WO2019109359A1 - Sgrna, lentivirus vector constructed therefrom, and application thereof - Google Patents

Abstract

Provided are an sgRNA, a lentivirus vector constructed therefrom, and an application thereof. The nucleotide sequence of the sgRNA is as shown in SEQ ID NOs. 1-3. The present invention uses the currently most efficient gene-editing tool, CRISPR/Cas9, and the designed HIF-1α gene sgRNA locus has better gene knockout activity than other loci reported in previous studies. By combining with TAE/TACE surgery for the first time, the present invention can be used in HCC tumor treatment.

Description

SgRNA and its constructed lentiviral vector and application Technical field

The invention relates to the field of biological gene therapy, in particular to a sgRNA and a lentiviral vector and application thereof, in particular to a lentivirus expressing CRISPR/Cas9 and targeting the knockdown HIF-1α gene and its combined liver artery Embolization for clinical therapeutic applications in patients with human liver tumors.

Background technique

As the fifth largest malignant tumor in the world, the mortality rate of Hepatocellular carcinoma (HCC) ranks among the top three in all tumors. The treatment situation of HCC in recent decades is not optimistic. HCC accounts for about 85% to 90% of the proportion of primary liver cancer. The data show that in 2012, there were 782,500 new cases of liver cancer in the world, and 745,500 patients died of liver cancer. At present, clinical techniques for the treatment of liver cancer include surgical resection and orthotopic liver transplantation. Studies have shown that 50% of patients with liver cancer are not suitable for these traditional methods because they are found too late. The Barcelona clinical liver cancer staging system (BCLC) pointed out that for patients with advanced stage B of HCC who cannot undergo surgery, it is recommended to use transarterial embolization (TAE), including transcatheter arterial chemoembolization. Transarterial chemoembolization (TACE).

At present, the development of new drugs for the treatment of liver tumors is very urgent. Clinically, TAE is to inject mixed materials including chemotherapy drugs into the HCC tumor arteries, block the tumor nutrient supply, lead to tumor tissue ischemia, hypoxia and necrosis, etc., to achieve the purpose of inhibiting tumor growth. Studies have shown that TAE/TACE can effectively control the growth of HCC and prolong the life of patients with liver cancer. However, HCC patients after TAE are prone to tumor recurrence, metastasis, and a worrying prognosis. Studies have shown that these adverse consequences are associated with tumor changes in hypoxic environments. This requires new methods or techniques to improve current TAE/TACE treatments, particularly to limit tumor angiogenesis and tumor metastasis under hypoxic conditions of HCC. Although, in recent years, tumor therapy represented by gene therapy and immunotherapy has made a huge breakthrough. However, its high cost, lengthy time consumption, and complex implementation strategies have made it possible to increase the use of existing clinically common patients. To this end, the use of existing new technologies to improve existing clinically feasible HCC treatments (including TAE) has become an urgent need and a development option.

Recently, the use of gene editing technology to transform the human genome has made great progress, especially in the field of translational medicine. CRISPR (clustered regular interspaced short palindromic repeats)/Cas9 editing technology is one of the most advanced and mature gene editing technologies. In particular, the CRISPR/Cas9 protein is a class of endonucleases derived from bacteria or archaea for obtaining an immune response in vivo. It targets specific DNA sites and completes gene editing under the guidance of a short guide RNA (sgRNA). At the biotechnology level, CRISPR/Cas9 and sgRNA can be introduced and expressed in target cells by a tool vector such as lentivirus, and CRISPR/Cas9 targets the DNA site of interest under the guidance of sgRNA. At this moment, the DNA double strand will be cleaved by the CRISPR/Cas9 protein, and part of the DNA sequence will be deleted and the nucleic acid coding sequence will be completely changed. The target gene will undergo a frameshift mutation and cannot perform normal function. To this end, CRISPR/Cas9 editing technology is a practical technique for the treatment of tumors caused by multiple gene mutations. Therefore, CRISPR/Cas9 gene editing technology can be used for biogene therapy in patients with HCC.

HIF-1α is a hypoxia-inducible transcription factor that plays a role in the progression of HCC, angiogenesis, chemotherapy tolerance, and liver cancer stem cell development. Studies have shown that HIF-1α activates hypoxia-related signaling pathways through its own hypoxia response element (HRE), up-regulates vascular endothelial growth factor (VEGF), thereby promoting tumor vascular endothelial cell growth. And new blood vessels. In addition, HIF-1α activates epithelial-mesenchymal transition (EMT) by upregulating MMP2 and MMP9 proteins, which is beneficial to tumor invasion and metastasis. Previous studies have also shown that HIF-1α protein is highly expressed in HCC, which is closely related to the high metastasis of hepatic vein. The MDR1 protein (multi-drug resistance protein) is also regulated by HIF-1α protein, and its protein product P-gp can maintain low chemotherapy in tumor cells. The drug concentration, which makes HCC have anti-chemotherapeutic drugs. More studies have shown that HCC patients in this treatment have high expression of HIF-1α protein in their serum and tumor tissues compared with patients who have not been treated with TAE/TACE. HIF-1α is closely related to high recurrence and tumor metastasis in patients.

Studies have shown that TAE/TACE surgery can effectively control the growth of HCC and prolong the life of patients. However, HCC patients after TAE are prone to tumor recurrence and a worrying prognosis. Studies have shown that patients with tumor recurrence, metastasis, drug resistance and various poor prognosis have a significant positive correlation with HIF-1α protein expressed in tumor tissues after TAE/TACE in HCC patients. To this end, there are significant treatment deficiencies in TAE/TACE surgery for HCC patients, and this long-term adverse outcome needs to be addressed and resolved.

Therefore, inhibition of high expression of HIF-1α in HCC patients after TAE/TACE is expected to cut off tumor recurrence and development, and it is a reliable and improved way to treat HCC.

Summary of the invention

In view of the defects of the prior art, the present invention provides a sgRNA and a lentiviral vector and application thereof, and the HIF-1α gene is knocked out from the gene level by advanced gene editing technology, thereby realizing the technical improvement of the TAE/TACE surgery. Significantly improve the quality of life and survival time of patients with HCC.

To this end, the present invention employs the following technical solutions:

In a first aspect, the invention provides a sgRNA having a nucleotide sequence as set forth in SEQ ID NO. 1-3 or a nucleotide sequence having at least 80% identity thereto.

The nucleotide sequence is as follows:

SEQ ID NO. 1 (sgRNA719): CCTCACACGCAAATAGCTGA;

SEQ ID NO. 2 (sgRNA720): TACTCATCCATGTGACCATG;

SEQ ID NO. 3 (sgRNA721): GTTATGGTTCTCACAGATGA.

In the present invention, the sgRNA was designed and optimized by studying HIF-1α, and it was found that the expression of CRISPR/Cas9 by the above sgRNA was used to efficiently knock out the HIF-1α gene, and knockdown of HCC liver cancer cells by lentiviral targeting. The HIF-1α gene can effectively control the growth of tumor cells, including inhibiting tumor cell migration and cell invasion, cell cycle arrest in G2/M phase, and promoting tumor cell apoptosis. The effect is obvious and statistically significant.

According to the present invention, the nucleotide sequence of the sgRNA is shown in SEQ ID NO. 3, and the inventors have verified that the three sgRNAs are capable of knocking out the HIF-1α gene, but SEQ ID NO. The nucleotide sequence shown, sgRNA721, has the highest targeting to the HIF-1α gene and the highest knockout efficiency.

In a second aspect, the invention provides a CRISP/Cas9 lentiviral vector comprising the nucleotide sequence of the sgRNA of the first aspect.

