WO2019109331A1 - Methods and compositions for tnbc stratification and treatment - Google Patents

Methods and compositions for tnbc stratification and treatment Download PDF

Info

Publication number
WO2019109331A1
WO2019109331A1 PCT/CN2017/115198 CN2017115198W WO2019109331A1 WO 2019109331 A1 WO2019109331 A1 WO 2019109331A1 CN 2017115198 W CN2017115198 W CN 2017115198W WO 2019109331 A1 WO2019109331 A1 WO 2019109331A1
Authority
WO
WIPO (PCT)
Prior art keywords
procr
antibody
cells
tnbc
cell
Prior art date
Application number
PCT/CN2017/115198
Other languages
French (fr)
Inventor
Yi Zeng
Daisong WANG
Original Assignee
Shanghai Institutes For Biological Sciences, Chinese Academy Of Sciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Institutes For Biological Sciences, Chinese Academy Of Sciences filed Critical Shanghai Institutes For Biological Sciences, Chinese Academy Of Sciences
Priority to CN201780097527.2A priority Critical patent/CN111656194B/en
Priority to PCT/CN2017/115198 priority patent/WO2019109331A1/en
Publication of WO2019109331A1 publication Critical patent/WO2019109331A1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2896—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against molecules with a "CD"-designation, not provided for elsewhere
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/337—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having four-membered rings, e.g. taxol
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7028—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages
    • A61K31/7034—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin
    • A61K31/704—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin attached to a condensed carbocyclic ring system, e.g. sennosides, thiocolchicosides, escin, daunorubicin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A61K39/39533—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
    • A61K39/3955—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against proteinaceous materials, e.g. enzymes, hormones, lymphokines
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407—Specifically defined cancers
    • G01N33/57415—Specifically defined cancers of breast
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/22—Immunoglobulins specific features characterized by taxonomic origin from camelids, e.g. camel, llama or dromedary
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/55—Fab or Fab'
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/569—Single domain, e.g. dAb, sdAb, VHH, VNAR or nanobody®
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/73—Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/92—Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
    • G01N2333/70503—Immunoglobulin superfamily, e.g. VCAMs, PECAM, LFA-3
    • G01N2333/70539—MHC-molecules, e.g. HLA-molecules

Definitions

  • compositions and kits that can be used in such methods.
  • breast cancer is among the most common cancers and is the fifth most common cause of cancer deaths. Due to the heterogeneity of breast cancers, 10-year progression free survival can vary widely with stage and type, from 98%to 10%. Different forms of breast cancers can have remarkably different biological characteristics and clinical behavior. Thus, classification of a patient's breast cancer has become a critical component for determining a treatment regimen. For example, along with classification of histological type and grade, breast cancers now are routinely evaluated for expression of hormone receptors (estrogen receptor (ER) and progesterone receptor (PR) ) and for expression of HER2 (ErbB2) , since a number of treatment modalities are currently available that target hormone receptors or the HER2 receptor.
  • hormone receptors estrogen receptor
  • PR progesterone receptor
  • ErbB2 HER2
  • ER and PR are both nuclear receptors (they are predominantly located at cell nuclei, although they can also be found at the cell membrane) and small molecular inhibitors that target ER and/or PR have been developed.
  • HER2 or human epidermal growth factor receptor type 2 is a receptor normally located on the cell surface and antibodies that target HER2 have been developed as therapeutics.
  • HER2 is the only member of the EGFR family (which also includes HER1 (EGFR) , HER3 (ErbB3) and HER4 (ErbB4) that is not capable of binding to an activating ligand on its own.
  • HER2 is only functional as a receptor when incorporated into a heterodimeric receptor complex with another EGFR family member, such as HER3.
  • Cancers classified as expressing the estrogen receptor may be treated with an ER antagonist such as tamoxifen.
  • breast cancers classified as expressing high levels the HER2 receptor may be treated with an anti-HER2 antibody, such as trastuzumab, or with a HER2-active receptor tyrosine kinase inhibitor such as lapatinib.
  • TNBC Triple negative breast cancer
  • TN tumors score negative (i.e., using conventional histopathology methods and criteria) for expression of ER and PR and do not express amplified levels of HER2 (i.e., they are ER - , PR - , HER2 - ) .
  • TNBC comprises primarily, but not exclusively, a molecularly and histopathologically distinct subtype of breast cancer known as the basal-like (BL) subtype.
  • the BL subtype also is characterized by the expression of cytokeratins (e.g., CK, CK5/6, CK14, CK17) and other proteins found in normal basal/myoepithelial cells of the breast.
  • cytokeratins e.g., CK, CK5/6, CK14, CK17
  • certain other types of breast cancers including some “normal breast-like” , metaplastic carcinomas, medullary carcinomas and salivary gland-like tumors can also exhibit the triple negative (TN) phenotype.
  • TNBC occurs more frequently in the presence of BRCA1 mutations and in pre-menopausal females of African-American or Hispanic descent.
  • TN tumors typically display very aggressive behavior, with shorter post-relapse survival and poor overall survival rates relative to other breast cancer types.
  • HER2 e.g., trastuzumab
  • ER e.g., tamoxifen, aromatase inhibitors
  • HER2 e.g., trastuzumab
  • chemotherapy regimens can lead to drug resistance in tumors, and the risk of recurrence of disease in TNBC is higher within the first three years of treatment than for other types of breast cancers.
  • a specific subtype of triple-negative breast cancers e.g., tumors
  • pharmaceutical compositions that can be used in such methods.
  • the methods and compositions are based, at least in part, on the surprising discovery that PROCR levels are upregulated in, and correlated with, about 50%of all TNBCs, which are referred herein as “PROCR+ TNBC” or “PROCR-high TNBC” .
  • PROCR-negative or PROCR-low TNBCs are referred to as “Quadruple Negative Breast Cancer” or “QNBC.
  • PROCR-antagonizing or neutralizing antibodies that inhibit or suppress PROCR activity (e.g., PROC binding) as well as suppress the growth of PROCR+ TNBC cells.
  • the anti-PROCR antibodies disclosed herein, or antigen-binding fragment thereof can be used for the diagnosis and/or treatment of PROCR+ TNBC.
  • protein C receptor for use in the diagnosis and/or treatment of PROCR-high triple negative breast cancer (TNBC) , wherein an H-score of at least 120 in an immunohistochemistry assay for detecting PROCR expression level indicates the presence of PROCR-high TNBC.
  • TNBC triple negative breast cancer
  • an H-score of at least 120 in an immunohistochemistry assay for detecting PROCR expression level indicates the presence of PROCR-high TNBC.
  • Polyclonal and monoclonal antibodies for immunohistochemistry can be generated using conventional methods known in the art. The antibody can be directly or indirectly labeled to facilitate detection in accordance with methods known in the art.
  • the immunohistochemistry assay uses an anti-PROCR antibody or antigen-binding fragment thereof.
  • the anti-PROCR antibody can be selected from the group consisting of: (i) any one of SEQ ID NOS: 1-3 and 11-22, or antigen-binding fragment thereof; (ii) an antibody or antigen binding fragment thereof wherein the antibody cross-competes for binding to PROCR with (i) ; (iii) an antibody having CDR1, CDR2 and CDR3 selected from the CDRs of SEQ ID NOS: 1-3 and 11-22; and (iv) an antibody or antigen binding fragment thereof wherein the antibody cross-competes for binding to PROCR with (iii) .
  • an anti-PROCR antibody, or antigen binding fragment thereof for use in the diagnosis and/or treatment of PROCR-high TNBC, wherein when the anti-PROCR antibody or antigen-binding fragment thereof is used in an immunohistochemistry assay to detect expression level of PROCR, an H-score of at least 120 indicates the presence of PROCR-high TNBC.
  • the antibody can be selected from the group consisting of: (i) any one of SEQ ID NOS: 1-3 and 11-22, or antigen-binding fragment thereof; (ii) an antibody or antigen binding fragment thereof wherein the antibody cross-competes for binding to PROCR with (i) ; (iii) an antibody having CDR1 selected from the group consisting of SEQ ID NOS: 4 and 7, CDR2 selected from the group consisting of SEQ ID NOS: 5, 8 and 9, and CDR3 selected from the group consisting of SEQ ID NOS: 6 and 10; and (iv) an antibody or antigen binding fragment thereof wherein the antibody cross-competes for binding to PROCR with (iii) .
  • an isolated anti-PROCR antibody, or antigen binding fragment thereof, is provided herein, wherein the antibody cross-competes for binding to PROCR with any one of SEQ ID NOS: 1-3 and 11-22.
  • a further aspect relates to a kit for diagnosing PROCR-high TNBC, comprising one or more of: (i) any one of SEQ ID NOS: 1-3 and 11-22, or antigen-binding fragment thereof; (ii) an antibody or antigen binding fragment thereof wherein the antibody cross-competes for binding to PROCR with (i) ; (iii) an antibody having CDR1, CDR2 and CDR3 selected from the CDRs of SEQ ID NOS: 1-3 and 11-22; and (iv) an antibody or antigen binding fragment thereof wherein the antibody cross-competes for binding to PROCR with (iii) .
  • PROCR inhibitor for use in the preparation of a medicament for: (1) the treatment of PROCR-high TNBC, (2) the inhibition of growth of PROCR-high TNBC cells, (3) the reduction of metastasis of PROCR-high TNBC cells, and/or (4) the inhibition of epithelial-mesenchymal transition (EMT) of PROCR-high TNBC cells; wherein the PROCR inhibitor is selected from the group consisting of: (i) any one of SEQ ID NOS: 1-3 and 11-22, or antigen-binding fragment thereof; (ii) an antibody or antigen binding fragment thereof wherein the antibody cross-competes for binding to PROCR with (i) ; (iii) an antibody having CDR1, CDR2 and CDR3 selected from the CDRs of SEQ ID NOS: 1-3 and 11-22; and (iv) an antibody or antigen binding fragment thereof wherein the antibody cross-competes for binding to PROCR with (iii) .
  • compositions for treating PROCR-high TNBC comprising the PROCR inhibitor disclosed herein and a pharmaceutically acceptable carrier.
  • Use of the PROCR inhibitor disclosed herein for the manufacture of a medicament for the treatment of PROCR-high TNBC is also included.
  • Another aspect relates to a method of suppressing growth, metastasis and/or EMT of a PROCR-high TNBC cell, comprising contacting the cell with an effective amount of the PROCR inhibitor disclosed herein.
  • Procr + basal cells (Lin - , CD24 + , CD29 hi , Procr + ) and Procr - basal cells (Lin - , CD24 + , CD29 hi , Procr - ) isolated from MMTV-Wnt1/FVB tumor were engrafted in limiting dilution to FVB recipient fat pads.
  • Procr + basal cells formed tumor vigorously with CSC frequency of 1/45, while Procr - cells could not. *** ⁇ 0.001
  • PROCR is highly expressed in half of TNBC cases and marks cancer stem cells within this subtype
  • PROCR expression was measured by IHC in tissue microarray containing 71 no-cancerous, 99 luminal A cancers, 105 luminal B cancers, 90 Her2 cancers and 149 TNBCs. Representative of negative (score 0) , weak (score 1) , medium (score 2) and strong (score 3) staining are shown.
  • PROCR-low cases include score 0 and score 1;
  • PROCR-high cases include score 2 and score 3.
  • Scale bars represent 200 ⁇ m in lower magnification, 50 ⁇ m in the zoom in.
  • PROCR+ cells are enriched for CSCs in PROCR+ BCs
  • PROCR + and PROCR - tumor cells isolated from PDX-1 were cultured in vitro and underwent 1h EdU incorporation. Representative images are shown (left) . Quantification indicating that PROCR + cells had 2.6-fold more EdU-labeling cells (right) . Scale bars represent 100 ⁇ m. Data are pooled from 3 independent experiments and presented as mean ⁇ s.e.m. ***p ⁇ 0.001.
  • PROCR + and PROCR - tumor cells isolated from PDX-1 were stained with Ki67. Representative images are shown (left) . Quantification indicating that PROCR + cells had 2.1-fold more Ki67 + cells (right) . Scale bars represent 100 ⁇ m. Data are pooled from 3 independent experiments and presented as mean ⁇ s.e.m. ***p ⁇ 0.001.
  • PROCR + and PROCR - cells isolated from PDX-1 were engrafted in limiting dilution as indicated.
  • PROCR + cells formed tumor readily, while PROCR - cells had drastically lower tumorigenicity.
  • Data are pooled from 3 independent experiments and presented as mean ⁇ s.e.m. ***p ⁇ 0.001.
  • PROCR + tumor cells (Lin - , EpCam + ) in two PDX-1 and PDX-2 tumors.
  • PROCR + tumor cells have reduced E-cad level (epithelial feature gene) and increased mesenchymal signature genes.
  • PROCR + and PROCR - cells isolated from PDX-4 were engrafted in limiting dilution as indicated.
  • PROCR + cells and PROCR - cells have similar tumorigenicity. Data are pooled from 3 independent experiments and presented as mean ⁇ s.e.m. ns, not significant.
  • a-g Illustration of inhibition of PROCR in PDX by shRNA.
  • Dissociated PDX tumor cells were virally infected by scramble control or sh-PROCR, and the infected cells were isolated using GFP tag, followed by engraftment to Nude recipients (a) .
  • An aliquot of cells was used for Western analysis and confirmed about 75%of PROCR knockdown efficiency in PDX-1 (b) , PDX-2 (d) and PDX-3 (f) .
  • Xenografts of the infected cells indicating that PROCR knockdown blocks PDX tumor growth (b-g) .
  • n 4 mice or more in each group. Data are presented as mean ⁇ s.e.m.
  • PROCR inhibitory nanobody suppresses the growth of PROCR + BCs.
  • MDA-MB-231 cells were cultured in the presence of IgG or PROCR inhibitory nanobody (200ug/ml) for 4 passages in complete media. Cell numbers counted in each passage indicating that the antibody inhibited proliferation (b) . EdU incorporation experiment (1hr) showing that the antibody markedly inhibited cell proliferation (c) . TUNEL staining showing no obvious difference in cell death (d) . Data are pooled from 3 independent experiments and presented as mean ⁇ s.e.m. ***p ⁇ 0.001.
  • mice baring PDX-1 tumor ( ⁇ 200 mm 3 ) were administered with paclitaxel and doxorubicin (PTX+DOX) or PROCR-mAb alone or in combination.
  • PTX+DOX were administered at d14, d20 and d27 (PTX: 20mg/kg, DOX: 3mg/kg body weight) (green arrowheads)
  • PROCR-mAb or IgG were administered at d14, d17, d20, d24, d28 and d32 (8mg/kg body weight) (blue arrows) .
  • Tumor sizes were suppressed for 2-fold with PTX+DOX, 3-fold with PROCR-mAb, 32-fold with the combination treatment.
  • Figure 7 Proposed models for TNBC stratification and targeted therapy based on PROCR expression.
  • PROCR + BC subgroup PROCR-high TNBC constitutes about half of TNBC cases.
  • PROCR + BCs PROCR is expressed at the surface of CSCs and can be targeted by inhibitory antibodies, resulting in inhibition of ERK, PI3K-Akt, RhoA pathways and suppression of EMT in CSCs, rendering tumor inhibition.
  • Figure 9 Procr marks CSCs in MMTV-Wnt1 mammary tumor, not in MMTV-PyVT or MMTV-Cre; Brca1 f/+ ; p53 f/+ mammary tumor.
  • Procr + basal cells were assessed for Procr + basal cells.
  • MMTV-Wnt1 tumor 8 ⁇ 0.9% of total basal cells in normal tissue control (WT)
  • WT normal tissue control
  • Procr + basal cells 8.5 ⁇ 1.1%)
  • MMTV-PyVT tumor 1.0 ⁇ 0.02%
  • MMTV-Cre MMTV-Cre
  • Brca1 f/+ 0.8 ⁇ 0.02%
  • p53 f/+ tumor 1.3 ⁇ 0.1%)
  • Procr + cells are absent from luminal compartment in WT and both tumor models, and the percentages of Procr + cells in mesenchymal compartment have no significant changes in tumors compared to the WT (c) .
  • Data are pool from three independent experiments in (b-c) . *** ⁇ 0.001, * ⁇ 0.05.
  • Procr + and Procr - basal cells isolated from MMTV-Wnt1/FVB tumor were engrafted (2,000 or 10,000 each) to Nude recipient fat pads.
  • Procr + formed tumor vigorously while Procr - cells could not.
  • Representative pictures are shown in (e) .
  • Tumor volume and tumor free percentage are shown in (f) and (g) respectively.
  • n 10 or more mice for each group as indicated.
  • Procr is critical for MMTV-Wnt1 mammary tumor growth.
  • PROCR expression is prevalent in TNBC and PROCR-high TNBC patients have poorer prognosis relative to PROCR-low TNBC patients.
  • MDA-MB-231 cells (PROCR-high TNBC) were virally infected with scramble control and two individual PROCR shRNAs (shRNA-1 and shRNA-3) and cultured in complete media. Cell numbers were counted for 4 passages. Both shRNAs inhibited MDA-MB-231 cell proliferation.
  • BT549 cells representative of PROCR-low TNBC, were virally infected with Scramble control and Sh-PROCR and culture for 4 passages in complete media. Cell numbers were counted in each passage. Sh-PROCR did not affect BT549 cell proliferation.
  • MCF-7 cells representative of hormone receptor-positive tumor, were virally infected with Scramble control and Sh-PROCR. Although MCF-7 cells have lower PROCR expression level compared to MDA-MB-231, Sh-PROCR could further reduce the PROCR expression in MCF-7 (3.4-fold decrease) .
  • PROCR inhibitory nanobody suppresses MDA-MB-231 proliferation and PROCR+ tumor growth.
  • PDX-1 (d) and PDX-2 (e) tumor cells were inoculated, IgG or PROCR inhibitory nanobody were i. p. administered at d5, d7, d10, d14 and d19. Tumor growth was inhibited with PROCR inhibitory nanobody (PROCR-mAb) .
  • n 4 mice in each group. Data are presented as mean ⁇ s.e.m. ***p ⁇ 0.001.
  • tumor cells post PTX/DOX treatment had a 1.5 fold increase in cell number compared to the control, whereas tumor cells post PROCR-mAb treatment had a 1.8 fold decrease in cell number.
  • Data are pooled from 3 independent experiments and presented as mean ⁇ s.e.m. ***p ⁇ 0.001.
  • FIG. 1 Schematic illustration showing role and potential use of PROCR.
  • PROCR activates ERK, PI3K-Akt-mTOR and RhoA-Rock signaling pathways in breast cancer cells.
  • Western blots in the same panel are from the same batch of cells using the same loadings, thus only one loading control is shown at the end of the panel. For a better illustration, they are shown as three separated columns representing ERK, Akt and RhoA pathway respectively.
  • Western blots in the same panel are from the same batch of cells using the same loadings, thus only one loading control is shown at the end of the panel. For a better illustration, they are shown as three separated columns representing ERK, Akt and RhoA pathway respectively.
  • FIG. 20 IGF-1R, not EGFR mediates the activation of ERK and PI3K-Akt-mTOR signalings induced by PROCR
  • Western blots in the same panel are from the same batch of cells using the same loadings, thus only one loading control is shown at the end of the panel. For a better illustration, they are shown as three separated columns representing ERK, Akt and RhoA pathway respectively.
  • Protein C serves as the ligand for the activation of PROCR intracellular signaling in breast cancer cells
  • MDA-MB-231 cells were cultured in the presence of Ctrl or sPROCR (6ug/ml) for 4 passages in complete media. Cell numbers that are counted in each passage showing that sPROCR markedly inhibited cell proliferation.
  • the spindle-shaped morphology of MDA-MB-231 (Ctrl, upper right panel) was altered to become more spherical in the presence of sPROCR (bottom right panel) .
  • MDA-MB-231 cells were cultured in the presence of Ctrl or PROC-DN (2ug/ml) for 4 passages in complete media. Cell numbers that are counted in each passage showing that PROC-DN markedly inhibited cell proliferation.
  • the spindle-shaped morphology of MDA-MB-231 (Ctrl, upper right panel) was altered to become more spherical in the presence of PROC-DN (bottom right panel) .
  • One of three similar experiments is shown.
  • For HDB169 library total 10x500 pfu of O3 phages were screened (a filter lift example is shown in a) . Total 100 plaques were picked for DNA sequencing.
  • HDB323 library total 13x500 pfu of O3 phages were screened. as shown in panel (b) and (d) , 18 positive clones were picked and sent for sequencing.
  • PROCR can be used as a biomarker and therapeutic target specifically for a subtype of TNBC that represents about 50%of all TNBCs, PROCR-high TNBC.
  • PROCR is highly expressed in some, but not all TNBC cells.
  • PROCR-high TNBC is characterized by expression level of PROCR in breast tissue having an immunoreactive H-score of at least 120 in immunohistochemistry.
  • PROCR-low TNBC or QNBC can be characterized by expression level of PROCR in breast tissue having an immunoreactive H-score of less than about 120 or less than about 100 in immunohistochemistry.
  • Various anti-PROCR antibodies can be used in such immunohistochemistry, such as the GS5, GS4, GS2, HD13, HD21, HD44, HD58 or HD61 monoclonal antibodies disclosed herein, as well as RCR-252.
  • PROCR expression is highly correlated with (a) poor survival rate of PROCR-high TNBC patients, (b) increased stemness of cancer stem cells and (c) metastasis in tumor models. It is additionally established herein that inhibition of PROCR defeats the tumorigenicity and progression of the PROCR-high TNBC subtype. As such, PROCR can be used as an effective target for PROCR-high TNBC diagnosis and therapeutic intervention.
  • the present disclosure detects all four markers, i.e., ER - , PR - , HER2 - and PROCR+ in a breast cancer patient sample, thereby determining the PROCR+ TNBC subtype. Thereafter, a PROCR inhibitor such as the antibodies disclosed herein can be used to treat the PROCR+ TNBC patient.
  • PROCR functioning molecular mechanism in breast cancer epithelial cells is different from PROCR in endothelial cell.
  • PROCR in breast cancer cells requires Src and IGF-1R, but it doesn't in endothelial cells. This is significant for designing targeting strategy to specifically target breast cancer cells and minimize potential toxicity to endothelial cells.
  • PROCR proceeds through F2R and Src/IGF-1R simultaneously in PROCR+ breast cancer cells (see Fig. 22e) .
  • PROCR-induced RhoA-ROCK-p38 signaling is dependent on F2R
  • PROCR-induced ERK and PI3k-Akt-mTOR signaling are dependent on Src and subsequent activation of IGF-1R.
  • Src and IGF-1R mediates the signaling function of PROCR. Functionally, blocking the F2R and Src using corresponding inhibitors inhibits cancer stem cell activities (Fig. 22) .
  • F2R does not account for all PROCR activities, which is distinct to previously described PROCR intracellular signaling mechanisms in endothelial cells, in which F2R is an essential mediator of all PROCR activities (Cheng et al., 2003; Feistritzer et al., 2006; Riewald et al., 2002; Yang et al., 2009) .
  • This difference in signaling mechanisms between breast cancer epithelial cells and endothelial cells enables novel treatment strategies to specifically target breast cancer cells and minimize the potential toxicity to endothelial cells.
  • combined anti-PROCR mAb with Src inhibitor or IGF-1R inhibitor may effectively diminish PROCR-high TNBC breast cancer stem cells, and prevent the potential side effects in endothelial cells.
  • the term “about” means acceptable variations within 20%, more preferably within 10%and most preferably within 5%of the stated value.
  • TNBC tumor negative or “TN” or “TNBC” refers to tumors (e.g., carcinomas) , typically breast tumors, in which the tumor cells score negative (i.e., using conventional histopathology methods) for estrogen receptor (ER) and progesterone receptor (PR) , both of which are nuclear receptors (i.e., they are predominantly located at cell nuclei) , and the tumor cells are not amplified for epidermal growth factor receptor type 2 (HER2 or ErbB2) , a receptor normally located on the cell surface.
  • HER2 or ErbB2 epidermal growth factor receptor type 2
  • Tumor cells are considered negative for expression of ER and PR if less than 5%of the tumor cell nuclei are stained for ER and PR expression using standard immunohistochemical techniques.
  • Tumor cells are considered highly amplified for HER2 (“HER2 3+ ” ) if, when tested with a HercepTest TM Kit (Code K5204, Dako North America, Inc., Carpinteria, Calif. ) , a semi-quantitative immunohistochemical assay using a polyclonal anti-HER2 primary antibody, they yield a test result score of 3+, or, the test HER2 positive by fluorescence in-situ hybridization (FISH) .
  • FISH fluorescence in-situ hybridization
  • tumor cells are considered negative for HER2 overexpression if they yield a test result score of 0 or 1+, or 2+, or if they are HER2 FISH negative.
