after 10 -weeks of LFD or HFD feeding. FIG. 8B shows food consumption of WT, ClpP+/- and ClpP-/- mice fed HFD, normalized to body weight. WT-white bars, ClpP+/- -grey bars, ClpP-/- -black bars.

FIGS. 9A-9I show ClpP-/- mice are resistant to diet-induced obesity and are protected from HFD-diet induced glucose intolerance and insulin resistance.

FIGS. 10A-10E reveal that mitochondrial respiration is increased in gWAT of HFD-fed ClpP-/- mice.

FIGS. 11A-11B show elevated mitochondrial biogenesis markers are preserved in gWAT of HFD fed ClpP-/- mice.

FIGS. 12A-12C is a table showing fatty acid metabolism data. FIGS. 12D-12E is a table showing glucose metabolism data. FIGS. 12F-12H is a table showing TCA cycle and ETC data. FIGS. 12I-12J is a table showing stress response data.

Description of Embodiments

While the making and using of various embodiments of the present invention are discussed in detail below, it should be appreciated that the present invention provides many applicable inventive concepts that can be embodied in a wide variety of specific contexts. The specific embodiments discussed herein are merely illustrative of specific ways to make and use the invention and do not delimit the scope of the invention.

To facilitate the understanding of this invention, a number of terms are defined below. Terms defined herein have meanings as commonly understood by a person of ordinary skill in the areas relevant to the present invention. Terms such as "a", "an" and "the" are not intended to refer to only a singular entity, but include the general class of which a specific example may be used for illustration. The terminology herein is used to describe specific embodiments of the invention, but their usage does not delimit the invention, except as outlined in the claims. ClpP-/- mice have reduced adiposity and white adipocytes from ClpP-/- mice exhibit increased respiration. Gispert S et al (2013) reported that ClpP-/- mice have reduced gain in body weight compared to wild-type (WT) littermates. In our cohort, we also found reduced weight gain in ClpP-/- mice and at 5 months of age ClpP-/- male mice have 28% reduction in body weight compared to WT littermates or CIpP^+/- mice, despite increased food consumption by ClpP-/- mice (34% more compared to WT) (FIGS. 1A and IB).

FIGS. 1A - 1H illustrate ClpP-/- mice have reduced adiposity and elevated respiration in WAT. (FIG. 1A) Body weights of WT, ClpP+/- and ClpP-/- male mice fed ad libitum at 5 months of age. (FIG. IB) Food consumption of WT, ClpP+/- and ClpP-/- mice fed ad libitum, normalized to body weight. (FIG. 1C) Fat mass and lean mass in WT, ClpP+/- and ClpP-/- mice, assessed by QMR imaging and normalized to body weight FIGS. ID, 1H and IE staining of gWAT sections of WT and ClpP-/- mice (left panel) and quantification of the average adipocyte area of gWAT sections (right panel). (FIG. IE) Oil red O staining of differentiated adipocytes from WT, ClpP+/- and ClpP-/- mice (left panel). Quantification of total oil red O extracted from differentiated adipocytes (right panel). Data shown are mearttSEM from three independent experiments. (FIG. IF) Graphical representation of cellular bioenergetics in differentiated primary adipocyte cultures from WT, ClpP+/- and ClpP-/- mice were measured using the Seahorse Bioscience XF24 Extracellular Flux Analyzer mitostress assay and the obtained values were normalized to protein concentration per well. Data represents mearttSEM from three independent experiments. (FIG. 1G) Immunostaining of differentiated adipocytes from WT and ClpP-/- mice using Tom20 antibody. (FIG. 1H) Electron micrographs of gWAT from WT and ClpP-/- mice. Magnification 5000x. Data shown are meartfcSEM. WT -white bars, ClpP+/- -grey bars, ClpP-/- -black bars. *WT vs ClpP-/-; #ClpP+/- vs ClpP-/-. */#p<0.05.

FIG. 2A shows fat mass and lean mass in WT and ClpP-/- male mice, assessed by QMR imaging. (FIG. 2B) Body weights of WT, ClpP+/- and ClpP-/- female mice fed ad libitum at 5 months of age. (FIG. 2C) Fat mass and lean mass in WT, ClpP+/- and ClpP-/- mice, assessed by QMR imaging and normalized to body weight (FIG. 2D) Transcript levels of PPARy, aP2 and CEBPa in gWAT of WT, ClpP+/- and ClpP-/- male mice fed ad libitum at 5 months of age. (FIG. 2E) Westernblots showing protein expression of ClpP and β-tubulin in differentiated 3T3- Ll control or ClpP knockdown (KD) adipocytes (left panel). Quantification of ClpP normalized to β-tubulin is shown in the right panel. (FIG. 2F) Cellular bioenergetics in differentiated 3T3- Ll control or ClpP KD adipocytes measured using the Seahorse Bioscience XF24 Extracellular Flux Analyzer mitostress assay (left panel). Graphical representation of the obtained values normalized to protein concentration per well (right panel). Data represents mean±SEM from three independent experiments. WT/Control-white bars, ClpP+/- -grey bars, ClpP-/-/ClpPKD- black bars. Data shown are mean±SEM. WT -white bars, ClpP+/- -grey bars, ClpP-/- -black bars. *WT/Control vs ClpP-/-/ClpPKD; #ClpP+/- vs ClpP-/-. */#p<0.05. Body composition analysis using quantitative magnetic resonance showed that CIpP^+/- mice have 64% reduction in fat mass and 24% reduction in lean mass (FIG. 2A). After normalizing to body weight, fat mass in CIpP^+/- mice showed 38% reduction compared to WT, whereas lean mass showed a tendency to increase but did not reach statistical significance (FIG. 1C). This suggests that reduced body weight in CIpP^+/- mice is attributable to reduced fat mass. Body weight, food intake, fat mass and lean mass of CIpP^+/- mice was similar to WT littermates (FIGS. 1A-C). CIpP^+/- female mice (5- month-old) also showed a reduction in body weight and fat mass, comparable to male mice (FIGS. 2B and 2C). Consistent with the finding that ClpP¹'^' mice have reduced fat mass, FIGS 1H and IE staining of gonadal white adipose tissue (gWAT) showed smaller adipocytes (37% reduction in adipocyte area) in ClpF'^' mice compared to adipocytes in WT mice (FIG. ID). Transcript levels of adipocyte differentiation factors peroxisome proliferator activated receptor gamma (PPARy), CCAAT/enhancer-binding protein alpha (C/ΕΒΡα) and adipocyte protein 2 (aP2) in gWAT were similar in CIpP^+/- and WT mice suggesting that the reduction in fat mass in CIpP^+/- mice is not due to impaired adipocyte differentiation (FIG. 2D).

Because ClpP is a major quality control protease in the mitochondria, we tested whether deficiency of ClpP altered mitochondrial function in white adipocytes. Pre-adipocytes were isolated from WT, CIpP^+/- and CIpP^+/- mice and differentiated into mature adipocytes. Differentiated adipocytes from ClpF'^' mice accumulated 50% less triglycerides than adipocytes from WT or CIpP^+/- mice, as observed by oil red O staining and quantification (FIG. IE). Mitochondrial function in differentiated adipocytes from WT, CIpP^+/- and CIpP^+/- mice was assessed by measuring respiration rates using the Seahorse Bioscience XF24 Extracellular Flux Analyzer. Basal respiration in CIpP^+/- adipocytes was elevated by 30% when compared to WT adipocytes (Fig. IF). Similarly, ClpF'^' adipocytes showed a significant increase in ATP-linked respiration (93% increase), maximal respiration (127% increase) and spare respiratory capacity (1319% increase) compared to WT or CIpP^+/- adipocytes (FIG. IF). Levels of non-mitochondrial respiration and proton leak were similar in WT, CIpP^+/- and ClpF'^' adipocytes. For CIpP^+/- adipocytes, only basal respiration showed a 17% increase compared to WT adipocytes, whereas other parameters were comparable to WT mice. Similarly, in vitro knockdown of ClpP (90% reduction in ClpP protein) in 3T3-L1 cells also increased respiration, compared to control cells (FIGS. 2E - 2F). Thus, ClpP deficiency increased respiration in adipocytes both in vitro and in vivo. An increased number of mitochondria per cell or the same number of highly active mitochondria per cell can both contribute to a high mitochondrial activity. Immunostaining of differentiated adipocytes using an antibody for mitochondrial outer membrane protein Tom20 showed more intense staining in ClpP^ adipocytes than WT adipocytes, suggesting there is an increase in mitochondrial content in ClpP-/- adipocytes (FIG. 1G). In agreement with this, mitochondrial content in gWAT of ClpP-/- mice was higher (and the mitochondria appeared larger) than WT mice, as assessed by electron microscopy (FIG. 1H). Thus, elevated mitochondrial content could contribute to elevated respiration and reduced fat mass in ClpP-/- mice.

FIGS. 3A-3H illustrate that markers of mitochondrial biogenesis, mitochondrial chaperones, and mitochondrial fission/fusion regulator OPA1 are elevated in gWAT of ClpP-/- mice. PGC-la is a key transcription factor that regulates mitochondrial biogenesis. In gWAT of ClpP-/- mice, expression of PGC-la is up-regulated 3-fold compared to WT mice (FIG. 3A). Protein expression of Tfam (mitochondrial DNA transcription factor, 3-fold) and VDAC (a highly conserved outer mitochondrial membrane protein, 3-fold) are also elevated in ClpP-/- mice gWAT (FIG. 3A). Protein expression of PGC-la, and Tfam were comparable in gWAT of ClpP^+/~ mice and WT mice, however, expression of VDAC was 2-fold higher in ClpP^+/~ mice compared to WT mice (FIG. 3A). Similar to the finding in gWAT, PGC-la expression is elevated (2.7-fold) in subcutaneous WAT (sWAT) in ClpP-/- mice. We also found a significant increase in the protein expression of electron transport chain (ETC) subunits ATP Synthase, H+ Transporting, Mitochondrial Fl Complex, Alpha Subunit 1 (ATP5al, 2.4-fold), ATP5ab (2.5- fold), Succinate Dehydrogenase Complex Flavoprotein Subunit A (SDHA, 3.4-fold), Succinate Dehydrogenase Complex Flavoprotein Subunit B (SDHAB, 2.4-fold), Succinate Dehydrogenase Complex Flavoprotein Subunit C (SDHC, 2.2-fold) and Ubiquinol-Cytochrome C Reductase Core Protein II (UQCRC2, 2.6-fold) in gWAT of Clp mPi-/c-e, compared to WT mice (FIG. 3B). However, expression of ETC subunits in WAT of CIpP^+/- mice was similar to WT mice (FIG. 3B). In addition, protein expression of citrate synthase was increased 2-fold (FIG. 4A) and mitochondrial DNA (mtDNA) content was increased 4-fold in the WAT of ClpP-/- mice (FIG. 3C). Taken together, mitochondrial biogenesis markers are increased in gWAT of ClpP-/- mice suggesting increase in mitochondrial mass, compared to WT or CIpP^+/- mice. Interestingly, PGC-la expression was unaffected by ClpP deficiency in brown fat (BAT), heart or skeletal muscle (FIG. 3D). We also looked for a potential signal that might drive PGC-la expression in gWAT. Increased levels of reactive oxygen species (ROS) is linked to activation of PGC-la expression in skeletal muscle (Irrcher et al., 2009, Silveira et al., 2006, St-Pierre et al., 2006). In humans also, in response to oxidative stress induced by short-term exercise increases PGC-la expression in skeletal muscle (Ristow et al., 2009). Based on this, we also tested whether ROS levels are altered in gWAT of ClpP-/- mice. Levels of 4-Hydroxynonenal (4-HNE) was used as a marker of oxidative stress (Andringa et al., 2014) and western blotting of gWAT showed increased 4-HNE levels (1.3-fold) in ClpP-/- mice compared to WT mice, suggesting increased oxidative stress in gWAT (FIG. 3E). Elevated levels of H2O2 is shown to induce PGC-la expression through activation of AMPK in skeletal muscle (Irrcher et al. 2009). Assessing AMP- activated protein kinase (AMPK) activation in gWAT of ClpP-/- mice showed that the ratio of phospho-AMPK/AMPK is increased in ClpP-/- mice compared to WT mice, suggesting increased AMPK activation (FIG. 3F). Thus, increase in ROS and AMPK activation could contribute to the increased expression of PGC-la in gWAT of ClpP-/- mice.