In the present invention, the vector may be an existing vector capable of constructing a lentiviral vector, and the sgRNA of the present application may be inserted into the vector to achieve the purpose of knocking out the HIF-1α gene in the present application. The skilled person can select the vector as needed, and is not particularly limited herein. The present application selects a conventional pLenti-CAS vector.

In a third aspect, the present invention provides a method for constructing a CRISP/Cas9 lentiviral vector according to the second aspect, comprising the steps of:

(1) designing sgRNAs according to the first exon sequence of HIF-1α;

(2) The obtained sgRNAs were inserted into a pLenti-CAS vector to obtain the CRISP/cas9 lentiviral vector.

In a fourth aspect, the present invention provides a recombinant lentivirus comprising a recombinant lentivirus comprising a CRISP/Cas9 lentiviral vector according to the second aspect and a packaging helper plasmid psPAX2, pMD2.G and PEImax reagent co-transfected with a mammalian cell .

According to the invention, the mammalian cell is a HEK293T cell.

In a fifth aspect, the present invention provides a CRISP/Cas9 lentiviral vector according to the second aspect for use in knocking out the HIF-1α gene.

In a sixth aspect, the present invention provides a pharmaceutical composition comprising the lentiviral vector of the second aspect and/or the recombinant lentivirus of the four aspects.

In a seventh aspect, the invention provides the lentiviral vector of the second aspect, the recombinant lentivirus of the fourth aspect or Use of the pharmaceutical composition according to the sixth aspect for the preparation of an antitumor drug.

Preferably, the tumor is a liver tumor, preferably liver cancer.

Preferably, the composition further comprises a pharmaceutically acceptable excipient, which is any one or a combination of at least two of an excipient, a diluent, a carrier, a flavoring agent, a binder, and a filler.

In an eighth aspect, the invention provides a lentiviral vector according to the second aspect, a recombinant lentivirus according to the fourth aspect, or a pharmaceutical composition according to the sixth aspect, for use in the treatment of a liver tumor.

According to the invention, the recombinant lentivirus and/or pharmaceutical composition is used in combination with any one or a combination of at least two of surgery, chemotherapy or radiation therapy.

According to the invention, the surgery is hepatic artery embolization (TAE) and/or transcatheter arterial chemoembolization (TACE).

In the present invention, the HIF-1α gene is knocked out from the gene level by advanced gene editing technology, and the quality technical improvement of the TAE/TACE operation is achieved, and the quality of life and survival time of the HCC patient are significantly improved.

Compared with the prior art, the present invention has the following beneficial effects:

(1) The CRISPR/Cas9 lentivirus of the present invention can efficiently knock out the HIF-1α gene, and knock out the HIF-1α gene in HCC hepatoma cells by lentiviral targeting, thereby achieving effective control of tumor cell growth, including inhibition. Tumor cell migration and cell invasion, cell cycle arrest in G2/M phase, and promotion of tumor cell apoptosis, etc., have obvious effects and significant statistical differences;

(2) The present invention adopts the most efficient CRISPR/Cas9 gene editing tool, and the designed HIF-1α gene sgRNA site has the knockout activity superior to other sites reported in previous studies, and the first joint TAE/TACE Surgery for HCC tumor therapy, this gene therapy combined with TAE/TACE is more effective than TAE/TACE in the treatment of HCC, and its clinical use potential is greater;

(3) The present invention combines the CRISPR/Cas9 editing technology of HIF-1α gene with TAE/TACE surgery, and can significantly inhibit the growth of mouse HCC and prolong the survival time of in situ HCC tumor-bearing mice, in order to achieve clinical Effective treatment and life extension of HCC patients provides a new treatment.

DRAWINGS

Figure 1 (A) shows the expression of HIF-1α protein in normal liver tissues (Normal, N) and HCC tissues (Tumor, T) in 3 HCC tissues of 3 liver cancer patients by immunoblotting; Figure 1 (B) is the immune group. The expression of HIF-1α protein in normal liver tissue and HCC hepatocarcinoma of HCC cancer in 1 liver cancer patient was observed. Figure 1 (C) shows the immunohistochemical detection of HIF in normal liver tissue and HCC cancer tissue of 20 patients. -1α protein expression difference. Statistical difference analysis: *, p ≤ 0.05;

2(A) is a schematic diagram of three sgRNAs and pLenti-CAS-sgRNA-egfp lentiviral expression vectors constructed in accordance with the present invention; and FIG. 2(B) is a HIG-treated by DNA gel electrophoresis for detection of the T7E1 endonuclease kit. 1α gene knockout; Figure 2 (C) shows the expression of HIF-1α in hypoxic conditions after different chronic diseases infected SMMC-7721 cells constructed by Western blotting; Figure 2 (D) Lentivirus infection SMMC-7721 cells After expressing GFP protein, MOI=2.5 infection, flow cytometry to detect the proportion of SMMC-7721 cells positively expressed by lentivirus infection; Figure 2 (E) qPCR detection of vegf1 and mdr1 genes in LV-H721 lentivirus infection The expression of VEGF1 and MDR1 protein in SMMC7721 cells under normal culture conditions after LV-H721 lentivirus infection, Fig. 2(F) shows the expression of VEGF1 and MDR1 protein in normal culture conditions of SMMC7721 cells after LV-H721 lentivirus infection. Actin is the internal reference gene; Figure 2 (G) LV-H721 intratumoral injection of mouse HCC tissue, immunohistochemistry detection of HIF-1α protein expression and knockout efficiency, statistical difference analysis: *, p ≤ 0.05; **, p ≤ 0.01; ***, p ≤ 0.001;

Figure 3 (A) Transwell assay to examine the effect of HIF-1α knockdown on the invasive ability of SMMC7721 cells. How much cells show their ability to cross the nylon membrane, MOI=2.5, LV-Ctrl and LV-H721 lentivirus infection after SMMC7721 cells, under hypoxic conditions CoCl ₂ induced cells are cultured and tested for invasive ability; in the case of FIG. 3 (B) MOI = 2.5, the LV-Ctrl and the LV-H721 cells were infected with lentivirus SMMC7721, CoCl ₂ induced The cells were cultured under hypoxic conditions and tested for cell transfer ability. Statistical difference analysis: *, p ≤ 0.05; **, p ≤ 0.01; ***, p ≤ 0.001;

Figure 4 (A) shows that knockdown of HIF-1α inhibits proliferation of SMMC-7721 cells under hypoxic conditions; Figure 4 (B) shows knockdown of HIF-1α in hypoxic conditions against SMMC-7721 cell cycle Figure 4 (C) shows the effect of knockout of HIF-1α on the G0/G1 phase of SMMC-7721 cells under hypoxic conditions; Figure 4 (D) 24 hours and 48 hours after infection, HIF- The effect of 1α knockout on the apoptosis of SMMC-7721 cells under hypoxic conditions and the statistical difference between the treatment groups, statistical difference analysis: *, p ≤ 0.05; **, p ≤ 0.01; ***, P≤0.001;

Fig. 5(A) shows the relationship between in-situ tumor volume and time growth of mice treated in each experimental group by in vivo imaging technique; Figure 5(B) shows the in situ tumor on the 20th day of mice treated in each experimental group. Volume growth; Figure 5 (C) is the 20th day of treatment of mice in each experimental group, stripping the liver to observe the tumor growth in situ; Figure 5 (D) is the survival curve of HCC tumor-bearing mice treated with each experimental group . Statistical difference analysis: *, p ≤ 0.05; **, p ≤ 0.01; ***, p ≤ 0.001; experimental mice were divided into 4 groups, 10 in each group, Ctrl group: orthotopic liver tumor and placebo The mice were treated with HAL group: orthotopic liver tumor and hepatic artery ligation HAL-treated mice group; HAL+LV-Ctrl group: orthotopic liver tumor, hepatic artery ligation HAL and control lentivirus-treated mice group; HAL+LV -H721 group: orthotopic liver tumor, hepatic artery ligation HAL, and lentiviral LV-H721 treated mice group against HIF-1α knockout;