  • Protein C receptor protein C receptor
  • PROCR protein C receptor
  • Procr generally referring to the gene or mRNA
  • PROCR the protein product unless otherwise noted. It should be understood that the terms include the complete gene, the cDNA sequence, the complete amino acid sequence, or any fragment or variant thereof.
  • PROCR inhibitor is intended to include therapeutic agents that inhibit, down-modulate, suppress or down-regulate PROCR activity.
  • the term is intended to include chemical compounds, such as small molecule inhibitors and biologic agents (e.g., antibodies) , interfering RNA (shRNA, siRNA) , soluble antagonists, gene editing/silencing tools (CRISPR/Cas9, TALENs) and the like.
  • an “antibody, ” as used herein is a protein consisting of one or more polypeptides comprising binding domains that bind to a target epitope.
  • the term antibody includes monoclonal antibodies comprising immunoglobulin heavy and light chain molecules, single heavy chain variable domain antibodies, and variants and derivatives thereof, including chimeric variants of monoclonal and single heavy chain variable domain antibodies.
  • Binding domains are substantially encoded by immunoglobulin genes or fragments of immunoglobulin genes, wherein the protein immunospecifically binds to an antigen.
  • the recognized immunoglobulin genes include the kappa, lambda, alpha, gamma, delta, epsilon and mu constant region genes, as well as myriad immunoglobulin variable region genes.
  • Light chains are classified as either kappa or lambda.
  • Heavy chains are classified as gamma, mu, alpha, delta, or epsilon, which in turn define the immunoglobulin classes, IgG, IgM, IgA, IgD and IgE, respectively.
  • the typical immunoglobulin structural unit comprises a tetramer that is composed of two identical pairs of polypeptide chains, each pair having one “light” (about 25 kD) and one “heavy” chain (about 50-70 kD) .
  • “V L ” and V H ′′ refer to the variable domains of these light and heavy chains respectively.
  • C L and C H refer to the constant domains of the light and heavy chains. Loops of ⁇ -strands, three each on the V L and V H are responsible for binding to the antigen, and are referred to as the “complementarity determining regions” or “CDRs” .
  • the “Fab” (fragment, antigen-binding) region includes one constant and one variable domain from each heavy and light chain of the antibody, i.e., V L , C L , V H and C H 1.
  • Antibodies include intact immunoglobulins as well as antigen-binding fragments thereof.
  • antigen-binding fragment refers to a polypeptide fragment of an antibody which binds antigen or competes with intact antibody (i.e., with the intact antibody from which they were derived) for antigen binding (i.e., specific binding) .
  • Antigen binding fragments can be produced by recombinant or biochemical methods that are well known in the art.
  • antigen-binding fragments include Fv, Fab, Fab', (Fab') 2 , CDR, paratope and single chain Fv antibodies (scFv) in which a V H and a V L chain are joined together (directly or through a peptide linker) to form a continuous polypeptide.
  • HCA heavy chain antibodies
  • camelids such as dromedary camels, Bactrian camels, wild Bactrian camels, llamas, alpacas, and guanacos (Hamers-Casterman et al., Nature, 363, 446-448 (1993) ; Wesolowski et al., Med. Microbiol. Immunol (2009) 198: 157-174; see also U.S. Pat. No. 5,759,808; U.S. Pat. No. 5,800,988; U.S. Pat. No. 5,840,526; and U.S. Pat. No.
  • V H H can include four framework regions or “FR” , FR1, FR2, FR3 and FR4.
  • the framework regions are interrupted by three CDRs, CDR1, CDR2 and CDR3.
  • One of the salient features of these naturally occurring heavy chain antibodies is the predominant presence of Glu, Arg and Gly at VL interface positions 44, 45 and 47 (Kabat numbering) , respectively, of their V H H.
  • V H H camelid HCA variable domain
  • Two more salient features of camelid V H H domains are their comparatively longer CDR3 and high incidence of cysteine pairs in CDRs. It appears that cysteine pairs mediate the formation of a disulfide bridge and are therefore involved in modulating the surface topology of the antibody combining site.
  • Antibodies also include variants, chimeric antibodies and humanized antibodies.
  • antibody variant refers to an antibody with single or multiple mutations in the heavy chains and/or light chains.
  • the mutations exist in the variable region.
  • the mutations exist in the constant region.
  • Chimeric antibodies refers to those antibodies wherein one portion of each of the amino acid sequences of heavy and light chains is homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular class, while the remaining segment of the chains is homologous to corresponding sequences in another.
  • variable region of both light and heavy chains mimics the variable regions of antibodies derived from one species of mammals, while the constant portions are homologous to the sequences in antibodies derived from another.
  • variable regions can conveniently be derived from presently known sources using readily available hybridomas or B cells from non-human host organisms in combination with constant regions derived from, for example, human cell preparations. While the variable region has the advantage of ease of preparation, and the specificity is not affected by its source, the constant region being human, is less likely to elicit an immune response from a human subject when the antibodies are injected than would the constant region from a non-human source.
  • the definition is not limited to this particular example.
  • Humanized antibodies refer to a molecule having an antigen-binding site that is substantially derived from an immunoglobulin from a non-human species and the remaining immunoglobulin structure of the molecule based upon the structure and/or sequence of a human immunoglobulin.
  • the antigen-binding site may comprise either complete variable domains fused onto constant domains or only the complementarity determining regions (CDRs) grafted onto appropriate framework regions in the variable domains.
  • Antigen binding sites may be wild type or modified by one or more amino acid substitutions, e.g., modified to resemble human immunoglobulin more closely.
  • Some forms of humanized antibodies preserve all CDR sequences (for example, a humanized mouse antibody which contains all six CDRs from the mouse antibodies) .
  • Other forms of humanized antibodies have one or more CDRs (one, two, three, four, five, or six) which are altered with respect to the original antibody, which are also termed one or more CDRs “derived from” one or more CDRs.
  • amino acid residues of an antibody can be numbered according to the general numbering of Kabat (Kabat, et al. (1991) Sequences of Proteins of Immunological Interest, 5th edition. Public Health Service, NIH, Bethesda, MD) .
  • binding refers to the process of a non-covalent interaction between molecules.
  • said binding is specific.
  • the specificity of an antibody can be determined based on affinity.
  • a specific antibody can have a binding affinity or dissociation constant Kd for its epitope of less than 10 -7 M, preferably less than 10 -8 M.
  • affinity refers to the strength of a binding reaction between a binding domain of an antibody and an epitope. It is the sum of the attractive and repulsive forces operating between the binding domain and the epitope.
  • affinity refers to the dissociation constant, K d .
  • antigen refers to a molecule or a portion of a molecule capable of being bound by a selective binding agent, such as an antibody, and additionally capable of being used in an animal to produce antibodies capable of binding to an epitope of that antigen.
  • a selective binding agent such as an antibody
  • An antigen may have one or more epitopes.
  • epitope includes any determinant, preferably a polypeptide determinant, capable of specific binding to an immunoglobulin or T-cell receptor.
  • epitope determinants include chemically active surface groupings of molecules such as amino acids, sugar side chains, phosphoryl, or sulfonyl, and, in certain embodiments, may have specific three-dimensional structural characteristics, and/or specific charge characteristics.
  • An epitope is a region of an antigen that is bound by an antibody.
  • an antibody is said to specifically bind an antigen when it preferentially recognizes its target antigen in a complex mixture of proteins and/or macromolecules.
  • Methods for epitope mapping are well known in the art, such as X-ray co-crystallography, array-based oligo-peptide scanning, site-directed mutagenesis, high throughput mutagenesis mapping and hydrogen–deuterium exchange.
  • paratope The site on the antibody that binds the epitope is referred to as “paratope, ” which typically include amino acid residues that are in close proximity to the epitope once bound. See Sela-Culang et al., Front Immunol. 2013; 4: 302.
  • IHC Immunohistochemistry
  • Immunospecific or “immunospecifically” refer to antibodies that bind via domains substantially encoded by immunoglobulin genes or fragments of immunoglobulin genes to one or more epitopes of a protein of interest, but which do not substantially recognize and bind other molecules in a sample containing a mixed population of antigenic molecules.
  • an antibody binds immunospecifically to a cognate antigen with a K d with a value of no greater than 50 nM, as measured by a surface plasmon resonance assay or a cell binding assay. The use of such assays is well known in the art.
  • an “anti-PROCR antibody” is an antibody that immunospecifically binds to PROCR (e.g., its extracellular domain) .
  • the antibody may be an isolated antibody.
  • Such binding to PROCR exhibits a K d with a value of, e.g., no greater than 1 ⁇ M, no greater than 100 nM or no greater than 50 nM. Kd can be measured by any methods known to a skilled in the art, such as a surface plasmon resonance assay or a cell binding assay.
  • An anti-PROCR antibody may be a monoclonal llama antibody, e.g., GS5, GS4, GS2, HD13, HD21, HD44, HD58 or HD61 disclosed herein, or antigen-binding fragments thereof.
  • anti-PROCR antibodies inhibit PROCR binding with protein C.
  • the anti-PROCR antibody may also be the “RCR-252” antibody, which refers to the monoclonal antibody having clone number RCR-252 as first described in Ye et al., “The endothelial cell protein C receptor (EPCR) functions as a primary receptor for protein C activation on endothelial cells in arteries, veins, and capillaries, ” Biochem Biophys Res Commun 1999, 259: 671.
  • RCR-252 is a rat anti human PROCR antibody, and is commercially available from multiple sources, such as Abcam under Catalog No. ab81712 and Sigma under Product No. E6280.
  • cross-compete means the ability of an antibody or fragment thereof to interfere with the binding directly or indirectly through allosteric modulation of the anti-PROCR antibodies of the present disclosure to the target PROCR.
  • the extent to which an antibody or fragment thereof is able to interfere with the binding of another to the target, and therefore whether it can be said to cross-block or cross-compete according to the present disclosure, can be determined using competition binding assays.
  • One particularly suitable quantitative cross-competition assay uses a FACS-or an AlphaScreen-based approach to measure competition between the labelled (e.g.
  • a cross-competing antibody or fragment thereof is for example one which will bind to the target in the cross-competition assay such that, during the assay and in the presence of a second antibody or fragment thereof, the recorded displacement of the immunoglobulin single variable domain or polypeptide according to the disclosure is up to 100% (e.g., in FACS based competition assay) of the maximum theoretical displacement (e.g., displacement by cold (e.g., unlabeled) antibody or fragment thereof that needs to be cross-blocked) by the to be tested potentially cross-blocking antibody or fragment thereof that is present in a given amount.
  • cross-competing antibodies or fragments thereof have a recorded displacement that is between 10%and 100%, more preferred between 50%to 100%.
  • suppress refers to any statistically significant decrease in biological activity (e.g., PROCR activity or tumor cell growth) , including full blocking of the activity.
  • inhibitor can refer to a decrease of about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%in biological activity.
  • patient includes a human or other mammalian animal that receives either prophylactic or therapeutic treatment.
  • treat, ” “treating, ” and “treatment, ” as used herein, refer to therapeutic or preventative measures such as those described herein.
  • the methods of “treatment” employ administration to a patient of a PROCR inhibitor provided herein, for example, a patient having TNBC, in order to prevent, cure, delay, reduce the severity of, or ameliorate one or more symptoms of the disease or disorder or recurring disease or disorder, or in order to prolong the survival of a patient beyond that expected in the absence of such treatment.
  • an agent such as a PROCR inhibitor, for example an anti-PROCR antibody, which is sufficient to effect treatment, prognosis or diagnosis of PROCR-high TNBC, when administered to a patient.
  • a therapeutically effective amount will vary depending upon the patient and disease condition being treated, the weight and age of the patient, the severity of the disease condition, the manner of administration and the like, which can readily be determined by one of ordinary skill in the art.
  • the dosages for administration can range from, for example, about 1 ng to about 10,000 mg, about 5 ng to about 9,500 mg, about 10 ng to about 9,000 mg, about 20 ng to about 8,500 mg, about 30 ng to about 7,500 mg, about 40 ng to about 7,000 mg, about 50 ng to about 6,500 mg, about 100 ng to about 6,000 mg, about 200 ng to about 5,500 mg, about 300 ng to about 5,000 mg, about 400 ng to about 4,500 mg, about 500 ng to about 4,000 mg, about 1 ⁇ g to about 3,500 mg, about 5 ⁇ g to about 3,000 mg, about 10 ⁇ g to about 2, 600 mg, about 20 ⁇ g to about 2,575 mg, about 30 ⁇ g to about 2,550 mg, about 40 ⁇ g to about 2,500 mg, about 50 ⁇ g to about 2,475 mg, about 100 ⁇ g to about 2,450 mg, about 200 ⁇ g to about 2,425 mg, about 300 ⁇ g to about 2,000, about 400 ⁇ g to about 1,175 mg
  • Dosing may be, e.g., every week, every 2 weeks, every three weeks, every 4 weeks, every 5 weeks or every 6 weeks. Dosage regimens may be adjusted to provide the optimum therapeutic response. An effective amount is also one in which any toxic or detrimental effects (side effects) of the agent are minimized and/or outweighed by the beneficial effects. Administration may be intravenous at exactly or about 6 mg/kg or 12 mg/kg weekly, or 12 mg/kg or 24 mg/kg biweekly. Additional dosing regimens are described below.
  • compositions, methods, and respective component (s) thereof are used in reference to compositions, methods, and respective component (s) thereof, that are present in a given embodiment, yet open to the inclusion of unspecified elements.
  • the term “consisting essentially of” refers to those elements required for a given embodiment. The term permits the presence of additional elements that do not materially affect the basic and novel or functional characteristic (s) of that embodiment of the disclosure.
  • compositions, methods, and respective components thereof as described herein, which are exclusive of any element not recited in that description of the embodiment.
  • the human PROCR is a highly glycosylated type I transmembrane protein of 238 amino-acids (UniProtKB ID No. Q9UNN8) . These amino acids comprise a signal peptide (amino acids 1017) , an extracellular domain (amino acids 18-210) , a 21-aa transmembrane domain (amino acids 211-231) , and a 7-aa intracytoplasmic sequence (amino acids 232-238) together coding for an ⁇ 46 kDa protein. Deglycosylation will reduce the protein mass to 25 kDa.
  • PROCR is expressed strongly on the endothelial cells of arteries and veins in heart and lung, less intensely in capillaries in the lung and skin, and not at all in the endothelium of small vessels of the liver and kidney.
  • PROCR is the receptor for protein C, a key player in the anticoagulation pathway.
  • the protein C anticoagulant pathway serves as a major system for controlling thrombosis, limiting inflammatory responses, and potentially decreasing endothelial cell apoptosis in response to inflammatory cytokines and ischemia.
  • the essential components of the pathway include thrombin, thrombomodulin, PROCR, protein C and protein S.
  • the pathway is initiated when thrombin binds to thrombomodulin on the surface of endothelium.
  • PROCR augments protein C activation by binding protein C and presenting it to the thrombin-thrombomodulin activation complex.
  • Activated protein C retains its ability to bind PROCR, and this complex appears to be involved in some of the cellular signaling mechanisms that down-regulate inflammatory cytokine formation (TNF, IL-6) .
  • PROCR is shed from the vasculature by inflammatory mediators and thrombin.
  • PROCR binds to activated neutrophils in a process that involves proteinase 3 and Mac-1. Furthermore, PROCR can undergo translocation from the plasma membrane to the nucleus.
  • PROCR can be cleaved to release a soluble form (sPROCR) in the circulation.
  • This sPROCR is detected as a single species of 43 kDa, resulting from shedding of membrane PROCR by the action of a metalloprotease, which is stimulated by thrombin and by some inflammatory mediators.
  • Soluble PROCR binds PC and aPC with similar affinity, but its binding to aPC inhibits the anticoagulant activity of aPC by blocking its binding to phospholipids and by abrogating its ability to inactivate factor Va.
  • sPROCR can be detected in plasma. In normal persons, sPROCR is present in levels of 83.6 +/-17.2 ng/ml. Elevated levels of sPROCR are positively correlated to a higher risk for thrombosis. Furthermore, a haplotype (A3 allele) has been linked to elevated levels of sPROCR (264 +/-174 ng/ml) .
  • the full gene sequence of human Procr is 44819 bp (GenBank ID No. NC_000020.11) .
  • the human cDNA sequence is 717 bp in length (GenBank ID No. NM_006404.4) .
  • the full gene sequence of mouse Procr gene is 4354 bp (GenBank ID No. NC_000068.7) .
  • the presence of PROCR and/or its expression level can be used as a biomarker for diagnosing and/or determining the prognosis of a specific subtype of TNBC, PROCR+ TNBC or PROCR-high TNBC. This is based on the surprising discovery that PROCR expression level is elevated in about 50-60%of TNBC cells.
  • PROCR protein level can be measured by mass spectrometry or an immunoassay using an anti-PROCR antibody, such as immunohistochemistry on a tissue sample or enzyme linked immunosorbent assay (ELISA) or Western blot.
  • PROCR mRNA level can be measured by quantitative reverse transcription PCR (qRT-PCR) or Northern blot or microarray. Other methods known in the art can also be used to detect the presence of PROCR and/or measure its expression level.
  • kits for detecting PROCR and thus, diagnosing PROCR+ TNBC are also provided.
  • the kit can include one or more anti-PROCR antibody disclosed herein, or antigen binding fragment thereof, for use in connection with an immunoassay such as immunohistochemistry or ELISA or Western blot.
  • the kit can include specific primers and/or probes for use in connection with qRT-PCR or Northern blot.
  • the kit can also include a microarray for detecting Procr mRNA or protein level where Procr gene or a fragment thereof, or anti-PROCR antibody or an antigen binding fragment thereof, can be attached to the microarray.
  • a control sample along with a user instruction manual can additionally be included in the kit, wherein a difference (e.g., increase) in the test sample compared to the control sample (after normalization) indicates the presence of PROCR+ TNBC.
  • the increase can be more than about 10%, more than about 20%, more than about 30%, more than about 50%, more than about 60%, more than about 80%, more than about 100%, or more, or any number therebetween.
  • PROCR inhibitors can be used as effective PROCR+ TNBC therapeutics.
  • PROCR inhibitors are included in the present disclosure.
  • Examples include chemical compounds, such as small molecule inhibitors and biologic agents (e.g., antibodies) that can bind PROCR and inhibit or decrease its activity, e.g., binding to protein C.
  • Agents that regulate Procr gene expression level are also included, such as interfering RNA (shRNA, siRNA) and gene editing/silencing tools (CRISPR/Cas9, TALENs, zinc finger nucleases) that are designed specifically to target the Procr gene or a regulatory sequence thereto.
  • the PROCR inhibitor is an anti-PROCR antibody, e.g., a monoclonal antibody.
  • An exemplary anti-PROCR antibody is GS5, GS4 or GS2.
  • the anti-PROCR antibody can be an antibody that cross-competes with GS5, GS4 or GS2 for binding to PROCR.
  • the anti-PROCR antibody is an antibody comprising one or more the CDR sequences of GS5, GS4 and/or GS2, as shown below wherein the CDRs for each VHH are bold and underlined.
  • GS2 (SEQ ID NO: 1) :
  • GS4 (SEQ ID NO: 2) :
  • GS5 (SEQ ID NO: 3) :
  • the anti-PROCR antibody can be a modified, e.g., chimeric or humanized antibody derived from GS2, GS4 and/or GS5.
  • the modified antibody can include one or more CDRs of GS2, GS4 and/or GS5.
  • the antibody includes one or more of CDR1 of GS2 (GSTFSITT (SEQ ID NO: 4) ) , CDR2 of GS2 (IIVVSDP (SEQ ID NO: 5) ) , and CDR3 of GS2 (VTSDHRGY (SEQ ID NO: 6) ) .
  • the antibody includes one or more of CDR1 of GS4 or GS5 (GDITGDNC (SEQ ID NO: 7) ) , CDR2 of GS4 (IYTATGS (SEQ ID NO: 8) ) , CDR2 of GS5 (IHTATDS (SEQ ID NO: 9) ) , and CDR3 of GS4 or GS5 (PTNNRYPWGGCPLYEDAYNY (SEQ ID NO: 10) ) .
  • CDR1 of GS4 or GS5 GDITGDNC (SEQ ID NO: 7)
  • CDR2 of GS4 IYTATGS (SEQ ID NO: 8)
  • CDR2 of GS5 IHTATDS (SEQ ID NO: 9)
  • CDR3 of GS4 or GS5 PTNNRYPWGGCPLYEDAYNY (SEQ ID NO: 10)
  • the anti-PROCR antibody can be selected from HD13, HD21, HD44, HD58 or HD61 as shown below, or an antigen-binding fragment thereof (e.g., the CDRs) .
  • the anti-PROCR antibody can be an antibody that cross-competes with HD13, HD21, HD44, HD58 or HD61 for binding to PROCR.
  • the anti-PROCR antibody is an antibody comprising one or more the CDR sequences of HD13, HD21, HD44, HD58, or HD61 (bold and underlined below) .
  • HD13-H (heavy chain, SEQ ID NO: 11; CDR1, CDR2 and CDR3 are underlined)
  • HD21-H (heavy chain, SEQ ID NO: 12; CDR1, CDR2 and CDR3 are underlined)
  • HD44-H (heavy chain, SEQ ID NO: 13; CDR1, CDR2 and CDR3 are underlined)
  • HD58-H (heavy chain, SEQ ID NO: 14; CDR1, CDR2 and CDR3 are underlined)
  • HD61-H (heavy chain, SEQ ID NO: 15; CDR1, CDR2 and CDR3 are underlined)
  • HD13-L light chain, SEQ ID NO: 17; CDR1, CDR2 and CDR3 are underlined
  • HD21-L light chain, SEQ ID NO: 18; CDR1, CDR2 and CDR3 are underlined
  • HD44-L light chain, SEQ ID NO: 19; CDR1, CDR2 and CDR3 are underlined
  • HD58-L light chain, SEQ ID NO: 20; CDR1, CDR2 and CDR3 are underlined
  • HD61-L light chain, SEQ ID NO: 21; CDR1, CDR2 and CDR3 are underlined
  • the anti-PROCR antibody is an antibody or antigen binding portion thereof which binds to an epitope of human PROCR, e.g., the extracellular domain.
  • the anti-PROCR antibody can cross-compete with GS5, GS4, GS2, HD13, HD21, HD44, HD58 or HD61 for binding to the epitope.
  • the epitope may be bound by GS5, GS4, GS2, HD13, HD21, HD44, HD58 or HD61.
  • GS5, GS4, GS2, HD13, HD21, HD44, HD58 or HD61 may bind to a different but proximate epitope on PROCR.
  • the anti-PROCR antibody can be characterized by at least partial inhibition of proliferation (e.g., by at least 10%relative to control) of a cancer cell expressing PROCR or by at least partial inhibition of tumor growth (e.g., volume and/or metastasis) in vivo in the patient or in a patient-derived xenograft.
  • proliferation e.g., by at least 10%relative to control
  • tumor growth e.g., volume and/or metastasis
  • the anti-PROCR antibody can comprise a mixture, or cocktail, of two or more anti-PROCR antibodies, each of which binds to a different epitope on PROCR.
  • the mixture, or cocktail comprises three anti-PROCR antibodies, each of which binds to a different epitope on PROCR.
  • the PROCR inhibitor comprises a nucleic acid molecule, such as an RNA molecule, that inhibits the expression or activity of PROCR.
  • RNA molecules such as an RNA molecule
  • Interfering RNAs specific for Procr such as shRNAs or siRNAs that specifically inhibits the expression and/or activity of Procr, can be designed in accordance with methods known in the art.
  • PROCR-expressing cells e.g., PROCR+ TNBC cells
  • a patient-derived xenograft can be used as a model for screening for agents that inhibit PROCR expression and/or activity.
  • An exemplary method includes: (a) providing a test agent to a plurality of PROCR+ TNBC cells, and (b) determining one or more of (1) PROCR expression level, (2) PROCR activity, and (3) survival and/or proliferation rate of the PROCR+ TNBC cells, wherein a decrease compared to a negative control not treated by the test agent indicates that the test agent is a PROCR inhibitor.
  • Another exemplary method includes: (a) providing a test agent to a patient-derived PROCR+ TNBC xenograft, and (b) determining (1) PROCR expression level, (2) PROCR activity, and (3) tumor growth and/or metastasis in the xenograft, wherein a decrease compared to a negative control not treated by the test agent indicates that the test agent is a PROCR inhibitor.
  • Yet another exemplary method includes: (a) providing a test agent, and (b) determining whether the test agent has one or more of the following characteristics: (i) binding to PROCR; (ii) interfering with or inhibiting binding of PROCR with protein C; (iii) cross-competing with GS5, GS4, GS2, HD13, HD21, HD44, HD58 or HD61; (iv) interfering with or inhibiting binding of GS5, GS4, GS2, HD13, HD21, HD44, HD58 or HD61 with PROCR; and/or (v) enhancing binding of GS5, GS4, GS2, HD13, HD21, HD44, HD58 or HD61 with PROCR; wherein the test agent is a PROCR inhibitor if it has one or more of (i) - (v) .