Loss of ClpP was reported to induce the expression of mitochondrial chaperones and the mitochondrial protease Lon in testis, heart, liver and brain of CIpP^+/- mice (Gispert et al., 2013). We found that the protein expression of Lon protease (2-fold) and mitochondrial chaperones [ Hsp60 (~4-fold), Hsp40 (~3-fold), HsplO (~3-fold) and ClpX (~2-fold)] were significantly elevated in ClpP-/- mice gWAT compared to WT mice (FIG. 3G). However, this increase in the expression of mitochondrial chaperones in gWAT could be attributed to the increase in mitochondrial number. In CIpP^+/- mice, protein levels of Lon, HsplO and ClpX were similar to WT mice, whereas protein expression of Hsp60 (2-fold) and Hsp40 (2-fold) were significantly elevated (FIG. 3G). Similarly, sWAT of ClpP-/- mice showed a strong induction of Lon and mitochondrial chaperones and BAT showed increased expression of Lon protease and Hsp40 compared to WT mice (FIG. 4B).

FIGS. 4A-4C show in each left panel: Immunoblots of sWAT and BAT extracts from WT and ClpP-/- mice for Lon, Hsp60, Hsp40, ClpX, ClpP and show in

each right panels: graphical representation of quantified blots normalized to P-tubulin/p-actin. WT-white bars, ClpP+/~grey bars, ClpP -/--black bars. FIG. 4B Left panels: Immunoblots of sWAT and BAT extracts from WT and ClpP-/- mice for Lon, Hsp60, Hsp40, ClpX, ClpP and β- tubulin/ β-actin. Right panels: graphical representation of quantified blots normalized to β- tubulin/ β-actin. WT-white bars, ClpP+/-grcy bars, qpiV-black bars. *WT vs ClpP-/-; #ClpP+/- vs ClpP-/-; @ change in same genotype with different diets. *

Previously we found that knockdown of ClpP (70% reduction compared control cells) in C2C12 muscle cells increased the expression of mitochondrial fission protein dynamin related protein 1, Drpl (Deepa et al., 2016). To test whether ClpP deficiency has an effect on mitochondrial dynamics, in vivo, we measured protein expression of mitochondrial fission-fusion proteins in ClpP-/- mice. In gWAT we did not see any change in the expression of fusion protein Mm2 or fission proteins Drpl or Fisl (data not shown). However, protein expression of mitochondrial fission-fusion regulator OPA1 (total) was increased in the gWAT (17%) and sWAT (114%) (FIG. 3H). Eight alternatively spliced mRNAs are transcribed from the OPA1 gene and multiple tissue-specific isoforms of the OPA1 protein were reported (Satoh, M, Hamamoto, T. et al., 2003; Olichon, A., Emorine, LJ., et al., 2002). OPA1 exist in multiple long forms (L-OPA1) and short forms (S-OPA1) and processing of OPA1 to L-OPA1 and S-OPA1 balances mitochondrial fission/fusion and the antibody we used detected five different isoforms, as previously reported (Anand R et al., 2014; Duvezdn-Caubet S et al., 2006). In BAT and skeletal muscle of ClpP-/- mice, total OPA1 was similar to WT mice, whereas in heart, total OPA1 was reduced by 34% (FIG. 3H). Thus, PGC-Ια and OPA1 showed a clear tissue-specific difference in then- expression and WAT depots showed higher OPA1 levels, compared to other tissues.

Pinkl and Parkin are known initiators of mitophagy (Narendra et al., 2010). Therefore, we quantified the expression of mitophagy markers PINK1 and Parkin in gWAT to test whether activation of mitophagy contributes to the recovery of healthy mitochondria in the absence of ClpP. Surprisingly, expression of PINK1 and Parkin are decreased in gWAT of ClpP-/- mice, suggesting that mitophagy is not activated in ClpP-/- mice (FIG. 4C).

FIGS. SA-SH depict that absence of ClpP increases whole body energy expenditure, and increases mitochondrial uncoupling and alters expression of metabolic enzymes in gWAT Metabolic cage data of WT, ClpP+/- and ClpP-/- mice. (FIG. 5A) oxygen consumption rate normalized to body weight, (FIG. SB) oxygen consumption rate normalized to lean body mass, (FIG. 5C) EE normalized to body weight, (FIG. 5D) EE normalized to lean body mass, (FIG. 5E) RER and (FIG. 5F) cage activity. WT-white bars, ClpP+/-grcy bars, qpiV-black bars. *WT vs ClpP-/-; UClpP+/- vs ClpP-/-. */#p<0.05. (FIG. 5G-5E) Transcript levels of UCP2 in gWAT, and UCP1 and UCP2 in sWAT of WT and ClpP-/- mice. Data shown are meaniSEM. WT-white bars, CIpP+/-grey bars, qpiV--black bars. *WT vs ClpP-/-; #CIpP+/- vs ClpP-/-. */#p<0.05. (FIG. SF-SD) Heatmaps showing changes in the expression of protein in fatty acid metabolism (first panel), glucose metabolism (second panel), TCA cycle, ETC and other mitochondrial proteins (third panel) and stress response (detoxification/antioxidant enzymes, chaperones, heat shock proteins and proteases) (forth panel) in gWAT of WT, ClpP+/- and ClpP-/- mice.

Absence of ClpP increases whole body energy expenditure and mitochondrial uncoupling and alters expression of metabolic enzymes in gWAT of ClpP-/- mice. To better understand how ClpP-/- mice remained lean, oxygen consumption and energy expenditure was measured by indirect calorimetry using a multiple animal respirometry system (MARS) (Sable Systems, Las Vegas, NV, USA). ClpP-/- mice exhibited 37% and 12% increases in oxygen consumption during dark and light phases, respectively, when normalized to total body mass (FIG. SA). However, when normalized to lean body mass, ClpP-/- mice showed only a 15% increase in oxygen consumption during dark phase and this difference was not statistically significant (FIG. SB). Similarly, energy expenditure (EE) normalized to total body mass was 40% and 34% higher for ClpP-/- mice during dark and light phases, respectively (FIG. 5C). Normalizing EE to lean body mass also reduced the increased EE in ClpP-/- to 10%, which did not reach statistical significance (FIG. 5D). Furthermore, WT and ClpP-/- mice had a similar respiratory exchange ratio (RER) and cage activity levels (FIG. 5E-5F). Metabolicalry, CIpP^+/- mice were similar to WT mice except for significantly reduced RER during the light phase (FIG. SE). Thus, the finding that higher oxygen consumption and EE rates of ClpP-/- mice were reduced when normalized to lean rather than total body mass are consistent with increased adipose tissue metabolism in ClpP-/- mice.

To gain further insight into adipose tissue metabolism in ClpP-/- mice, we tested mRNA levels of three major uncoupling proteins, UCP1, UCP2 and UCP3 in WAT depots. Transcript level of UCP1 was significantly increased in sWAT, not in gWAT, of ClpP-/- mice compared to WT mice (FIG. 5G). UCP2 was significantly elevated in gWAT and sWAT of ClpP-/- mice compared to WT mice (FIG. 5G), whereas UCP3 levels were similar in WT and ClpP-/- mice WAT depots (data not shown). Thus, increased uncoupling could account for the lean phenotype exhibited by ClpP-/- mice (FIG. 5G). Beige fat or 'brown-like' fat present in WAT are known to increase energy expenditure (Wu et al., 2013; Fisher et al., 2012). Therefore, we tested markers of browning/beiging in sWAT and found that in addition to UCP1, transcript levels of PGC-la (11.6-fold), Cell Death-Inducing DFFA-Like Effector A (CIDEA, 11.4-fold) and Cytochrome C Oxidase Subunit 8b (Cox8b, 15.8-fold) were elevated in sWAT of ClpP-/- mice, however levels of PR/SET Domain 16 (Prdml6) was similar in ClpP-/- and WT mice (FIG. 6A). Western blotting to assess protein expression of UCP1 in BAT showed no significant change in UCP1 expression (FIG. 6B). Thus, increased uncoupling in WAT depots as well as 'browning' of sWAT could contribute for to increased energy expenditure in ClpP-/- mice. A targeted quantitative proteomic approach was employed for a detailed study of the changes in protein expression of mitochondrial metabolic enzymes in gWAT of WT, ClpP^+/~ and ClpP-/- mice. Protein expression of mitochondrial fatty acid oxidation enzymes, enzymes/proteins involved glucose metabolism, tricarboxylic acid (TCA) cycle, electron transport chain (ETC), and antioxidants are altered in gWAT of ClpP-/- mice, compared to WT mice (FIG. 5H1 and FIG. SH2). Thus, absence of ClpP altered expression of metabolic enzymes in gWAT and the increase in mitochondrial biogenesis might partly contribute to this increase. FIGS. 7A-7H. ClpP-/- mice exhibit improved insulin sensitivity. Glucose tolerance test (FIG. 7A) and insulin tolerance test (FIG. 7B) of WT, ClpP+/- and ClpP-/- mice fed ad libitum. (FIG. 7C) Western blots showing expression P-Akt (T308), Akt, β-actin and ClpP in WT and ClpP-/- mice muscle (first panel), liver (second panel) and gWAT (third panel) injected with PBS (-Ins) or insulin (+Ins) (top panels). Quantification of P-Akt/Akt is shown in bottom panels. (D-H) Levels of circulation insulin (FIG. 7D), glucose (FIG. 7E), triglyceride (FIG. 7F), free fatty acids (FIG. 7G) and adiponectin (FIG. 7H) in WT and ClpP-/- mice in fed state. Data shown are meaniSEM. WT-white bars, ClpP+/-grey bars, C//>iV-black bars. *WT vs ClpP-/-; #CIpP+/- vs ClpP-/-. */#p<0.05. ClpP-/- mice have improved insulin sensitivity. Mitochondrial function is an important determinant of insulin sensitivity and several studies support a role of mitochondrial dysfunction in the development of insulin resistance (Montgomery & Turner, 20 IS). To understand the effect of ClpP deficiency on glucose metabolism, glucose clearance was measured by glucose tolerance test (GTT) and was found to be similar in WT, ClpP-/- and ClpP'- mice (FIG. 7A). However, ClpP-/- mice exhibited improved insulin sensitivity compared to WT or ClpP^+/~ mice when subjected to insulin tolerance test (ITT) (FIG. 7B). Improved insulin sensitivity suggests enhanced insulin-stimulated Akt activation to enable faster glucose uptake. Consistent with this, insulin-stimulated Akt-phosphorylation was significantly elevated in skeletal muscle (45%), liver (62%) and gWAT (27%) of ClpP m-/i-ce compared to WT mice (FIG. 7C). Circulating level of insulin and glucose were reduced by 68% and 44%, respectively, in ClpP-/- mice compared to WT mice, further supporting improved insulin sensitivity in ClpP-/- mice (FIGS. 7D and 7E). Circulating triglycerides were also significantly reduced (33%) in ClpP-/- mice, whereas free fatty acid levels were similar in ClpP-/- mice and WT mice (FIGS. 7F and 7G). Surprisingly, circulating level of the insulin sensitizing adipokine, adiponectin was significantly lower (23%) in ClpP-/- mice compared to WT (FIG. 7H).

FIG. 8A is a representative images of WT and ClpP-/- mice after 10-weeks of LFD or HFD- feeding. FIG. 8B is a graph showing food consumption of WT, ClpP+/- and ClpP-/- mice fed HFD, normalized to body weight WT-white bars, ClpP+/- -grey bars, ClpP-/- -black bars.

FIGS. 9A-9I shows ClpP-/- mice are resistant to diet-induced obesity and are protected from HFD-diet induced glucose intolerance and insulin resistance. (FIG. 9A) Change in body weights of WT, ClpP+/- and ClpP-/- mice fed low fat diet (LFD, solid line) or high fat diet (HFD, dotted line). WT-white circle, CIpP+/—grey triangle, C/_jpiV— black square (FIG. 9B) QMR analysis showing fat mass (left panel) and lean mass (right panel), normalized to body weight (FIG. 9C) Weights of different fat depots, normalized to body weight (gWAT-gonadal white adipose tissue, sWAT-subcutaneous WAT and BAT-brown adipose tissue). (FIG. 9D) H&E staining of gWAT sections of WT and ClpP-/- mice fed a LFD or HFD. (FIG. 9E) Tissue weight of gastrocnemius muscle (left) and quadriceps muscle (right) normalized to body weight (FIG. 9F) Liver weight of WT, ClpP+/- and ClpP-/- mice fed LFD or HFD (left panel) and H&E staining of liver sections of WT and ClpP-/- mice fed a LFD or HFD. (FIG. 9G) Glucose tolerance test of WT, ClpP+/- and ClpP-/- mice fed LFD or HFD (left panel). Area Under the Curve is represented graphically (right panel). (FIG. 9H) Insulin tolerance test of of WT, ClpP-/- and ClpP+/- mice fed LFD or HFD (left panel). Graphical representation of Area Under the Curve (right panel). (FIG. 91) Levels of circulating glucose (first panel) and insulin (second panel) in LFD or HFD-fed WT and ClpP-/- mice, fasted for 16 hours, and levels of circulating triglycerdies (third panel) and adiponectin (fourth panel) in LFD or HFD-fed WT and ClpP-/- mice in fed state. WT -white bars, CIpP+/—grey bars, Gf/jiV—black bars. *WT vs ClpP-/-; #ClpP+/- vs ClpP-/-; @ change in same genotype with different diets. */#/@p<0.05.