Figure 6 (A) The knockdown of HIF-1α inhibits the angiogenesis of SMMC-7721 in situ HCC tumors, and the expression of CD31 is detected by immunohistochemistry. Figure 6 (B) shows the immunohistochemical detection of CD31+ in tumor tissues. The cell area was statistically different between different treatment groups; Fig. 6(C) shows TUNEL detection of HIF-1α knockdown on SMMC-7721 established in situ HCC tumor apoptosis; Figure 6 (D) shows TUNEL detection of tumor Statistical differences in apoptotic cells between tissues, statistical difference analysis: *, p ≤ 0.05; **, p ≤ 0.01; ***, p ≤ 0.001; experimental mice were divided into 4 groups, each group was 4, Ctrl group: orthotopic liver tumor and placebo-treated mice group; HAL group: orthotopic liver tumor and hepatic artery ligation HAL-treated mice group; HAL+LV-Ctrl group: orthotopic liver tumor, liver artery ligation HAL and control lentivirus-treated mice; HAL+LV-H721 group: orthotopic liver tumor, hepatic artery ligation HAL, and lentiviral LV-H721-treated mice group against HIF-1α knockout.

Detailed ways

The technical solutions of the present invention will be further described with reference to the accompanying drawings and the embodiments of the present invention, but the present invention is not limited to the scope of the embodiments.

Example 1: Detection of HIF1-α expression in HCC tumor tissues

The method for detecting expression of HIF1-α in HCC tumor tissue comprises the following steps:

1. Detection of HIF1-α expression in HCC tumor tissues by protein imprinting

(1) Sample preparation: 1) Surgical operation of hepatobiliary and pancreatic surgery in Shenzhen People's Hospital for tumor and adjacent tissues of HCC liver cancer patients, liquid nitrogen cryopreservation; 2) adding liquid nitrogen, rapid grinding, obtaining tumor and normal tissue powder, RIPA lysate Cleavage the sample; 3) Centrifuge at 12000 g/min for 4 minutes at 4 °C; 4) Transfer the supernatant to a new tube, determine the protein concentration using a protein quantification kit, and record, add 1/5 volume of 5× to each sample. Load the buffer, mix with a gun and boil in a boiling water bath for 5 min; 5) Centrifuge at a maximum speed of 4 ° C for 10 minutes; 6) Transfer the supernatant to a new tube and dispense, and store in a -80 ° C refrigerator.

(2) Western blotting (Western-blot) to identify HIF1-α protein expression:

1) Clean the glass plate: fasten the glass plate with one hand and gently scrub the other hand with the washing powder. After scrubbing on both sides, rinse with tap water, rinse with distilled water and stand in the basket to dry;

2) Glue and load: After aligning the glass plates, put them into the clips and clamp them, then vertically clamp them on the shelf to prepare the glue, and formulate 10% separation glue according to the formula. Immediately after adding TEMED, you can fill the glue and fill the glue. When using a 10ml gun, take 5ml of glue and release it along the glass. When the rubber surface rises to the height of the middle line of the green belt, accelerate the gel with isopropyl alcohol liquid seal and leave it at room temperature for 30min. When the gelation is observed, it will be inverted. Propanol, rinse with water and blot with absorbent paper;

3) With 4% concentrated glue, immediately add TEMED, shake it to fill the glue, fill the remaining space with the concentrated glue and then insert the comb into the concentrated glue. As the glue solidifies, the volume will shrink and shrink, thus making the sample hole The loading volume is reduced, so in the process of solidification of the concentrated glue, it is necessary to make glue on both sides. After the concentrated gel is solidified, the two sides of the comb are respectively pinched and pulled up vertically, and rinsed with water. Glue, put it into the electrophoresis tank;

4) Take the extracted protein sample and load 30μg per electrophoresis well. Add enough electrophoresis solution and start to prepare for loading. (The electrophoresis solution should at least flow through the small glass plate measured inside.) Adhere with a micro-injector. Sample, take the sample out, do not suck in the bubble, insert the sampler needle into the sample hole and slowly add the sample (the sample is too fast to make the sample out of the sample hole, if there is a bubble, the sample may overflow, add the next one When the sample is sampled, the injector should be washed several times in the outer tank running buffer to avoid cross-contamination);

5) Electrophoresis: The electrophoresis time is generally 4 to 5 hours, the voltage is 40V, and 60V is also available. (In order to speed up, use 80V to condense the glue, run with 120-140V after separating the glue, the result is also good, the total time is about 2h). When the bromophenol blue is just run out, the electrophoresis can be terminated and the film can be transferred.

6) Transfer film: Before the film is transferred, the PVDF film is wetted in methanol and then immersed in the transfer buffer. The gel is cut off, the gel is also bubbled in the transfer buffer, and the two pieces of thick filter paper are transferred. The membrane buffer is wet, and the transfer film sandwich layer is assembled. From bottom to top, the filter paper, PVDF membrane, gel, filter paper, and the power source are connected, and the constant flow 60 mA is transferred for 1 hour;

7) Blocking: After washing the membrane with PBST, the membrane was immersed in a blocking solution of 5% skim milk powder prepared with PBST, and blocked at 4 ° C overnight;

8) Primary antibody hybridization: After the blocked membrane was washed with PBST, the membrane was immersed in HIF1-α prepared with PBST. And β-actin antibody (anti-HIF1-α antibody, 1:1000, Proteintech, #20960-I-AP; anti-β-actin antibody, 1:3000, Thermo, #MA1-140) Shake the hybrid at 4 ° C overnight;

9) Washing the membrane: the membrane subjected to primary antibody hybridization was washed 6 times with PBST for 4 minutes each time, and shaken at high speed on a shaker;

10) Secondary antibody hybridization: The washed membrane was immersed in horseradish peroxidase-labeled anti-rabbit IgG-HRP (1:2000, Cell Signaling Technology, #7074) or anti-mouse IgG-HRP (closed with blocking solution). 1:2000, Cell Signaling Technolog, #7076) secondary hybridization solution was shaken for 1 hour at room temperature;

11) Washing the membrane: the membrane subjected to secondary antibody hybridization was washed 6 times with PBST for 4 minutes each time, and shaken at high speed on a shaker;

12) Development: Chemiluminescence (ECL method), mix 0.5 ml of solution A and solution B in the kit and add PVDF membrane and fully contact. After 1-2 min, the protein imager (ThermoFisher, Rockford, IL, USA) Color and take a picture, save the picture, the result is shown in Figure 1 (A).

As can be seen from Fig. 1(A), HIF1-α protein was highly expressed in HCC tumor tissue (T), while HIF1-α protein expressed in adjacent normal liver tissue (N) was low.