  • the test agent can be an antibody, a small molecule, a peptide and/or a nucleic acid.
  • a PROCR inhibitor for the manufacture of a medicament for the treatment of PROCR+ TNBC is provided.
  • a method of suppressing growth of a PROCR+TNBC cell is provided, the method comprising contacting the cell with an effective amount of a PROCR inhibitor.
  • a method of suppressing growth of a PROCR+ TNBC tumor in a patient is provided, the method comprising administering to the patient an effective amount of a PROCR inhibitor.
  • a method of treating a patient for a PROCR+ TNBC tumor is provided, the method comprising administering to the patient an effective amount of a PROCR inhibitor.
  • a method of treating a breast cancer tumor in a patient comprising: selecting a patient with a PROCR+ TNBC tumor; and administering to the patient an effective amount of a PROCR inhibitor.
  • the PROCR inhibitor is an anti-PROCR antibody.
  • An exemplary anti-PROCR antibody is GS5, GS4, GS2, HD13, HD21, HD44, HD58 or HD61 or an antigen binding fragment thereof, or an antibody that cross-competes with GS5, GS4, GS2, HD13, HD21, HD44, HD58 or HD61 in PROCR binding.
  • Antibodies typically comprise two identical pairs of polypeptide chains, each pair having one full-length “light” chain (typically having a molecular weight of about 25 kDa) and one full-length “heavy” chain (typically having a molecular weight of about 50-70 kDa) .
  • the amino-terminal portion of each chain typically includes a variable region of about 100 to 110 or more amino acids that typically is responsible for antigen recognition.
  • the carboxy-terminal portion of each chain typically defines a constant region responsible for effector function.
  • the variable regions of each of the heavy chains and light chains typically exhibit the same general structure comprising four relatively conserved framework regions (FR) joined by three hyper variable regions, also called complementarity determining regions or CDRs.
  • FR relatively conserved framework regions
  • both light and heavy chain variable regions typically comprise the domains FR1, CDR1, FR2, CDR2, FR3, CDR3 and FR4.
  • the assignment of amino acids to each domain is typically in accordance with the definitions of Kabat Sequences of Proteins of Immunological Interest (1987 and 1991, National Institutes of Health, Bethesda, Md. ) , Chothia &Lesk, 1987, J. Mol. Biol. 196: 901-917, or Chothia et al., 1989, Nature 342: 878-883) .
  • Monoclonal antibodies are produced using any method that produces antibody molecules by continuous cell lines in culture. Examples of suitable methods for preparing monoclonal antibodies include the hybridoma methods of Kohler et al. (1975, Nature 256: 495-497) and the human B-cell hybridoma method (Kozbor, 1984, J. Immunol. 133: 3001; and Brön et al., 1987, Monoclonal Antibody Production Techniques and Applications, Marcel Dekker, Inc., New York, pp. 51-63) .
  • Monoclonal antibodies may be modified for use as therapeutics.
  • One example is a “chimeric” antibody in which a portion of the heavy chain and/or light chain is identical with or homologous to a corresponding sequence in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain (s) is/are identical with or homologous to a corresponding sequence in antibodies derived from another species or belonging to another antibody class or subclass.
  • Other examples are fragments of such antibodies, so long as they exhibit the desired biological activity. See, U.S. Pat. No. 4,816,567; and Morrison et al. (1985) , Proc. Natl. Acad. Sci. USA 81: 6851-6855.
  • CDR-grafted antibody in which the antibody comprises one or more complementarity determining regions (CDRs) from a particular species or belonging to a particular antibody class or subclass, while the remainder of the antibody chain (s) is/are identical with or homologous to a corresponding sequence in antibodies derived from another species or belonging to another antibody class or subclass.
  • CDRs complementarity determining regions
  • a humanized antibody is produced by a non-human animal, and then certain amino acid residues, typically from non-antigen recognizing portions of the antibody, are modified to be homologous to said residues in a human antibody of corresponding isotype.
  • Humanization can be performed, for example, using methods described in the art (Jones et al., 1986, Nature 321: 522-525; Riechmann et al., 1988, Nature 332: 323-327; Verhoeyen et al., 1988, Science 239: 1534-1536) , by substituting at least a portion of a rodent variable region for the corresponding regions of a human antibody.
  • transgenic animals e.g., mice
  • an antigen typically having at least 6 contiguous amino acids
  • a carrier optionally conjugated to a carrier.
  • transgenic animals are produced by incapacitating the endogenous mouse immunoglobulin loci encoding the mouse heavy and light immunoglobulin chains therein, and inserting loci encoding human heavy and light chain proteins into the genome thereof. Partially modified animals, which have less than the full complement of modifications, are then cross-bred to obtain an animal having all of the desired immune system modifications. When administered an immunogen, these transgenic animals produce antibodies that are immunospecific for these antigens having human (rather than murine) amino acid sequences, including variable regions. See PCT Publication Nos. WO96/33735 and WO94/02602, incorporated by reference. Additional methods are described in U.S. Pat. No. 5,545,807, PCT Publication Nos.
  • Human antibodies may also be produced by the expression of recombinant DNA in host cells or by expression in hybridoma cells as described herein.
  • Fully human antibodies can also be produced from phage-display libraries (as disclosed in Hoogenboom et al., 1991, J. Mol. Biol. 227: 381; and Marks et al., 1991, J. Mol. Biol. 222: 581) . These processes mimic immune selection through the display of antibody repertoires on the surface of filamentous bacteriophage, and subsequent selection of phage by their binding to an antigen of choice.
  • One such technique is described in PCT Publication No. WO99/10494, incorporated by reference, which describes the isolation of high affinity and functional agonistic antibodies for MPL-and msk-receptors using such an approach.
  • nucleotide sequences encoding the above antibodies have been determined, chimeric, CDR-grafted, humanized, and fully human antibodies also may be produced by recombinant methods. Nucleic acids encoding the antibodies are introduced into host cells and expressed using materials and procedures generally known in the art.
  • the disclosure provides one or more monoclonal antibodies against PROCR.
  • the antibodies bind PROCR.
  • the disclosure provides nucleotide sequences encoding, and amino acid sequences comprising, heavy and light chain immunoglobulin molecules, particularly sequences corresponding to the variable regions thereof.
  • sequences corresponding to CDRs specifically from CDR1 through CDR3, are provided.
  • the disclosure provides hybridoma cell lines expressing such immunoglobulin molecules and monoclonal antibodies produced therefrom, preferably purified human monoclonal antibodies against human PROCR.
  • the CDRs of the light and heavy chain variable regions of anti-PROCR antibodies of the disclosure can be grafted to framework regions (FRs) from the same, or another, species.
  • the CDRs of the light and heavy chain variable regions of anti-PROCR antibody may be grafted to consensus human FRs.
  • consensus human FRs FRs from several human heavy chain or light chain amino acid sequences are aligned to identify a consensus amino acid sequence.
  • the FRs of the anti-PROCR antibody heavy chain or light chain can be replaced with the FRs from a different heavy chain or light chain. Rare amino acids in the FRs of the heavy and light chains of anti-PROCR antibody typically are not replaced, while the rest of the FR amino acids can be replaced.
  • Rare amino acids are specific amino acids that are in positions in which they are not usually found in FRs.
  • the grafted variable regions from anti-PROCR antibodies of the disclosure can be used with a constant region that is different from the constant region of anti-PROCR antibody.
  • the grafted variable regions are part of a single chain Fv antibody. CDR grafting is described, e.g., in U.S. Pat. Nos. 6,180,370, 5,693,762, 5,693,761, 5,585,089, and 5,530,101, which are hereby incorporated by reference for any purpose.
  • the disclosure provides an anti-PROCR antibody GS5, GS4, GS2, HD13, HD21, HD44, HD58 or HD61. In other embodiments, the disclosure provides anti-PROCR antibodies that comprise one or more CDRs of GS5, GS4, GS2, HD13, HD21, HD44, HD58 or HD61.
  • antibodies of the disclosure can be produced by hybridoma lines.
  • the antibodies of the disclosure bind to PROCR with a dissociation constant (K d ) of between approximately 4 pM and 1 ⁇ M.
  • the antibodies bind to PROCR with a K d of less than about 100 nM, less than about 50 nM or less than about 10 nM.
  • the antibodies of the disclosure are of the IgG1, IgG2, or IgG4 isotype, with the IgG1 isotype most preferred.
  • the antibodies comprise a human kappa light chain and a human IgG1, IgG2, or IgG4 heavy chain.
  • the variable regions of the antibodies are ligated to a constant region other than the constant region for the IgG1, IgG2, or IgG4 isotype.
  • the antibodies of the disclosure have been cloned for expression in mammalian cells.
  • antibodies of the disclosure can be expressed in cell lines other than hybridoma cell lines.
  • sequences encoding particular antibodies can be used for transformation of a suitable mammalian host cell.
  • transformation can be achieved using any known method for introducing polynucleotides into a host cell, including, for example packaging the polynucleotide in a virus (or into a viral vector) and transducing a host cell with the virus (or vector) or by transfection procedures known in the art. Such procedures are exemplified by U.S. Pat. Nos.
  • heterologous polynucleotides include, but are not limited to, dextran-mediated transfection, calcium phosphate precipitation, polybrene-mediated transfection, protoplast fusion, electroporation, encapsulation of the polynucleotide (s) in liposomes, and direct microinjection of the DNA into nuclei.
  • a nucleic acid molecule encoding the amino acid sequence of a heavy chain constant region, a heavy chain variable region, a light chain constant region, or a light chain variable region of a PROCR antibody of the disclosure is inserted into an appropriate expression vector using standard ligation techniques.
  • the PROCR heavy or light chain constant region is appended to the C-terminus of the appropriate variable region and is ligated into an expression vector.
  • the vector is typically selected to be functional in the particular host cell employed (i.e., the vector is compatible with the host cell machinery such that amplification of the gene and/or expression of the gene can occur) .
  • the vector is typically selected to be functional in the particular host cell employed (i.e., the vector is compatible with the host cell machinery such that amplification of the gene and/or expression of the gene can occur) .
  • expression vectors used in any of the host cells will contain sequences for plasmid maintenance and for cloning and expression of exogenous nucleotide sequences.
  • sequences typically include one or more of the following nucleotide sequences: a promoter, one or more enhancer sequences, an origin of replication, a transcriptional termination sequence, a complete intron sequence containing a donor and acceptor splice site, a sequence encoding a leader sequence for polypeptide secretion, a ribosome binding site, a polyadenylation sequence, a polylinker region for inserting the nucleic acid encoding the polypeptide to be expressed, and a selectable marker element.
  • sequences are well known in the art.
  • Expression vectors of the disclosure may be constructed from a starting vector such as a commercially available vector. Such vectors may or may not contain all of the desired flanking sequences. Where one or more of the flanking sequences described herein are not already present in the vector, they may be individually obtained and ligated into the vector. Methods used for obtaining each of the flanking sequences are well known to one skilled in the art.
  • the completed vector may be inserted into a suitable host cell for amplification and/or polypeptide expression.
  • the transformation of an expression vector for an anti-PROCR antibody into a selected host cell may be accomplished by well-known methods including transfection, infection, calcium phosphate co-precipitation, electroporation, microinjection, lipofection, DEAE-dextran mediated transfection, or other known techniques. The method selected will in part be a function of the type of host cell to be used. These methods and other suitable methods are well known to the skilled artisan, and are set forth, for example, in Sambrook et al., supra.
  • the host cell when cultured under appropriate conditions, synthesizes an anti-PROCR antibody that can subsequently be collected from the culture medium (if the host cell secretes it into the medium) or directly from the host cell producing it (if it is not secreted) .
  • the selection of an appropriate host cell will depend upon various factors, such as desired expression levels, polypeptide modifications that are desirable or necessary for activity (such as glycosylation or phosphorylation) and ease of folding into a biologically active molecule.
  • Mammalian cell lines available as hosts for expression are well known in the art and include, but are not limited to, many immortalized cell lines available from the American Type Culture Collection (ATCC) , including but not limited to Chinese hamster ovary (CHO) cells, HeLa cells, baby hamster kidney (BHK) cells, monkey kidney cells (COS) , human hepatocellular carcinoma cells (e.g., Hep G2) , and a number of other cell lines. In certain embodiments, one may select cell lines by determining which cell lines have high expression levels and produce antibodies with constitutive PROCR binding properties.
  • ATCC American Type Culture Collection
  • BHK baby hamster kidney
  • COS monkey kidney cells
  • Hep G2 human hepatocellular carcinoma cells
  • a heterologous antibody e.g., mouse myeloma cell lines NS0 and SP2/0
  • compositions are provided that can be used in the methods disclosed herein, i.e., pharmaceutical compositions for treating PROCR+ TNBC.
  • the pharmaceutical composition for treating TNBC comprises a PROCR inhibitor and a pharmaceutical carrier.
  • the PROCR inhibitor can be formulated with the pharmaceutical carrier into a pharmaceutical composition.
  • the pharmaceutical composition can include, for example, instructions for use of the composition for the treatment of patients for PROCR+ TNBC.
  • the PROCR inhibitor in the composition is an anti-PROCR antibody, e.g., GS5, GS4, GS2, HD13, HD21, HD44, HD58 or HD61 or an antibody comprising the CDRs of GS5, GS4, GS2, HD13, HD21, HD44, HD58 or HD61 positioned in the antibody in the same relative order as they are present in GS5, GS4, GS2, HD13, HD21, HD44, HD58 or HD61 so as to provide immunospecific binding of PROCR.
  • antibodies or antigen binding fragments thereof that can cross-compete with GS5, GS4, GS2, HD13, HD21, HD44, HD58 or HD61 in PROCR binding are provided by the present disclosure.
  • “pharmaceutically acceptable carrier” includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, and other excipients that are physiologically compatible.
  • the carrier is suitable for parenteral, oral, or topical administration.
  • the active compound e.g., small molecule or biologic agent, may be coated in a material to protect the compound from the action of acids and other natural conditions that may inactivate the compound.
  • Pharmaceutically acceptable carriers include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion, as well as conventional excipients for the preparation of tablets, pills, capsules and the like.
  • sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion, as well as conventional excipients for the preparation of tablets, pills, capsules and the like.
  • the use of such media and agents for the formulation of pharmaceutically active substances is known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the pharmaceutical compositions provided herein is contemplated. Supplementary active compounds can also be incorporated into the compositions.
  • a pharmaceutically acceptable carrier can include a pharmaceutically acceptable antioxidant.
  • pharmaceutically-acceptable antioxidants include: (1) water soluble antioxidants, such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite and the like; (2) oil-soluble antioxidants, such as ascorbyl palmitate, butylated hydroxyanisole (BHA) , butylated hydroxytoluene (BHT) , lecithin, propyl gallate, alpha-tocopherol, and the like; and (3) metal chelating agents, such as citric acid, ethylenediamine tetraacetic acid (EDTA) , sorbitol, tartaric acid, phosphoric acid, and the like.
  • water soluble antioxidants such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite and the like
  • oil-soluble antioxidants such as ascorbyl palmitate, buty
  • aqueous and nonaqueous carriers examples include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like) , and suitable mixtures thereof, and injectable organic esters, such as ethyl oleate.
  • polyols such as glycerol, propylene glycol, polyethylene glycol, and the like
  • injectable organic esters such as ethyl oleate.
  • proper fluidity can be maintained, for example, by the use of coating materials, such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.
  • isotonic agents for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride in the composition.
  • Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent that delays absorption, for example, monostearate salts and gelatin.
  • compositions may also contain functional excipients such as preservatives, wetting agents, emulsifying agents and dispersing agents.
  • compositions typically must be sterile, non-phylogenic, and stable under the conditions of manufacture and storage.
  • the composition can be formulated as a solution, microemulsion, liposome, or other ordered structure suitable to high drug concentration.
  • Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by sterilization, e.g., by microfiltration.
  • dispersions are prepared by incorporating the active compound into a sterile vehicle that contains a basic dispersion medium and the required other ingredients from those enumerated above.
  • methods of preparation include vacuum drying and freeze-drying (lyophilization) that yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
  • the active agent (s) may be mixed under sterile conditions with additional pharmaceutically acceptable carrier (s) , and with any preservatives, buffers, or propellants which may be required.
  • Prevention of presence of microorganisms may be ensured both by sterilization procedures, supra, and by the inclusion of various antibacterial and antifungal agents, for example, paraben, chlorobutanol, phenol sorbic acid, and the like. It may also be desirable to include isotonic agents, such as sugars, sodium chloride, and the like into the compositions. In addition, prolonged absorption of the injectable pharmaceutical form may be brought about by the inclusion of agents which delay absorption such as aluminum monostearate and gelatin.
  • compositions comprising a PROCR inhibitor can be administered alone or in combination therapy.
  • the combination therapy can include a composition provided herein comprising a PROCR inhibitor and at least one or more additional therapeutic agents, such as one or more chemotherapeutic agents known in the art, discussed in further detail below.
  • Pharmaceutical compositions can also be administered in conjunction with radiation therapy and/or surgery.
  • Dosage regimens are adjusted to provide the optimum desired response (e.g., a therapeutic response) .
  • a single bolus may be administered, several divided doses may be administered over time or the dose may be proportionally reduced or increased as indicated by the exigencies of the therapeutic situation.
  • Exemplary dosage ranges for administration of an antibody include: 10-1000 mg (antibody) /kg (body weight of the patient) , 10-800 mg/kg, 10-600 mg/kg, 10-400 mg/kg, 10-200 mg/kg, 30-1000 mg/kg, 30-800 mg/kg, 30-600 mg/kg, 30-400 mg/kg, 30-200 mg/kg, 50-1000 mg/kg, 50-800 mg/kg, 50-600 mg/kg, 50-400 mg/kg, 50-200 mg/kg, 100-1000 mg/kg, 100-900 mg/kg, 100-800 mg/kg, 100-700 mg/kg, 100-600 mg/kg, 100-500 mg/kg, 100-400 mg/kg, 100-300 mg/kg and 100-200 mg/kg.
  • Exemplary dosage schedules include once every three days, once every five days, once every seven days (i.e., once a week) , once every 10 days, once every 14 days (i.e., once every two weeks) , once every 21 days (i.e., once every three weeks) , once every 28 days (i.e., once every four weeks) and once a month.
  • Unit dosage form refers to physically discrete units suited as unitary dosages for the patients to be treated; each unit contains a predetermined quantity of active agent calculated to produce the desired therapeutic effect in association with any required pharmaceutical carrier.
  • the specification for unit dosage forms are dictated by and directly dependent on (a) the unique characteristics of the active compound and the particular therapeutic effect to be achieved, and (b) the limitations inherent in the art of compounding such an active compound for the treatment of sensitivity in individuals.
  • parenteral as used herein in the context of administration means modes of administration other than enteral and topical administration, usually by injection, and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, epidural and intrasternal injection and infusion.
  • parenteral administration and “administered parenterally” as used herein refer to modes of administration other than enteral (i.e., via the digestive tract) and topical administration, usually by injection or infusion, and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, epidural and intrasternal injection and infusion. Intravenous injection and infusion are often (but not exclusively) used for antibody administration.
  • agents provided herein are administered as pharmaceuticals, to humans or animals, they can be given alone or as a pharmaceutical composition containing, for example, 0.001 to 90% (e.g., 0.005 to 70%, e.g., 0.01 to 30%) of active ingredient in combination with a pharmaceutically acceptable carrier.
  • the methods and uses provided herein for suppressing growth of PROCR+TNBC cells or for treating a patient with PROCR+ TNBC can comprise administration of a PROCR inhibitor and at least one additional anti-cancer agent that is not a PROCR inhibitor.
  • the at least one additional anti-cancer agent comprises at least one chemotherapeutic drug.
  • chemotherapeutic drugs include platinum-based chemotherapy drugs (e.g., cisplatin, carboplatin) , taxanes (e.g., paclitaxel docetaxel EndoTAG-1 TM (a formulation of paclitaxel encapsulated in positively charged lipid-based complexes; MediGene) , (a formulation of paclitaxel bound to albumin) ) , tyrosine kinase inhibitors (e.g., ) , and combinations thereof.
  • platinum-based chemotherapy drugs e.g., cisplatin, carboplatin
  • taxanes e.g., paclitaxel docetaxel EndoTAG-1 TM (a formulation of paclitaxel encapsulated in positively charged lipid-based complexes; MediGene)
  • tyrosine kinase inhibitors e.g., )
  • the at least one additional anti-cancer agent comprises an EGFR inhibitor, such as an anti-EGFR antibody or a small molecule inhibitor of EGFR signaling.
  • an exemplary anti-EGFR antibody is cetuximab Cetuximab is commercially available from ImClone Systems Incorporated.
  • Other examples of anti-EGFR antibodies include matuzumab (EMD72000) , panitumumab ( Amgen) ; nimotuzumab (TheraCIM TM ) and mAb 806.
  • An exemplary small molecule inhibitor of the EGFR signaling pathway is gefitinib which is commercially available from AstraZeneca and Teva.
  • small molecule inhibitors of the EGFR signaling pathway include erlotinib HCL (OSI-774; OSI Pharma) ; lapatinib ( GlaxoSmithKline) ; canertinib (canertinib dihydrochloride, Pfizer) ; pelitinib (Pfizer) ; PKI-166 (Novartis) ; PD158780; and AG 1478 (4- (3-Chloroanillino) -6, 7-dimethoxyquinazoline) .
  • the at least one additional anti-cancer agent comprises a VEGF inhibitor.
  • An exemplary VEGF inhibitor comprises an anti-VEGF antibody, such as bevacizumab ( Genentech) .
  • the at least one additional anti-cancer agent comprises an anti-ErbB2 antibody.
  • Suitable anti-ErbB2 antibodies include trastuzumab and pertuzumab.
  • the improved effectiveness of a combination according to the disclosure can be demonstrated by achieving therapeutic synergy.
  • therapeutic synergy is used when the combination of two products at given doses is more efficacious than the best of each of the two products alone at the same doses.
  • therapeutic synergy can be evaluated by comparing a combination to the best single agent using estimates obtained from a two-way analysis of variance with repeated measurements (e.g., time factor) on parameter tumor volume.
  • additive refers to when the combination of two or more products at given doses is equally efficacious than the sum of the efficacies obtained with of each of the two or more products, whilst the term “superadditive” refers to when the combination is more efficacious than the sum of the efficacies obtained with of each of the two or more products.
  • log 10 cell kill T-C (days) /3.32 ⁇ T d
  • T-C represents the delay in growth of the cells, which is the average time, in days, for the tumors of the treated group (T) and the tumors of the control group (C) to have reached a predetermined value (1 g, or 10 mL, for example)
  • T d represents the time, in days necessary for the volume of the tumor to double in the control animals.
  • a combination, used at its own maximum tolerated dose, in which each of the constituents is present at a dose generally less than or equal to its maximum tolerated dose exhibits therapeutic synergy when the log 10 cell kill is greater than the value of the log 10 cell kill of the best constituent when it is administered alone.
  • the log 10 cell kill of the combination exceeds the value of the log 10 cell kill of the best constituent of the combination by at least one log cell kill.
  • Example 1 Targeting Protein C Receptor to inhibit cancer stem cells in a subgroup of triple negative breast cancer
  • TNBC triple-negative breast cancer
  • MaSCs mammary stem cells
  • Procr+ cells were enriched for cancer stem cells (CSCs) in Wnt1 basal-like tumor, but not Brca1 basal-like tumor or PyVT luminal tumor.
  • CSCs cancer stem cells
  • PDX patient-derived xenograft
  • PROCR+ BC discrete subgroup
  • Our data reveal the essential role of Procr in MaSC maintenance and suggest a key role of MaSC in breast tumorigenesis.
  • PROCR as a biomarker to stratify TNBC into clinically relevant subgroups and may provide a novel targeted treatment strategy for this clinically important tumor subtype.
  • Procr is essential for mouse MaSC properties and marks CSCs in Wnt1 basal-like mammary tumor;
  • PROCR is a biomarker to stratify human TNBC into clinically relevant subgroups, PROCR + TNBC (PROCR + BC) and PROCR - TNBC;
  • PROCR expression is enriched for CSCs in PROCR + BC; and
  • development of a PROCR inhibitory antibody such as a nanobody can effectively suppress PDX tumor formation.
  • IHC markers such as estrogen receptor (ER) , progesterone receptor (PR) and HER2, together with clinicopathological features, are conventionally used for patient prognosis and management. IHC markers separate patients into four subgroups, Luminal A (ER+, PR+) , Luminal B (ER+, PR+, HER2/Ki67+) , HER2 (HER2+) and Triple-negative breast cancer (TNBC, i.e. lack of ER and PR expression, and absence of HER2 amplification or overexpression) (Foulkes et al., 2010) .