To understand the effect of ClpP deficiency under metabolic stress, WT, ClpP^+/~ and ClpP-/- mice were fed defined diets containing low fat (10% of calories from fat, LFD) or high fat (60% of calories from fat, HFD) for 10 weeks. Weight gain for WT, ClpP^+/- and ClpP-/- mice at 10 weeks on a LFD was 26%, 26% and 0.7%, respectively, and weight gain for HFD-fed mice was 83%, 65% and 12%, respectively (FIGS. 8A and 9A). This difference in body weight between WT and ClpP-/- mice with HFD feeding is regardless of any significant change in food intake (FIG. 9B).

Quantum Magnetic Resonance (QMR) analysis of WT, ClpP^+/~ and ClpP-/- mice after 10 weeks on HFD showed 184%, 143% and 79% increase in fat mass and 41%, 26% and 12% decrease in lean mass as a percentage of body weight, respectively, suggesting that the increase in body weight with HFD feeding is due to an increase in fat mass (FIG. 9B, left panel). gWAT mass as a percentage of body weight in WT and ClpP^+/~ mice fed a HFD increased 125% and 168% respectively, whereas ClpP-/- mice did not show a significant increase in gWAT weight, compared to respective control mice fed a LFD (FIG. 9C, left panel). H&E staining of the gWAT showed hypertrophied adipocytes in HFD-fed WT mice that would account for the increase in fat pad weight, whereas in HFD fed ClpP-/- mice adipocytes were smaller, similar to CIpP^+/- mice fed LFD (FIG. 9D). sWAT weight as a percentage of body weight in HFD fed WT and ClpP^+/~ mice weighed 168% and 115% more, compared to respective control mice fed a LFD. Interestingly, HFD fed ClpP-/- mice showed a 140% increase in sWAT weight compared to CIpP^+/- mice fed a LFD (FIG. 9C, middle panel). BAT weight as a percentage of body weight was significantly higher in ClpP-/- mice, compared to ClpP^+/~ or WT mice (FIG. 9C, right panel). BAT weight as a percentage of body weight of LFD and HFD-fed ClpP^+/~ and WT mice were similar, however BAT weights of HFD-fed ClpP-/- mice was reduced by 63%, compared to ClpP-/- mice fed a LFD (FIG. 9C, right panel). Gastrocnemius muscle weight as a percentage of body weight showed a significant reduction in WT (36%) and ClpP^+/- mice (27%) fed a HFD, compared to mice a LFD, whereas in HFD fed ClpP-/- mice gastrocnemius muscle weight was similar to ClpP-/- mice fed a LFD (FIG. 9E, left panel). Similarly, tissue weight of quadriceps muscle weight as a percentage of body weight showed a significant reduction in HFD fed WT (42%) and CIpP^+/- (37%) mice, however, in HFD fed ClpP-/- mice quadriceps weight was reduced by only 7% and this reduction is not statistically significant (FIG. 9E, right panel). ClpP-/- mice were protected from HFD-induced hepatic steatosis. Ten weeks of HFD feeding increased liver weight of WT and CIpP^+/- mice by 18% and 9%, respectively, whereas liver weight of ClpP-/- mice was reduced (12%) by HFD feeding, compared to ClpP-/- mice fed LFD (FIG. 9F, left panel). Consistent with this, H&E staining of liver sections revealed increased lipid accumulation only in HFD-fed WT mice, not in ClpP-/- mice (FIG. 9F, right panel). Thus ClpP-/- mice are protected against diet-induced obesity and hepatic steatosis.

Effect of HFD on glucose metabolism in WT, CIpP^+/- and ClpP-/- mice was tested by GTT and ITT. As expected, HFD induced glucose intolerance and insulin resistance in WT and CIpP^+/~ mice, compared to mice fed a LFD (FIGS. 9G and 9H). In contrast, glucose tolerance and insulin sensitivity in HFD fed ClpP-/- mice was similar to LFD fed ClpP-/- mice suggesting that ClpP-/- mice are protected from HFD-induced glucose intolerance and insulin resistance (FIGS. 9G and 9H). HFD feeding also elevated levels of circulating glucose (53%), insulin (23%) and triglyceride (22%) and reduced adiponectin (35%) in WT mice, as expected (FIG. 91). However, HFD fed ClpP-/- mice had similar blood glucose, insulin and triglyceride levels to ClpP-/- mice fed LFD (FIG. 91).

FIGS. 10A-10E show mitochondrial respiration is increased in gWAT of HFD-fed ClpP-/- mice. (FIG. 10A) ETC complex I-linked OXPHOS measured with the substrate combination glutamate, malate, and ADP. (FIG. 10B) ETC complex Il-linked OXPHOS measured with the substrate combination glutamate, malate, ADP, succinate, cytochrome c, and rotenone. (FIG. IOC) ETC complex I&II-linked OXPHOS, or maximum OXPHOS capacity (P) of the ETC, measured with the substrate combination glutamate, malate, ADP, succinate, and cytochrome c. (FIG. 10D) Mitochondrial innermembrane proton leak-linked oxygen consumption in the presence of substrates (glutamate and malate) and absence of ADP. (FIG. 10E) Mitochondrial innermembrane proton leak-linked oxygen consumption in the presence of substrates (glutamate, malate, and succinate) and ADP but addition of oligomycin to inhibit ATP synthase. Data information: (A-E) Bars represent mean ± SEM. (ANOVA, *WT vs

*WT vs ClpP^-, #CIpP⁺- vs ClpP^: */#p<0.05). WT-white bars, CIpP⁺ -grey bars, C/^-black bars.

Mitochondrial respiration is increased in gWAT of HFD-fed ClpP^4' mice. To understand the effect of HFD-feeding on mitochondrial function in gWAT of ClpP^4' mice, we measured mitochondrial respiration in adipose tissue explants using the OROBOROS Oxygraph 2K. Measurement of Cl-linked oxidative phosphorylation (OXPHOS) using glutamate/malate as electron transport chain (ETC) complex I (CI) substrates did not show a significant difference in respiration for WT, ClpP^+/' or ClpP-/- mice fed LFD or HFD (FIG. 10A). However, gWAT from LFD-fed or HFD-fed ClpP-/- mice showed increased oxygen consumption, compared to LFD-fed or HFD-fed WT or CIpP^+/- mice, both with the addition of succinate/rotenone to measure complex Il-linked OXPHOS (FIG. 10B) and the complex II substrate succinate to measure OXPHOS capacity through complex I and II (FIG. IOC). Measurement of proton leak-linked oxygen consumption in the absence of substrates did not show any significant difference between LFD or HFD fed WT, ClpP⁺- and ClpP-/- mice (FIG. 10D). However, proton leak- linked oxygen consumption following ATP synthase inhibition was significantly increased in both LFD-fed and HFD-fed ClpP-/- mice compared to WT or ClpP^+/' mice (FIG. 10E). Oligomycin increases membrane potential and thus increases the driving force for proton leak, likely causing the discrepancy in these proton leak measurements (Nicholls DG et al., 2000). Thus, gWAT from ClpP-/- mice have significantly increased respiratory capacity when fed a LFD or HFD, compared to WT or ClpP^{+ '} mice.

FIGS. 11A-11B show elevated mitochondrial biogenesis markers are preserved in gWAT of HFD fed ClpP-/- mice. FIG. 11A shows western blots showing protein expression of PGC-la, Tfam, VDAC, ClpP and β-tubulin in gWAT of LFD or HFD-fed WT and ClpP-/- mice Oeft panel). Quantification of proteins normalized to β-tubulin are shown in the right panel. FIG. 11A shows western blots showing protein expression of PGC-la, Tfam, IR0, Glut4, ClpP and β- tubulin in skeletal muscle of LFD or HFD-fed WT and ClpP-/- mice (left panel). Quantification of proteins normalized to β-tubulin are shown in the right panel. WT-white bars, ClpP+/~grey bars, ClpP-/~black bars. *WT vs ClpP-/-; #ClpP+/- vs ClpP-/-; @ change in same genotype with different diets. */#/@p<0.05.

Elevated mitochondrial biogenesis markers are preserved in gWAT of HFD fed ClpP-/- mice. Mitochondrial dysfunction in adipose tissue is characterized by reduced mitochondrial number and is associated with the development of insulin resistance under obese conditions (Kusminski and Sherer, 2012). Consistent with this, HFD-feeding reduced the expression of mitochondrial biogenesis markers [PGC-la (64%), Tfam (44%) and VDAC (64%)] in the gWAT of WT mice (FIG. 10A). LFD-fed ClpP-/- mice have increased expression of mitochondrial biogenesis markers PGC-la (2.5-fold), Tfam (1.7-fold) and VDAC (2.5-fold) in gWAT and HFD-feeding preserved the expression of these proteins (FIG. 11A). Because skeletal muscle is the major site for glucose utilization, we tested the effect of HFD on mitochondrial biogenesis markers in this tissue. In WT mice, HFD increased the expression of PGC-la (47%) in skeletal muscle and expression of Tfam was unchanged, however, HFD did not affect the expression of PGC-la or Tfam in ClpP-/- mice (FIG. 1 IB).

Mitochondrial dysfunction in adipose tissue is characterized by reduced mitochondrial number and is associated with the development of insulin resistance under obese conditions (Kusminski & Scherer, 2012). HFD-feeding reduced the expression of mitochondrial biogenesis markers [PGC-la (64%), Tfam (44%) and VDAC (64%)] in the gWAT of WT mice (Figure 7A). LFD- fed ClpP-/- mice have increased expression of mitochondrial biogenesis markers PGC-la (2.5- fold), Tfam (1.7-fold) and VDAC (2.5-fold) in gWAT and HFD-feeding preserved the expression of these proteins (FIG. 11A). Because skeletal muscle is the major site for glucose utilization, we tested the effect of HFD on mitochondrial biogenesis markers in this tissue. In WT mice, HFD increased the expression of PGC-la (47%) in skeletal muscle and expression of Tfam was unchanged, however, HFD did not affect the expression of PGC-la or Tfam in ClpP-/- mice (FIG. 1 IB). Protein expression of insulin receptor beta (IRβ) was elevated by 68% in LFD- fed ClpP-/- mice skeletal muscle, compared to LFD-fed WT mice, and could contribute to the improved insulin sensitivity in LFD-fed ClpP-/- mice. HFD-feeding further increased the expression of IRβ in ClpP-/- mice by 29% (FIG. 1 IB). WT and ClpP-/- mice have similar levels of glucose transporter 4 (Glut4) when fed LFD, however HFD reduced Glut4 expression in WT by 52% whereas Glut4 expression in ClpP-/- mice skeletal muscle was unaffected by HFD (FIG. 1 IB). Thus, increased expression of IRp^* and preservation of Glut4 in skeletal muscle with HFD feeding could contribute to the improved insulin sensitivity in CIpP^+/- mice. It is noteworthy that in HFD-fed WT mice, ClpP protein expression was reduced by 73% in gWAT, but not in muscle (FIGS. 11A and 1 IB). It is possible that the reduction in mitochondrial content in gWAT could account for this drastic reduction in ClpP levels.

The UPR"* is an important pathway that maintains mitochondrial matrix proteo stasis through up- regulation of mitochondrial chaperones, yet the effect of UPR"* on mammalian metabolism is not known. Because ClpP is proposed to play an important role in UPR"*, we used mice deficient in ClpP ( ClpP-/- mice) to understand the role of defective UPR"* in metabolism. Surprisingly, our findings revealed an unexpected effect of ClpP on UPR"* and paradoxical beneficial effect of ClpP deficiency on metabolism. Absence of ClpP resulted in many compensatory responses in ClpP-/- mice. One such response is increase in the expression of mitochondrial biogenesis markers, suggesting increased mitochondrial mass, in WAT of ClpP-/- mice. Gispert et al. (2013) measured the protein expression of VDAC/porin, Tfam and ETC complex subunits in testis, heart, liver and brain of ClpP-/- mice and did not find any difference in their expression compared to WT mice (Gispert et al., 2013). We found a 4-fold increase in mtDNA content, another mitochondrial biogenesis marker, in WAT. Interestingly, Gispert et al (2013) also reported 2-4 fold accumulation of mtDNA in testis, ovary, heart and brain of ClpP-/- mice compared to WT mice. However, it should be noted that in the tissues that showed an increase in mtDNA, none of the mitochondrial biogenesis markers (Tfam, porin or ETC subunits) were increased. It is proposed that elevated levels of ClpX, the binding partner of ClpP, could contribute mtDNA accumulation (Gispert et al., 2013), because ClpX has been shown to contribute to the maintenance of mitochondrial genome distribution (Kasashima, K., et al., 2012). Thus, our finding that mitochondrial biogenesis markers increases only in adipose tissue, but not in other tissues suggest that mitochondrial biogenesis is selectively occurring in WAT. The increase in mitochondrial mass could contribute to increased respiration by WAT, because respiration is reduced in the heart of ClpP-/- mice, whereas respiration in muscle and brain are similar to WT mice (Gispert et al., 2013; Szczepanowska et al., 2016). Thus, ClpP deficiency shows a differential effect on respiration in tissues. Our findings also suggest that increase in ROS level and AMPK activation could be the driver of the mitochondrial biogenesis in WAT, because ROS is known to induce PGC-la expression through AMPK that is a known activator of PGC-la (Irrcher et al., 2009).