2. Immunohistochemical detection of HIF1-α expression in HCC tumor tissues

(1) taking out the above-mentioned HCC liver tumor and adjacent normal tissues after surgery;

(2) 4% paraformaldehyde fixed tumor tissue;

(3) Washing: After the material is fixed, the fixing liquid in the tissue must be washed out, because the fixing liquid remaining in the tissue is not conducive to dyeing, and some precipitation or crystallization influence observation;

(4) Dehydration: 30%, 50%, 70%, 80%, 90% ethanol solution of each stage is dehydrated for 40 minutes, placed in 95%, 100% twice each for 20 minutes (after fixing and washing various materials) , the tissue contains a lot of water, because water and paraffin can not be mutually soluble, so the water in the tissue must be removed);

(5) Transparent: 100% alcohol, xylene equal volume mixture for 15min, xylene 0.5h (or until transparent), xylene must be changed once (because ethanol is incompatible with paraffin, and xylene is soluble in ethanol) It is also soluble in paraffin, so it needs to pass through xylene to transfer after dehydration. When the whole part of the tissue is occupied by xylene, the light can pass through, and the tissue shows different degrees of transparency);

(6) Permeation wax: a mixture of xylene and paraffin wax is placed for 15 minutes, and then paraffin I and paraffin II permeation wax are placed for 20 to 30 minutes each time (the purpose of permeating wax is to remove the transparent agent such as xylene in the tissue, etc. The paraffin is infiltrated into the interior of the tissue to be saturated for embedding. The wax penetration time is longer depending on the waxing time of the tissue, which takes about 1-2 days. The wax penetration should be carried out in the incubator and keep the temperature inside the box at 55-60. °C or so, pay attention to the temperature is not too high, so as not to be brittle. Placed in the incubator 0.5h);

(7) Embedding: The wax-transparent tissue was poured into a container together with the melted paraffin, and then immediately poured into cold water to immediately solidify into a wax block. The melting point of paraffin wax used for embedding is between 50-60 ° C. When embedded, the paraffin wax with different melting point should be selected according to the materials of the tissue, the thickness of the slice, the climatic conditions, etc. The melting point of paraffin wax commonly used in animal materials is 52-56 ° C. ;

(8) slicing, patching;

(9) Immunohistochemical preparation and observation, this experiment requires the use of immunohistochemical DAB assay kit:

1) Tissue sections were baked in a 60 ° C incubator for 2 hours; 2) Tissue sections were placed in xylene (I) for 10 min, replaced with xylene (II) and then soaked for 10 min; 3) Anhydrous ethanol (I) Soak for 5 min; 4) soak for 2 min in absolute ethanol (II); 5) soak for 2 min in 95% ethanol; 6) soak for 2 min in 70% ethanol; 7) soak for 2 min in single distilled water; 8) antigen repair: use 0.01M Trisodium citrate microwave method; 9) After standing for 20 minutes, the slice was returned to room temperature, soaked in three steamed water; 10) immersed in PBS for 5 min; 11) 3% H ₂ O ₂ deionized water, and allowed to stand at room temperature for 10 min. Wash TBST 2-3 times for 5 min each time; 12) Add normal goat serum blocking solution at room temperature for 15 min; 13) Remove excess liquid and add HIF-1α antibody (1:100, Proteintech, #20960-I-AP), 4 Overnight; 14) TBST was washed 3 times for 3 min each; 15) 40-50 μl of horseradish peroxidase-labeled secondary antibody was added dropwise, allowed to stand at room temperature for 30 min; TBST was washed 3 times for 3 min each; 16) DAB was developed in a microscope Understand the degree of dyeing; 17) PBS or tap water rinse for 10 min; 18) hematoxylin counterstaining for about 1 min, 1% hydrochloric acid alcohol differentiation; 19) tap water rinse for 10-15 min; 20) dehydration: 95% alcohol for 10 seconds twice, 100 % Alcohol 10 seconds twice, xylene 10 seconds twice; 21) baking sheet; 22) microscopic observation and scanning to obtain the expression of HIF-1α protein in liver tumor and normal liver tissue and statistical differences in cell expression, results As shown in Figure 1 (B) - Figure 1 (C);

As can be seen from Fig. 1(B), immunohistochemistry results indicated that HIF1-α protein was highly expressed in HCC tumor tissues (HCC), while HIF1-α protein expressed in normal liver tissues (Normal) was low. From Figure 1 (C), the expression of HIF1-α protein in HCC tissues and adjacent normal liver tissues of 20 HCC patients was statistically analyzed. The statistics showed that the difference was significant (*, p ≤ 0.05).

Example 2: Construction of CRISPR/Cas9 Lentiviral Against HIF1-α Knockout

The method for constructing the CRISPR/Cas9 lentivirus comprises the following steps:

1. Construction of pLenti-CAS-sg719/sg720/sg721-egfp plasmid

The sgRNAs (including sgRNA719, sgRNA720 and sgRNA721) targeting the first exon sequence of HIF-1α were designed by online software (www.crispr.mit.edu). The nucleotide sequences of the three sgRNAs were designed as follows:

sgRNA719 (SEQ ID NO. 1): CCTCACACGCAAATAGCTGA;

sgRNA720 (SEQ ID NO. 2): TACTCATCCATGTGACCATG;

sgRNA721 (SEQ ID NO. 3): GTTATGGTTCTCACAGATGA;

The sgRNAs of interest were inserted into the plasmid pLenti-CAS-sgRNA-egfp (GeneChem, Shanghai) and identified by sequencing, and the successful pLenti-CAS-sg719/sg720/sg721-egfp was constructed as shown in Fig. 2(A);

As shown in Figure 2(A), we designed three different sgRNAs for the first exon sequence of HIF-1α, including sgRNA719, sgRNA720 and sgRNA721. The basic structure of the plasmid pLenti-CAS-sgRNA-egfp is shown in the figure.

2. Recombinant lentivirus packaging and purification

(1) 1 × 10 ⁷ HEK 293T cells (ATCC, USA) were plated in a 15 cm-diameter cell dish. The cells were cultured in DMEM (GIBCO) using complete medium, including 10% FBS (GIBCO). 20 μg of pLenti-CAS-sg719/sg720/-sg721 plasmid, 15 μg of psPAX2, 10 μg of pMD2.G (Addgene, USA) and PEImax (Polysciences, USA) were thoroughly mixed and added to 0.5 ml of Opti MEM (GIBCO) medium, followed by On HEK293T cells, add a little medium to the cell layer;

(2) After 6 hours of culture, the mixture was removed and cultured in complete medium. After 48-h, 96-h, the supernatant was collected and filtered using a 0.45 μm filter (Merck Millipore, USA);

(3) The supernatant filtrate was centrifuged in a 20,000 rpm ultracentrifuge for 2 hours (4 ° C), the supernatant was removed, and the bottom LV-CAS virus particles (LV-H719/720/721) were carefully collected in PBS and stored at -80 ° C. refrigerator;

3. Titration of recombinant lentivirus

(1) HEK293T cells were used for titration of recombinant lentivirus. The specific method was to quantify the gene expression level of gfp in cells by qPCR method, wherein β-actin gene was used as an internal reference gene. The specific plan is:

(1') 5×10 ⁴ HEK293T cells were plated into 24-well plates;

(2') After overnight, 10 μl of the concentrated lentiviral stock solution was mixed with 90 μl of DMEM, the mixture was diluted 10-fold, and then 7 gradients were diluted by analogy. Different concentrations of lentivirus were added to HEK293T cells, and three gradients were repeated for each concentration.

After (3') 48 hours, Trizol extracted total RNA from cells, and RT-PCR identified the expression level of GFP mRNA in HEK293T cells after different concentrations of lentivirus infection (specification "Construction and characterization of a PDCD5 recombinant lentivirus vector and its Expression in tumor cells, DOI: 10.3892/or.2012.1756" "Detection of the recombinant lentiviral titer by real-time PCR" section in Methods and Materials.

(4') Primers for virus titration are:

β-actin-F (SEQ ID NO. 4): 5'-GTCCACCGCAAATGCTTCTA-3';

β-actin-R (SEQ ID NO. 5): 5'-TGCTGTCACCTTCACCGTTC-3';

GFP-F (SEQ ID NO. 6): 5'-TGCTTCAGCCGCTACCC-3';

GFP-R (SEQ ID NO. 7): 5'-AGTTCACCTTGATGCCGTTC-3';

The results showed that the virus titers of each recombinant virus: LV-Ctrl, LV-H719, LV-H720 and LV-H721 were: 3×10 ⁸ , 5×10 ⁸ , 3×10 ⁸ , 5×10 ⁸ Tu/ml .