  • IHC markers such as estrogen receptor (ER) , progesterone receptor (PR) and HER2, together with clinicopathological features, are conventionally used for patient prognosis and management. IHC markers separate patients into four subgroups, Luminal A (ER+, PR+) , Luminal B (ER+, PR+, HER2/Ki67+) , HER2 (HER2+) and Triple-negative breast cancer
  • TNBCs account for 15-20%of newly diagnosed breast cancer cases, and are generally associated with a high risk of disease recurrence and poor patient survival (Foulkes et al., 2010; Lehmann et al., 2011) .
  • TNBC is a difficult and complex disease and its clinical outcome has been unsatisfactory, even when diagonosed at an early stage of the disease (Carey et al., 2010; Foulkes et al., 2010; Metzger-Filho et al., 2012) .
  • TNBCs are heterogeneous in terms of biology, prognosis and response to treatment (Adamo and Anders, 2011; Perou et al., 2000; Prat et al., 2010) .
  • the absence of well-defined molecular targets is a major challenge in treating patients with TNBC.
  • stratifying TNBCs into well-defined molecular subgroups and identifying molecular drivers on which to base targeted therapy is of utmost importance.
  • TNBC is similar in gene expression to normal stem cells in the mammary gland (Lim et al., 2009; Prat et al., 2010) .
  • MaSCs normal mammary stem cells
  • breast cancer stem cells remains elusive.
  • TNBCs derived from BRCA1-mutant carriers are originated from mammary luminal progenitors (Lim et al., 2009; Molyneux et al., 2010; Nolan et al., 2016; Proia et al., 2011; Sau et al., 2016) , thus implying that normal MaSCs are less relevant to CSCs in these cancers.
  • Procr is required for MaSCs during development and homeostasis
  • Procr flox/+ mice were bred to Procr flox/+ mice.
  • Procr CreER/flox mice developed normally and their mammary glands displayed no discernable phenotypes (data not shown) .
  • Tamoxifen (TAM) was administered in the control (Procr flox/+ ) and cKO pre-pubertal mice (2-week old) .
  • the phenotype resulted from Procr deletion was evaluated in adult (8-week old) .
  • the control mammary gland has completed the epithelium extension and occupied the whole fat pad ( Figure 1b) . Strikingly, in cKO mice, the growth of the epithelium was strongly retarded: the mammary gland had very few branches close to the nipple ( Figure 1b) .
  • MMTV-Wnt1 that preferentially induces tumor from stem/progenitor cells (Li et al., 2003) , and shares transcriptional patterns with human basal-like breast cancer and TNBC (Herschkowitz et al., 2007; Tsukamoto et al., 1988) , MMTV-PyVT tumor that is closely clustered to the luminal B subtype (Guy et al., 1992; Herschkowitz et al., 2007) , and MMTV-Cre; Brca1 f/+ ; p53 f/+ tumor associated with the human BRCA1 basal-like tumor (Herschkowitz et al., 2007; Xu et al., 1999) .
  • Procr + cells are distributed in a small portion of basal cells and some stromal cells ( Figure 9a-c) .
  • Procr + cells Lin - , CD24 + , CD29 hi , Procr +
  • Procr - cells Lin - , CD24 + , CD29 hi , Procr - ) were isolated from the tumors and xenografted to fat pads of recipients in limiting dilution.
  • Procr + cells For MMTV-Wnt1/FVB tumor grafting to FVB recipients, Procr + cells reconstituted tumors robustly, whereas in sharp contrast, Procr - cells failed to form tumors ( Figure 2a, Figure 9d) . Same results were observed when using Nude recipients ( Figure 9e-g) . These results suggest that Procr + cells are enriched for CSCs of MMTV-Wnt1 tumors. Of note, a previous study suggests that transplantation of a mixture of MMTV-Wnt1 basal and luminal cells, but not MMTV-Wnt1 basal cells alone (in mixed genetic background) , can reconstitute tumors in transplantation assays (Cleary et al., 2014) .
  • Procr is critical for MMTV-Wnt1 mammary tumor growth
  • PROCR is highly expressed in half of TNBC cases that are associated with poorer clinical outcome compared to PROCR-low TNBC patients
  • TNBC tissue microarrays
  • the frequency of PROCR-high cases was drastically lower (ranging from 2-7%) in non-cancerous and other subtypes of carcinomas ( Figure 2c-d) .
  • PROCR expression was reversely associated with ER status (P ⁇ 0.001) , PR status (P ⁇ 0.001) and HER2 status (P ⁇ 0.001) in breast cancers, but there was no other correlation between PROCR levels and other clinicopathological features (Table 1) .
  • PROCR protein C receptor
  • ER estrogen receptor
  • PR progesterone receptor
  • HER-2 human epidermal growth factor receptor 2
  • TNBC triple negative breast cancer
  • Luminal ER and/or PR positive
  • HER-2 Enrichment ER and PR negative, HER-2 positive
  • TNBC ER negative, PR negative, and HER-2 negative
  • PROCR-high was correlated with poorer disease-free survival (DFS) compared with PROCR-low by Kaplan-Meier analysis ( Figure 3e) .
  • DFS disease-free survival
  • Figure 3e In hormone-receptor positive subtype and HER2 + subtype, no significant association was found between PROCR levels and disease events ( Figure 3f-g) .
  • Kaplan-Meier Plotter further analysis of a large public clinical database of breast cancer (Kaplan-Meier Plotter) also supported that high level of PROCR expression correlates with a poorer clinical outcome in patients with hormone receptor-negative breast cancer ( Figure 11e) , whereas PROCR expression has no prognostic value in hormone receptor-positive patients (Figure 11f) .
  • PROCR protein C receptor
  • TNBC triple negative breast cancer
  • PROCR The expression of PROCR was also investigated in a panel of human breast cancer cell lines. qPCR analysis indicated that all ER + /PR + lines (T-47D, ZR75-1, MB415 and MCF-7) and HER2 + lines (SK-BR-3, MDA-MB-453 and BT474) tested exhibit relatively low PROCR expression.
  • a subset of TNBC lines MDA-MB-231, Hs578T, HCC38, CAL51 and HCC1806) highly expressed PROCR, whereas some TNBC lines (MDA-MB-468, BT549, MDA-MB-436, HCC1937, HCC1599 and HCC2157) exhibited low expression of PROCR (Figure 12a) . These results are in line with our observations in patient tissue samples (52%of TNBC cases are PROCR-high) , supporting the idea that PROCR expression stratifies TNBCs.
  • PROCR-high TNBC is a subset distinct from BRCA1 mutant carrier TNBC
  • PROCR protein C receptor
  • TNBC triple negative breast cancer
  • TNBC cell lines can be subdivided into basal-like and Claudin-low subsets (Prat et al., 2010) , or proliferation-related, mesenchymal-related and immune-related subsets (Lehmann et al., 2011) .
  • PROCR status did not appear to correlate with these stratifications ( Figure 12b) .
  • PROCR enriches CSCs in human PROCR + BC
  • PROCR + BC PROCR + BC
  • All cells in MDA-MB-231 express PROCR, making it not suitable for investigating CSCs (see discussion) .
  • PDXs patient-derived xenografts
  • IHC indicated negative expression of ER, PR and HER2, and robust expression of PROCR in all three PDX tumors we used ( Figure 4A, a, Figure 13a-c) .
  • PROCR + cells compose about 50%of total tumor cells in these PDXs ( Figure 4A, b, Figure 13, d-e) , representing a drastic increase of PROCR + cells compared to those (3%) in non-cancerous breast tissues.
  • Both PROCR + and PROCR - tumor cells were proliferative, but PROCR + tumor cells exhibited about 2-fold more G2/M phase cells (4N) ( Figure 4A, c) , EdU + cells and Ki67 + cells ( Figure 4A, d-e) .
  • TUNEL staining suggested no difference of apoptosis between these two populations ( Figure 4A, f) .
  • PROCR + and PROCR - cells were isolated from PDX tumors and engrafted to immunocompromised recipients in limiting dilution.
  • PROCR + cells can potently form tumors (1/64 CSC frequency) .
  • 30% (9 out of 30) of transplants formed tumors ( Figure 4A, g) .
  • PROCR - cells are proliferative, they displayed drastically lower tumor-initiating capacity (1/29475 CSC frequency) , suggesting that they are likely not the driver cells fueling tumor formation ( Figure 4A, g) .
  • PDXs tumor cells were infected with dCas9-KRAB and sgRNA (sg-PROCR) (Figure 5h) .
  • PROCR knockdown with sgRNA also drastically inhibited tumor formation in Xenograft experiments ( Figure 5i-j) .
  • the impact of PROCR attenuation was also investigated in cell lines.
  • knockdown of PROCR using two independent shRNAs significantly inhibited cell proliferation ( Figure 13f-g) .
  • sh-PROCR drastically delayed tumor formation of MDA-MB-231 cells and inhibited tumor growth, when compared with the scramble control ( Figure 13h) .
  • PROCR inhibitory nanobody suppress PROCR + BC growth
  • PROCR activates pSrc, subsequently activates IGF-1R and both MEK-ERK and PI3K-Akt-mTOR pathways; concomitantly PROCR activates RhoA-ROCK-p38 pathways via a surface effector F2R (JBC in revision, see supplementary manuscript) .
  • F2R surface effector F2R
  • the anti-tumor efficacy of the antibody was further investigated in vivo.
  • Mice bearing PROCR + BC PDX were treated with the antibody. The treatment was started soon after the engraftment (at day 5) , and the antibody was injected for a total of 5 times.
  • Similar inhibitory effects were observed in all three PDXs ( Figure 14d-e) .
  • the remaining tumors were further analyzed.
  • We found that the percentage of PROCR + cells post IgG treatment remains similar to their parental tumor (48.2%) , while the percentage of PROCR + cells was decreased to 22.1%post the antibody treatment, supporting that the nanobody directly targets PROCR + cells thus resulting in the growth inhibition (Figure 6h) .
  • nanobody is able to affect established PDX tumors.
  • the treatment began when tumors had developed to be about 200 mm 3 .
  • the nanobody or chemotherapeutic agents paclitaxel and doxorubicin; PTX/DOX
  • chemotherapeutic agents paclitaxel and doxorubicin; PTX/DOX
  • PTX/DOX doxorubicin
  • combination treatment completely inhibited the growth of the established tumors (32 fold inhibition) ( Figure 6i, black line) .
  • the remaining tumors were analyzed.
  • TNBC is viewed as a group of different diseases that have similar phenotype but different genotypes with varying prognoses and responses to chemotherapy.
  • Our study, as illustrated in Figure 7a, suggests a further stratification of TNBC based on PROCR expression, revealing a PROCR + BC subgroup, which constitutes about half of TNBC cases in the current study cohort, and is associated with poorer prognosis compared with PROCR-low TNBCs; furthermore, in PROCR + BCs, PROCR + cells are CSCs that can be targeted by PROCR-inhibitory nanobody.
  • the new stratification based on PROCR expression has a broad clinical implication.
  • PROCR can be measured by IHC, a routine practice in breast cancer diagnosis and treatment planning.
  • IHC intracranial pressure
  • PROCR expression marks cancer stem cells in TNBC has been eluded in previous studies using MDA-MB-231 (Hwang-Verslues et al., 2009; Schaffner et al., 2013) .
  • MDA-MB-231 as a tamed cell line that has ubiquitous PROCR expression is not suitable to investigate CSC population (JBC in revision, see supplementary manuscript) .
  • PROCR + cells are CSCs in PROCR + BC subtype, defined by the following functional assays for CSCs (Clarke et al., 2006; Kreso and Dick, 2014) .
  • PROCR is a druggable target on the surface of CSCs. Inhibition of PROCR by an inhibitory nanobody results in a concomitant blockade of MEK-ERK, PI3K-Akt-mTOR and RhoA-ROCK pathways and repression of EMT, rendering a high degree of tumor suppression.
  • PROCR inhibition has no effect on growth of PROCR-low TNBC (QNBC) or ER + /PR + tumor, highlighting that the identity of CSC and the costumed intervention are dependent on the BC subtype.
  • Procr expression marks mouse normal MaSCs that exhibit EMT characteristics (Wang et al., 2015) .
  • our data demonstrate that PROCR expression also marks EMT-featuring CSCs in human PROCR + BC.
  • PROCR + BC is a malignancy originated from normal MaSCs, and that after MaSCs acquire genetic alterations and become CSCs, the expression and molecular mechanism of PROCR are still coupled with these cells ( Figure 7b) .
  • Human breast tissue was obtained from Fudan University Shanghai Cancer Center, with approval from the Human Research Ethics Committee of Fudan University Shanghai Cancer Center. Fresh samples were histologically normal para-tumor breast tissue.
  • a total of 80 stage I to III primary breast cancer samples from females with invasive ductal carcinoma were randomly collected at the Department of Breast Surgery at the Fudan University Shanghai Cancer Center between August 2013 and March 2014.
  • the clinical pathologic diagnosis of breast cancer cases was determined by pathologists in the Department of Pathology.
  • ER, PR, and human epidermal growth factor receptor 2 (HER2) expression statuses were also determined by IHC staining.
  • HER2 expression status IHC, score ⁇ 2
  • FISH florescence in situ hybridization
  • the HER2 overexpression subgroup was defined as FISH positive or an IHC staining score ⁇ 3.
  • the breast cancer patients were classified into four molecular subtypes according to the ER, PR, and HER2 status, including luminal A subtype (ER+ and/or PR+, low Ki67) , luminal B subtype (ER+ and/or PR+, high Ki67 or HER2+) , HER2+ subtype (HER2+, ER-and PR-) , and triple-negative subtype (ER-, PR-, and HER2-) .
  • Total 80 breast cancer samples (20 for each of subtypes) were obtained to examine the PROCR protein level by immunohistochemical analysis using breast tumor whole-sections.
  • Tissue microarrays containing 450 pathologically proven breast cancer samples and 72 non-cancerous mammary controls to examine the PROCR expression level.
  • TMAs Tissue microarrays
  • the breast cancer patients in this cohort fulfilled the following inclusion criteria: (i) female patients diagnosed with stage I to III primary breast cancer; (ii) patients with unilateral invasive ductal carcinoma (IDC) ; ductal carcinomas in situ were excluded; (iii) patients without any evidence of metastasis at diagnosis; (iv) patients underwent a mastectomy and axillary lymph node dissection or breast conservation surgery followed by adjuvant chemotherapy; the therapeutic regimen decisions were based on the Chinese Anti-Cancer Association guidelines for the diagnosis and treatment of breast cancer.
  • IDC unilateral invasive ductal carcinoma
  • TMAs tissue microarrays
  • Tissue microarray Tissue microarray
  • TMAs were constructed using above 450 paraffin-embedded blocks of breast tumors and 72 blocks of non-cancerous mammary controls using a tissue micro arrayer (UNITMA Instruments, Seoul, Korea) .
  • the hematoxylin and eosin (HE) -stained slides from tumors were evaluated to identify representative tumor regions.
  • TMAs were composed of two 1.0-mm tissue cores from different areas of the same tumor to compare staining patterns. TMA sections were subsequently dewaxed in xylene and rehydrated in ethanol for IHC staining. PROCR staining was quantified in parallel by two experienced breast disease pathologists who were blinded to all clinical data.
  • DFS Disease-free survival
  • Procr flox was inserted upstream of exon 2, and an frt-flanked PGK-neo cassette followed by a second loxP site was inserted downstream of exon 4 of Procr gene.
  • Procr flox mice were breed with a germline Flpase strain to remove the frt-flanked neomycin selection cassette.
  • Procr CreERT2-IRES-tdTomato mouse was describe in a previous study (Wang et al., 2015) .
  • mice received intraperitoneal injection of 4 mg/25g body weight of Tamoxifen (TAM, Sigma-Aldrich) diluted in sunflower oil every other day for a total of three times.
  • TAM Tamoxifen
  • MMTV-Wnt1, MMTV-PyVT, MMTV-Cre, Brca1 f/+ , p53 f/+ , Nude, and SCID/Beige mice strains were used. Experimental procedures were approved by Animal Care and Use Committee of Shanghai Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences.
  • ATCC American Type Culture Collection
  • Antibodies used in immunohistochemistry Mouse anti human PROCR (1: 300, Abcam) , rabbit anti human K14 (1: 100, Thermo) , mouse anti ER (1: 50, DAKO) , mouse anti PR (1: 50 DAKO) , rabbit anti HER2 (1: 50, Proteintech) .
  • Antibodies used in Western blotting Rabbit anti human PROCR (1: 200, Novus) , rabbit anti human phospho-Src (1: 1000, Cell Signaling Technology) , rabbit anti human total Src (1: 1000, Cell Signaling Technology) , rabbit anti human phosphor-MEK (1: 1000, Cell Signaling Technology) , mouse anti human total MEK (1: 1000, Cell Signaling Technology) , rabbit anti human phosphor-ERK (1: 1000, Cell Signaling Technology) , rabbit anti human total ERK (1: 100, Santa Cruz) , rabbit anti human phosphor-Raf (1: 100, Santa Cruz) , rabbit anti human total Raf (1: 100, Santa Cruz) , rabbit anti human phosphor-Akt (1: 1000, Cell Signaling Technology) , rabbit anti human total Akt (1: 1000, Cell Signaling Technology) , rabbit anti human total Akt (1: 1000, Cell Signaling Technology) , rabbit anti human total Akt (1: 1000, Cell Signaling Technology) , rabbit anti human total Akt (1: 1000, Cell Signaling Technology)
  • the Human Phospho-Kinase Array (R&D system, ARY003B) was performed as the procedure attached in the Kit. 10 6 of MDA-MB-231 cells were used.
  • the Human Phospho-RTK Array (R&D system, ARY001B) was performed as the procedure attached in the Kit. 10 6 of freshly isolated PROCR + and PROCR - cells from PDX tumors were used. Protein samples are normalized by Tubulin level through western blotting before using in array analysis.
  • the minced primary tumor or mammary tissue was placed in culture medium (RPMI 1640 with 25 mM HEPES, 5%fetal bovine serum, 1%PSQ (Penicillin-Streptomycin-Glutamine) , 300U ml-1 Collagenase III [Worthington] ) and digested for up to 3 hrs at 37°C. After lysis of the red blood cells in NH4Cl, a single-cell suspension was obtained by sequential incubation with 0.25%trypsin-EDTA at 37°C for 5 min and 0.1 mg/ml DNase I (Sigma) for 5 mins with gentle pipetting, followed by filtration through 70 um cell strainers.
  • culture medium RPMI 1640 with 25 mM HEPES, 5%fetal bovine serum, 1%PSQ (Penicillin-Streptomycin-Glutamine) , 300U ml-1 Collagenase III [Worthington]
  • a single-cell suspension was obtained by sequential incubation with 0.2
  • the following antibodies in 1 200 dilutions were used: PE/cy7-anti-human EpCam, APC-anti human CD49f, Biotin-anti human CD49f, FITC-anti human CD31, FITC-anti human CD45, FITC-anti human CD235a (Biolegend) , APC-anti human PROCR (eBioscience) , Streptavidin-V450 (BD PharMingen) .
  • Antibody incubation was performed on ice for 20 min in HBSS with 10%fetal bovine serum. For DNA content analysis, Hoechst (1ug/ml) was used. All sortings were performed using a FCASJazz (Becton Dickinson) . The purity of sorted population was routinely checked and ensured to be more than 95%.
  • Tissue paraffin or frozen sections were incubated with primary antibodies at 4°C overnight, followed by washes, incubation with secondary antibodies for 2 hrs at 25°C, and counterstaining with DAPI (Sigma) .
  • DAPI Sigma
  • Immunohistochemistry for PROCR was performed using anti-PROCR antibody (1: 300, Abcam) and Goat Anti-mouse HRP (1: 1000, Santa Cruz) as secondary antibody followed by color development (DAKO) before counterstaining with hematoxylin.
  • Expression constructs for sPROCR (1-214 aa, extracellular domain) and Protein C (1-252 aa, a truncation of the kinase domain) were made using pCMV-Fc vector (Addgene) .
  • Lentiviral expression constructs for hPROCR overexpression were made using pHIV-zsgreen vectors carrying FLAG tag at the N terminus (Addgene) .
  • shRNAs targeting hPROCR sequences were constructed in lentivirus-based pLKO. 1-EGFP constructs (Addgene) .
  • the efficiency of individual shRNA was validated by Western blotting or qPCR.
  • the sequences for hPROCR-shRNA-1 and hPROCR-shRNA-3 were
  • sh-PROCR represents hPROCR-shRNA-1.
  • dCas9-VP64 and dCas9-KRAB plasmids for the activation or suppression are from Addgene.
  • the sgRNAs targeting hPROCR genome sequence were constructed in lentivirus-based plasmid (MP177 from Addgene) .
  • the efficiency of individual sgRNA was validated by Western blotting. Sequence for hPROCR activation: TCCTGCCGGCGCTGACTCAG (SEQ ID NO: 25) Sequence for hPROCR suppression: CAGACTCCGCCCCTCCCAGA (SEQ ID NO: 26)
  • Purified Protein C (100ul, 0.2ug/ml) was pre-coated to the bottom of a 96-well plate at 4°Covernight. The wells were washed with PBS containing 0.5%Tween-20 and blocked with 1%BSA. A mixture of purified sPROCR (100ul, 3ug/ml) and the competing antibody or control antibody (in limiting dilution) were added into the wells and incubated for 2 h at 37C. The bound sPROCR was detected after subsequent incubation with a biotin conjugated PROCR primary antibody (R&D Systems) for 1.5 hours and Streptavidin-HRP secondary antibody (R&D Systems) for 30 minutes. After HRP color detection, the absorbance was determined with a microplate reader at 450 nm. All tests were performed in triplicate.
  • MDA-MB-231 or BT549 cells infected with scramble or PROCR shRNA were plated at similar cell number and passaged every 2 days. During each passage, cell numbers are counted.
  • control non-neutralizing or neutralizing antibodies 200ug/ml were added every 24hrs.
  • 4X10 4 of EpCAM + epithelial cells were plated in complete growth medium, cell numbers were quantified every day.
  • PROCR + and PROCR - cells were FACS isolated and cultured in 2D overnight in complete growth medium. Cells are then incubated with EdU for 1h. After 15min fixation with PFA, the EdU color development is performed following manufacturer’s protocol (Life Technology, C10339) .
  • MDA-MB-231 cells were plated at a low density (5 ⁇ 10 4 ) onto coverslips in 12-well plate and cultured with antibodies in complete culture medium. After 16hrs, cells were incubated with EdU for 1h, followed by PBS washes and fixation with 4%PFA for 10min. the EdU/TUNEL color development is performed following manufacturer’s protocol (EdU: Life Technology, C10339, TUNEL: Roche, 12156792910) .
  • Sorted cells were resuspended in 50%Matrigel, PBS with 20%FBS, and 0.04%Trypan Blue (Sigma) , and injected in 10-20 ul volumes into the fat pads of 8-week-old Nude.
  • MDA-MB-231, MCF-7 and PDXs were virally infected by scramble or sh-PROCR.
  • PDX lines were originally initiated by implantation of a fresh patient tumor fragment into the mammary fat pad of recipient SCID/Beige mice and were maintained by serial passage in vivo at intervals characteristic for each line, and in accordance with Institutional Animal Care and Use Committee requirements.
  • the naive llama (camelid) sdAb phagemid library (Genscript) was used for selection of PROCR-specific single domain antibodies.
  • Fc–PROCR extracellular domain (ECD) (1-214aa) protein produced in HEK293T cells was used as target antigen for several rounds of selection to enrich the specific sdAb binders.
  • the plasmids were isolated from the output of phage display and constructed into a vector containing human IgG1 for soluble sdAb screening. Soluble sdAb clones were screened by ELISA using Fc–sPROCR, and their binding to PROCR was further verified by FACS analysis using HEK293 cells stably expressing PROCR full length. The inhibitory activity of the antibody was further examined by competitive Elisa as described above. Clone GS-5 was used in all the in vitro cell culture and in vivo studies.
  • ALDH1 is a marker of normal and malignant human mammary stem cells and a predictor of poor clinical outcome.
  • BRCA1 basal-like breast cancers originate from luminal epithelial progenitors and not from basal stem cells.
  • int-1 gene is associated with mammary gland hyperplasia and adenocarcinomas in male and female mice.
  • PROCR Protein C receptor
  • PROCR Protein C receptor
  • PROCR is a single-pass transmembrane receptor, and is best known for its expression on vascular cells and its anti-coagulation activity (11) .
  • PROCR activates its ligand, a protease precursor protein C (PC) , to become activated PC (aPC) , which is then dissociated from PROCR and exerts anti-coagulation effect directly via inactivation of FVa and FVIIIa (reviewed in (12, 13) ) .
  • PC protease precursor protein C
  • PROCR activates intracellular signaling, resulting in cytoprotective effects in endothelial cells, monocyte, keratinocyte, and intestinal epithelial cells (14-18) . It is widely accepted that the central event of PROCR intracellular signaling is the activation of a G protein-coupled receptor (GPCR) , F2R (also called protease-activated receptor-1, PAR-1) (19) .