Absence of ClpP resulted in many compensatory responses in ClpP-/- mice. One such response is increase in the expression of mitochondrial biogenesis markers, suggesting increased mitochondrial mass, in WAT of ClpP-/- mice. Gispert et al. (2013) measured the protein expression of VDAC/porin, Tfam and ETC complex subunits in testis, heart, liver and brain of ClpP-/- mice and did not find any difference in their expression compared to WT mice (Gispert et al., 2013). We found a 4-fold increase in mtDNA content, another mitochondrial biogenesis marker, in WAT. Interestingly, Gispert et al (2013) also reported 2-4 fold accumulation of mtDNA in testis, ovary, heart and brain of ClpP-/- mice compared to WT mice. However, it should be noted that in the tissues that showed an increase in mtDNA, none of the mitochondrial biogenesis markers (Tfam, porin or ETC subunits) were increased. It is proposed that elevated levels of ClpX, the binding partner of ClpP, could contribute mtDNA accumulation (Gispert et al., 2013), because ClpX has been shown to contribute to the maintenance of mitochondrial genome distribution (Kasashima, K., et al., 2012). Thus, our finding that mitochondrial biogenesis markers increases only in adipose tissue, but not in other tissues suggest that mitochondrial biogenesis is selectively occurring in WAT. The increase in mitochondrial mass could contribute to increased respiration by WAT, because respiration is reduced in the heart of ClpP-/- mice, whereas respiration in muscle and brain are similar to WT mice (Gispert et al., 2013; Szczepanowska et al., 2016). Thus, ClpP deficiency shows a differential effect on respiration in tissues. Our findings also suggest that increase in ROS level and AM PK activation could be the driver of the mitochondrial biogenesis in WAT, because ROS is known to induce PGC-Ια expression through AMPK that is a known activator of PGC-Ια (Irrcher et al., 2009).

In addition to the increased expression of mitochondrial transcription factor PGC-Ια, up- regulation of mitochondrial uncoupling proteins (and 'beiging or browning' of WAT) and OPA1 could also be compensatory responses due to ClpP deficiency in WAT. Increased expression of these proteins could be metabolically beneficial in ClpP-/- mice, because studies have shown that over-expression of human PGC-Ια in human subcutaneous white adipocytes increases the expression of respiratory chain proteins, UCP1 and fatty acid oxidation (Tiraby et al., 2003), and WAT-specific loss of PGC-Ια in mice has been shown to reduce expression of mitochondrial OXPHOS and fatty acid oxidation genes and these mice develop insulin resistance when challenged with HFD (Kleiner et al., 2012). UCP2 uncouples OXPHOS only after induction by cold or ROS and we found increased ROS level in gWAT of ClpP m-/-ice (Fisler et al., 2006). UCP2 gene expression is reduced in the WAT of patients with obesity and type 2 diabetes (Mahadik et al., 2012) and moderate overexpression of human UCP2 in mice has been shown to reduce fat mass (Horvath et al., 2003) and three common polymorphisms in UCP2 gene are possibly associated with DM2 and/or obesity (de Souza et al., 2011). Proteomic analysis of gWAT revealed increased expression of enzymes/proteins involved in glycolysis, TCA cycle, ETC and beta-oxidation, in ClpP-/- mice. These changes in gWAT are associated with increased mitochondrial number, and elevated respiration in gWAT. Recently, it was shown that absence of ClpP can increase respiration, e. g. DARS2 mice, a mouse model of dysregulated mitochondrial translation, have a strong up-regulation of the UPR"* and heart-specific deletion of ClpP in DARS2 mice increases respiration (Seiferling et al., 2016). OPA1 is critical in regulating mitochondrial cristae structure that in turn determines respiratory efficiency, and deletion of OPA1 reduces supercomplex assembly and respiration whereas its over-expression favors supercomplex formation and increases respiration (Cogliati et al., 2013, Lee et al., 2017). It is possible that increased OPA1 protein is contributing to increased respiration in WAT of ClpP-/- mice. Increased expression of PGC-Ια and OPA1 is specific to WAT of ClpP-/- mice, however, the reason(s) for this tissue-specific effect is not known. Thus, our findings signify a beneficial metabolic effect of increased adipose tissue metabolism due to ClpP deficiency. This was further supported by the finding that increased oxygen consumption and energy expenditure rates of ClpP-/- mice were reduced when normalized to lean rather than total body mass.

Up-regulation of mitochondrial chaperones in ClpP-/- mice might be yet another compensatory response that will help to stabilize unfolded proteins generated due to ClpP deficiency (Voos et al., 2016). In WAT depots of ClpP-/- mice, it is difficult to differentiate up-regulation of mitochondrial chaperones from mitochondrial biogenesis. It is possible that the increase in mitochondrial chaperones is a reflection of elevated mitochondrial number in WAT. However, in other tissues that showed an increase in mitochondrial chaperones (testis, heart, liver, and brain) mitochondrial biogenesis markers are not elevated suggesting that mitochondrial chaperones are induced in those tissues (Gispert et al., 2013). Similarly, in ClpP^+/- mice WAT, mitochondrial chaperones Hsp60 and HSp40 are elevated and expression of mitochondrial biogenesis markers in CIpP^+/~ mice was similar to WT mice. The transcription factors CHOP and C/ΕΒΡβ are the proposed transcription factors for mitochondrial chaperones in mammals and they bind to the conserved regulatory element in promoters of the UPR"* related genes when UPR"* is initiated (Aldridge et al., 2007). How these transcription factors are activated to increase the expression of mitochondrial chaperones in the absence of ClpP is not known. Induction of mitochondrial chaperones in the absence of ClpP might suggest that ClpP is dispensable for mammalian UPR"* induction. One possible explanation of the accumulation of mitochondrial chaperones in ClpP-/- mice is that ClpP is the peptidase that is specifically responsible for mitochondrial chaperone turnover, therefore, absence of ClpP would lead to chaperone accumulation. This is not unlikely, because mitochondrial chaperones ClpX and Erall are degraded by ClpP (Gispert et al., 2013; Szczepanowska et al., 2016). Mitochondrial matrix protease Lon is yet another QC protease that showed a tissue-specific adaptive response in ClpP-/- '^' mice. Lon is also increased in both WAT and BAT of ClpP-/- mice, and a similar increase is previously reported in brain, but not in other tissues (Gispert et al., 2013). Lon protease is mainly involved the degradation of oxidized proteins, in addition to its role in the turnover of specific mitochondrial enzymes and in the regulation of mtDNA replication (Bota and Davis, 2016). Whether Lon can compensate for the absence of ClpP is not known. In our previous study in C2C12 muscle cells, we performed an acute knock down of ClpP and found that decline in ClpP (70% down-regulation) expression can cause mitochondrial dysfunction (Deepa SS et al., 2016). However, in ClpP-/- mice, such as effect was not observed in skeletal muscle. A likely explanation is that loss of ClpP is a chronic effect in ClpP-/- mice that is compensated by molecular adaptations. Thus, the lack of adaptations in acute knockdown could explain the differential outcome. The finding that ClpP is critical for the initiation of UPR"* and UPR"* initiation will shift cell metabolism from respiration to glycolysis was made using C. elegans as a model organism (Haynes CM et al., 2007; Nargund et al., 2012). In contrast, many aspects of mammalian UPR"* are less well understood, even though loss of mitochondrial proteo stasis is shown to increase the expression of Hsp60 and ClpP (Zhao Q et al., 2002; Houtkooper RH et al., 2013). The role of ClpP in the initiation of mammalian UPR"* and how UPR"" affects metabolism in mammals is not known. Recent study by Seiferling D et al. (2016) suggest that ClpP is neither required for, nor it regulates the UPR"* in mammals. Their study demonstrated that a strong mitochondrial cardiomyopathy and diminished respiration due to DARS2 deficiency can be alleviated by the loss of ClpP. Thus, further studies are need to understand the role of ClpP in mammalian UPR"" and UPR^-associated metabolic shift. ClpP-/- mice fed ad libitum exhibited improved insulin sensitivity compared to WT mice. In contrast, glucose clearance in response to glucose tolerance test in ClpP-/- mice fed ad libitum was similar to WT mice. This would suggest that the ClpP-/- mice have a lower or slower insulin release in response to the glucose challenge and in support of this, insulin levels in ClpP-/- mice in fed state is lower than wild type mice (FIG. 7D). Thus, a reduction in glucose-induced insulin secretion could be a potential reason why we do not see improved glucose clearance in chow fed animals. However, when fed HFD, wild type mice develop glucose intolerance and therefore the difference between WT and ClpP-/- mice in glucose clearance become more obvious. Reduced fat mass could account for the improved metabolic parameters in ClpP-/- mice when fed ad libitum or HFD. Previous studies have correlated reduced fat mass with beneficial metabolic outcomes with HFD-feeding (Bluher et al., 2002. Vernochet et al., 2012; Bhaskaran et al., 2017). ClpP-/- mice have minimal fat deposition when fed a HFD and interestingly this fat accumulation occurred only in the sWAT, but not in gWAT, and it is known that visceral adipose tissue mass, not subcutaneous adipose tissue mass, correlates with the development of insulin resistance

(Wajchenberg 2000; Yang et al., 2008). Importantly, HFD-fed ClpP m-/-ice retained elevated levels of PGC-Ια and increased respiration in gWAT that could contribute to increased fat utilization. In addition to reduced fat mass in ClpP-/- mice, increased expression of IRp^* and

Glut4 in skeletal muscle could also contribute to improved insulin sensitivity in HFD-fed conditions. Reduced insulin signaling is a well-established defect in obesity-mediated insulin resistance (Boucher et al., 2014) and studies have shown that patients with insulin receptor mutation exhibit insulin resistance (Krook & O'Rahilly, 1996), and muscle-specific knockout of

IR can cause systemic insulin resistance in mice (Bruning et al., 1998). Thus, cellular levels of

IR itself, rather than downstream signaling is critical for insulin signaling. Muscle-specific deletion of Glut4 in mice causes insulin resistance and glucose intolerance (Zisman et al., 2000), and transgenic overexpression of GLUT4 enhances glucose tolerance in lean and obese mice

(Atkinson et al., 2013). Adiponectin is a well known insulin sensitizer and increased levels of adiponectin are associated with improved insulin sensitivity whereas a reduction in adiponectin is associated with insulin resistance condition (Kadowaki et al., 2006). Surprisingly, ClpP-/- mice have reduced levels of circulating adiponectin when fed a LFD or HFD, suggesting that adiponectin does not contribute to the improved insulin sensitivity in ClpP-/- mice. In support of this, studies have shown that fat-specific Tfam knockout mice have reduced levels of circulating adiponectin, yet have improved insulin sensitivity when fed a HFD (Vernochet et al., 2012).

The importance of WAT mitochondria in metabolism is highlighted by the fact that a reduction in mitochondrial number, respiration or antioxidant levels are associated with metabolic disease conditions in mice and humans (Choo et al., 2006; Heinonen et al., 201S; Chattopadhyay et al., 20 IS). Compounds such as TZD that can stimulate mitochondrial biogenesis in WAT has beneficial metabolic outcome (Wilson-Fritch et al., 2004). WAT-specific genetic manipulations targeting mitochondrial biogenesis or mitochondrial fatty acid oxidation have improved metabolic phenotype when challenged with HFD (Kusminski et al., 2014; Kusminski, et al., 2012; Vernochet et al., 2012). Thus, adipose tissue mitochondria are an ideal organelle for targeting in obesity and related metabolic disorders. Generation of fat-specific ClpP knockout mice will help to understand whether the beneficial metabolic effects in ClpP-/- mice are due to the metabolic changes specifically in WAT. In future, identification of ClpP inhibitor(s) and targeting ClpP using these inhibitor(s) to increase mitochondrial respiration in adipose tissue will make our findings translationally important that will help to compact the obesity pandemic.

All experiments were approved by the Institutional Animal Care and Use Committee at the Oklahoma Medical Research Foundation. ClpP-/- mice were generated as described previously and obtained from Georg Auburger (Goethe University Medical School, Frankfurt am Main, Germany). All experiments, except high fat diet feeding, was performed in 5 -month-old male ClpP-/-, CIpP^+/- and control littermates in C57BL/6 background. The mice were group housed (five animals per cage) in ventilated cages 20 ± 2° C, 12 h/12 h dark/light cycle and were fed ad libitum.