Example 3: Cnr CRISPR/Cas9-expressing lentivirus knockout of SMMC-7721 cells and HCC tumor HIF1-α gene

1. The infection of SMMC-7721 cells by the expression of CRISPR/Cas9 lentivirus

(1) 3×10 ⁵ SMMC-7721 cells (ATCC, USA) were plated into 6-well plates, and 2 cell plates were plated together. The cells were cultured in complete medium DMEM (GIBCO), including 10% FBS (GIBCO). ;

(2) After 8 hours of culture, LV-Ctrl, LV-H719, LV-H720 and LV-H721 were added to the supernatant culture solution, and Polybrene (Sigma) was added, and each sample was repeated 3 times;

(3) After 6-8 hours, the supernatant medium was removed and fresh medium was added; in the hypoxia experiment, 150 μM CoCl ₂ (Sigma) was added to the medium as an hypoxia inducing agent;

(4) After 48 hours, collect the cells and take a partial flow (C6, BD Biosciences) to detect GFP positive cells. Rate of achievement;

(5) The genomic DNA of the cells was extracted by QIAamp DNA Blood Kit (QIAGEN), quantified and determined by spectrophotometer, and then stored at -20 ° C, and the total RNA and total protein were extracted.

2. Identification of HIF1-α gene knockout in SMMC-7721 cells by T7E1 endonuclease

The T7E1 endonuclease mismatch detection kit is used to identify CRISPR/Cas9-mediated gene breaks and fragmental disorders. The procedure is described with reference to the specification. Specifically, the DNA fragment of the defective region is cloned by PCR and denatured at 200 ng and 95 °C. 5 min, then slowly cooled to 35 ° C -37 ° C conditions, the sample was further incubated with 5 U of T7E1 endonuclease in buffer (NEB), DNA electrophoresis and analysis results, the results shown in Figure 2 (B) ;

As can be seen from Figure 2 (B), LV-H719/720/721 lentivirus mediates gene knockdown of HIF-1α.

3. Western blot detection of HIF1-α protein in SMMC-7721 cells infected with LV-H719/720/721 under hypoxia Expression

(1) Sample preparation: 1) After LV-H719/720/721 infection of SMMC-7721 cells for 8 hours (MOI=2.5), 150 μM CoCl ₂ (Sigma) was added to the medium as hypoxia inducer, 72 hours later. Collect cell samples; 2) Add 300 μl of RIPA to SMMC-7721 cells, mix rapidly with a gun, and place on ice for 20 min. During the 2-3 min period, force the tube wall; 3) 4 °C 12000 g/ Centrifuge for 20 minutes at min; 4) Transfer the supernatant to a new tube, measure the protein concentration with a protein quantification kit, and record, add 1/4 volume of 5× loading buffer to each sample and mix with a gun. After boiling in a boiling water bath for 5 min; 5) Centrifuge at a maximum speed of 4 ° C for 10 minutes; 6) Transfer the supernatant to a new tube and dispense, and store in a -80 ° C refrigerator.

(2) Western-blot was used to identify the expression of HIF1-α protein in different treatment groups: the specific procedure was the same as in Example 1.

The picture was saved, and the experimental results are shown in Fig. 2(C). It can be seen from Fig. 2(C) that the LV-H721 virus-mediated HIF-1α knockout effect is good compared with the LV-H719/720 lentivirus. The expression of protein HIF-1α was significantly decreased; therefore, LV-H721 lentivirus will be used in the following examples and used in the study.

4. Trizol extracts total mRNA of SMMC-7721 cells from different lentivirus treatment groups

(1) Prepare reagents: chloroform, isopropanol, 75% ethanol (DEPC water), RNAase-free water or 0.5% SDS solution, specifically add water to RNase-free glass bottle, add DEPC to the final concentration of 0.01% (V/V), overnight and high pressure, SDS should also be treated with treated DEPC water;

(2) SMMC-7721 cells adherently grown after infection with lentiviruses such as LV-H721 for 48-h: add 1 ml of Trizol and repeatedly beat (1 ml of Trizol for 10 cm ² area, and insufficient amount of Trizol may cause DNA contamination). Leave at room temperature for 5 min to ensure complete dissociation of the nucleoprotein complex;

(3) Add 1 ml of Trizol plus 0.2 ml of chloroform, cover the tube cover, mix for 15 s, and let stand for 2-3 min at room temperature;

(4) Centrifugation for 15 min, 4 ° C, the centrifugal speed does not exceed 12000 g;

(5) taking the upper aqueous phase into a new tube, such as separating DNA or protein to retain the organic phase, adding 0.5 ml of isopropanol per 1 ml of Trizol, incubating for 10 min at room temperature;

(6) 12000×15min, 4°C, remove the supernatant, add at least 1ml of 75% ethanol per 1ml of Trizol, mix with vortex, 7500g×5min, 4°C, remove the supernatant, short-time air drying RNA precipitation, use RNase-free Dissolved in water or 0.5% SDS;

(7) Blow several times, incubate at 55-60 ° C for 10 min, and store at -80 ° C;

5. Expression of vegf and mar1 mRNA in SMMC-7721 cells infected with LV-H721

(1) Add 2 μl of extracted total RNA to an RNase-free PCR tube, 2 μl of M-MLV reverse transcription buffer, 2 μl of dNTP, 1 μl of RNasin (Life Technology), and add 9 μl of RNase-free ultrapure water to the total volume. 16μl, mix well;

(2) Take two new RNase-free PCR tubes, labeled with RT+, RT-, and divide the above 16 μl mixture into two tubes;

(3) Add 1 μl of reverse primer of HIV-1 gag to each tube, add 1 μl of M-MLV Reverse Transcription Buffer (Life Technology) to RT+ tube, add 1 μl of RNase-free ultrapure water to RT-tube. Mix well;

(4) Reverse transcription for 1 hour in 42 °C water;

(5) Inactivation of reverse transcriptase at 93 ° C for 3 min;

(6) performing PCR using reverse transcription cDNA as a template;

(7) After the completion of PCR, electrophoresis detection;

(8) After quantitative determination and concentration by ultraviolet spectrophotometer, stored at -20 ° C;

(9) qPCR was used to identify the expression of VEGF1 and MDR1 at the mRNA level. The primers were:

VEGF1-F (SEQ ID NO. 8): 5'-TGCTCTACCTCCACCATGCCA-3';

VEGF 1-R (SEQ ID NO. 9): 5'-GAAGATGTCCACCAGGGTCTCG-3';

MDR1-F (SEQ ID NO. 10): 5'-TGATGCTGCTCAAGTTAAAGGG-3';

MDR1-R (SEQ ID NO. 11): 5'-TTGCCAACCATAGATGAAGGATAT-3';

β-actin-F (SEQ ID NO. 12): 5'-GTCCACCGCAAATGCTTCTA-3';

β-actin-R (SEQ ID NO. 13): 5'-TGCTGTCACCTTCACCGTTC-3;

Using a qPCR kit (Thunderbird SYBR Green qPCR Mix, TOYOBO) and a PCR instrument (Roche Light Cycler 384, Roche), template DNA: 1:10 dilution;

The PCR procedure was: denaturation 94 ° C, 1 min; 40 cycles of PCR: denaturation 94 ° C, 10 s; annealing 58 ° C, 10 s; extension: 20 s; final extension: 10 min; 4 ° C continued;

The data analysis was performed using the 2 ^-ΔΔCT method, and the results are shown in Fig. 2 (D) and Fig. 2 (E).