  • GPCR G protein-coupled receptor
  • F2R also called protease-activated receptor-1, PAR-1 (19)
  • aPC uses PROCR as a co-receptor for the cleavage of F2R, enabling F2R to activate downstream signaling events (reviewed in (12, 13) ) .
  • the PROCR-F2R axis has been shown to increase endothelial cell barrier function, survival, proliferation or migration through activation of the mitogen activated protein kinase (MAPK) , phosphatidylinositol-3 kinase (PI3K) , or endothelial nitric oxide synthase (eNOS) pathways or through inhibition of p53 (20-23) .
  • MAPK mitogen activated protein kinase
  • PI3K phosphatidylinositol-3 kinase
  • eNOS endothelial nitric oxide synthase
  • aPC-PROCR-F2R can stimulate the MAPK pathway via activation of epidermal growth factor receptor (EGFR) (17, 24, 25) .
  • EGFR epidermal growth factor receptor
  • PROCR activates ERK, PI3K-Akt-mTOR and RhoA-ROCK pathways in TNBC cells
  • PROCR is differentially expressed in breast cancer cell lines. Overall, PROCR expression was relatively lower in ER+/PR+ (estrogen receptor, Progesterone receptor) and HER2+ cells, and higher in triple negative breast cancer (TNBC) ( Figure 12a) . Within TNBC, MDA-MB-231, Hs578T, HCC38, CAL51, HCC1806 cells exhibited higher PROCR expression level compared to other lines (MDA-MB-468, BT549, MDA-MB-436, HCC1937, HCC1599, HCC2157) , ER+/PR+ lines and HER+ lines ( Figure 12a) .
  • TNBC triple negative breast cancer
  • PROCR silencing with shRNA led to inhibition of the phosphorylation of several kinases, including p38 ⁇ (T180Y182) , ERK (T202Y204, T221Y223) , Src (Y419) , Ampka1 (T183) , CREB (S133) , S6K (T389) and Wnk1 (T60) ( Figure 16a) .
  • PROCR + and PROCR - cells Upon proper isolation of PROCR + and PROCR - cells, the signaling activities of the three pathways (ERK, PI3K-Akt and RhoA) were examined. Western analyses showed that PROCR + tumor cells exhibit markedly more robust signaling activities in all three pathways compared to PROCR - tumor cells ( Figure 17d) . PROCR + cells also had distinctly higher expression of c-Myc and Cyclin D1 compared to PROCR - cells ( Figure 17d) . These data reinforce that ERK, PI3K-Akt-mTOR and RhoA-ROCK-p38 signaling cascades are intracellular effectors of PROCR in breast cancer cells.
  • PROCR activates RhoA-ROCK-p38 signaling via F2R
  • RhoA-ROCK-p38 signaling induced by PROCR is dependent on F2R, while ERK and PI3K-Akt-mTOR activation is dependent on other surface effectors, not F2R.
  • PROCR engages IGF-1R for the activation of ERK and PI3K-Akt-mTOR pathways
  • RTKs receptor tyrosine kinases
  • Protein C serves as the ligand for the activation of PROCR intracellular signaling in breast cancer cells
  • sPROCR soluble PROCR, extracellular domain of PROCR
  • sPROCR soluble PROCR, extracellular domain of PROCR
  • Addition of sPROCR in MDA-MB-231 culture resulted in decreased proliferation, accompanied with cell shape changes: the spindle-shaped morphology of MDA-MB-231 was altered to become more spherical ( Figure 21a) .
  • Similar effects on cell proliferation and morphology were observed when PROCR is knockdown by shRNA (data not shown) .
  • Protein C (PROC) , a coagulation proteases, is a well established ligand in endothelial cells for anti-coagulation, anti-inflammation and cytoprotective activities of PROCR (14, 15, 19, 31-33) .
  • PROC-DN protease dead form of PROC
  • Addition of PROC-DN led to decreased proliferation and similar morphological changes in MDA-MB-231 cells ( Figure 21b) .
  • the activities of the three intracellular signaling of PROCR were blocked in the presence of PROC-DN ( Figure 21c) .
  • addition of active PROC aPC
  • enhanced the three PROCR-dependent intracellular signaling ( Figure 21d) .
  • PROCR has been implicated in tumor progression and is an important surface marker for normal stem cells in several tissues. However, the signaling mechanism of PROCR had remained elusive. In the present study, we investigated PROCR signaling mechanism in breast cancer cells. We revealed that PROCR induces the activation of ERK and PI3K-Akt-mTOR signaling through transactivation of IGF-1R by Src; concomitantly stimulates RhoA-ROCK-p38 signaling through F2R (illustrated in Figure 22e) . These findings were further validated in PROCR + cells and PROCR - cells isolated from PDX tumors. We also confirmed that PROC is the ligand of PROCR in breast cancer cells.
  • PROCR promotes the activities of ERK, PI3K-Akt-mTOR and RhoA pathways, and leads to accumulation of c-Myc and Cyclin D1, which are key signaling events in breast cancer (26)
  • Previous studies in normal mammary gland and in breast cancer cells have suggested that PROCR + cells have increased epithelial and mesenchymal transition (EMT) characteristics (1, 35) .
  • EMT epithelial and mesenchymal transition
  • observations on the cell shape changes upon modulation of PROCR expression may also due to alteration of EMT program.
  • EMT could be another channel through which PROCR signaling promotes tumor progression.
  • the effective RTK, IGF-1R was identified in a screen using phospho antibody array.
  • the MCF7, SK-BR-3, MDA-MB-231, Hs578T, T-47D, ZR-75-1, MDA-MB-415, MDA-MB-453, BT474, MDA-MB-436, BT549, HCC38, CAL51, HCC1806, MDA-MB-468, HCC1937, HCC1599 and HCC2157 human breast cancer cell lines were obtained from the Shanghai Cell Bank Type Culture Collection Committee or American Type Culture Collection (ATCC) and maintained in complete growth medium as recommended by the distributor.
  • ATCC American Type Culture Collection
  • PDX lines were originally initiated by implantation of a fresh patient tumor fragment into the mammary fat pad of recipient SCID/Beige mice and were maintained by serial passage in vivo at intervals characteristic for each line, and in accordance with Institutional Animal Care and Use Committee requirements. This study was approved by the institutional review board (IRB) of Fudan University Shanghai Cancer Center (FDSCC) .
  • Antibodies used in immunohistochemistry Mouse anti human PROCR (1: 300, Abcam) , mouse anti ER (1: 50, DAKO) , mouse anti PR (1: 50 DAKO) , rabbit anti HER2 (1: 50, Proteintech) , Antibodies used in Western blotting: Rabbit anti human PROCR (1: 200, Novus) , rabbit anti human phospho-Src (1: 1000, Cell Signaling Technology) , rabbit anti human total Src (1: 1000, Cell Signaling Technology) , rabbit anti human phospho-MEK (1: 1000, Cell Signaling Technology) , mouse anti human total MEK (1: 1000, Cell Signaling Technology) , rabbit anti human phospho-ERK (1: 1000, Cell Signaling Technology) , rabbit anti human total ERK (1: 100, Santa Cruz) , rabbit anti human phospho-Raf (1: 100, Santa Cruz) , rabbit anti human total Raf (1: 100, Santa Cruz) , rabbit anti human phospho-Akt (1: 1000, Cell Signaling Technology) , rabbit anti human total Akt
  • Antibodies for FACS were used in 1: 200 dilutions: PE/cy7-anti-human EpCam, FITC-anti human CD31, FITC-anti human CD45, FITC-anti human CD235a (Biolegend) , APC-anti human PROCR (eBioscience) , PE-anti human PROCR (BD Pharmingen) .
  • the Human Phospho-Kinase Array (R&D system, ARY003B) was performed as the procedure attached in the kit. 10 6 of MDA-MB-231 cells were used. The Human Phospho-RTK Array (R&D system, ARY001B) was performed as the procedure attached in the kit. 10 6 of freshly isolated PROCR + and PROCR - cells from PDX tumors were used. Protein samples are normalized by Tubulin level through western blotting before using in array analysis.
  • the minced primary tumor was placed in culture medium (RPMI 1640 with 25 mM HEPES, 5%fetal bovine serum, 1%PSQ (Penicillin-Streptomycin-Glutamine) , 300U ml -1 Collagenase III [Worthington] ) and digested for up to 3 hrs at 37°C. After lysis of the red blood cells in NH4Cl, a single-cell suspension was obtained by sequential incubation with 0.25%trypsin-EDTA at 37°C for 5 min and 0.1 mg/ml DNase I (Sigma) for 5 mins with gentle pipetting, followed by filtration through 70 um cell strainers.
  • culture medium RPMI 1640 with 25 mM HEPES, 5%fetal bovine serum, 1%PSQ (Penicillin-Streptomycin-Glutamine) , 300U ml -1 Collagenase III [Worthington]
  • a single-cell suspension was obtained by sequential incubation with 0.25%tryp
  • Antibody incubation was performed on ice for 20 min in HBSS with 10%fetal bovine serum. All sortings were performed using a FCASJazz (Becton Dickinson) . The purity of sorted population was routinely checked and ensured to be more than 95%.
  • the efficacies of two PROCR antibodies, clone RCR-252 (PE-conjugated, BD Pharmingen, cat. #557950) and clone RCR-227 (APC-conjugated, eBioscience, cat. #17-2018-42) were compared using both MDA-MB-231 cells and TNBC breast cancer PDX tumor cells.
  • RCR-252 antibody detected a small portion (18.1%) of PROCR + cells by FACS (Fig. 18a) .
  • the isolated cells displayed no differential expression of PROCR by qPCR analysis (Fig. 18b) , suggesting an inaccurate separation of PROCR + and PROCR - cells using this antibody.
  • FACS analysis using RCR-227 showed that almost all MDA-MB-231 cells (98.3%) are PROCR + (Fig. 18a) , suggesting RCR-227 is a more potent antibody in this assay compared to RCR-252.
  • the comparison of the two antibodies was further carried out using freshly dissociated cells from PROCR-high TNBC PDX.
  • RCR-252 was ineffective in recognizing PROCR + cells by FACS, whereas FCAS analysis using RCR-227 established that 48.7%of the PDX cells are PROCR + (Fig. 18c) .
  • Western analysis of PROCR protein levels confirmed the correct isolation using RCR-227 ( Figure 17c) .
  • Experiments in both MDA-MB-231 cells and PDX tumor cells indicated the effectiveness of clone RCR-227, and the inefficacy of clone RCR-252 for FACS analysis.
  • Tissue paraffin sections were incubated with primary antibodies at 4°C overnight using anti-PROCR antibody (1: 300, Abcam) and Goat Anti-mouse HRP (1: 1000, Santa Cruz) as secondary antibody for 2 hrs at 25°C followed by color development (DAKO) before counterstaining with hematoxylin.
  • anti-PROCR antibody 1: 300, Abcam
  • Goat Anti-mouse HRP 1: 1000, Santa Cruz
  • shRNAs targeting PROCR sequences were constructed in lentivirus-based pLKO. 1-EGFP constructs (Addgene) .
  • the efficiency of individual shRNA was validated by Western blotting or qPCR.
  • the shRNA sequences were as following:
  • PROCR GCAGCAGCTCAATGCCTACAA (SEQ ID NO: 27)
  • F2R CCCGGTCATTTCTTCTCAGGA (SEQ ID NO: 28)
  • IGF-1R GCGGTGTCCAATAACTACATT (SEQ ID NO: 29)
  • EGFR CGCAAAGTGTGTAACGGAATA (SEQ ID NO: 30)
  • the dCas9-VP64 plasmid was from Addgene.
  • the sgRNAs targeting PROCR genome sequence were constructed in lentivirus-based plasmid (MP177 from Addgene) .
  • the efficiency of individual sgRNA was validated by Western blotting.
  • sgRNAs sequence for PROCR activation TCCTGCCGGCGCTGACTCAG (SEQ ID NO: 31)
  • MDA-MB-231 cells infected with scramble or PROCR shRNA or BT-549 cells infected with control or PROCR sgRNA were plated at a low density (5 ⁇ 10 4 ) onto coverslips in 12-well plate using complete culture medium. After 12 hrs when cells are adhered to the coverslip, the plates are washed with PBS followed by fixation with 4%PFA for 10min. Cells on coverslips are stained with Vimentin and DAPI counterstain. To examine the effect of various protein on MDA-MB-231 cell morphology, purified sPROCR (6ug/ml) or Protein C-kinase dead (2ug/ml) were used when cells are plated.
  • Antigen hPROCR-extra cellular domain is a 25KD soluble protein fused with human Fc protein. This project focused on discovery and development of anti-h-ED antibody using phage display platform. This report is divided into two parts: Antibodies panning and Screening and future working plan for cloning of antibody expression: It also recorded related activities and results through whole project procedure in current stage and detail plan for next step. For panning and screening procedure, total 118 phage hits were discovered from panning phage libraries (HDB323, HDB169) using two panning formats: solution and immunotube formats. The antigen binding specificity of phage hits were confirmed by sequence analysis and single point ELISA (SPE) .
  • SPE single point ELISA
  • Fab genes were amplified from antigen positive phages and sequenced. VL and VH sequences were analyzed to sort out 41 unique hits for diversity determination. SPE showed that all phage hit have different specific binding toward antigen h-ED. Those candidates were converted into antibody expression vectors, and their binding to PROCR was further verified by SPE and FACS analysis using HEK293 cells stably expressing PROCR full length. The inhibitory activity of the antibody was further examined by competitive Elisa, in vitro cell based assays and in vivo tumor formation assays.
  • Two Fab Phage display libraries (HDB323 and HDB169) were panned against antigen h-ED separately using either Streptavidin-Magnetic beads solution or immunotube panning format protocol. Three rounds of panning were carried out. After three rounds of panning, proximately 20,000 output-3 (O3) phages were screened for binding to biotin-labeled antigens by filter lift assay (Fig. 23) . Positive hits were then verified by DNA sequencing and phage Single Point ELISA (SPE) (Fig. 24) . VL and VH gene sequences of all hits were checked for quality control before delivered.
  • SPE DNA sequencing and phage Single Point ELISA
  • Table1 two libraries (HDB323 and HDB169) were panned separately against 100 nM (1 st round) , 100 nM (2 nd round) , 50 nM (3 rd round) of h-ED as described in the method section. Output phage titer and Fab positive ratios were obtained after each round of panning.
  • Table 2 two libraries (HDB323 and HDB169) were panned separately against 100 nM (1 st round) , 100 nM (2 nd round) , 50 nM (3 rd round) of h-ED as described in the method section. Output phage titer and Fab positive ratios were obtained after each round of panning. (Notebook HDBA01007, P1-25, Expt. 1-6)
  • VL and VH gene sequences of selected hits will be amplified by PCR, and cloned into antibody expression vectors pFUSE2ss-CLIg-hk (light chain) and pFUSEss-CHIg-hG1 (heavy chain) and then sequenced.
  • the binding of the antibody to PROCR was further verified by SPE and FACS analysis using HEK293 cells stably expressing PROCR full length (data not shown) .
  • the inhibitory activity of the antibody was further examined by competitive Elisa.
  • Purified Protein C 100ul, 0.2ug/ml
  • the wells were washed with PBS containing 0.5%Tween-20 and blocked with 1%BSA.
  • a mixture of purified sPROCR (100ul, 3ug/ml) and the competing antibody or control antibody (in limiting dilution) were added into the wells and incubated for 2 h at 37C.
  • the bound sPROCR was detected after subsequent incubation with a biotin conjugated PROCR primary antibody (R&D Systems) for 1.5 hours and Streptavidin-HRP secondary antibody (R&D Systems) for 30 minutes.
  • Taq DNA Polymerase TaKaRa, Cat No. R001;
  • Endo-Free Plasmid Mini Kit II Omega Bio-Tek, Cat No. D6950;
  • the input-1 library phages (5x10e12 pfu in 1ml of 0.5%casein) were first incubated in casein-blocked 100 ⁇ L streptavdin-Magnetic beads for 15 min to deplete streptavdin beads binders.
  • the depleted library was then incubated with bio-Fc-control, for 2h rolling up and down, followed by incubation with 100 ⁇ L casein blocked streptavdin-Magnetic beads for 15 min.
  • the depleted library was then incubated with bio-hIgG1-Fc, for 2h rolling up and down, followed by incubation with 100 ⁇ L casein blocked streptavdin-Magnetic beads for 15 min.
  • the depleted library was then incubated with bio-h-ED, for 2h rolling up and down, followed by incubation with 100 ⁇ L casein blocked streptavdin-Magnetic beads for 15 min. Unbound phages were removed by washing with PBSt for 10/15 times. The bound phages were eluted with 400 ⁇ L of freshly prepared 100 mM Triethylamine and neutralized by addition of 200 ⁇ L of 1M Tris-HCl, pH 6.4. The Output-1 phage was kept on ice all the time. Percentage of Fab positive clones in each input and output phage pools was monitored by filter lift assay.
  • Immunotube was coated with 1 ml antigen at 4°C overnight.
  • the input-1 library phages (5x10e12 pfu in 1ml of 1%BSA) were first incubated in casein-coated immunotube for 2h.
  • the depleted library was then incubated in Fc-control -coated immunotube for 2h rolling up and down.
  • the depleted library was then incubated in hIgG1-Fc-coated immunotube for 2h rolling up and down.
  • the depleted library was then incubated in h-ED immunotube for 2h rolling up and down. Unbound phages were removed by washing with PBSt for 5-20 times.
  • the bound phages were eluted with 1 ml of freshly prepared 100 mM Triethylamine and neutralized by addition of 0.5 ml of 1M Tris-HCl, pH 6.4.
  • the Output-1 phage was kept on ice all the time. Percentage of Fab positive clones in each input and output phage pools was monitored by filter lift assay.
  • h-ED were biotinylated using EZ-link sulfo-NHS-LC-biotin (Thermo) biotinylation kits. O3 phage was diluted and plated out (500-5000 pfu per plate) to grow at 37°C for 8h and captured by anti-kappa antibody-coated filter overnight at 22°C. Biotinylated h-ED (50 nM) and NeutrAvidin-AP conjugate (1: 1000 dilution) were applied to the filter to detect antigen binding anti-h-ED phages.
  • phage plaques were picked and eluted into 100 ⁇ l of phage elution buffer. About 10-15 ⁇ l eluted phages were used to infect 1 ml XL1 blue cells to make high titer phage (HT) for further analysis.
  • HT high titer phage
  • Fab genes were amplified from antigen positive phages by PCR using primers 19939 and 530 and sequenced with primers 355 and 530 at Genewiz Biotech Co. (Shanghai) . VL and VH sequences were analyzed to sort out unique hits and to determine the hit diversity.
  • 96 well Greiner plate was coated with antigen at 4°C overnight and blocked with 1%casein.
  • HT phages of antigen positive clones were first blocked with 0.1%BSA for 1 hour and then incubated in the antigen plate for 2 hours. The plate was washed with PBSt between incubations. Antigen bound phages were detected by anti-M13-HRP (1: 5000 dilutions in 1%casein) .
  • Fab genes will be amplified from antigen positive phages (from part I) by PCR with cloning primers, showing in the table below. VL and VH gene sequences of one phage hit will be cloned into expression vectors pFUSE2ss-CLIg-hk and pFUSEss-CHIg-hG1 using amplification conditions as the table below.
  • Step 1 94°C for 2 min
  • Step 2 94°C for 30 sec
  • Step 3 (Annealing temp. ) for 30 sec
  • Step 4 72°C for 48 sec Step 5 Goto Step 2, repeat for additional 24 cycles
  • Step 6 72°C for 5 min
  • Step 7 10°C forever
  • Fab genes will be amplified from antigen positive phages by PCR and sequenced with primers PZH-2-SEP-ZH-BL-FW at Genewiz Biotech Co. (Shanghai) . VL and VH sequences were analyzed with sequence of original unique hits.

Abstract

Provided herein are methods for diagnosing and/or treating a new subtype of triple negative breast cancers (TNBC), as well as compositions and kits that can be used in such methods.

Description

METHODS AND COMPOSITIONS FOR TNBC STRATIFICATION AND TREATMENT FIELD
Provided herein are methods for determining and/or treating a specific subtype of breast cancer, in particular triple-negative breast cancer, as well as compositions and kits that can be used in such methods.
BACKGROUND
In women, breast cancer is among the most common cancers and is the fifth most common cause of cancer deaths. Due to the heterogeneity of breast cancers, 10-year progression free survival can vary widely with stage and type, from 98%to 10%. Different forms of breast cancers can have remarkably different biological characteristics and clinical behavior. Thus, classification of a patient's breast cancer has become a critical component for determining a treatment regimen. For example, along with classification of histological type and grade, breast cancers now are routinely evaluated for expression of hormone receptors (estrogen receptor (ER) and progesterone receptor (PR) ) and for expression of HER2 (ErbB2) , since a number of treatment modalities are currently available that target hormone receptors or the HER2 receptor. ER and PR are both nuclear receptors (they are predominantly located at cell nuclei, although they can also be found at the cell membrane) and small molecular inhibitors that target ER and/or PR have been developed. HER2, or human epidermal growth factor receptor type 2, is a receptor normally located on the cell surface and antibodies that target HER2 have been developed as therapeutics. HER2 is the only member of the EGFR family (which also includes HER1 (EGFR) , HER3 (ErbB3) and HER4 (ErbB4) that is not capable of binding to an activating ligand on its own. Thus HER2 is only functional as a receptor when incorporated into a heterodimeric receptor complex with another EGFR family member, such as HER3. Cancers classified as expressing the estrogen receptor (estrogen receptor positive, or ER+ tumors) may be treated with an ER antagonist such as tamoxifen. Similarly, breast cancers classified as expressing high levels the HER2 receptor may be treated with an anti-HER2 antibody, such as trastuzumab, or with a HER2-active receptor tyrosine kinase inhibitor such as lapatinib.
Triple negative breast cancer (TNBC) is a term used to designate a well-defined clinically relevant subtype of breast carcinomas that account for approximately 15%of all breast cancer cases. TN tumors score negative (i.e., using conventional histopathology methods and criteria) for expression of ER and PR and do not express amplified levels of HER2 (i.e., they are ER-, PR-, HER2-) . TNBC comprises primarily, but not exclusively, a molecularly and histopathologically distinct subtype of breast cancer known as the basal-like (BL) subtype. The BL subtype also is  characterized by the expression of cytokeratins (e.g., CK, CK5/6, CK14, CK17) and other proteins found in normal basal/myoepithelial cells of the breast. However, in addition to the BL subtype, certain other types of breast cancers, including some “normal breast-like” , metaplastic carcinomas, medullary carcinomas and salivary gland-like tumors can also exhibit the triple negative (TN) phenotype. Furthermore, TNBC occurs more frequently in the presence of BRCA1 mutations and in pre-menopausal females of African-American or Hispanic descent. TN tumors typically display very aggressive behavior, with shorter post-relapse survival and poor overall survival rates relative to other breast cancer types.
Given the lack of expression of hormone receptors or of significant amounts of HER2 in TNBC cells, treatment options have been very limited as the tumors are not responsive to treatments that target ER (e.g., tamoxifen, aromatase inhibitors) or HER2 (e.g., trastuzumab) . Instead these tumors are treated with conventional neoadjuvant and adjuvant chemotherapy regimens, which have limited efficacy and many cytotoxic side effects. Furthermore, such chemotherapy regimens can lead to drug resistance in tumors, and the risk of recurrence of disease in TNBC is higher within the first three years of treatment than for other types of breast cancers.
A summary of currently available targeted treatments for the 4 types of breast cancers is shown below. Clearly, there is a major need to better understand the molecular basis, in particular specific biomarkers and therapeutic targets, of TNBC and to develop effective treatments for this aggressive type of breast cancer.
Figure PCTCN2017115198-appb-000001
SUMMARY
Provided herein are methods for determining, diagnosing and/or treating a specific subtype of triple-negative breast cancers (e.g., tumors) , as well as pharmaceutical compositions that can be used in such methods. The methods and compositions are based, at least in part, on the surprising discovery that PROCR levels are upregulated in, and correlated with, about 50%of all TNBCs,  which are referred herein as “PROCR+ TNBC” or “PROCR-high TNBC” . Correspondingly, PROCR-negative or PROCR-low TNBCs are referred to as “Quadruple Negative Breast Cancer” or “QNBC. ” Also disclosed herein are PROCR-antagonizing or neutralizing antibodies that inhibit or suppress PROCR activity (e.g., PROC binding) as well as suppress the growth of PROCR+ TNBC cells. Thus, the anti-PROCR antibodies disclosed herein, or antigen-binding fragment thereof, can be used for the diagnosis and/or treatment of PROCR+ TNBC.