Quantitative magnetic resonance (QMR) imaging. Body composition (fat mass and lean mass) of nonanesthetized mice was analyzed by quantitative magnetic resonance imaging during the light phase using quantitative magnetic resonance imaging [EchoMRI (Echo Medical Systems, Houston, TX)] as described before (Bhaskaran S et al., 2017).

WAT and liver histology. WAT and liver tissue were fixed in 10% formalin and embedded in paraffin. Sections (7 μτα) were stained with hematoxylin and eosin (H&E) and images were visualized and captured with Nikon Element software (Nikon Inc., Melville, NY, USA). Image J software (NIH image) was used to quantify adipocyte cell area. Glucose tolerance test (GTT) and insulin tolerance test (ITT). For GTT, mice were given an intraperitoneal injection of 2g/Kg body weight of glucose (Sigma, St. Louis, MO) after a 6 hour fast during the light cycle. For ITT, mice were given an intraperitoneal injection of O.SU of insulin (Novalin R; Novo Nordisk, Princeton, NJ, USA) after fasting for 5 hours during the light cycle. Before injection and at indicated time points after injection blood glucose levels were measured using a One-Touch Ultra glucometer (Life Scan, Inc., Milpitas, CA, USA) (Deepa et al., 2003).

Primary adipocyte culture. Stromal vascular fraction (SVF) from sWAT and differentiated to mature adipocytes as described before (Fisher FM et al., 2012; Aune UL et al. 2013). In brief, adipose tissue was digested with dispase II (Roche), and l.S U/mL collagenase D (Roche) and the SVF obtained after centrifugation and filtration were cultured in complete stromal-vascular culture medium (DMEM/F12 [1: 1; Invitrogen] plus glutamax, pen/strep, and 10% FBS). For adipocyte differentiation assays, SVF were plated and grown to confluence and exposed to the adipogenic cocktail (1 uM dexamethasone, 5 |ig/mL insulin, 0.S mM isobutylmethylxanthine (DM), and 1 uM rosiglitazone) in stromal-vascular culture medium, followed by addition of 5 |ig/mL insulin in stromal-vascular culture medium after 48 h. At day 6 of differentiation, cells are ready for analysis.

Measurement of mitochondrial respiration in differentiated adipocytes. Mitochondrial respiration in primary adipocyte cultures or 3T3-L1 differentiated adipocytes were measured using a Seahorse Bioscience XF24 Extracellular Flux Analyzer (North Billerica, MA). SVF isolated from WT, ClpP-/- and ClpP-/- mice sWAT were seeded at a density of 20,000 cells/well kept in a 37 °C incubator with 5% C02. Once the cells reached confluency, the pre-adipocytes were differentiated to mature adipocytes and respiration was assessed as described before. In brief, adipocytes were metabolically perturbed by the sequential injections of oligomycin, carbonyl cyanide-4-(trifluoromethoxy) phenylhydrazone (FCCP) and antimycin A (1 mM, final concentration) and oxygen consumption rate (OCR) was recorded. The following measurements were made from the OCR values and normalized to protein concentration in each well: third basal measurement indicates basal respiration; the difference between basal respiration and oligomycin-induced respiration represents ATP-linked respiration; the difference between oligomycin-induced and antimycin A- induced respirations is proton leak; the OCR after FCCP injection represents maximal respiration; and the difference between maximal respiration and basal respiration is reserve capacity (Deepa et al., 2016).

Targeted quantitative proteomics. Quantitative proteomics was used to determine changes in mitochondrial enzymes in gWAT as previously described (Bhaskaran S et al., 2017). Briefly, 20|ig total adipose tissue homogenate from gWAT was run l.S cm into a 12.5% SDS-PAGE gel (Criterion, Bio-Rad) followed by fixation and staining with GelCode Blue (Pierce). The entire lane was cut into ~1 mm3 pieces, washed, reduced with DTT, alkylated with iodoacetamide, and digested with trypsin. The peptides generated were extracted with 50% methanol/10% formic acid in water, dried, reconstituted in 1% acetic acid and analyzed using selected reaction monitoring (SRM) with a triple quadrupole mass spectrometer (ThermoScientific TSQ Vantage) configured with a splitless capillary column HPLC system (Eksigent). Data processing was done using the program Pinpoint (ThermoScientific), which aligned the various collision induced dissociation reactions monitored for each peptide and determines the chromatographic peak areas. The response for each protein was taken as the total response for all peptides monitored. Changes in the relative abundance of the proteins was determined by normalization to the BSA internal standard, with confirmation by normalization to the housekeeping proteins.

Transmission Electron Microscopy. The electron microscopy experiment was carried out in the Oklahoma Medical Research Foundation Imaging Facility using established procedures, as described before (Deepa et al, 2016).

In vivo insulin action. Mice at five months of age were fasted for 16 hours and given an intraperitoneal injection of insulin (1 U/kg animal body weight (Novalin; Novo Nordisk) or an equal volume of saline. Ten minutes after the injection, mice were euthanized via cervical dislocation, and WAT, liver and gastrocnemius muscle were collected and snap frozen in liquid nitrogen, and kept at 80°C until further analysis (Deepa et al., 2013).

Oil red O staining. Differentiated adipocytes in 6-well culture dishes were fixed with 10% formalin, washed with 60% isopropanol and stained with Oil Red O. After washing with water, images were taken and the content of oil red O in each well was quantified by extracting with 100% isopropanol and measuring absorb ance at 550nm (Sato T, Kotake D et al., 2013).

HFD diet feeding. Three to four month-old WT (n=8/group), ClpP-/- (n=10/group) and ClpP-/- (n=7/group) female mice were fed a defined diet containing 10% fat diet [low fat diet (LFD), Research Diets, Cat#D12450J] or 60% kcal from fat [high fat diet (HFD), Research Diets, Cat# D 12492]. Mice were fed the diets for 10 weeks and food consumption and body weight were monitored weekly as previously described (Bhaskaran S et al., 2017). Glucose tolerance tests (GTT) and insulin tolerance tests (ITT) were performed at 8 and 9 weeks after feeding the diets. At the end of experimental period, mice were sacrificed and tissues were snap frozen in liquid nitrogen and stored at -80°C until used. The following primary antibodies were used for western blotting: PGC-Ια, VDAC, Tfam, heat shock protein 60 (Hsp60), Hsp40, HsplO, OPA1, UCP1, PINK1 and Parkin from Abeam (Cambridge, MA); phospho-Akt (S473), Akt2 , insulin receptor beta (Πφ), glucose transporter 4 (Glut4), phospho-AMPK (Thrl72), AMPK and β-actin were from Cell signaling technology (Danvers, MA); ClpP and β-tubulin from Sigma (St Louis, MO); Tom20 from Santa Cruz Biotechnology, Dallas, TX); and Lon protease (gift from Luke Szweda, OMRF). ELISA kits for insulin and adiponectin were from Crystal Chem (Downers Grove, IL); kits for triglyceride was from Cayman Chemical (Ann Arbor, MI); and the nonesterified fatty acid (NEFA) kit was from Wako USA (Richmond, VA).

Western blotting. The tissues collected during sacrifice was immediately frozen in liquid nitrogen and stored at -80°C until use. Homogenization of tissues and western blotting was performed as previously described (Deepa et al, 2013). Images were taken using a G:BOX imaging system (Syngene) and quantified using ImageJ software (U.S. National Institutes of Health, Bethesda, MD, USA).

Detection of 4-HNE adducts. For the detection of 4-HNE modified proteins, equal amounts of protein

were subjected to SDS-PAGE, separated proteins were transferred to PVDF membrane and treated with 250mM sodium borohydride in lOOmM MOPS, pH 8.0 for IS minutes to chemically reduce the adduct for antibody recognition. This was followed by washing the membrane with water, TBS-T, blocking with 5% non-fat milk and overnight incubation with 1:2000 dilution of polyclonal antibody made against 4-HNE (Uchida et al., 1993). The antibody recognizes cysteine, lysine, and histidine 4-HNE protein adducts and is highly specific to 4-HNE derived protein adducts (gift from Luke Szweda, OMRF, Uchida et al., 199S). This was followed by incubation with anti-rabbit IgG HRP conjugated antibody and development of the blot using enhanced chemiluminescence reagent.

Quantitative real-time PCR. Total RNA was extracted using the RNeasy kit (Qiagen, Valencia, CA, USA) from 50 mg of frozen WAT as described before (Bhaskaran S et al., 2017). First- strand cDNA was synthesized using Superscript II reverse transcriptase (Life Technologies, Grand Island, NY, USA) and quantitative real-time PCR was performed with ABI Prism using Power SYBR Green PCR Master Mix with the primers (Applied Biosystems, Foster City, CA, USA). The following primers were used: UCP1 (SEQ ID NO: 1 forward- ACTGCCACACCTCCAGTCATT, SEQ ID NO: 2 reverse-CTTTGCCTCACTCAGGATTGG), UCP2 (SEQ ID NO: 3 forward-GTGGTCGGAGATACCAGAGC, SEQ ID NO: 4 reverse- GAGGTTGGCTTTCAGGAGAG) PGC-Ια (SEQ ID NO: 5 forward- CCCTGCCATTGTTAAGACC, SEQ ID NO: 6 reverse-TGCTGCTGTTCCTGTTTTC);

mtDNA copy number. Total DNA was isolated from gWAT (50 mg) by proteinase K digestion for 16 h as described before (Deepa SS et al., 2013). Relative mtDNA copy number was measured as described by Gispert et al. (2013) by determining the ratio of mtDNA target sequence (mitochondrial Cox3 gene: SEQ ID NO: 19 forward, TTTGCAGGATTCTTCTGAGC; SEQ ID NO: 20 reverse, TGAG CTCATGTAATTGAAACACC) to the expression of nuclear target sequence (Ndufvlgene: SEQ ID NO: 21 forward, CTTCCCCACTGGCCTCAAG; SEQ ID NO: 22 reverse, CCAAAACCCAGTGATCCAGC) by real-time PCR using Power SYBR Green PCR Master Mix (Applied Biosystems). The reaction was initiated by 50 °C for 2 min and then 94 °C for 10 min, followed by 40 cycles of 95 °C for 10 s, 60 °C for 60 s, and melting curve ranging from 85 °C to 65 °C was done. The Q for Ndufvl was subtracted from Q for Cox3 to generate ΔC_T. Relative differences in mtDNA copy number were determined using

Mitochondrial Respirometry. Mitochondrial respiration in gonadal white adipose tissue was measured using high-resolution respirometry in the OROBOROS Oxy graph 2K (Innsbruck, Austria) as previously described (Mancuso DJ et al., 2010). In brief, gWAT was removed, weighed and immediately placed in mitochondrial isolation buffer (0.21 M mannitol, 70 mM sucrose, 0.1 mM potassium EDTA, 1 mM EGTA, 10 mM Tris-HCl, 0.5% BSA, pH 7.4) on ice. 40-60 mg adipose tissue was cut into ~1 mm3 in a cold room and loaded into the Oxy graph 2K in calibrated MiR05 assay buffer (100 mM sucrose, 60 mM potassium lactobionate, 20 mM HEPES, 10 mM KH2P0₄, 3 mM MgCh, 0.5 mM EGTA, 0.1% BSA, pH 7.1). Mitochondrial function was assessed using sequential additions of 10 mM glutamate, 2 mM malate, 2.5 mM ADP, 10 mM succinate, 5 μΜ cytochrome c, 0.5 μΜ rotenone, 2.5 μΜ oligomycin, and 5 μΜ Antimycin A. Data were normalized using the Complex III inhibitor Antimycin A to account for non-mitochondrial respiration and tissue mass.

Cell culture and generation of a stable ClpP deficient cell line. The mouse myoblast cell line 3T3-L1 (ATCC) was grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal calf serum and 1% penicillin-streptavidin and maintained at 37 °C in 5% humidified incubator. For generation of the stable cell line, 3T3-L1 myoblasts were infected with mission shRNA lentiviral transduction particles for ClpP (Sigma, St Louis, MO) or shRNA control transduction particles and transduced cells were obtained by puromycin selection. 3T3- Ll cells were differentiated to adipocytes by growing them in DMEM containing 2% horse serum and 1% penicillin-streptavidin for four days.