It can be seen from Fig. 2(D) that when MOI=2.5, the proportion of GFP-expressing SMMC-7721 cells infected with LV-H721 chronic disease reached 93.6%. As shown in Fig. 2(E), the LV-H721 virus-mediated HIF-1α knockout effect was good, and the vegf and mdr1 genes under the control of HIF-1α protein were down-regulated at the mRNA level, and their expression was significantly inhibited ( *, p ≤ 0.001).

6. Western blot detection of VEGF and MDR1 protein in SMMC-7721 cells infected with LV-H721 under normal conditions Expression

(1) Sample preparation: 1) LV-H721 was infected with SMMC-7721 cells for 8 hours (MOI=2.5), complete medium was added, and cell samples were collected 72 hours later; 2) 300 μl of RIPA was added to SMMC-7721 cells, Quickly blow and mix with a gun, place on ice for 20 min, and force the wall every 2-3 min; 3) Centrifuge at 12000 g/min for 4 minutes at 4 °C; 4) Transfer the supernatant to a new tube with protein The concentration of the protein was determined by a quantitative kit, and it was recorded that 1/4 volume of 5× loading buffer was added to each sample, mixed with a gun and boiled in a boiling water bath for 5 min; 5) centrifuged at a maximum speed of 4 ° C for 10 minutes; 6) The supernatant was transferred to a new tube and dispensed and stored in a -80 ° C refrigerator.

(2) The expression of VEGF and MDR1 protein in different treatment groups was identified by Western blot. The specific steps were the same as in Example 1.

The results of the experiment were as shown in Fig. 2(F). It can be seen from Fig. 2(F) that the expression of VEGF and MDR1 protein in the downstream target proteins was significantly decreased after LV-H721 virus-mediated HIF-1α knockout.

7. Immunohistochemical detection of HIF-1α protein expression in tumors of mice infected with LV-H721 infected with HCC

(1) LV-H721 lentivirus-infected mouse HCC tumor: 1,5×10 ⁷ SMMC-7721 cells were subcutaneously injected into nude mice. After 9 days, after the tumor of the mouse grew to 200 mm ³ , 5 × 10 ⁷ LV-H721 lentiviruses were injected into the tumor, and LV-Ctrl lentivirus was injected into the tumor of another group as a control group. The PBS group was a negative control group with 4 mice in each group.

(2) After 3 days of lentivirus infection, tumor tissues were taken out, fixed, and subjected to immunohistochemistry. Methods Reference Example 1: Immunohistochemistry was used to detect the expression of HIF1-α in HCC tumor tissues. The result is shown in Figure 2 (G).

As shown in Figure 2(G), the expression of HIF-1α protein was significantly inhibited by LV-H721 lentivirus infection in mouse HCC tumors established by SMMC-7721 cells, and the difference was significant (*** , p ≤ 0.001).

Example 4: Effect of HIF1-α knockout on migration and invasion of SMMC-7721 cells

1. Cell culture and CoCl ₂ induced hypoxic condition culture

(1) SMMC-7721 cells were cultured in DMEM (GIBCO) using complete medium, including 10% FBS (GIBCO), and CoCl _{2 was} used to create cell hypoxic culture conditions;

(2) In this experiment, SMMC-7721 cells were seeded in 6-well plates, and after 6-8 hours, they were infected with lentivirus (LV-Ctrl and LV-H721) or treated separately. After 8 hours of treatment, part 6 Orifice plates can be used for scratch testing. Some cells can be used in Transwell experiments. Some cells can be seeded into 96-well plates in exchange for new complete medium and 150 μM CoCl ₂ working solution. After 48-h and 96-h, MTT was used to detect cell proliferation. At the same time, the treated cells were collected at 24-h and 48-h after infection, and subsequent operations such as cell cycle and apoptosis were detected.

2, Transwell and cell scratch test

(1) The Transwell experiment used a filter membrane (Corning, Inc., Corning, NY) with a diameter of 6.5 mm and a pore size of 8 μm for observing the invasive ability of the cells. Matrigel (50 μL DMEM was added to 10 μl, Corning, #356234) The gel was added to the filter, and a small layer was formed at 37 ° C for 2 h. After SMMC-7721 cells were infected with lentivirus for 48-h, 1×10 ⁵ SMMC-7721 cells were plated into the upper layer (none). FBS, 200μl DMEM), the lower layer of the filter was added with 20% FBS in DMEM, cultured at 37 °C for 24-h, the upper layer of the filter was gently brushed, the cells in the lower layer were stained with crystal violet, observed under a microscope of 200× , take pictures and count the number. The result is shown in Figure 3 (A);

(2) Cell scratch test: 3×10 ⁵ SMMC-7721 cells were plated into 6-well plates. After 6-8-h, after 8 hours of different lentivirus treatment, the supernatant was removed and a trace was drawn with a yellow gun head. So that no cells exist in this area, wash PBS 3 times, then add complete medium, observe cell migration ability at 24-h and 48-h, and take photos to calculate the scratch distance. In hypoxia experiment, different lentivirus treatment 24 After an hour, the supernatant was removed and a trace was drawn with a yellow tip. At this time, 150 μM CoCl _{2 was} added to induce hypoxic culture conditions, and 24-h and 48-h were observed for cell migration ability and photographed to calculate the scratch distance. Figure 3 (B) shows.

It can be seen from Fig. 3(A) that under hypoxic conditions, Transwell results indicate that knockdown of HIF-1α has a significant restriction on SMMC-7721 liver tumor cell invasion, and statistical differences between groups are significant (* **, p ≤ 0.001). It can be seen from Fig. 3(B) that under hypoxic conditions, the cell scratch test showed that the knockdown of HIF-1α had a great restriction on the migration of SMMC-7721 liver tumor cells, and the statistical differences between the groups were significant ( ***, p ≤ 0.001).

Example 5: Effect of HIF1-α knockout on proliferation, cell cycle and apoptosis of SMMC-7721 cells

1. MTT assay for detecting proliferation of SMMC-7721 cells

After different groups of SMMC-7721 cells were treated with lentivirus, 1×10 ⁴ cells were plated into 96-well plates, and 3 replicate experiments were performed at each time point. After 6-8 h, 20 μl MTT (5 mg/ml) was added to the medium. And 150μM CoCl ₂ , the subsequent 490nm photometer to detect the concentration, the results are shown in Figure 4 (A);

2, PI detection cell cycle

(1) 3×10 ⁵ cells were plated into 6-well plates, and each experimental group was repeated for 3 wells. Different groups of SMMC-7721 cells were treated with lentivirus for 24h and 48h;

(2) After treating each group of cells by trypsin digestion, washing twice with PBS;

(3) 70% of cold ethanol was fixed for 1-h, and PBS was washed twice;

(4) PI (PI-RNase solution; BD) solution was protected from light for 15 minutes, and the operation reference manual;

(5) The fluorescence intensity of PI was detected by flow cytometry (FACScan analyzer, BD), and the results of FlowJo software analysis showed the results as shown in Fig. 4 (B) and Fig. 4 (C);

3, Annexin V-PE, 7-AAD antibody detection of apoptosis

(1) 3 × 10 ⁵ cells were plated into 6-well plates, and 3 wells were repeated for each experimental group. Different groups of SMMC-7721 cells were treated with lentivirus (control group: Ctrl; lentivirus control group: LV-Ctrl; lentivirus experimental group: LV-H721), and 150 μM CoCl _{2 was used to} induce hypoxic conditions in the medium, set for 24 h and 48h;

(2) After each group of cells were trypsinized, the cells were incubated with Annexin V-PE and 7-AAD antibody in an apoptosis detection kit (BD Biosciences, #7026588), and the reference manual was operated;

(3) Flow cytometry (FACScan analyzer, BD) to detect each fluorescence intensity, FlowJo software analysis results, the results are shown in Figure 4 (D);

It can be seen from Fig. 4(A) that under hypoxic conditions, knockdown of HIF-1α has a great restriction on the proliferation of SMMC-7721 liver tumor cells, and between groups after 48-h and 96-h infection. The statistical difference was significant (***, p ≤ 0.001); at the same time, Figure 4 (B) knockdown of HIF-1α caused SMMC-7721 cells to stay in the G2/M phase; Figure 4 (C) shows its G0/G1 phase The number of cells in the HIF-1α knockdown was significantly reduced, and the statistical difference between the groups was significant (***, p ≤ 0.001). FIG. 4 (D) shows that of HIF-1α knockout causes of early apoptotic cells SMMC-7721; under anaerobic conditions induced CoCl _2, HIF-1α induces apoptosis SMMC-7721 cells reached 28.6% higher, each group The statistical difference between the two is significant (***, p ≤ 0.001).