In one aspect, provided herein is protein C receptor (PROCR) for use in the diagnosis and/or treatment of PROCR-high triple negative breast cancer (TNBC) , wherein an H-score of at least 120 in an immunohistochemistry assay for detecting PROCR expression level indicates the presence of PROCR-high TNBC. Polyclonal and monoclonal antibodies for immunohistochemistry can be generated using conventional methods known in the art. The antibody can be directly or indirectly labeled to facilitate detection in accordance with methods known in the art. In some embodiments, the immunohistochemistry assay uses an anti-PROCR antibody or antigen-binding fragment thereof. For example, the anti-PROCR antibody can be selected from the group consisting of: (i) any one of SEQ ID NOS: 1-3 and 11-22, or antigen-binding fragment thereof; (ii) an antibody or antigen binding fragment thereof wherein the antibody cross-competes for binding to PROCR with (i) ; (iii) an antibody having CDR1, CDR2 and CDR3 selected from the CDRs of SEQ ID NOS: 1-3 and 11-22; and (iv) an antibody or antigen binding fragment thereof wherein the antibody cross-competes for binding to PROCR with (iii) .
Also provided herein is an anti-PROCR antibody, or antigen binding fragment thereof, for use in the diagnosis and/or treatment of PROCR-high TNBC, wherein when the anti-PROCR antibody or antigen-binding fragment thereof is used in an immunohistochemistry assay to detect expression level of PROCR, an H-score of at least 120 indicates the presence of PROCR-high TNBC. The antibody can be selected from the group consisting of: (i) any one of SEQ ID NOS: 1-3 and 11-22, or antigen-binding fragment thereof; (ii) an antibody or antigen binding fragment thereof wherein the antibody cross-competes for binding to PROCR with (i) ; (iii) an antibody having CDR1 selected from the group consisting of SEQ ID NOS: 4 and 7, CDR2 selected from the group consisting of SEQ ID NOS: 5, 8 and 9, and CDR3 selected from the group consisting of SEQ ID NOS: 6 and 10; and (iv) an antibody or antigen binding fragment thereof wherein the antibody cross-competes for binding to PROCR with (iii) .
In another aspect, an isolated anti-PROCR antibody, or antigen binding fragment thereof, is provided herein, wherein the antibody cross-competes for binding to PROCR with any one of SEQ ID NOS: 1-3 and 11-22.
A further aspect relates to a kit for diagnosing PROCR-high TNBC, comprising one or more of: (i) any one of SEQ ID NOS: 1-3 and 11-22, or antigen-binding fragment thereof; (ii) an antibody or antigen binding fragment thereof wherein the antibody cross-competes for binding to PROCR with (i) ; (iii) an antibody having CDR1, CDR2 and CDR3 selected from the CDRs of SEQ ID NOS: 1-3 and 11-22; and (iv) an antibody or antigen binding fragment thereof wherein the antibody cross-competes for binding to PROCR with (iii) .
Another aspect relates to a PROCR inhibitor for use in the preparation of a medicament for: (1) the treatment of PROCR-high TNBC, (2) the inhibition of growth of PROCR-high TNBC cells, (3) the reduction of metastasis of PROCR-high TNBC cells, and/or (4) the inhibition of epithelial-mesenchymal transition (EMT) of PROCR-high TNBC cells; wherein the PROCR inhibitor is selected from the group consisting of: (i) any one of SEQ ID NOS: 1-3 and 11-22, or antigen-binding fragment thereof; (ii) an antibody or antigen binding fragment thereof wherein the antibody cross-competes for binding to PROCR with (i) ; (iii) an antibody having CDR1, CDR2 and CDR3 selected from the CDRs of SEQ ID NOS: 1-3 and 11-22; and (iv) an antibody or antigen binding fragment thereof wherein the antibody cross-competes for binding to PROCR with (iii) .
Also provided herein is a pharmaceutical composition for treating PROCR-high TNBC, comprising the PROCR inhibitor disclosed herein and a pharmaceutically acceptable carrier. Use of the PROCR inhibitor disclosed herein for the manufacture of a medicament for the treatment of PROCR-high TNBC is also included. Another aspect relates to a method of suppressing growth, metastasis and/or EMT of a PROCR-high TNBC cell, comprising contacting the cell with an effective amount of the PROCR inhibitor disclosed herein.
BRIEF DESCRIPTION OF THE FIGURES
Figure 1. Procr is critical for MaSCs and basal cell fate
(a) Illustration of Procr flox allele with two loxP sites flanking exon 2-4.
(b) Strategy for generating conditional deletion of Procr in developing mammary gland. TAM was i.p. administered at 2-week prepubertal female mice every other day for a total of 3 times. The mammary glands were harvested at 8-week old. Whole mount carmine staining indicating that mammary development was stopped in ProcrCreER/flox (cKO) mice. Scale bars=1mm.
(c-d) Strategy for generating conditional deletion of Procr in homeostatic mammary gland. TAM was i. p. administered at 8-week adult female mice every other day for a total of 3 times. The mammary glands were harvested at 11-week old. Whole mount confocal staining (c) and FACS quantification (d) indicating that fewer basal cells in cKO compared to the control. Basal cells are marked by K14 in (d) , and Lin-, CD24+, CD29hi in (c) . Scale bars=50μm.
Figure 2. Procr marks CSCs of a particular basal-like subtype
(a) Procr+ basal cells (Lin-, CD24+, CD29hi, Procr+) and Procr-basal cells (Lin-, CD24+, CD29hi, Procr-) isolated from MMTV-Wnt1/FVB tumor were engrafted in limiting dilution to FVB recipient fat pads. Procr+ basal cells formed tumor vigorously with CSC frequency of 1/45, while Procr-cells could not. ***<0.001
(b-c) Procr+ cells (Lin-, CD24+, CD29hi, Procr+) and Procr-cells (Lin-, CD24+, CD29hi, Procr-) isolated from MMTV-PyVT tumor (b) or MMTV-Cre; Brca1f/+; p53f/+ tumor (c) were engrafted in limiting dilution to Nude recipient fat pads. There is no significant difference in tumor formation efficiency between the two populations. ns p>0.1
(d) Experimental setup used in lineage tracing of Procr+ cells in MMTV-Wnt1 premalignant animal. TAM was injected at 8-week old, mammary premalignant tissues or tumors were harvest after short term (2d) and long term (6mth) tracing.
(e-f) Section imaging indicating individual basal cells is labeled by mGFP expression (arrows) at 2d post TAM. Basal cells were marked by K14 (e) . Luminal cells were marked by K8 (f) .
(g-i) Section imaging indicating after 6 months of tracing, the clonal expansion of GFP+ cells in tumor tissues. Basal cells were marked by K14 (g) . Luminal cells were marked by K8 (h) .
Quantification of GFP+ cells in sections indicating significant increased percentages over the 6 months of tracing (i) .
(j-o) Experimental setup for tracing of Procr+ cells in formed MMTV-Wnt1 tumor (j) . Section imaging indicating individual Procr+ cell is labeled by mGFP expression in the tumor at 2d post TAM (k-l) . After 3 weeks of tracing, immunostaining in sections showing the expansion of GFP+ cells (m-n) . Quantification of GFP+ cells in sections indicating significant increased percentages over the 3 weeks of tracing (o) . All scale bars represent 20μm.
Figure 3. PROCR is highly expressed in half of TNBC cases and marks cancer stem cells within this subtype
(a) Representative images showing immunostaining of human non-cancerous mammary tissue with antibody to PROCR and Keratin 14 (K14) . Scale bars represent 20μm in lower magnification, 5μm in the zoom in.
(b) FACS analysis of non-cancerous mammary tissue (n=4 patients) showing that PROCR expression is in 3%of basal cells.
(c) PROCR expression was measured by IHC in tissue microarray containing 71 no-cancerous, 99 luminal A cancers, 105 luminal B cancers, 90 Her2 cancers and 149 TNBCs. Representative of negative (score 0) , weak (score 1) , medium (score 2) and strong (score 3) staining are shown. PROCR-low cases include score 0 and score 1; PROCR-high cases include score 2 and score 3. Scale bars represent 200μm in lower magnification, 50μm in the zoom in.
(d) Statistical analysis of PROCR expression according to the IHC score. Majority of non- cancerous, Luminal A, Luminal B and HER2+ samples have weak (score 1) or negative (score 0) expression of PROCR, whereas 52.4%of TNBCs display PROCR-high (score 2 + score 3) .
(e-g) Kaplan-Meier analysis of disease free survival (DFS) in our cohort. PROCR expression is associated with poor DFS in TNBC patients (e, n=141 patients) . PROCR expression has no significant association with hormone receptor-positive (f, n=187 patients) or HER2 enrichment subtypes (g, n=87 patients) .
Figure 4A. PROCR+ cells are enriched for CSCs in PROCR+ BCs
(a) IHC indicating that PDX-1 is ER-, PR-, HER2-, and PROCR-high. Scale bars represent 100μm.
(b) FACS analysis showing the PROCR+ epithelial cells (Lin-, Epcam+, PROCR+) are composed of 48.5±1.1%tumor epithelial cells (Lin-, Epcam+) in PDX-1.
(c) FACS analysis showing that both PROCR+ and PROCR-tumor cells isolated from PDX-1 are proliferative, both containing G2/M phase cells (4N) (left) , while PROCR+ cells have 1.9-fold more 4N cells compared to PROCR-tumor cells (right) (c) . Data are pooled from 3 independent experiments and presented as mean±s.e.m. **p<0.005.
(d) PROCR+ and PROCR-tumor cells isolated from PDX-1 were cultured in vitro and underwent 1h EdU incorporation. Representative images are shown (left) . Quantification indicating that PROCR+ cells had 2.6-fold more EdU-labeling cells (right) . Scale bars represent 100μm. Data are pooled from 3 independent experiments and presented as mean±s.e.m. ***p<0.001.
(e) PROCR+ and PROCR-tumor cells isolated from PDX-1 were stained with Ki67. Representative images are shown (left) . Quantification indicating that PROCR+ cells had 2.1-fold more Ki67+ cells (right) . Scale bars represent 100μm. Data are pooled from 3 independent experiments and presented as mean±s.e.m. ***p<0.001.
(f) TUNEL staining of PROCR+ and PROCR-tumor cells (Lin-, EpCam+) isolated from PDX-1 indicating that no significant difference in cell death in these two populations. Scale bars represent 100μm. Data are presented as mean±s.e.m. p>0.05
(g) PROCR+ and PROCR-cells isolated from PDX-1 were engrafted in limiting dilution as indicated. PROCR+ cells formed tumor readily, while PROCR-cells had drastically lower tumorigenicity. Data are pooled from 3 independent experiments and presented as mean±s.e.m. ***p<0.001.
(h) FACS analysis of the tumor outgrowths derived from engrafted PROCR+ cells indicating that they comprise both PROCR+ and PROCR-cells, at similar percentages as the parental PDX tumor.
(i) Gene Set Enrichment Analysis of PROCR+ tumor cells (Lin-, Epcam+, PROCR+) have enriched EMT1, Myc_targets2, and MaSCs signatures3 relative to PROCR-tumor cells (Lin-, Epcam+, PROCR-) .
(j) Heat map analysis of isolated PROCR+ and PROCR-tumor cells (Lin-, EpCam+) in two PDX-1 and PDX-2 tumors. PROCR+ tumor cells have reduced E-cad level (epithelial feature gene) and  increased mesenchymal signature genes.
(k) Western analysis indicating that PROCR+ tumor cells have reduced E-cad level and increased Slug and c-Myc levels. Tubulin serves a loading control.
Figure 4B. PROCR expression does not distinguish CSCs in PDX tumor with faint (score 1) PROCR expression
(a) IHC indicating that PDX-4 PROCR-low. Scale bars represent 100μm.
(b) FACS analysis showing the PROCR+ epithelial cells (Lin-, Epcam+, PROCR+) are composed of 2.0±1.1%tumor epithelial cells (Lin-, Epcam+) in PDX-4.
(c) PROCR+ and PROCR-cells isolated from PDX-4 were engrafted in limiting dilution as indicated. PROCR+ cells and PROCR-cells have similar tumorigenicity. Data are pooled from 3 independent experiments and presented as mean±s.e.m. ns, not significant.
Figure 5. Inhibition of PROCR suppresses PROCR+ BC PDX tumor growth
(a-g) Illustration of inhibition of PROCR in PDX by shRNA. Dissociated PDX tumor cells were virally infected by scramble control or sh-PROCR, and the infected cells were isolated using GFP tag, followed by engraftment to Nude recipients (a) . An aliquot of cells was used for Western analysis and confirmed about 75%of PROCR knockdown efficiency in PDX-1 (b) , PDX-2 (d) and PDX-3 (f) . Xenografts of the infected cells indicating that PROCR knockdown blocks PDX tumor growth (b-g) . n=4 mice or more in each group. Data are presented as mean±s.e.m.
(h-j) Illustration of inhibition of PROCR expression using CRISPR interference (h) . Western analysis validating the repression of PROCR by KRAB (i) . Xenografts of the infected cells indicating that PROCR knockdown significantly inhibits PDX-1 tumor formation (i, j) . n=10 mice in each group. Data are presented as mean±s.e.m.
Figure 6. The PROCR inhibitory nanobody suppresses the growth of PROCR+ BCs.
(a) Illustration of single-domain antibody, consisting antigen binding camelid VHHs (devoid of light chains) and human IgG.
(b-d) MDA-MB-231 cells were cultured in the presence of IgG or PROCR inhibitory nanobody (200ug/ml) for 4 passages in complete media. Cell numbers counted in each passage indicating that the antibody inhibited proliferation (b) . EdU incorporation experiment (1hr) showing that the antibody markedly inhibited cell proliferation (c) . TUNEL staining showing no obvious difference in cell death (d) . Data are pooled from 3 independent experiments and presented as mean±s.e.m. ***p<0.001.
(e) In MDA-MB-231 cell culture, PROCR-dependent signaling activities were examined at 8h, 12h and 16h after addition of the nanobody. Western analysis indicating that the antibody attenuated Src and IGF-1R phosphorylation, and inhibited ERK, PI3K-Akt-mTOR and RhoA-ROCK pathway  activities of MDA-MB-231 cells in vitro, at 12h and 16h. Analyses in this panel are from the same batch of cells using the same loadings, thus only one loading control (Tubulin) is shown at the end of the panel. For a better illustration, they are shown as three separated columns representing ERK, Akt and RhoA pathway respectively.
(f) In MDA-MB-231 cell culture, EMT related proteins were examined by Western analysis at 8h, 12h and 16h after addition of the nanobody. increased E-cad level, decreased Vim, Slug and Zeb1 levels were apparent at 12h and 16h.
(g) IgG or PROCR inhibitory antibody (PROCR-mAb) was i. p. administered at d5, d7, d10, d14 and d19 (8mg/kg body weight) (blue arrows) after engraftment of PDX-3 tumor cells. Tumor sizes were suppressed for 6-fold with PROCR inhibitory antibody. n=6 mice in each group. Data are presented as mean±s.e.m. ***p<0.001. Similar experiments using PDX-1 and PDX-2 are shown in Figure 14d-e.
(h) FACS analysis indicating decreased percentage of PROCR+ epithelial cells (Lin-, EpCam+, PROCR+) in the remaining tumors treated with PROCR nanobody, compared to tumors treated with IgG (left) . The ratios of PROCR+ cells vs PROCR-cells were quantified (right) . Data are pooled from 3 independent experiments and presented as mean±s.e.m. ***p<0.001.
(i) Mice baring PDX-1 tumor (～200 mm3) were administered with paclitaxel and doxorubicin (PTX+DOX) or PROCR-mAb alone or in combination. PTX+DOX were administered at d14, d20 and d27 (PTX: 20mg/kg, DOX: 3mg/kg body weight) (green arrowheads) ; PROCR-mAb or IgG were administered at d14, d17, d20, d24, d28 and d32 (8mg/kg body weight) (blue arrows) . Tumor sizes were suppressed for 2-fold with PTX+DOX, 3-fold with PROCR-mAb, 32-fold with the combination treatment. Post d32, all treatments were removed. Tumor sizes were continued measured (during the withdrawal of treatment) . Tumor sizes increased quickly when withdrawal of PTX/DOX treatment (green line) , which was in contrast to the moderate increase of tumor sizes post antibody treatment (blue line) and combination treatment (black line) . n=10 mice or more in each group. Data are presented as mean±s.e.m. ***p<0.001.
Figure 7. Proposed models for TNBC stratification and targeted therapy based on PROCR expression.
(a) Illustration of PROCR-based stratification and targeted therapy. Our data suggest a further stratification of TNBC based on PROCR expression. The potential PROCR+ BC subgroup (PROCR-high TNBC) constitutes about half of TNBC cases. In PROCR+ BCs, PROCR is expressed at the surface of CSCs and can be targeted by inhibitory antibodies, resulting in inhibition of ERK, PI3K-Akt, RhoA pathways and suppression of EMT in CSCs, rendering tumor inhibition.
(b) Schematic model of the human breast epithelial hierarchy and progression of PROCR+ BC. Hypothetically, PROCR+ BC may result from the acquisition of genetic alterations in MaSC, which  become CSCs fueling the growth of the tumor.
Figure 8. Procr is critical for MaSC and basal cell activities
(a) Illustration of homologue recombination strategy to generate Procr flox allele with two loxP sites flanking exon 2-4. The locations of four genotyping primers are marked.
(b) Genotyping PCR demonstrating that  pups # 1, 2, 7, 8, 9 are heterozygotes, while  pups # 3, 4, 5, 6 are wild type.
(c-d) Strategy for generating conditional deletion of Procr in developing mammary gland. TAM was i. p. administered at 4-week old pubertal female mice every other day for a total of 3 times. The mammary glands were harvested at 8-week old (c) . Whole mount carmine staining indicating that mammary development had stopped in ProcrCreER/flox (cKO) mice at lymph node (L. N. ) area (d) . Scale bar=1mm.
(e-f) Strategy for generating conditional deletion of Procr in adult mammary gland. TAM was i. p. administered at 8-week old pubertal female mice every other day for a total of 3 times. The mammary glands were harvested at 11-week old (e) . Whole mount carmine staining indicating that ProcrCreER/flox (cKO) mammary gland has reduced side branches compared to Ctrl (f) . Scale bar=2.5mm.
(g) qPCR analysis of isolated basal cells from Ctrl and cKO mammary gland validating the successful knockout of Procr in cKO.
(h) Illustration of transplantation experiments. 100 Lin-, CD24+, CD29hi, Procr+ cells isolated from Ctrl or cKO mammary gland were transplanted to each cleared fat pad of 3-week old Nude mice. TAM was administered at 2-week or 4-week post transplantation. The mammary outgrowths were examined at 9-week post transplantation.
(i) In groups that TAM was administered at 2-week post transplantation, whole mount carmine staining indicating that mammary outgrowths from ProcrCreER/flox (cKO) donor were smaller (have fewer fat pad filled) . n=6 in each group. Scale bar=1mm.
(j-k) In groups that TAM was administered at 4-week post transplantation, whole mount carmine staining indicating abnormality in branching in ProcrCreER/flox (cKO) outgrowths. n=6 in each group. Scale bar=1mm (j) . Immunostaining indicating fewer basal cells (K14+) in the cKO outgrowth compared to the Ctrl. Scale bars=50μm (k) .
Figure 9. Procr marks CSCs in MMTV-Wnt1 mammary tumor, not in MMTV-PyVT or MMTV-Cre; Brca1f/+; p53f/+ mammary tumor.
(a-c) FACS analyses showing the distribution of Procr+ cells in related to basal, luminal and stromal cell compartments in WT mammary gland, MMTV-Wnt1, MMTV-PyVT and MMTV-Cre; Brca1f/+; p53f/+ tumor. One of three similar experiments is shown (a) . Quantification indicating that Procr+ basal cells consisted of 2.5 ±0.9%of total basal cells in normal tissue control  (WT) , there is a significant increase of Procr+ basal cells in MMTV-Wnt1 tumor (8.1 ±1.1%) , and a decrease of Procr+ basal cells in MMTV-PyVT tumor (1.0 ±0.02%) and MMTV-Cre; Brca1f/+; p53f/+ tumor (1.3 ±0.1%) (b) . Procr+ cells are absent from luminal compartment in WT and both tumor models, and the percentages of Procr+ cells in mesenchymal compartment have no significant changes in tumors compared to the WT (c) . Data are pool from three independent experiments in (b-c) . ***<0.001, *<0.05.
(d) Representative images of MMTV-Wnt1/FVB tumor outgrowths in FVB recipients.
(e-g) Procr+ and Procr-basal cells isolated from MMTV-Wnt1/FVB tumor were engrafted (2,000 or 10,000 each) to Nude recipient fat pads. Procr+ formed tumor vigorously while Procr-cells could not. Representative pictures are shown in (e) . Tumor volume and tumor free percentage are shown in (f) and (g) respectively. n=10 or more mice for each group as indicated.
(h-j) Experimental setup used in lineage tracing of Procr+ cells in MMTV-Wnt1 premalignant animal (h) . After 6 months of tracing, immunostaining in sections showed the clonal expansion of GFP+ cells in premalignant tissues. GFP+ cells are distributed in both basal (arrow) and luminal (arrowhead) lineages (i, j) . Basal cells were marked by K14 (i) ; luminal cells were marked by K8 (j) .
Figure 10. Procr is critical for MMTV-Wnt1 mammary tumor growth.
(a) qPCR analysis indicating the knockdown efficacy of sh-Procr in MMTVWnt1 tumor cells.
(b-g) MMTV-Wnt1/FVB mammary cells were virally infected by scramble control or Sh-Procr followed by transplantation to Nude (b-d) or FVB (e-g) recipients. Control cells efficiently formed tumors, whereas knockdown of Procr inhibited tumor growth. Representative pictures are shown in (b, e) . Tumor volume and tumor free percentage are shown in (e, f) and (d, g) respectively. n=8 or more mice for each group as indicated.
Figure 11. PROCR expression is prevalent in TNBC and PROCR-high TNBC patients have poorer prognosis relative to PROCR-low TNBC patients.
(a) Immunostaining of human non-cancerous mammary tissue showing, in few areas, PROCR expression could be detected in many basal cells (based on location) . In these cases, these basal cells have low (undetectable) Keratin 14 (K14) expression level, which is distinct to the robust K14 expression seen in other areas that have sparse PROCR+ basal cells (shown in Fig. 3a) . Scale bars represent 20μm.
(b) FACS analysis of non-cancerous mammary tissue (n=4 patients) showing that PROCR expression is in 3%of basal cells, 3.5%of mesenchymal cells and is devoid from mature luminal cells and luminal progenitors. Ctrl analysis without the PROCR antibody indicating the background fluorescent levels in basal and mesenchymal compartments, and showing that basal and mesenchymal cells have higher background staining relative to luminal cells.
(c-d) Representative images of PROCR IHC staining in the four subtypes of human breast cancer tissue samples. Representative of each subtype was shown. PROCR staining is in brown; hematoxylin counterstain is in blue. Scale bar represents 200 μm (c) . H-score analysis revealed a strong association of PROCR expression with TNBC. Student’s t test: ***p<0.0001 (d) .
(e-f) Kaplan-Meier analysis of DFS derived from a large public clinical database (kmplot. com) . PROCR expression is associated with poor DFS in hormone-receptor negative breast cancer patients (e, n=671 patients) . PROCR expression has no significant association with hormone receptor-positive breast cancer patients (f, n=1802 patients) .
Figure 12. Subtype and gene expression analysis of TNBC cell lines; PROCR-high TNBC is distinct from BRCA1 TNBC
(a) qPCR analysis of PROCR expression in human breast cancer cell lines as indicated. PROCR level is markedly higher in a subset of TNBC lines (red) and lower in other TNBC lines (blue) . #indicating lines with BRCA1/2 mutation. One of three similar experiments is shown.
(b) Assignment of TNBC cell lines to the proposed 6 subtypes and 2 subtypes based on genome-wide gene expression studies 1-3. PROCR status did not correlate with above stratification. Known mutations in each cell line were listed (www. sanger. ac. uk/denetics/CGP/cosmic) .
(c-d) PROCR expression was measured by IHC in human TNBC samples containing 28 cases of BRCA1 mutation carriers and 30 cases of BRCA1 wildtype. Representative of negative (H-score <30) , weak (H-score 30-75) , medium (H-score 80-120) and strong (H-score >120) staining are shown. PROCR staining is in brown; hematoxylin counterstain is in blue. Scale bar represents 200μm (c) . Quantification indicating that 89.3%of BRCA1 mutant carriers have low expression of PROCR (n=28) , whereas 70%of BRCA1 wild type TNBCs are PROCR-high (n=30) , exhibiting an H-score higher than 80 (d) . (e) qPCR analysis of Claudins (CLDN3, CLDN4, CLDN7) in TNBC cell lines. No obvious correlation of PROCR status with CLDN levels was detected.