Immunofluorescence. Primary cultures of differentiated adipocytes were stained with Tom20 antibody followed by Alexa Fluor® 488 F(ab')2 Fragment of Goat Anti-Rabbit IgG (H+L) antibody as per manufacturer's instructions. Cell fluorescence was measured using the NIH Image J software. Corrected total cell fluorescence (CTCF) was calculated as CTCF = Integrated Density - (Area of selected cell X Mean fluorescence of background readings).Indirect Calorimetry. Energy expenditure was measured by indirect calorimetry in WT, CIpP^+/- and ClpP-/- mice. Animals were acclimated to the testing cages and metabolic cabinet for 48 hours before data collection with ad libitum access to food and water. After acclimation, oxygen consumption and carbon dioxide production were measured using a multiple animal respirometry system (MARS) (Sable Systems, Las Vegas, NV). 10-min/animal averages were collected hourly over a continuous 20 hours period. The respiratory exchange ratio was calculated as the ratio of the average carbon dioxide produced to oxygen consumed over this time period. Energy expenditure was calculated as described by Tschop MH et al. (2011) using the caloric equivalent of oxygen. Data were initially subdivided into the light or dark phase time periods to evaluate potential differences in metabolic responses associated with different activity levels. Light and dark phase values were then averaged to report results. Rates of energy expenditure were normalized to either total body mass or lean body mass as determined by dual- energy x-ray absorptiometry analysis.

Statistics. Ordinary One-way ANOVA or Two-way ANOVA with Tukey's Post-hoc Test was used to analyze data.

The present invention includes small molecule inhibitors of ClpP activity. The small molecule disclosed herein inhibit the enzymatic activity of recombinant bacterial ClpP similarly as the activity of the b-lactone inhibitors in the initial study as well as the enzymatic activity of recombinant human mitochondrial ClpP. For example, A2-32-01 inhibited cleavage of ClpP fluorogenic peptide substrates when added to lysates of mitochondria isolated from cells or intact cells. A2-32-01 did not inhibit cytoplasmic chymotrypsin, trypsin, or caspase-like protease enzymatic activity when added to lysates of red blood cells that contained proteasome complexes but lacked mitochondria, therefore demonstrating its specificity for mitochondrial proteases.

For example the small molecule inhibitors of ClpP may be a member of the lactone family and more specifically may be a β-lactone. For example the b-lactone inhibitors may have the general structure non-8-en-l-yl and 2-(pyridin-3 -yl)ethyl substituents at positions 3 and 4.

The term "lactone" refers a cyclic ester which is the condensation product of an alcohol group and a carboxylic acid group in the same molecule. The term beta-lactone or b-lactone (i.e., "β- lactone") is intended to indicate that the ring in the lactone is a four member ring having the general structure

The β-lactone may include one or more substitutions at R and Ri selected from the group consisting of an unsubstituted alkyl, a substituted alkyl, an unsubstituted alkenyl, a substituted alkenyl, an unsubstituted aryl, a substituted aryl, an unsubstituted heterocycle, a substituted heterocycle, hydroxyl, ester, amido, aldehyde, and a halogen. As used herein the terms "alkyl" and "substituted alkyl" refer, respectively, to substituted and unsubstituted C₁-C₁₀ straight chain saturated aliphatic hydrocarbon groups, substituted and unsubstituted C₂-C₁₀ straight chain unsaturated aliphatic hydrocarbon groups, substituted and unsubstituted C₄-C₁₀ branched saturated aliphatic hydrocarbon groups, substituted and unsubstituted C4-C₁₀ branched unsaturated aliphatic hydrocarbon groups, substituted and unsubstituted C₃-C₈ cyclic saturated aliphatic hydrocarbon groups, substituted and unsubstituted C₅-C₈ cyclic unsaturated aliphatic hydrocarbon groups having the specified number of carbon atoms.

The term "alkyl" includes, but is not limited to. any of the following: methyl (Me), ethyl (Et), propyl (Pr), butyl (Bu), pentyl, hexyl, heptyl, octyl, nonyl, decyl, undecyl, ethenyl, propenyl, buienyl, penentyl, hexenyl, heptenyl, octenyl, nonenyl, decenyl, undecenyl, isopropyl (i-Pr), isobutyl (i-Bu), tert-butyl (t-Bu), sec-butyl (s-Bu), isopentyl, neopentyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, cyclopentenyl, cyclohexenyl, cycloheptenyl, cyclooctenyl. memylcyclopropyl. ethylcyclohexenyl, butenylcyclopentyl, adamantyl, norbornyl and the like. In substituted alky Is, substituents are independently selected from a group consisting of halogen,

heteroarylCiMoalkyl, Ci-ioalkyloxy, arylCo-ioalkylosy, Ci-ioalkylthio, arylCo-ioalkylthio, Ci- loalkylamino, arylCo-ioalkylamino, N-aryl-N— Co-ioalkylamino, Ci-ioalkylcarbonyl, arylCV loalkylcarhonyl, Ci-ioalkylcarboxy, arylCo-ioalkylcarboxy, Ci-ioalkylcarbonylamino, arylCo- loalkylcarbonylamino, tetiahydrofuryl, morpholinyl, piperazinyl, hydroxypyronyl, -----Co- loalkylCOOFU and— Co-ioalkylCONRbRc, wherein R.,, Rb and R_c are independently selected from hydrogen, an alkyl, an aryl, or Rb and Rc are taken together with the nitrogen to which they are attached to form a saturated cyclic or unsaturated cyclic system containing 3 to 8 carbon atoms, with at least one substituent

The term '"aryP refers to an unsubstituted, monosubstituted, disubstituted, or trisubstituted monocyclic, polycyclic, biatyl aromatic groups covalently attached at any ring position capable of forming a stable covalent bond, certain preferred points of attachment being apparent to those skilled in the art (e.g., 3-phenyl, 4-naphtyl and the like). In substituted aruls, substituents are

selected from hydrogen, an alkyl, an aryl, or Rb and R_c are taken together with the nitrogen to which they are attached to form a saturated cyclic or unsaturated cyclic system containing 3 to 8 carbon atoms with at least one substituent

The definition of "aryl" includes, but is not limited to, such specific groups as phenyl, biphenyl, naphthyi, dihydronaphthyl, tetrahydronaphthyl, indenyl, indanyl, azulenyl, anthryi, phenanthryi, fluorenyl, pyrenyl and the like.

The terms "heteroaryl", "heterocycle" or "neterocyclic'^' refer to a monovalent unsaturated group having a single ring or multiple condensed (also known as "fused") rings, from 1 to 8 carbon atoms and from 1 to 4 hetero atoms selected from nitrogen, sulfur or oxygen within the ring. The heteroaryl groups in this invention can be optionally substituted with 1 to 3 substituents selected from the group consisting of halogen, —

trihalomethyl,

and— Co-ioalkylCONRbRc wherein Ra, ¾ and Ro are independently selected from hydrogen, an alkyl, an aiyl, or R* and Rc are taken together with the nitrogen to which they are attached to form a saturated cyclic or unsaturated cyclic system containing 3 to 8 carbon atoms with at least one substituent.

The definition of "heteroaryf' includes, but is not limited to, such specific groups as thienyl, benzothienyl, isobenzothienyl, 2,3-dmydrobenzothienyl, furyl, pyranyl, benzofuranyl, isobenzofurany], 2,3-dihydrobenzofuranyl, pyrrolyl, pyrrolyl-2,5-dione, 3-pyrrolinyl, indolyl, isoindolyl, 3H-indolyl, indolinyl, indoUzinyl, indazolyl, phwaliinidyl (or isoindoly-l,3-dione), imidazolyl, 2H-imidazoUnyl, benzimidazolyl, pyridyl, pyrazinyl, pyradazinyl, pyrimidinyl, triazinyl, quinolyl, isoquinolyl, 4H-quinolizinyl, cinnolinyl. phthalazinyl, quinazolinyl, quinoxalinyl, 1,8-naphthyridinyl, pteridinyl, carbazolyl, acridinyl, phenazinyl, phenothiazinyl, phenoxazinyl, chromanyl, benzodioxolyl. piperonyl, purinyl. pyrazoh/l, triazolyl. tetrazolyl, thiazolyl, isothiazolyl, benzthiazolyl, oxazolyl, isoxazolyl, benzoxazolyl, oxadiazolyl, thiadiazolyl, pyrrolidinyl-2,5-dione, imidazolidinyl-2,4-dione, 2-thioxo-imidazolidinyl-4-one, iniidazolidinyl-2,4-dithionc, thiazolidinyl-2,4-dione, 4-thioxo-thiazolidinvl-2-onc, piperazinyl- 2,5-dione, tetrahydro-pyridazinyl-3 ,6-dione, 1 ,2-dihydro-f 1 ,2,4,5]tetrazinyl-3 ,6-dione, [l,2_;,4,5]tetrazinanyl-3,6-dione, dihydro-pyrimidinyl-2,4-dione, p\'rimidinyl-2,4,6-trione and the like.

The term "acyl" refers to a radical— R— C(=0)— , i.e., to a radical derived from an organic acid by the removal of the hydroxyl group of the carboxylic moiety. Typical examples of acyl groups include acetyl and benzoyl moieties.

Examples include but are not limited to (2R,3S,4S)-3-Hexyl-4-(2-hydroxy-tridecyl)-oxetan-2- one; (2R,3S,4S)^-(2-Hydroxy-tridecyl)-3-(2-memoxy-ethoxy)-oxetan-2-one; (2R,3S,4S)-3- Hexyl-4-(2-hydroxy-hex-5-enyl)-oxetan-2-one; (2R,3S,4S)-3-Hexyl-4-(2-hydroxy-hept-5-enyl)- oxetan-2-one; (2R,3S,4S)-3-e%l-4-(2-hydroxytridecyl)oxetan-2-one; (2R,3S,4S)-3-lHexyl-4- (2 -hydroxy -pentadecyl)-oxetan-2-one; (2R,3S,4S)-4-(2-Hydroxy-pentadecyl)-3-(2-methoxy- ethoxy)-oxetan-2-one; (2R,3S,4S)-3-butyl-4-(2-hydroxytridecyl)oxetan-2-one; (2R,3S,4S)-3- Ethyl-4-(2-hydroxy-tridecyl)-oxetan-2-one; (2R,3S,4S)-4-(2-Hydroxy-tridecyl)-3-methyl- oxetan-2-one; (S)-3-octyl-(S)^-((R)-2-tert-butyldimethylsiloxy)undecyl-oxetan-2-one^ (3 S,4S)- 3-hexyl-4-((R)-2-hydroxypropyl)oxetan-2-one; (2R,3S,4S)-3-Hexyl-4-(2-hydroxy-tridec-12- enyl)-oxetan-2-one; (3S,4S)-3-buryl-4-((R)-2-hydroxypropyl)oxetan-2-one; (2R,3S,4S)-3- Hexyl-4-(2-hydroxy-tridec-5-enyl)-oxetan-2-one; (3RS,4RS)-3-(non-8-en-l-yl)-4-(2-(pyridin-3- yl)ethyl)oxetan-2-one and derivatives and substitutions thereof.

For examples the β-Lactone bacterial ClpP inhibitor may include but are not limited to (3RS,4RS)-3-(8-Nonenyl)-4-(2-phenylethyl)oxetan-2-one; (3RS,4RS)-3-Non-8-enyl-4-(2-(3- pyridyl)ethyl)-oxetan-2-one; (3RS,4RS)-3-Dodecyl-4-(2-phenylethyl)oxetan-2-one; (3RS,4RS)- 4-(4-(N,N-Dimethylanuno)benzamido-5-pentyl)-3-(non-8-enyl)oxetan-2-one; (3RS,4RS)-4-[N- (tert-Butoxycarbonyl)- 1 l-aminoundecyl]-3-(non-8-enyl)-oxetan-2-one; (3RS,4RS)-3-(N-(tert- Butoxycarbonyl)-9-aminononyl)-4-(dec-9-enyl)oxetan-2-one; S-Pyridin-2-yl- 10-undecene thioate; (Z)-2-((l-((tert-ButyldimemylsUyl)oxy)undeca-l,10^henyl)thio)pyri and (3RS,4RS)-3-(non-8-en-l-yl)^(2-(pyridin-3-yl)ethyl)oxetan-2-one. The substituted b-lactone inhibitor is a bacterial ClpP inhibitor having the structure (3RS,4RS)-3-(non-8-en- l-yl)-4-(2- (pyridin-3-yl)ethyl)oxetan-2-one (A2-32-01).

The present invention provides one or more antibody or antigen binding fragment thereof that binds at least a portion of a peptide selected from Lon protease, Hsp60, Hsp40, HsplO, Clp, ClpP, ClpX, OPA1, PGC-la, Tfam, and VDAC. These one or more antibody or antigen binding fragment may be included in a pharmaceutical formulation comprising an antibody or antigen binding fragment thereof that binds at least a portion of a peptide selected from Lon protease, Hsp60, Hsp40, HsplO, Clp, ClpP, ClpX, OPA1, PGC-la, Tfam, and VDAC in a pharmaceutically acceptable carrier. The present invention also provides an antibody or antigen binding fragment thereof that binds at least a portion of a peptide selected from Lon protease, Hsp60, Hsp40, HsplO, Clp, ClpX, OPA1, PGC-la, Tfam, and VDAC for use in a method of treating a disease selected from obesity, diabetes, hepatic steatosis, glucose intolerance, and insulin resistance. The one or more antibody or antigen binding fragment thereof may bind to at least a portion of a peptide selected from Lon protease, Hsp60, Hsp40, HsplO, Clp, ClpP, ClpX, OPA1, PGC-la, Tfam, and VDAC to inhibit, inpart or entirely, its activity. The ClpP modulated disease may be obesity, diabetes, hepatic steatosis, glucose intolerance, insulin resistance or a combination thereof.