Example 6: Treatment of orthotopic tumors in mice by lentiviral LV-H721 in combination with HAL

1. Construction of SMMC-7721 cells labeled with firefly luciferase gene

(1) Construction of lentiviral LV-Fluc carrying firefly luciferase and mCherry: construction of pWPXLd-mCherry-Fluc plasmid, and transfection and construction of lentiviral LV in HEK293T cells with pMD2.0 and psPAX2 plasmids -Fluc, the method is the same as in the embodiment 2;

(2) Lentivirus LV-Fluc infected SMMC-7721 cells (MOI=2.5), after stable expression for 7 days, flow sorting mCherry positive labeled cells, expanded culture and cryopreservation;

2. In situ tumor and treatment established by SMMC-7721-Fluc cells

(1) Nude mice (BALB/c nu/nu mice, female, 6-8 weeks) were purchased from Shanghai Shrek Limited Biosystems ((license: SCXK(HU) 2007-0003, China), mice at SPF level) Animal room operation, and carry out experimental operations in accordance with the regulations of the Animal Experiment Management of Jinan University and the Animal Ethics Provisions of Guangzhou;

(2) After inoculation of nude mice with 10% chloral hydrate (400 mg/kg), inoculate 3×10 ⁶ SMMC-7721-Fluc cells/SMMC-7721-Fluc cells infected with LV-Ctr or LV-H721 in situ. The liver of the mice was inoculated, and the wound was sutured with a suture needle (Reflex Wound Clips 7 mm, Reflex Skin Closure System, Harvard apparatus), and a treatment experiment was carried out 7 days later;

(3) HCC tumor-bearing mice were divided into 4 groups, 8 in each group. The specific operations were: (1) HCC tumor established by SMMC-7721-Fluc (Ctrl; n=8), and (2) establishment of SMMC-7721-Fluc HCC tumor + arterial ligation (HAL; n = 8), (3) LV-Ctrl infected SMMC-7721-Fluc established HCC tumor + HAL (LV-Ctrl + HAL; n=8), (4) LV-H721 infected SMMC-7721-Fluc established HCC tumor + HAL (LV-H721 + HAL; n = 8). Among them, tumor cells were inoculated into mouse liver, 5 days later, each group Mouse arterial ligation experiments were performed. ;

(4) The growth of orthotopic liver tumors in mice was observed by a living imager. A volume of 15 mg/ml of D-luciferin potassium salt (Goldbio) was intraperitoneally injected, and the time point was HAL and the fifth time after lentivirus treatment. 10, 15 and 20 days, photo recording data;

(5) A relationship between the fluorescence intensity of the mouse tumor region and time;

(6) On the 20th day after treatment with mouse HAL and lentivirus, the mice were sacrificed and the tumor tissues were taken out, and the expression of CD31 and apoptosis were detected. The results are shown in Fig. 5(A)-Fig. 5(D);

Figure 5 (A) shows that on the 20th day after treatment, the results of in vivo imaging showed that the HAL-treated group significantly inhibited the growth of HCC tumors, and the LV-H721+HAL experimental group had the best inhibition of HCC growth. Fig. 5(B) shows the fluorescence of each group observed in the mouse in situ tumor in vivo growth on the 20th day after the treatment. Fig. 5(C) shows the growth of mouse orthotopic tumors in the case of mouse exfoliation on the 20th day after the treatment. Fig. 5(D) Survival curve of mice in each treatment group showed that LV-H721+HAL experimental group can significantly prolong the survival time of tumor-bearing mice, and the statistical difference is obvious (*, p≤0.05).

3. Tumor tissue acquisition and immunohistochemistry were used to detect the expression of CD31 protein in tumor tissues.

(1) taking out the orthotopic liver tumor tissues of the different treatment groups described above;

(2) Stripped mouse tumor, 4% paraformaldehyde fixed tumor tissue;

(3) Washing: After the material is fixed, the fixing liquid in the tissue must be washed out, because the fixing liquid remaining in the tissue is not conducive to dyeing, and some precipitation or crystallization influence observation;

(4) Dehydration: 30%, 50%, 70%, 80%, 90% ethanol solution of each stage is dehydrated for 40 minutes, placed in 95%, 100% twice each for 20 minutes (after fixing and washing various materials) , the tissue contains a lot of water, because water and paraffin can not be mutually soluble, so the water in the tissue must be removed);

(5) Transparent: 100% alcohol, xylene equal volume mixture for 15min, xylene 0.5h (or until transparent), xylene must be changed once (because ethanol is incompatible with paraffin, and xylene is soluble in ethanol) It is also soluble in paraffin, so it needs to pass through xylene to transfer after dehydration. When the whole part of the tissue is occupied by xylene, the light can pass through, and the tissue shows different degrees of transparency);

(6) Permeation wax: a mixture of xylene and paraffin wax is placed for 15 minutes, and then paraffin I and paraffin II permeation wax are placed for 20 to 30 minutes each time (the purpose of permeating wax is to remove the transparent agent such as xylene in the tissue, etc. The paraffin is infiltrated into the interior of the tissue to be saturated for embedding. The wax penetration time is longer depending on the waxing time of the tissue, which takes about 1-2 days. The wax penetration should be carried out in the incubator and keep the temperature inside the box at 55-60. °C or so, pay attention to the temperature is not too high, so as not to be brittle. Placed in the incubator 0.5h);

(7) Embedding: The wax-transparent tissue was poured into a container together with the melted paraffin, and then immediately poured into cold water to immediately solidify into a wax block. The melting point of paraffin wax used for embedding is between 50-60 ° C. When embedded, the paraffin wax with different melting point should be selected according to the materials of the tissue, the thickness of the slice, the climatic conditions, etc. The melting point of paraffin wax commonly used in animal materials is 52-56 ° C. ;

(8) slicing, patching;

(9) Immunohistochemical preparation and observation, this experiment requires the use of immunohistochemical DAB assay kit:

1) Tissue sections were baked in a 60 ° C incubator for 2 hours; 2) Tissue sections were placed in xylene (I) for 10 min, replaced with xylene (II) and then soaked for 10 min; 3) Anhydrous ethanol (I) Soak for 5 min; 4) soak for 2 min in absolute ethanol (II); 5) soak for 2 min in 95% ethanol; 6) soak for 2 min in 70% ethanol; 7) soak for 2 min in single distilled water; 8) antigen repair: use 0.01M Trisodium citrate microwave method; 9) After standing for 20 minutes, the slice was returned to room temperature, soaked in three steamed water; 10) immersed in PBS for 5 min; 11) 3% H ₂ O ₂ deionized water, and allowed to stand at room temperature for 10 min. TBST wash 2-3 times for 5 min each; 12) Add normal goat serum blocking solution at room temperature for 15 min; 13) Remove excess liquid, add CD31 antibody (1:100, CST, USA), 4 degrees overnight; 14) TBST wash 3 times each for 3 min; 15) add 40-50 μl of horseradish peroxidase-labeled secondary antibody, let stand for 30 min at room temperature; wash TBST 3 times for 3 min each; 16) DAB color, grasp the degree of staining under the microscope; 17) Rinse with PBS or tap water for 10 min; 18) Hematoxylin counterstaining for 1 min, 1% hydrochloric acid alcohol differentiation; 19) Tap water rinse for 10-15 min; 20) Dehydration: 95% alcohol for 10 seconds twice, 100% alcohol for 10 seconds twice Xylene twice in 10 seconds; 21) baking sheet; 22) microscopic observation and scanning to obtain the expression of CD31 protein in liver tumor tissue and statistical cell area and statistical difference, the results are shown in Figure 6 (A) - Figure 6 (B )