Figure 13. PROCR expression analysis of PDX samples; Inhibition of PROCR potently suppress MDA-MB-231 tumor growth, while it is ineffective in blocking BT549 or MCF-7 tumor formation.
(a) Patient information of the 3 PDX origins.
(b-c) IHC indicating that PDX-2 (b) and PDX-3 (c) are ER-, PR-, HER2-, and PROCR-high. Scale bars represent 100μm.
(d-e) FACS analysis showing the proportion of PROCR+ (Lin-, Epcam+, PROCR+) and PROCR- (Lin-, Epcam+, PROCR-) cells in PDX-2 (d) and PDX-3 (e) tumors.
(f) Western analysis showing the various knockdown efficacies of 3 different shRNAs of PROCR. shRNA1 exhibited the most efficient knockdown (namely Sh-PROCR) ; shRNA3 also showed evidently inhibitory effect.
(g) MDA-MB-231 cells (PROCR-high TNBC) were virally infected with scramble control and two individual PROCR shRNAs (shRNA-1 and shRNA-3) and cultured in complete media. Cell numbers were counted for 4 passages. Both shRNAs inhibited MDA-MB-231 cell proliferation.
(h) An aliquot of cells was used for Western analysis and confirmed about 85%of PROCR knockdown efficiency by sh-PROCR (shRNA-1) . Xenograft experiment indicating that knockdown of PROCR inhibits MDA-MB-231 tumor growth and delays tumor formation. n=4 mice in each group. Data are presented as mean±s.e.m.
(i) BT549 cells, representative of PROCR-low TNBC, were virally infected with Scramble control and Sh-PROCR and culture for 4 passages in complete media. Cell numbers were counted in each passage. Sh-PROCR did not affect BT549 cell proliferation.
(j) MCF-7 cells, representative of hormone receptor-positive tumor, were virally infected with Scramble control and Sh-PROCR. Although MCF-7 cells have lower PROCR expression level compared to MDA-MB-231, Sh-PROCR could further reduce the PROCR expression in MCF-7 (3.4-fold decrease) . Xenograft experiments indicating that knockdown of PROCR does not affect the growth of MCF-7 tumor, representative of hormone receptor-positive tumor. n=4 mice in each group. Data are presented as mean±s.e.m.
Figure 14. PROCR inhibitory nanobody suppresses MDA-MB-231 proliferation and PROCR+ tumor growth.
(a) Reported three-dimensional protein structure of extracellular domain of PROCR (in green) bound to Gla domain of PROC (in turquoise) (Protein Data Bank accession number 1LQV) 4. Glycosyl groups are shown in beige.
(b) Elisa indicating that the inhibitory antibody blocks PROCR with its potential ligand PROC binding, while the control antibody cannot.
(c) Western analysis indicating that PROCR inhibitory antibody attenuates the activity of EGFR at T845 of MDA-MB-231 cells in vitro, at 12h and 16h, but does not affect T1068 or T1173 phosphorylation.
(d-e) PDX-1 (d) and PDX-2 (e) tumor cells were inoculated, IgG or PROCR inhibitory nanobody were i. p. administered at d5, d7, d10, d14 and d19. Tumor growth was inhibited with PROCR inhibitory nanobody (PROCR-mAb) . n=4 mice in each group. Data are presented as mean±s.e.m. ***p<0.001.
(f) FACS analysis indicating increased percentage of PROCR+ epithelial cells (Lin-, EpCam+, PROCR+) in the remaining tumors treated with PTX+DOX, compared to tumors treated with IgG (left) . The ratios of PROCR+ cells vs PROCR-cells were quantified (right) . Data are pooled from 3 independent experiments and presented as mean±s.e.m. ***p<0.001.
(g) The remaining tumors, which were treated with IgG or PTX/DOX or the PROCR-mAb, were also dissociated and plated in equal number in culture, and their proliferation was assessed for 3  consecutive days. By day 3, tumor cells post PTX/DOX treatment had a 1.5 fold increase in cell number compared to the control, whereas tumor cells post PROCR-mAb treatment had a 1.8 fold decrease in cell number. Data are pooled from 3 independent experiments and presented as mean±s.e.m. ***p<0.001.
Figure 15. Schematic illustration showing role and potential use of PROCR.
Figure 16. PROCR activates ERK, PI3K-Akt-mTOR and RhoA-Rock signaling pathways in breast cancer cells.
(a) Illustration and representing image of phospho-kinase antibody array using lysates of MDA-MB-231 cells with scramble control and sh-PROCR. Seven proteins with most evident downregulation following PROCR knockdown are indicated.
(b) Western blot showing downregulation of ERK, PI3K-Akt-mTOR and RhoA-ROCK pathway activities in MDA-MB-231 cells with sh-PROCR knockdown. Tubulin was used as loading controls.
(c) Western blot showing differential activities of ERK, PI3K-Akt-mTOR and RhoA-ROCK pathway in PROCR-high TNBC cell lines (MDA-MB-231, Hs578T) and PROCR-low TNBC cell lines (MDA-MB-468, BT549) . Tubulin was used as loading control.
Western blots in the same panel are from the same batch of cells using the same loadings, thus only one loading control is shown at the end of the panel. For a better illustration, they are shown as three separated columns representing ERK, Akt and RhoA pathway respectively.
Figure 17. Validation of PROCR-dependent signaling activities in human breast cancer PDX
(a) IHC indicating that the breast cancer PDX sample is ER-, PR-, HER2-, and PROCR-high. Scale bars represent 100um.
(b) FACS analysis of PDX cells using PROCR antibody (clone RCR-227) indicating that 86.9%of cells are EpCam+ epithelial cells; Within EpCam+ cells, 48.7%of cells are positive for PROCR.
(c) Western analysis indicating obvious higher level of PROCR in isolated PROCR+ cells compared to PROCR-cells, confirming the correct isolation using RCR-227 antibody.
(d) Illustration and Western blot showing differential activities of ERK, PI3K-Akt-mTOR and RhoA-ROCK pathway in PROCR+ and PROCR-cells isolated from PROCR+ BC PDX-1 tumor. Tubulin was used as loading control. Western blots in the same panel are from the same batch of cells using the same loadings, thus only one loading control is shown at the end of the panel. For a better illustration, they are shown as three separated columns representing ERK, Akt and RhoA pathway respectively.
Figure 18. Validation of PROCR antibodies for Flow Cytometry
(a) FACS analysis of MDA-MB-231 cells using two distinct monoclonal antibodies of PROCR. RCR-252 (BD Pharmingen, cat. 557950) only detects 18.1%of cells are positive for PROCR, while RCR-227 (eBioscience, cat. 17-2018-42) indicates 98.3%of cells are positive for PROCR.
(b) qPCR analysis indicating no significant difference of PROCR expression levels between isolated PROCR+/-cells using RCR-252.
(c) FACS analysis of PDX cells using the two PROCR antibodies. Analysis with RCR-252 was not able to detect cells that are positive for PROCR, while analysis with RCR-227 indicates 48.7%of cells are positive for PROCR. Correct isolation of PROCR+/-cells using RCR-227 is shown in Figure 17c.
Figure 19. F2R mediates the activation of RhoA pathway by PROCR, not the activation of ERK and PI3K-Akt-mTOR pathways.
(a) Illustration of activating endogenous PROCR expression using CRISPR interference system, through viral infection with dCas9-VP64 and sg-PROCR.
(b) Western blot indicating that ERK, PI3K-Akt-mTOR and RhoA-ROCK signaling activities are all upregulated as a consequence of PROCR overexpression using the system in (a) , including increased c-Myc and Cyclin D1 levels.
(c) Overexpression of PROCR in BT549 cells induces change of cell shape as visualized by Vimentin (Vim) staining.
(d) Western blot showing that in BT549 cells with PROCR overexpression, knockdown of F2R by sh-RNA attenuates RhoA-ROCK signaling, while it is ineffective to ERK and PI3K-Akt-mTOR pathways.
Western blots in the same panel are from the same batch of cells using the same loadings, thus only one loading control is shown at the end of the panel. For a better illustration, they are shown as three separated columns representing ERK, Akt and RhoA pathway respectively.
Figure 20. IGF-1R, not EGFR mediates the activation of ERK and PI3K-Akt-mTOR signalings induced by PROCR
(a) Illustration and representing image of phospho-kinase antibody array using PROCR+ (Lin-, EpCam+, PROCR+) and PROCR- (Lin-, EpCam+, PROCR-) cells isolated from PDX tumor. Eight proteins with most evident differential activities are indicated.
(b) Western blot showing the knockdown efficacy of IGF-1R and EGFR by shRNAs.
(c) Western blot showing that in BT549 cells with PROCR overexpression, knockdown of IGF-1R by sh-RNA does not affect Src activity, while it diminishes both ERK and PI3K-Akt-mTOR pathways, and it is ineffective to RhoA-ROCK signaling; knockdown of EGFR by sh-RNA affects none of Src and the three PROCR-dependent signalings.
(d) Western blot showing that in BT549 cells with PROCR overexpression, inhibition of Src using KX2-391 diminishes the activities of Src, IGF-1R, EGFR-T845, both ERK and PI3K-Akt-mTOR pathways, while it is ineffective to RhoA-ROCK signaling.
(e) Western analysis indicating that in MDA-MB-231 cells, knockdown of PROCR attenuates the activity of EGFR at T845, but does not affect EGFR T1068 or T1173 phosphorylation.
(f) Illustration of PROCR-dependent intracellular signaling pathways. Impact on EGFR-T845 activity is a subsequence of activation of Src by PROCR.
Western blots in the same panel are from the same batch of cells using the same loadings, thus only one loading control is shown at the end of the panel. For a better illustration, they are shown as three separated columns representing ERK, Akt and RhoA pathway respectively.
Figure 21. Protein C serves as the ligand for the activation of PROCR intracellular signaling in breast cancer cells
(a) MDA-MB-231 cells were cultured in the presence of Ctrl or sPROCR (6ug/ml) for 4 passages in complete media. Cell numbers that are counted in each passage showing that sPROCR markedly inhibited cell proliferation. The spindle-shaped morphology of MDA-MB-231 (Ctrl, upper right panel) was altered to become more spherical in the presence of sPROCR (bottom right panel) . One of three similar experiments is shown.
(b) MDA-MB-231 cells were cultured in the presence of Ctrl or PROC-DN (2ug/ml) for 4 passages in complete media. Cell numbers that are counted in each passage showing that PROC-DN markedly inhibited cell proliferation. The spindle-shaped morphology of MDA-MB-231 (Ctrl, upper right panel) was altered to become more spherical in the presence of PROC-DN (bottom right panel) . One of three similar experiments is shown.
(c) Western blot showing that addition of PROC-DN in MDA-MB-231 cells (24 hr) diminishes the activities of Src and all three PROCR intracellular signaling pathways (ERK, PI3K-Akt-mTOR and RhoA-ROCK signaling) .
(d) Western blot showing that addition of aPC in MDA-MB-231 cells (2 hr) enhances the activities of Src and all three PROCR intracellular signaling pathways.
(e) The model of PROCR signaling mechanisms in breast cancer cells. Western blots in the same panel are from the same batch of cells using the same loadings, thus only one loading control is shown at the end of the panel.
Figure 22. Blockage of PROCR intracellular signaling impedes clonogenicity of breast cancer cells
(a-b) Colonies formed from PDX-1 single cells were dissolved from Matrigel for imaging. Representative pictures are shown. Knockdown of PROCR abolished colony formation (a) . F2R  inhibitor (sch79797) or Src inhibitor (KX2-391) attenuated colony formation, and the combined treatment completely blocked colony formation (b) . Scale bars, 20 μm.
(c-d) Quantification indicating that colony formation efficiency (c) and colony sizes (d) are significantly reduced when PROCR or its downstream signaling component is inhibited. The combined treatment of F2R inhibitor and IGF-1R inhibitor completely blocked colony formation, similar to the effect of PROCR knockdown. **p<0.002, ***p<0.0001. Data are pooled from three independent experiments.
(e) The model of PROCR signaling mechanisms in breast cancer cells.
Figure 23. h-ED Antigen specific filter lift assay
(～500 pfu each plate) HDB169 (a) and HDB323 (b) from immunotube panning format detected with 50 nM biotin-h-ED. HDB169 (c) and HDB323 (d) from solution panning format detected with 50 nM biotin-h-ED. For HDB169 library, total 10x500 pfu of O3 phages were screened (a filter lift example is shown in a) . Total 100 plaques were picked for DNA sequencing. For HDB323 library, total 13x500 pfu of O3 phages were screened. as shown in panel (b) and (d) , 18 positive clones were picked and sent for sequencing.
Figure 24. Single Point ELISA of anti-h-ED hits
96 well Greiner plate was coated with 50 nM of h-ED, hIgG Fc, Fc control, PBS respectively, at 4℃ overnight. All 118 hits were assayed by Single Point ELISA (SPE) for binding to the h-ED antigen and showed different binding affinities to h-ED protein.
Figure 25. Identify and validate antibodies with PROCR-inhibitory function
(a) Competitive Elisa identifying the clones that inhibit Protein C and PROCR binding.
(b) The spindle-shaped morphology of MDA-MB-231 (Ctrl, upper panel) was altered to become more spherical in the presence of PROCR-inhibitory antibodies (PROCR-mAb, bottom panel) . All inhibitory clones as indicated in (a) showed similar phenotypes. Representative images are shown.
(c) Mice baring PDX-1 tumor (～200 mm3) were administered with various clones of PROCR-mAb. PROCR-mAb was administered at days as indicated by arrows for a total of 5 times (8mg/kg body weight) . Tumor sizes were suppressed with the antibodies as indicated
DETAILED DESCRIPTION
It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the compositions and methods of the present disclosure.
One aspect of the present disclosure relates to the surprising discovery that PROCR can be used as a biomarker and therapeutic target specifically for a subtype of TNBC that represents about 50%of  all TNBCs, PROCR-high TNBC. Unexpectedly, PROCR is highly expressed in some, but not all TNBC cells. In some embodiments, PROCR-high TNBC is characterized by expression level of PROCR in breast tissue having an immunoreactive H-score of at least 120 in immunohistochemistry. Conversely, PROCR-low TNBC or QNBC can be characterized by expression level of PROCR in breast tissue having an immunoreactive H-score of less than about 120 or less than about 100 in immunohistochemistry. Various anti-PROCR antibodies can be used in such immunohistochemistry, such as the GS5, GS4, GS2, HD13, HD21, HD44, HD58 or HD61 monoclonal antibodies disclosed herein, as well as RCR-252.
It is also discovered that PROCR expression is highly correlated with (a) poor survival rate of PROCR-high TNBC patients, (b) increased stemness of cancer stem cells and (c) metastasis in tumor models. It is additionally established herein that inhibition of PROCR defeats the tumorigenicity and progression of the PROCR-high TNBC subtype. As such, PROCR can be used as an effective target for PROCR-high TNBC diagnosis and therapeutic intervention.
It should be noted that the inventors have previously reported the use of PROCR for the diagnosis and treatment of all TNBC cases in PCT/CN2015/087555 filed August 19, 2015, where 82.6%of the TNBC patients were reported to be PROCR positive. However, the inventors have surprisingly found that, as disclosed herein, only 52%of TNBC exhibit high-level expression of PROCR, making PROCR a biomarker for a subtype of TNBC, as opposed to all TNBC. This is through analyzing PDX sample with faint PROCR staining (H-score <120, e.g., 80-120) . It came to a surprising finding that only 2%of tumor cells are indeed PROCR+ by FACS analysis. Xenograft experiments with limiting dilution of tumor cells indicated that these 2%PROCR+ are not enriched for cancer stem cell (Figure 4B) . In contrast, when analyzing PDX sample with strong PROCR staining (H-score >120) , 48.5%of tumor cells are PROCR+ revealed by FACS analysis. Xenograft experiments indicated that these PROCR+ cells are cancer stem cells. Even one single PROCR+cell isolated in this type of tumor was readily to form new tumor upon xenograft (Figure 4A) . Thus, instead of using PROCR as a surrogate marker for TNBC, the present disclosure detects all four markers, i.e., ER-, PR-, HER2-and PROCR+ in a breast cancer patient sample, thereby determining the PROCR+ TNBC subtype. Thereafter, a PROCR inhibitor such as the antibodies disclosed herein can be used to treat the PROCR+ TNBC patient.
In addition, without wishing to be bound by theory, it is believed that PROCR functioning molecular mechanism in breast cancer epithelial cells is different from PROCR in endothelial cell. PROCR in breast cancer cells requires Src and IGF-1R, but it doesn't in endothelial cells. This is significant for designing targeting strategy to specifically target breast cancer cells and minimize potential toxicity to endothelial cells.
Specifically, it has been discovered herein that PROCR proceeds through F2R and Src/IGF-1R simultaneously in PROCR+ breast cancer cells (see Fig. 22e) . Specifically,  PROCR-induced RhoA-ROCK-p38 signaling is dependent on F2R, while PROCR-induced ERK and PI3k-Akt-mTOR signaling are dependent on Src and subsequent activation of IGF-1R. This is the first report that Src and IGF-1R mediates the signaling function of PROCR. Functionally, blocking the F2R and Src using corresponding inhibitors inhibits cancer stem cell activities (Fig. 22) .
It has been surprisingly discovered herein that, in breast cancer cells, F2R does not account for all PROCR activities, which is distinct to previously described PROCR intracellular signaling mechanisms in endothelial cells, in which F2R is an essential mediator of all PROCR activities (Cheng et al., 2003; Feistritzer et al., 2006; Riewald et al., 2002; Yang et al., 2009) . This difference in signaling mechanisms between breast cancer epithelial cells and endothelial cells enables novel treatment strategies to specifically target breast cancer cells and minimize the potential toxicity to endothelial cells. For example, combined anti-PROCR mAb with Src inhibitor or IGF-1R inhibitor may effectively diminish PROCR-high TNBC breast cancer stem cells, and prevent the potential side effects in endothelial cells.
Definitions
For convenience, certain terms employed in the specification, examples, and appended claims are collected here. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.
As used herein, the following terms and phrases are intended to have the following meanings: The articles “a” and “an” are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element.
As used herein, the term “about” means acceptable variations within 20%, more preferably within 10%and most preferably within 5%of the stated value.
As used herein, the term “triple negative” or “TN” or “TNBC” refers to tumors (e.g., carcinomas) , typically breast tumors, in which the tumor cells score negative (i.e., using conventional histopathology methods) for estrogen receptor (ER) and progesterone receptor (PR) , both of which are nuclear receptors (i.e., they are predominantly located at cell nuclei) , and the tumor cells are not amplified for epidermal growth factor receptor type 2 (HER2 or ErbB2) , a receptor normally located on the cell surface. Tumor cells are considered negative for expression of ER and PR if less  than 5%of the tumor cell nuclei are stained for ER and PR expression using standard immunohistochemical techniques. Tumor cells are considered highly amplified for HER2 (“HER23+” ) if, when tested with a HercepTestTM Kit (Code K5204, Dako North America, Inc., Carpinteria, Calif. ) , a semi-quantitative immunohistochemical assay using a polyclonal anti-HER2 primary antibody, they yield a test result score of 3+, or, the test HER2 positive by fluorescence in-situ hybridization (FISH) . As used herein, tumor cells are considered negative for HER2 overexpression if they yield a test result score of 0 or 1+, or 2+, or if they are HER2 FISH negative.
“Procr” and “PROCR” are used interchangeably and refer to protein C receptor, with “Procr” generally referring to the gene or mRNA and “PROCR” the protein product unless otherwise noted. It should be understood that the terms include the complete gene, the cDNA sequence, the complete amino acid sequence, or any fragment or variant thereof.
As used herein, the term “PROCR inhibitor” is intended to include therapeutic agents that inhibit, down-modulate, suppress or down-regulate PROCR activity. The term is intended to include chemical compounds, such as small molecule inhibitors and biologic agents (e.g., antibodies) , interfering RNA (shRNA, siRNA) , soluble antagonists, gene editing/silencing tools (CRISPR/Cas9, TALENs) and the like.
An “antibody, ” as used herein is a protein consisting of one or more polypeptides comprising binding domains that bind to a target epitope. The term antibody includes monoclonal antibodies comprising immunoglobulin heavy and light chain molecules, single heavy chain variable domain antibodies, and variants and derivatives thereof, including chimeric variants of monoclonal and single heavy chain variable domain antibodies. Binding domains are substantially encoded by immunoglobulin genes or fragments of immunoglobulin genes, wherein the protein immunospecifically binds to an antigen. The recognized immunoglobulin genes include the kappa, lambda, alpha, gamma, delta, epsilon and mu constant region genes, as well as myriad immunoglobulin variable region genes. Light chains are classified as either kappa or lambda. Heavy chains are classified as gamma, mu, alpha, delta, or epsilon, which in turn define the immunoglobulin classes, IgG, IgM, IgA, IgD and IgE, respectively. For most vertebrate organisms, including humans and murine species, the typical immunoglobulin structural unit comprises a tetramer that is composed of two identical pairs of polypeptide chains, each pair having one “light” (about 25 kD) and one “heavy” chain (about 50-70 kD) . “VL” and VH″refer to the variable domains of these light and heavy chains respectively. “CL” and CH″refer to the constant domains of the light and heavy chains. Loops of β-strands, three each on the VL and VH are responsible for binding to the antigen, and are referred to as the “complementarity determining regions” or “CDRs” . The “Fab” (fragment, antigen-binding) region includes one constant and one variable domain from each heavy and light chain of the antibody, i.e., VL, CL, VH and C H1.
Antibodies include intact immunoglobulins as well as antigen-binding fragments thereof. The term "antigen-binding fragment" refers to a polypeptide fragment of an antibody which binds antigen or competes with intact antibody (i.e., with the intact antibody from which they were derived) for antigen binding (i.e., specific binding) . Antigen binding fragments can be produced by recombinant or biochemical methods that are well known in the art. Exemplary antigen-binding fragments include Fv, Fab, Fab', (Fab') 2, CDR, paratope and single chain Fv antibodies (scFv) in which a VH and a VL chain are joined together (directly or through a peptide linker) to form a continuous polypeptide.
Another class of antibodies known as heavy chain antibodies (HCA, also referred to as two-chain or two-chain heavy chain antibodies) have been reported in camelids such as dromedary camels, Bactrian camels, wild Bactrian camels, llamas, alpacas, 
Figure PCTCN2017115198-appb-000002
and guanacos (Hamers-Casterman et al., Nature, 363, 446-448 (1993) ; Wesolowski et al., Med. Microbiol. Immunol (2009) 198: 157-174; see also U.S. Pat. No. 5,759,808; U.S. Pat. No. 5,800,988; U.S. Pat. No. 5,840,526; and U.S. Pat. No. 5,874,541) . Compared with conventional four-chain immunoglobulins of IgG-type, which are also produced by camelids, these antibodies lack the light chains and CH1 domains of conventional immunoglobulins, and their variable domains are sometimes designated “VHH” . VHH can include four framework regions or “FR” , FR1, FR2, FR3 and FR4. The framework regions are interrupted by three CDRs, CDR1, CDR2 and CDR3. One of the salient features of these naturally occurring heavy chain antibodies is the predominant presence of Glu, Arg and Gly at VL interface positions 44, 45 and 47 (Kabat numbering) , respectively, of their VHH. The same positions in the VH of conventional four-chain antibodies (are almost exclusively occupied by Gly, Leu and Trp. These differences are thought to be responsible for the high solubility and stability of camelid HCA variable domain (VHH) , as compared with the relative insolubility of VH domain of the conventional four-chain antibodies. Two more salient features of camelid VHH domains are their comparatively longer CDR3 and high incidence of cysteine pairs in CDRs. It appears that cysteine pairs mediate the formation of a disulfide bridge and are therefore involved in modulating the surface topology of the antibody combining site. In the crystal structure of a camel sdAb-lysozyme complex, a rigid loop protruding from the sdAb and partly stabilized by a CDR disulfide linkage extends out of the combining site and penetrates deeply into the lysozyme active site (Desmyter et al., Nature Struct. Biol., 3, 803-811 (1996) ) .