It will be understood that particular embodiments described herein are shown by way of illustration and not as limitations of the invention. The principal features of this invention can be employed in various embodiments without departing from the scope of the invention. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, numerous equivalents to the specific procedures described herein. Such equivalents are considered to be within the scope of this invention and are covered by the claims. The use of the word "a" or "an" when used in conjunction with the term "comprising" in the claims and/or the specification may mean "one," but it is also consistent with the meaning of "one or more," "at least one," and "one or more than one." The use of the term "or" in the claims is used to mean "and/or" unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive, although the disclosure supports a definition that refers to only alternatives and "and/or." Throughout this application, the term "about" is used to indicate that a value includes the inherent variation of error for the device, the method being employed to determine the value, or the variation that exists among the study subjects.

As used in this specification and claim(s), the words "comprising" (and any form of comprising, such as "comprise" and "comprises"), ^c¾aving" (and any form of having, such as ^c¾ave" and ^c¾as"), "including" (and any form of including, such as "includes" and "include") or "containing" (and any form of containing, such as "contains" and "contain") are inclusive or open-ended and do not exclude additional, unrecited elements or method steps. In embodiments of any of the compositions and methods provided herein, "comprising" may be replaced with "consisting essentially of or "consisting of. As used herein, the phrase "consisting essentially of requires the specified integers) or steps as well as those that do not materially affect the character or function of the claimed invention. As used herein, the term "consisting" is used to indicate the presence of the recited integer (e.g., a feature, an element, a characteristic, a property, a method/process step or a limitation) or group of integers (e.g., feature(s), element(s), characteristic(s), property(ies), method/process steps or limitations)) only.

The term "or combinations thereof as used herein refers to all permutations and combinations of the listed items preceding the term. For example, "A, B, C, or combinations thereof is intended to include at least one of: A, B, C, AB, AC, BC, or ABC, and if order is important in a particular context, also BA, CA, CB, CBA, BCA, ACB, BAC, or CAB. Continuing with this example, expressly included are combinations that contain repeats of one or more item or term, such as BB, AAA, AB, BBC, AAABCCCC, CBBAAA, CABABB, and so forth. The skilled artisan will understand that typically there is no limit on the number of items or terms in any combination, unless otherwise apparent from the context.

As used herein, words of approximation such as, without limitation, "about", "substantial" or "substantially" refers to a condition that when so modified is understood to not necessarily be absolute or perfect but would be considered close enough to those of ordinary skill in the art to warrant designating the condition as being present The extent to which the description may vary will depend on how great a change can be instituted and still have one of ordinary skill in the art recognize the modified feature as still having the required characteristics and capabilities of the unmodified feature. In general, but subject to the preceding discussion, a numerical value herein that is modified by a word of approximation such as "about" may vary from the stated value by at least ±1, 2, 3, 4, 5, 6, 7, 10, 12 or 15%.

All of the compositions and/or methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions and/or methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.

REFERENCES

Aldridge JE, Horibe T, Hoogenraad NJ (2007) Discovery of genes activated by the mitochondrial may be unfolded protein response (mtUPR) and cognate promoter elements. PLoS One 2: e874

Anand R, Wai T, Baker MJ, Kladt N, Schauss AC, Rugarli E, Langer T (2014) The i-AAA protease YME1L and OMA1 cleave OPA1 to balance mitochondrial fusion and fission. J Cell Biol 204: 919-929

Andringa KK, Udoh US, Landar A, Bailey SM (2014) Proteomic analysis of 4-hydroxynonenal (4-HNE) modified proteins in liver mitochondria from chronic ethanol-fed rats. Redox Biol. 2: 1038-1047

Atkinson BJ, Griesel BA, King CD, Josey MA, Olson AL (2013) Moderate GLUT4 overexpression improves insulin sensitivity and fasting triglyceridemia in high-fat diet-fed transgenic mice. Diabetes 62: 2249-2258

Baker BM, Haynes CM (2011) Mitochondrial protein quality control during biogenesis and aging. Trends Biochem Sci 36: 254-261

Bhaskaran S, Unnikrishnan A, Ranjit R, Qaisar R, Pharaoh G, Matyi S, Kinter M, Deepa SS (2017) A fish oil diet induces mitochondrial uncoupling and mitochondrial unfolded protein response in epididymal white adipose tissue of mice. Free Radic Biol Med 108: 704-714

Bota DA, Davies KJ (2016) Mitochondrial Lon protease in human disease and aging: Including an etiologic classification of Lon-related diseases and disorders. Free Radic Biol Med 100: 188-198 Boucher J, Kleinridders A, Kahn CR (2014) Insulin receptor signaling in normal and insulin- resistant states. Cold Spring Harb Perspect Biol 6

Bruning JC, Michael MD, Winnay JN, Hayashi T, Horsch D, AcciU D, Goodyear LJ, Kahn CR (1998) A muscle-specific insulin receptor knockout exhibits features of the metabolic syndrome of NIDDM without altering glucose tolerance. Mol Cell 2: SS9-S69

Chattopadhyay M, Khemka VK, Chatterjee G, Ganguly A, Mukhopadhyay S, Chakrabarti, S. (2015) Enhanced ROS production and oxidative damage in subcutaneous white adipose tissue mitochondria in obese and type 2 diabetes subjects. Mol Cell Biochem 399: 95- 103

Civitarese AE, MacLean PS, Carling S, Kerr-Bayles L, McMillan RP, Pierce A, Becker TC, Mora C, Finlayson J, Lefort N et al (2010) Regulation of skeletal muscle oxidative capacity and insulin signaling by the mitochondrial rhomboid protease PARL. CellMetab 11: 412-426

Cogliati S, Frezza C, Soriano ME, Varanita T, Quintana-Cabrera R, Corrado M, Cipolat S, Costa V, Casarin A, Gomes LC et al (2013) Mitochondrial cristae shape determines respiratory chain supercomplexes assembly and respiratory efficiency. Cell 155: 160-171

Cousin B, Cinti S, Morroni M, Raimbault S, Ricquier D, Penicaud L, Casteilla L (1992) Occurrence of brown adipocytes in rat white adipose tissue: molecular and morphological characterization. JCellSci 103: 931-942

Deepa SS, Bhaskaran S, Ranjit R, Qaisar R, Nair BC, Liu Y, Walsh ME, Fok WC, Van Remmen H (2016) Down-regulation of the mitochondrial matrix peptidase ClpP in muscle cells causes mitochondrial dysfunction and decreases cell proliferation. Free Radic Biol Med 91:281-292

Deepa SS, Pulliam D, Hill S, Shi Y, Walsh ME, Salmon A, Sloane L, Zhang N,Zeviani M, Viscomi C et al (2013) Improved insulin sensitivity associated with reduced mitochondrial complex IV assembly and activity. FASEB J21: 1371-1380

Donate AJ, Henson GD, Hart CR, Layec G, Trinity JD, Bramwell RC, Enz RA, Morgan RG, Reihl KD, Hazra S et al (2014) The impact of ageing on adipose structure, function and vasculature in the B6D2F1 mouse: evidence of significant multisystem dysfunction. J Physiol 592: 4083-4096

Duvezin-Caubet S, Jagasia R, Wagener J, Hofmann S, Trifunovic A, Hansson A, Chomyn A, Bauer MF, Attardi G, Larsson NG et al (2006) Proteolytic processing of OPA1 links mitochondrial dysfunction to alterations in mitochondrial morphology. J Biol Chem 281: 37972- 37979 Fisher FM, Kleiner S, Douris N, Fox EC, Mepani RJ, Verdeguer F, Wu J, Kharitonenkov A, Flier JS, Maratos-Flier E, Spiegelman BM (2012) FGF21 regulates PGC-lalpha and browning of white adipose tissues in adaptive thermogenesis. Genes Dev 26: 271-281

Fisler JS, Warden CH (2006) Uncoupling proteins, dietary fat and the metabolic syndrome. Nutr Metab (Lond) 3: 38

Gispert S, Parganlija D, Klinkenberg M, Drose S, Wittig I, Mittelbronn M, Grzmil P, Koob S, Hamann A, Walter M et al (2013) Loss of mitochondrial peptidase Clpp leads to infertility, hearing loss plus growth retardation via accumulation of CLPX, mtDNA and inflammatory factors. Hum Mol Genet 22: 4871-4887

Haynes CM, Petrova K, Benedetti C, Yang Y, Ron D (2007) ClpP mediates activation of a mitochondrial unfolded protein response in C. elegans. Dev Cell 13: 467-480.

Haynes CM, Yang Y, Blais SP, Neubert TA, Ron, D (2010) The matrix peptide exporter HAF-1 signals a mitochondrial UPR by activating the transcription factor ZC376.7 in C. elegans. Mol Cell 37: 529-540

Heinonen S, Buzkova J, Muniandy M, Kaksonen R, Ollikainen M, Ismail K, Hakkarainen A, Lundbom J, Lundbom N, Vuolteenaho K et al (2015) Impaired Mitochondrial Biogenesis in Adipose Tissue in Acquired Obesity. Diabetes 64: 3135-3145

Held NM, Houtkooper RH (2015) Mitochondrial quality control pathways as determinants of metabolic health. Bioessays 37: 867-876

Horvath TL, Diano S, Miyamoto S, Barry S, Gatti S, Alberati D, Livak F, Lombardi A, Moreno M, Goglia F et al (2003) Uncoupling proteins-2 and 3 influence obesity and inflammation in transgenic mice. IntJObes Relat Metab Disord 27: 433-442

Houtkooper RH, Mouchiroud L, Ryu D, Moullan N, Katsyuba E, Knott G, Williams RW, Auwerx, J (2013) Mitonuclear protein imbalance as a conserved longevity mechanism. Nature 497: 451-457

Irrcher I, Ljubicic V, Hood DA (2009) Interactions between ROS and AMP kinase activity in the regulation of PGC-lalpha transcription in skeletal muscle cells. Am J Physiol Cell Physiol 296: CI 16-123

Jenkinson EM, Rehman AU, Walsh T, Clayton-Smith J, Lee K, Morell RJ, Drummond MC, Khan SN, Naeem MA, Rauf B, et al (2013) Perrault syndrome is caused by recessive mutations in CLPP, encoding a mitochondrial ATP-dependent chambered protease. Am J Hum Genet 92: 605-613 Jensen MB, Jasper H (2014) Mitochondrial proteo stasis in the control of aging and longevity. CellMetab 20: 214-225

Jukarainen S, Heinonen S, Ramo JT, Rinnankoski-Tuikka R, Rappou E, Tummers M, Muniandy M, Hakkarainen A, Lundbom J, Lundbom N, et al (2016) Obesity Is Associated With Low NAD(+)/SIRT Pathway Expression in Adipose Tissue of BMI-Discordant Monozygotic Twins. J Clin Endocrinol Metab 101: 275-283

Kadowaki T, Yamauchi T, Kubota N, Hara K, Ueki K, Tobe K (2006) Adiponectin and adiponectin receptors in insulin resistance, diabetes, and the metabolic syndrome. J Clin Invest 116: 1784-1792

Kasashima K, Sumitani M, Endo H. (2012) Maintenance of mitochondrial genome distribution by mitochondrial AAA+ protein ClpX. Exp Cell Res 318: 2335-43

Katie M, Kennedy AR, Leykin I, Norris A, McGettrick A, Gesta S, Russell SJ, Bluher M, Maratos-Flier E, Kahn CR (2007) Mitochondrial gene expression and increased oxidative metabolism: role in increased lifespan of fat-specific insulin receptor knock-out mice. Aging Cell 6: 827-839

Kleiner S, Mepani RJ, Laznik D, Ye L, Jurczak MJ, Jornayvaz FR, Estall JL, Chatterjee Bhowmick D, Shulman GI, Spiegelman BM (2012) Development of insulin resistance in mice lacking PGC- lalpha in adipose tissues. Proc Natl Acad Sci USA 1Q9: 9635-9640

Krook A, O'Rahilly S (1996) Mutant insulin receptors in syndromes of insulin resistance. Baillieres Clin Endocrinol Metab 10: 97-122

Kusminski CM, Holland WL, Sun K, Park J, Spurgin SB, Lin Y, Askew GR, Simcox JA., McClain DA, Li C, Scherer PE (2012) MitoNEET-driven alterations in adipocyte mitochondrial activity reveal a crucial adaptive process that preserves insulin sensitivity in obesity. Nat Med 18: 1539-1549