4, TUNEL kit to detect cell apoptosis in HCC tumor tissue

Apoptosis cells were detected by 3'-hydroxyl end labeling of DNA cleavage sites in combination with histochemical methods (TUNEL). This method can accurately locate and detect early DNA breaks during apoptosis, using Promega kit (DeadEndTM Colorimetric) TUNEL DAB system):

1) Dip twice with xylene for 5 min each time; 2) Dip with gradient ethanol (100%, 95%, 90%, 80%, 70%) for 3 min each time; 3) PBS rinse 2 4) Treatment of tissue with proteinase K working solution for 15-30 min at 21-37 ° C or addition of cell permeable solution for 8 min; 5) rinsing twice with PBS; 6) Preparation of TUNEL reaction mixture, treatment group with 50 μl TdT + 450 μl fluorescence The labeled dUTP solution was mixed. In the negative control group, only 50 μl of fluorescein-labeled dUTP solution was added. The positive control group was firstly added with 100 μl of DNase I, and the reaction was carried out at 15-25 ° C for 10 min, followed by the same treatment group; 7) slide After drying, add 50 μl of TUNEL reaction mixture (negative control group only add 50 μl of fluorescein-labeled dUTP solution) to the specimen, and cover the slide or sealant in a dark humid chamber to react at 37 ° C × 1-h; 8) PBS Rinsing 3 times; 9) Apoptotic cells can be counted under fluorescent microscope with 1 drop of PBS (excitation wavelength is 450-500 nm, detection wavelength is 515-565 nm); 10) slide is dried and 50 μl of converter-POD is added to the specimen. , cover glass or seal film in a dark wet box reaction 37 ° C × 30min; 11) PBS rinse 3 times; 12) add 50-100μl DAB substrate in the tissue, the reaction 15-25 ° C × 10min; 13) rinsing 3 times with PBS; 14) After dyeing with hematoxylin or methyl green, immediately rinse with tap water after a few seconds, gradient alcohol dehydration, xylene transparent, neutral gum seal, the result is shown in Figure 6 (C) - Figure 6 (D);

TUNEL: Brown-yellow granules were positive in the nucleus, ie apoptotic cells. The number of apoptotic cells in 5 high-power fields was counted in each section, and the average value was the number of apoptotic cells in the tumor.

MVD (microvessel density): First, the five regions with the highest vascular density in each section were observed under a low power microscope, and then the number of microvessels in each field of view was counted under high magnification. The average value is the MVD value of the tumor of this case;

Statistical analysis: All statistical results in the present invention were obtained by SPSS 17.0 software (SPSS Inc., Chicago, IL, USA), and statistical differences between the two sets of data were obtained by untested two-tailed Student's t-test. The survival time curve of the mice was obtained by Kaplan-Meier analysis, and the statistical difference was obtained by log-rank test. The statistically significant differences were marked as: *, p ≤ 0.05, **, p ≤ 0.01, ***, p ≤ 0.001. In the present invention, the experiment has been repeated four times.

It can be seen from Fig. 6(A) that there is a new generation of tumor blood vessels after HAL treatment, and the expression of CD31 positive cells in the LV-H721+HAL experimental group is small, indicating that the angiogenesis in the tumor is significantly inhibited. . The statistical results of Fig. 6(B) also showed that the area of CD31+ cells was significantly inhibited in the LV-H721+HAL experimental group (*, p ≤ 0.05) compared with the other HAL-treated groups. At the same time, the TUNEL results in Fig. 6(C) also showed that the apoptosis effect was evident in the tumor tissues of HCC in the LV-H721+HAL experimental group. Figure 6 (D) statistical results show that compared with other control groups, the apoptosis rate of tumor cells in the LV-H721 + HAL experimental group is very significant (*, p ≤ 0.05).

In summary, the lentivirus used to target knockout of HIF-1α can effectively knock out the HIF-1α gene in SMMC-7721 liver tumor cells, and can effectively inhibit tumor cell growth, including inhibition of tumor cell migration and cells. Invasion, G2/M phase cell cycle arrest and promotion of tumor cell apoptosis, etc., the effect is obvious and statistically significant difference, not only that, LV-H721 and hepatic artery ligation HAL (hepatic artery ligation) can significantly inhibit mouse HCC Growth and prolongation of survival time in in situ HCC tumor-bearing mice. Therefore, the combination of gene therapy and TAE/TACE is more effective than TAE/TACE in the treatment of HCC, and its clinical use potential is greater.

The Applicant declares that the present invention is described by the above-described embodiments, but the present invention is not limited to the above detailed methods, that is, it does not mean that the present invention must be implemented by the above detailed methods. It should be apparent to those skilled in the art that any modifications of the present invention, equivalent substitution of the various materials of the products of the present invention, addition of auxiliary components, selection of specific means, and the like, are all within the scope of the present invention.

Claims (10)

1. A sgRNA characterized in that the nucleotide sequence of the sgRNA is as shown in SEQ ID NO. 1-3 or a nucleotide sequence having at least 80% identity thereto.
2. The sgRNA according to claim 1, wherein the nucleotide sequence of the sgRNA is as shown in SEQ ID NO.
3. A CRISP/Cas9 lentiviral vector, characterized in that the lentiviral vector comprises the nucleotide sequence of the sgRNA of claim 1 or 2.
4. A method for constructing a CRISP/Cas9 lentiviral vector according to claim 3, comprising the steps of:

   (1) designing sgRNAs according to the first exon sequence of HIF-1α;

   (2) The obtained sgRNAs were inserted into a pLenti-CAS vector to obtain the CRISP/Cas9 lentiviral vector.
5. A recombinant lentivirus characterized by comprising a recombinant lentivirus comprising a CRISP/Cas9 lentiviral vector according to claim 3 and a packaging helper plasmid psPAX2, pMD2.G and PEImax co-transfected with a mammalian cell.
6. The recombinant lentivirus according to claim 5, wherein the mammalian cell is a HEK293T cell.
7. A CRISP/Cas9 lentiviral vector according to claim 3 for use in knocking out the HIF-1α gene.
8. A pharmaceutical composition comprising the lentiviral vector of claim 3 and/or the recombinant lentivirus of claim 5.
9. Use of the lentiviral vector according to claim 3, the recombinant lentivirus according to claim 5 or the pharmaceutical composition according to claim 8 for the preparation of an antitumor drug;

   Preferably, the tumor is a liver tumor, preferably liver cancer;

   Preferably, the composition further comprises a pharmaceutically acceptable excipient;

   Preferably, the excipient is any one or a combination of at least two of an excipient, a diluent, a carrier, a flavoring agent, a binder, and a filler.
10. The lentiviral vector according to claim 3, the recombinant lentivirus according to claim 5 or the pharmaceutical composition according to claim 8 for treating liver cancer;

    Preferably, the recombinant lentivirus and/or pharmaceutical composition is used in combination with any one or a combination of at least two of surgery, chemotherapy or radiation therapy;

    Preferably, the surgery is hepatic artery embolization and/or transcatheter arterial chemoembolization.

Images