Kusminski CM, Park J, Scherer PE (2014) MitoNEET-mediated effects on browning of white adipose tissue. Nat Commun 5: 3962

Kusminski CM, Scherer PE (2012) Mitochondrial dysfunction in white adipose tissue. Trends Endocrinol Metab 23: 435-443

Lee H, Smith SB, Yoon Y (2017) The short variant of the mitochondrial dynamin OPA1 maintains mitochondrial energetics and cristae structure. J Biol Chem 292: 7115-7130

Luce K, Weil AC, Osiewacz HD (2010) Mitochondrial protein quality control systems in aging and disease. Adv Exp Med Biol 694: 108-125 Mahadik SR, Lele RD, Saranath D, Seth A, Parikh V (2012) Uncoiling protein-2 (UCP2) gene expression in subcutaneous and omental adipose tissue of Asian Indians: Relationship to adiponectin and parameters of metabolic syndrome. Adipocyte 1: 101-107

Mancuso DJ, Sims HF, Yang K, Kiebish MA, Su X, Jenkins CM, Guan S, Moon SH, Pietka T, Nassir F et al (2010) Genetic ablation of calcium-independent phospholipase A2gamma prevents obesity and insulin resistance during high fat feeding by mitochondrial uncoupling and increased adipocyte fatty acid oxidation. J Biol Chem 285: 36495-36510

Matsuzaki S, Szweda LI (2007) Inhibition of complex I by Ca2+ reduces electron transport activity and the rate of superoxide anion production in cardiac submitochondrial particles. Biochemistry 46: 1350-1357

Montgomery MK, Turner N (2015) Mitochondrial dysfunction and insulin resistance: an update. Endocr Connect A: R1-R15

Muller FL, Liu Y, Van Remmen H (2004) Complex III releases superoxide to both sides of the inner mitochondrial membrane. J Biol Chem 279: 49064-49073

Narendra DP, Jin SM, Tanaka A, Suen DF, Gautier CA, Shen J, Cookson MR, Youle RJ (2010) PINK1 is selectively stabilized on impaired mitochondria to activate Parkin. PLoS Biol 8: e 1000298

Nargund AM, Pellegrino MW, Fiorese CJ, Baker BM, Haynes CM (2012) Mitochondrial import efficiency of ATFS-1 regulates mitochondrial UPR activation. Science 337: 587-590

Nicholls DG, Budd SL (2000) Mitochondria and neuronal survival. Physiol Rev 80: 315-360

Orrenius . (2007) Reactive oxygen species in mitochondria-mediated cell death. Drug Metab Rev 39: 443-455

Pulliam DA, Deepa SS, Liu Y, Hill S, Lin AL, Bhattacharya A, Shi Y, Sloane L, Viscomi C, Zeviani M, Van Remmen H (2014) Complex IV-deficient Surfl(-/-) mice initiate mitochondrial stress responses. Biochem J 462: 359-371

Rath E, Berger E, Messlik A, Nunes T, Liu B, Kim SC, Hoogenraad N, Sans M, Sartor RB, Haller D (2012) Induction of dsRNA-activated protein kinase links mitochondrial unfolded protein response to the pathogenesis of intestinal inflammation. Gut 61: 1269-1278

Ristow M, Zarse K, Oberbach A, Kloting N, Birringer M, Kiehntopf M, Stumvoll M, Kahn CR, Bluher M (2009) Antioxidants prevent health-promoting effects of physical exercise in humans. Proc Natl Acad Sci USA 106: 8665-8670 Sato T, Kotake D, Hiratsuka M, Hirasawa N (2013) Enhancement of inflammatory protein expression and nuclear factor Kappab (NF-Kappab) activity by trichostatin A (TSA) in OP9 preadipocytes. PLoS One 8: e59702

Seiferling D, Szczepanowska K, Becker C, Senft K, Hermans S, Maiti P, Konig T, Kukat A, Trifunovic A (2016) Loss of CLPP alleviates mitochondrial cardiomyopathy without affecting the mammalian UPRmt. EMBORep 17: 953-964

Silveira LR, Pilegaard H, Kusuhara K, Curi R, Hellsten Y (2006) The contraction induced increase in gene expression of peroxisome proliferator-activated receptor (PPAR)-gamma coactivator 1 alpha (PGC-lalpha), mitochondrial uncoupling protein 3 (UCP3) and hexokinase II (HKII) in primary rat skeletal muscle cells is dependent on reactive oxygen species. Biochim BiophysActa 1763: 969-976

St-Pierre J, Drori S, Uldry M, Silvaggi JM, Rhee J, Jager S, Handschin C, Zheng K, Lin J, Yang W, Simon DK, Bachoo R, Spiegelman BM (2006) Suppression of reactive oxygen species and neurodegeneration by the PGC-1 transcriptional coactivators. Cell 127: 397-408

Souza BM, Assmann TS, Kliemann LM, Gross JL, Canani LH, Crispin. D (2011) The role of uncoupling protein 2 (UCP2) on the development of type 2 diabetes mellitus and its chronic complications. Arq Bras Endocrinol Metabol 55: 239-248

Szczepanowska K, Maiti P, Kukat A, Hofsetz E, Nolte H, Senft K, Becker C, Ruzzenente B, Hornig-Do HT, Wibom R et al (2016) CLPP coordinates mitoribosomal assembly through the regulation of ERAL1 levels. EMBOJX: 2566-2583

Tiraby C, Tavernier G, Lefort C, Larrouy D, Bouillaud F, Ricquier D, Langin D (2003) Acquirement of brown fat cell features by human white adipocytes. J Biol Chem 278: 33370-33376

Tschop MH, Speakman JR, Arch JR, Auwerx J, Bruning JC, Chan L, Eckel RH, Farese RV Jr., Galgani JE, Hambly C, et al (2011) A guide to analysis of mouse energy metabolism. Nat Methods 9: 57-63

Uchida K, Szweda LI, Chae HZ, Stadtman ER (1993) Immunochemical detection of 4- hydroxynonenal protein adducts in oxidized hepatocytes. Proc Natl Acad Sci U SA 90: 8742- 8746

Uchida K, Itakura K, Kawakishi S, Hiai H, Toyokuni S, Stadtman ER (1995) Characterization of epitopes recognized by 4-hydroxy-2-nonenal specific antibodies. Arch Biochem Biophys 324: 241-248 Vemochet C, Mourier A, Bezy O, Macotela Y, Boucher J, Rardin MJ, An D, Lee KY, Ilkayeva OR, Zingaretti, CM et al (2012) Adipose-specific deletion of TFAM increases mitochondrial oxidation and protects mice against obesity and insulin resistance. CellMetab 16: 765-776

Voos W, Jaworek W, Wilkening A, Bruderek M (2016) Protein quality control at the mitochondrion. Essays Biochem 60: 213-225

Wajchenberg BL (2000) Subcutaneous and visceral adipose tissue: their relation to the metabolic syndrome. EndocrRev 21: 697-738

Wallace DC, Fan W, Procaccio V (2010) Mitochondrial energetics and therapeutics. Annu Rev Pathol 5: 297-348

Wu J, Cohen P, Spiegelman BM (2013) Adaptive thermogenesis in adipocytes: is beige the new brown? Genes Dev 27: 234-250

Yang YK, Chen M, Clements RH, Abrams GA, Aprahamian CJ, Harmon CM (2008) Human mesenteric adipose tissue plays unique role versus subcutaneous and omental fat in obesity related diabetes. Cell Physiol Biochem 22: 531-538

Zhao Q, Wang J, Levichkin IV, Stasinopoulos S, Ryan MT, Hoogenraad NJ (2002) A mitochondrial specific stress response in mammalian cells. EMBO J 21: 4411-4419

Zheng Z, Liu X, Zhao Q, Zhang L, Li C, Xue Y (2014) Regulation of UCP1 in the Browning of Epididymal Adipose Tissue by beta3 -Adrenergic Agonist: A Role for MicroRNAs. Int J Endocrinol 2014: 530636

Zisman A, Peroni OD, Abel ED, Michael MD, Mauvais-Jarvis F, Lowell BB, Wojtaszewski JF, Hirshman MF, Virkamaki A, Goodyear LJ, et al. (2000) Targeted disruption of the glucose transporter 4 selectively in muscle causes insulin resistance and glucose intolerance. Nat Med 6: 924-928

Claims

1. A method of treating obesity in a patient by upregulation of mitochondrial chaperones comprising the steps of: providing a pharmaceutically effective amount of a cDNA composition encoding one or more cellular proteins to increase the one or more cellular proteins in the cell and reduced adiposity in the patient.

2. The method of claim 1, wherein the one or more cellular proteins are selected from Lon protease, Hsp60, Hsp40, HsplO, ClpX, OPA1, PGC-Ια, Tfam, and VDAC.

3. A method of treating obesity in a patient by down-regulation of one or more mitochondrial proteases comprising the steps of: providing a pharmaceutically effective amount of a mitochondrial protease antagonist to the patient, wherein the mitochondrial protease antagonist interacts to reduce the level of mitochondrial protease in a patient; and reducing the availability of the mitochondrial protease and increasing the levels of one or more cellular proteins and reduce adiposity in the patient

4. The method of claim 1, wherein the one or more cellular proteins comprise mitochondrial chaperones and the mitochondrial protease.

5. The method of claim 3, wherein the one or more cellular proteins are selected from Lon protease, Hsp60, Hsp40, HsplO, ClpX, OPA1, PGC-Ια, Tfam, and VDAC.

6. The method of claim 3, wherein the mitochondrial protease antagonist comprises a cDNA composition encoding a peptide that down regulates the mitochondrial protease.

7. The method of claim 3, wherein the mitochondrial protease antagonist comprises a cDNA composition encoding a peptide that binds the mitochondrial protease.

8. The method of claim 3, wherein the mitochondrial protease is a mitochondrial matrix protease.

9. The method of claim 3, wherein the mitochondrial protease is a caseinolytic peptidase.

10. The method of claim 3, wherein the mitochondrial protease interacts to reduce a caseinolytic peptidase multimerization with a mitochondrial chaperone.

11. The method of claim 3, wherein the mitochondrial protease interacts to reduce the formation of a ClpXP protease.

12. A cDNA composition encoding a peptide selected from Lon protease, Hsp60, Hsp40, HsplO, ClpX, OPA1, PGC-Ια, Tfam, and VDAC.

13. A method of treating a disease in a patient by ^regulation of mitochondrial chaperones comprising the steps of: providing a pharmaceutically effective amount of a cDNA composition encoding one or more cellular proteins to increase the one or more cellular proteins in the cell and reduced one or more symptom of the disease in the patient.

14. The method of claim 13, wherein the disease is obesity, diabetes, hepatic steatosis, glucose intolerance, insulin resistance.

15. A method for promoting weight loss or facilitating maintenance of a stable weight, the method comprising administering to an obese or overweight human individual in need thereof a pharmaceutically effective amount of a mitochondrial chaperone antagonist, whereby weight loss is promoted or maintenance of a stable weight is facilitated.

16. A method of inhibition of ClpP activity comprising the steps of: providing a pharmaceutically effective amount of a β-Lactone inhibitor to inhibit ClpP activity, Wherein the β-Lactone inhibitor is preferably (3RS,4RS)-3-(8-Nonenyl)-4-(2- phenylethyl)oxetan-2-one; (3RS,4RS)-3-Non-8-enyl-4<2-(3-pyridyl)ethyl)-oxetan-2-one; (3RS,4RS)-3-Dcxiecyl-4-(2-phen^

Dimethylammo)benzamido-5-pentyl)-3-(non-8-enyl)oxetan-2-one; (3RS,4RS)-4-[N-(tert- Butoxycarbonyl)-l l-aminoundecyl]-3-(non-8-enyl)-oxetan-2-one; (3RS,4RS)-3-(N-(tert- Butoxycarbonyl)-9-aminononyl)-4-(dec-9-enyl)oxetan-2-one; S-Pyridin-2-yl- 10-undecene thioate; (Z)-2-((l-((tert-Butyldimemylsilyl^ or (3RS,4RS)-

3-(non-8-en-l-yl)-4-(2-^yridin-3-yl)ethyl)oxetan-2-one or a pharmaceutically acceptable salt thereof and more preferably (3RS,4RS)-3-(non-8^n-l-yl)^-(2-(pyridin-3-yl)ethyl)oxetan-2-one or a pharmaceutically acceptable salt thereof.

17. The method of claim 16, wherein the β-Lactone inhibitor is (3RS,4RS)-3-(non-8-en-l- yl)^(2-(r>yridin-3-yl)ethyl)oxetan-2-one or a pharmaceutically acceptable salt thereof.

18. An antibody or antigen binding fragment thereof that binds at least a portion of ClpP.

19. An antibody or antigen binding fragment thereof that binds at least a portion of a ClpP peptide for use in a method of treating a ClpP modulated disease.