Antibodies also include variants, chimeric antibodies and humanized antibodies. The term “antibody variant” as used herein refers to an antibody with single or multiple mutations in the heavy chains and/or light chains. In some embodiments, the mutations exist in the variable region. In some embodiments, the mutations exist in the constant region. “Chimeric antibodies” refers to those antibodies wherein one portion of each of the amino acid sequences of heavy and light chains is homologous to corresponding sequences in antibodies derived from a particular species or  belonging to a particular class, while the remaining segment of the chains is homologous to corresponding sequences in another. Typically, in these chimeric antibodies, the variable region of both light and heavy chains mimics the variable regions of antibodies derived from one species of mammals, while the constant portions are homologous to the sequences in antibodies derived from another. One clear advantage to such chimeric forms is that, for example, the variable regions can conveniently be derived from presently known sources using readily available hybridomas or B cells from non-human host organisms in combination with constant regions derived from, for example, human cell preparations. While the variable region has the advantage of ease of preparation, and the specificity is not affected by its source, the constant region being human, is less likely to elicit an immune response from a human subject when the antibodies are injected than would the constant region from a non-human source. However, the definition is not limited to this particular example. “Humanized” antibodies refer to a molecule having an antigen-binding site that is substantially derived from an immunoglobulin from a non-human species and the remaining immunoglobulin structure of the molecule based upon the structure and/or sequence of a human immunoglobulin. The antigen-binding site may comprise either complete variable domains fused onto constant domains or only the complementarity determining regions (CDRs) grafted onto appropriate framework regions in the variable domains. Antigen binding sites may be wild type or modified by one or more amino acid substitutions, e.g., modified to resemble human immunoglobulin more closely. Some forms of humanized antibodies preserve all CDR sequences (for example, a humanized mouse antibody which contains all six CDRs from the mouse antibodies) . Other forms of humanized antibodies have one or more CDRs (one, two, three, four, five, or six) which are altered with respect to the original antibody, which are also termed one or more CDRs “derived from” one or more CDRs.
As described herein, the amino acid residues of an antibody, including VHH, can be numbered according to the general numbering of Kabat (Kabat, et al. (1991) Sequences of Proteins of Immunological Interest, 5th edition. Public Health Service, NIH, Bethesda, MD) .
The term “binding” as used herein in the context of binding between an antibody, such as a VHH, and an epitope of PROCR as a target, refers to the process of a non-covalent interaction between molecules. Preferably, said binding is specific. The specificity of an antibody can be determined based on affinity. A specific antibody can have a binding affinity or dissociation constant Kd for its epitope of less than 10-7 M, preferably less than 10-8 M.
The term “affinity” refers to the strength of a binding reaction between a binding domain of an antibody and an epitope. It is the sum of the attractive and repulsive forces operating between the binding domain and the epitope. The term affinity, as used herein, refers to the dissociation constant, Kd.
The term “antigen” refers to a molecule or a portion of a molecule capable of being bound by a  selective binding agent, such as an antibody, and additionally capable of being used in an animal to produce antibodies capable of binding to an epitope of that antigen. An antigen may have one or more epitopes.
The term “epitope” includes any determinant, preferably a polypeptide determinant, capable of specific binding to an immunoglobulin or T-cell receptor. In certain embodiments, epitope determinants include chemically active surface groupings of molecules such as amino acids, sugar side chains, phosphoryl, or sulfonyl, and, in certain embodiments, may have specific three-dimensional structural characteristics, and/or specific charge characteristics. An epitope is a region of an antigen that is bound by an antibody. In certain embodiments, an antibody is said to specifically bind an antigen when it preferentially recognizes its target antigen in a complex mixture of proteins and/or macromolecules. Methods for epitope mapping are well known in the art, such as X-ray co-crystallography, array-based oligo-peptide scanning, site-directed mutagenesis, high throughput mutagenesis mapping and hydrogen–deuterium exchange.
The site on the antibody that binds the epitope is referred to as “paratope, ” which typically include amino acid residues that are in close proximity to the epitope once bound. See Sela-Culang et al., Front Immunol. 2013; 4: 302.
“Immunohistochemistry” or “IHC” refers to the process of detecting an antigen in cells of a tissue section allowing the binding and subsequent detection of antibodies immunospecifically recognizing the antigen of interest in a biological tissue. For a review of the IHC technique, see, e.g., Ramos-Vara et al., Veterinary Pathology January 2014 vol. 51 no. 1, 42-87, incorporated herein by reference in its entirety. To evaluate IHC results, different qualitative and semi-quantitative scoring systems have been developed. See, e.g., Fedchenko et al., Diagnostic Pathology, 2014; 9: 221, incorporated herein by reference in its entirety. One example is the H-score, determined by adding the results of multiplication of the percentage of cells with staining intensity ordinal value (scored from 0 for “no signal” to 3 for “strong signal” ) with 300 possible values.
“Immunospecific” or “immunospecifically” (sometimes used interchangeably with “specifically” ) refer to antibodies that bind via domains substantially encoded by immunoglobulin genes or fragments of immunoglobulin genes to one or more epitopes of a protein of interest, but which do not substantially recognize and bind other molecules in a sample containing a mixed population of antigenic molecules. Typically, an antibody binds immunospecifically to a cognate antigen with a Kd with a value of no greater than 50 nM, as measured by a surface plasmon resonance assay or a cell binding assay. The use of such assays is well known in the art.
An “anti-PROCR antibody” is an antibody that immunospecifically binds to PROCR (e.g., its extracellular domain) . The antibody may be an isolated antibody. Such binding to PROCR exhibits  a Kd with a value of, e.g., no greater than 1 μM, no greater than 100 nM or no greater than 50 nM. Kd can be measured by any methods known to a skilled in the art, such as a surface plasmon resonance assay or a cell binding assay. An anti-PROCR antibody may be a monoclonal llama antibody, e.g., GS5, GS4, GS2, HD13, HD21, HD44, HD58 or HD61 disclosed herein, or antigen-binding fragments thereof. Exemplary anti-PROCR antibodies inhibit PROCR binding with protein C. The anti-PROCR antibody may also be the “RCR-252” antibody, which refers to the monoclonal antibody having clone number RCR-252 as first described in Ye et al., “The endothelial cell protein C receptor (EPCR) functions as a primary receptor for protein C activation on endothelial cells in arteries, veins, and capillaries, ” Biochem Biophys Res Commun 1999, 259: 671. RCR-252 is a rat anti human PROCR antibody, and is commercially available from multiple sources, such as Abcam under Catalog No. ab81712 and Sigma under Product No. E6280.
The terms "cross-compete" , "cross-competition" , "cross-block" , "cross-blocked" and "cross-blocking" are used interchangeably herein to mean the ability of an antibody or fragment thereof to interfere with the binding directly or indirectly through allosteric modulation of the anti-PROCR antibodies of the present disclosure to the target PROCR. The extent to which an antibody or fragment thereof is able to interfere with the binding of another to the target, and therefore whether it can be said to cross-block or cross-compete according to the present disclosure, can be determined using competition binding assays. One particularly suitable quantitative cross-competition assay uses a FACS-or an AlphaScreen-based approach to measure competition between the labelled (e.g. His tagged, biotinylated or radioactive labelled) an antibody or fragment thereof and the other an antibody or fragment thereof in terms of their binding to the target. In general, a cross-competing antibody or fragment thereof is for example one which will bind to the target in the cross-competition assay such that, during the assay and in the presence of a second antibody or fragment thereof, the recorded displacement of the immunoglobulin single variable domain or polypeptide according to the disclosure is up to 100% (e.g., in FACS based competition assay) of the maximum theoretical displacement (e.g., displacement by cold (e.g., unlabeled) antibody or fragment thereof that needs to be cross-blocked) by the to be tested potentially cross-blocking antibody or fragment thereof that is present in a given amount. Preferably, cross-competing antibodies or fragments thereof have a recorded displacement that is between 10%and 100%, more preferred between 50%to 100%.
The terms “suppress” , “suppression” , “inhibit” , “inhibition” , “neutralize” and “neutralizing” as used interchangeably herein, refer to any statistically significant decrease in biological activity (e.g., PROCR activity or tumor cell growth) , including full blocking of the activity. For example, “inhibition” can refer to a decrease of about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%in biological activity.
The term “patient” includes a human or other mammalian animal that receives either prophylactic  or therapeutic treatment.
The terms “treat, ” “treating, ” and “treatment, ” as used herein, refer to therapeutic or preventative measures such as those described herein. The methods of “treatment” employ administration to a patient of a PROCR inhibitor provided herein, for example, a patient having TNBC, in order to prevent, cure, delay, reduce the severity of, or ameliorate one or more symptoms of the disease or disorder or recurring disease or disorder, or in order to prolong the survival of a patient beyond that expected in the absence of such treatment.
The term “effective amount, ” as used herein, refers to that amount of an agent, such as a PROCR inhibitor, for example an anti-PROCR antibody, which is sufficient to effect treatment, prognosis or diagnosis of PROCR-high TNBC, when administered to a patient. A therapeutically effective amount will vary depending upon the patient and disease condition being treated, the weight and age of the patient, the severity of the disease condition, the manner of administration and the like, which can readily be determined by one of ordinary skill in the art. The dosages for administration can range from, for example, about 1 ng to about 10,000 mg, about 5 ng to about 9,500 mg, about 10 ng to about 9,000 mg, about 20 ng to about 8,500 mg, about 30 ng to about 7,500 mg, about 40 ng to about 7,000 mg, about 50 ng to about 6,500 mg, about 100 ng to about 6,000 mg, about 200 ng to about 5,500 mg, about 300 ng to about 5,000 mg, about 400 ng to about 4,500 mg, about 500 ng to about 4,000 mg, about 1 μg to about 3,500 mg, about 5 μg to about 3,000 mg, about 10 μg to about 2, 600 mg, about 20 μg to about 2,575 mg, about 30 μg to about 2,550 mg, about 40 μg to about 2,500 mg, about 50 μg to about 2,475 mg, about 100 μg to about 2,450 mg, about 200 μg to about 2,425 mg, about 300 μg to about 2,000, about 400 μg to about 1,175 mg, about 500 μg to about 1,150 mg, about 0.5 mg to about 1,125 mg, about 1 mg to about 1,100 mg, about 1.25 mg to about 1,075 mg, about 1.5 mg to about 1,050 mg, about 2.0 mg to about 1,025 mg, about 2.5 mg to about 1,000 mg, about 3.0 mg to about 975 mg, about 3.5 mg to about 950 mg, about 4.0 mg to about 925 mg, about 4.5 mg to about 900 mg, about 5 mg to about 875 mg, about 10 mg to about 850 mg, about 20 mg to about 825 mg, about 30 mg to about 800 mg, about 40 mg to about 775 mg, about 50 mg to about 750 mg, about 100 mg to about 725 mg, about 200 mg to about 700 mg, about 300 mg to about 675 mg, about 400 mg to about 650 mg, about 500 mg, or about 525 mg to about 625 mg, of an antibody or antigen binding portion thereof, as provided herein. Dosing may be, e.g., every week, every 2 weeks, every three weeks, every 4 weeks, every 5 weeks or every 6 weeks. Dosage regimens may be adjusted to provide the optimum therapeutic response. An effective amount is also one in which any toxic or detrimental effects (side effects) of the agent are minimized and/or outweighed by the beneficial effects. Administration may be intravenous at exactly or about 6 mg/kg or 12 mg/kg weekly, or 12 mg/kg or 24 mg/kg biweekly. Additional dosing regimens are described below.
Other terms used in the fields of recombinant nucleic acid technology, microbiology, immunology,  antibody engineering, and molecular and cell biology as used herein will be generally understood by one of ordinary skill in the applicable arts. For example, conventional techniques may be used for preparing recombinant DNA, performing oligonucleotide synthesis, and practicing tissue culture and transformation (e.g., electroporation, transfection or lipofection) . Enzymatic reactions and purification techniques may be performed according to manufacturer's specifications or as commonly accomplished in the art or as described herein. The foregoing techniques and procedures may be generally performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification. See, e.g., Sambrook et al., 2001, Molecular Cloning: A Laboratory Manual, 3rd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., which is incorporated herein by reference for any purpose. Unless specific definitions are provided, the nomenclature utilized in connection with, and the laboratory procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well-known and commonly used in the art. Standard techniques may be used for chemical syntheses, chemical analyses, pharmaceutical preparation, formulation, and delivery, and treatment of patients.
As used herein the term "comprising" or "comprises" is used in reference to compositions, methods, and respective component (s) thereof, that are present in a given embodiment, yet open to the inclusion of unspecified elements.
As used herein the term "consisting essentially of" refers to those elements required for a given embodiment. The term permits the presence of additional elements that do not materially affect the basic and novel or functional characteristic (s) of that embodiment of the disclosure.
The term "consisting of" refers to compositions, methods, and respective components thereof as described herein, which are exclusive of any element not recited in that description of the embodiment.
As used in this specification and the appended claims, the singular forms "a, " "an, " and “the” include plural references unless the context clearly dictates otherwise. Thus for example, references to "the method" includes one or more methods, and/or steps of the type described herein and/or which will become apparent to those persons skilled in the art upon reading this disclosure and so forth.
Various aspects and embodiments are described in further detail in the following subsections.
PROCR-high TNBC
The human PROCR is a highly glycosylated type I transmembrane protein of 238 amino-acids (UniProtKB ID No. Q9UNN8) . These amino acids comprise a signal peptide (amino acids 1017) ,  an extracellular domain (amino acids 18-210) , a 21-aa transmembrane domain (amino acids 211-231) , and a 7-aa intracytoplasmic sequence (amino acids 232-238) together coding for an ～46 kDa protein. Deglycosylation will reduce the protein mass to 25 kDa. PROCR is expressed strongly on the endothelial cells of arteries and veins in heart and lung, less intensely in capillaries in the lung and skin, and not at all in the endothelium of small vessels of the liver and kidney.
PROCR is the receptor for protein C, a key player in the anticoagulation pathway. The protein C anticoagulant pathway serves as a major system for controlling thrombosis, limiting inflammatory responses, and potentially decreasing endothelial cell apoptosis in response to inflammatory cytokines and ischemia. The essential components of the pathway include thrombin, thrombomodulin, PROCR, protein C and protein S. The pathway is initiated when thrombin binds to thrombomodulin on the surface of endothelium. PROCR augments protein C activation by binding protein C and presenting it to the thrombin-thrombomodulin activation complex. Activated protein C (aPC) retains its ability to bind PROCR, and this complex appears to be involved in some of the cellular signaling mechanisms that down-regulate inflammatory cytokine formation (TNF, IL-6) . PROCR is shed from the vasculature by inflammatory mediators and thrombin. PROCR binds to activated neutrophils in a process that involves proteinase 3 and Mac-1. Furthermore, PROCR can undergo translocation from the plasma membrane to the nucleus.
PROCR can be cleaved to release a soluble form (sPROCR) in the circulation. This sPROCR is detected as a single species of 43 kDa, resulting from shedding of membrane PROCR by the action of a metalloprotease, which is stimulated by thrombin and by some inflammatory mediators. Soluble PROCR binds PC and aPC with similar affinity, but its binding to aPC inhibits the anticoagulant activity of aPC by blocking its binding to phospholipids and by abrogating its ability to inactivate factor Va. sPROCR can be detected in plasma. In normal persons, sPROCR is present in levels of 83.6 +/-17.2 ng/ml. Elevated levels of sPROCR are positively correlated to a higher risk for thrombosis. Furthermore, a haplotype (A3 allele) has been linked to elevated levels of sPROCR (264 +/-174 ng/ml) .
The full gene sequence of human Procr is 44819 bp (GenBank ID No. NC_000020.11) . The human cDNA sequence is 717 bp in length (GenBank ID No. NM_006404.4) . The full gene sequence of mouse Procr gene is 4354 bp (GenBank ID No. NC_000068.7) .
In some embodiments, the presence of PROCR and/or its expression level can be used as a biomarker for diagnosing and/or determining the prognosis of a specific subtype of TNBC, PROCR+ TNBC or PROCR-high TNBC. This is based on the surprising discovery that PROCR expression level is elevated in about 50-60%of TNBC cells.
PROCR protein level can be measured by mass spectrometry or an immunoassay using an anti-PROCR antibody, such as immunohistochemistry on a tissue sample or enzyme linked immunosorbent assay (ELISA) or Western blot. Alternatively, PROCR mRNA level can be  measured by quantitative reverse transcription PCR (qRT-PCR) or Northern blot or microarray. Other methods known in the art can also be used to detect the presence of PROCR and/or measure its expression level.
Kits for detecting PROCR and thus, diagnosing PROCR+ TNBC are also provided. The kit can include one or more anti-PROCR antibody disclosed herein, or antigen binding fragment thereof, for use in connection with an immunoassay such as immunohistochemistry or ELISA or Western blot. Alternatively, the kit can include specific primers and/or probes for use in connection with qRT-PCR or Northern blot. The kit can also include a microarray for detecting Procr mRNA or protein level where Procr gene or a fragment thereof, or anti-PROCR antibody or an antigen binding fragment thereof, can be attached to the microarray. A control sample along with a user instruction manual can additionally be included in the kit, wherein a difference (e.g., increase) in the test sample compared to the control sample (after normalization) indicates the presence of PROCR+ TNBC. The increase can be more than about 10%, more than about 20%, more than about 30%, more than about 50%, more than about 60%, more than about 80%, more than about 100%, or more, or any number therebetween.
PROCR Inhibitor and Use Thereof
In addition to being a strong marker for PROCR+ TNBC, inhibition of PROCR defeats the tumorigenicity and progression in this TNBC subtype. As such, PROCR inhibitors can be used as effective PROCR+ TNBC therapeutics.
Various PROCR inhibitors are included in the present disclosure. Examples include chemical compounds, such as small molecule inhibitors and biologic agents (e.g., antibodies) that can bind PROCR and inhibit or decrease its activity, e.g., binding to protein C. Agents that regulate Procr gene expression level are also included, such as interfering RNA (shRNA, siRNA) and gene editing/silencing tools (CRISPR/Cas9, TALENs, zinc finger nucleases) that are designed specifically to target the Procr gene or a regulatory sequence thereto.
In certain embodiments, the PROCR inhibitor is an anti-PROCR antibody, e.g., a monoclonal antibody. An exemplary anti-PROCR antibody is GS5, GS4 or GS2. Alternately, the anti-PROCR antibody can be an antibody that cross-competes with GS5, GS4 or GS2 for binding to PROCR. In another embodiment, the anti-PROCR antibody is an antibody comprising one or more the CDR sequences of GS5, GS4 and/or GS2, as shown below wherein the CDRs for each VHH are bold and underlined.
GS2 (SEQ ID NO: 1) :
Figure PCTCN2017115198-appb-000003
Figure PCTCN2017115198-appb-000004
GS4 (SEQ ID NO: 2) :
Figure PCTCN2017115198-appb-000005
GS5 (SEQ ID NO: 3) :
Figure PCTCN2017115198-appb-000006
In certain embodiments, the anti-PROCR antibody can be a modified, e.g., chimeric or humanized antibody derived from GS2, GS4 and/or GS5. Methods for making modified antibodies are known in the art. See below for details. The modified antibody can include one or more CDRs of GS2, GS4 and/or GS5. In one embodiment, the antibody includes one or more of CDR1 of GS2 (GSTFSITT (SEQ ID NO: 4) ) , CDR2 of GS2 (IIVVSDP (SEQ ID NO: 5) ) , and CDR3 of GS2 (VTSDHRGY (SEQ ID NO: 6) ) . In a further embodiment, the antibody includes one or more of CDR1 of GS4 or GS5 (GDITGDNC (SEQ ID NO: 7) ) , CDR2 of GS4 (IYTATGS (SEQ ID NO: 8) ) , CDR2 of GS5 (IHTATDS (SEQ ID NO: 9) ) , and CDR3 of GS4 or GS5 (PTNNRYPWGGCPLYEDAYNY (SEQ ID NO: 10) ) .
In certain embodiments, the anti-PROCR antibody can be selected from HD13, HD21, HD44, HD58 or HD61 as shown below, or an antigen-binding fragment thereof (e.g., the CDRs) . Alternately, the anti-PROCR antibody can be an antibody that cross-competes with HD13, HD21, HD44, HD58 or HD61 for binding to PROCR. In another embodiment, the anti-PROCR antibody is an antibody comprising one or more the CDR sequences of HD13, HD21, HD44, HD58, or HD61 (bold and underlined below) .
HD13-H (heavy chain, SEQ ID NO: 11; CDR1, CDR2 and CDR3 are underlined)
Figure PCTCN2017115198-appb-000007
HD21-H (heavy chain, SEQ ID NO: 12; CDR1, CDR2 and CDR3 are underlined)
Figure PCTCN2017115198-appb-000008
HD44-H (heavy chain, SEQ ID NO: 13; CDR1, CDR2 and CDR3 are underlined)
Figure PCTCN2017115198-appb-000009
HD58-H (heavy chain, SEQ ID NO: 14; CDR1, CDR2 and CDR3 are underlined)
Figure PCTCN2017115198-appb-000010
HD61-H (heavy chain, SEQ ID NO: 15; CDR1, CDR2 and CDR3 are underlined)
Figure PCTCN2017115198-appb-000011
Consensus sequence of heavy chains (SEQ ID NO: 16; CDR1, CDR2 and CDR3 are boxed)
Figure PCTCN2017115198-appb-000012
HD13-L (light chain, SEQ ID NO: 17; CDR1, CDR2 and CDR3 are underlined)
Figure PCTCN2017115198-appb-000013
HD21-L (light chain, SEQ ID NO: 18; CDR1, CDR2 and CDR3 are underlined)
Figure PCTCN2017115198-appb-000014
HD44-L (light chain, SEQ ID NO: 19; CDR1, CDR2 and CDR3 are underlined)
Figure PCTCN2017115198-appb-000015
HD58-L (light chain, SEQ ID NO: 20; CDR1, CDR2 and CDR3 are underlined)
Figure PCTCN2017115198-appb-000016
HD61-L (light chain, SEQ ID NO: 21; CDR1, CDR2 and CDR3 are underlined)
Figure PCTCN2017115198-appb-000017
Consensus sequence of light chains (bottom sequence, SEQ ID NO: 22; CDR1, CDR2 and CDR3 are underlined)
Figure PCTCN2017115198-appb-000018
In some embodiments, the anti-PROCR antibody is an antibody or antigen binding portion thereof which binds to an epitope of human PROCR, e.g., the extracellular domain. The anti-PROCR antibody can cross-compete with GS5, GS4, GS2, HD13, HD21, HD44, HD58 or HD61 for binding to the epitope. The epitope may be bound by GS5, GS4, GS2, HD13, HD21, HD44, HD58 or HD61. In addition, GS5, GS4, GS2, HD13, HD21, HD44, HD58 or HD61 may bind to a different but proximate epitope on PROCR. The anti-PROCR antibody can be characterized by at least partial inhibition of proliferation (e.g., by at least 10%relative to control) of a cancer cell expressing PROCR or by at least partial inhibition of tumor growth (e.g., volume and/or metastasis) in vivo in the patient or in a patient-derived xenograft.
In yet another embodiment, the anti-PROCR antibody can comprise a mixture, or cocktail, of two or more anti-PROCR antibodies, each of which binds to a different epitope on PROCR. In one  embodiment, the mixture, or cocktail, comprises three anti-PROCR antibodies, each of which binds to a different epitope on PROCR.
In another embodiment, the PROCR inhibitor comprises a nucleic acid molecule, such as an RNA molecule, that inhibits the expression or activity of PROCR. Interfering RNAs specific for Procr, such as shRNAs or siRNAs that specifically inhibits the expression and/or activity of Procr, can be designed in accordance with methods known in the art.
In some embodiments, PROCR-expressing cells (e.g., PROCR+ TNBC cells) or a patient-derived xenograft can be used as a model for screening for agents that inhibit PROCR expression and/or activity. An exemplary method includes: (a) providing a test agent to a plurality of PROCR+ TNBC cells, and (b) determining one or more of (1) PROCR expression level, (2) PROCR activity, and (3) survival and/or proliferation rate of the PROCR+ TNBC cells, wherein a decrease compared to a negative control not treated by the test agent indicates that the test agent is a PROCR inhibitor. Another exemplary method includes: (a) providing a test agent to a patient-derived PROCR+ TNBC xenograft, and (b) determining (1) PROCR expression level, (2) PROCR activity, and (3) tumor growth and/or metastasis in the xenograft, wherein a decrease compared to a negative control not treated by the test agent indicates that the test agent is a PROCR inhibitor. Yet another exemplary method includes: (a) providing a test agent, and (b) determining whether the test agent has one or more of the following characteristics: (i) binding to PROCR; (ii) interfering with or inhibiting binding of PROCR with protein C; (iii) cross-competing with GS5, GS4, GS2, HD13, HD21, HD44, HD58 or HD61; (iv) interfering with or inhibiting binding of GS5, GS4, GS2, HD13, HD21, HD44, HD58 or HD61 with PROCR; and/or (v) enhancing binding of GS5, GS4, GS2, HD13, HD21, HD44, HD58 or HD61 with PROCR; wherein the test agent is a PROCR inhibitor if it has one or more of (i) - (v) . These methods can be performed in vitro or in vivo. The test agent can be an antibody, a small molecule, a peptide and/or a nucleic acid.
In one aspect, use of a PROCR inhibitor for the manufacture of a medicament for the treatment of PROCR+ TNBC is provided. In another aspect, a method of suppressing growth of a PROCR+TNBC cell is provided, the method comprising contacting the cell with an effective amount of a PROCR inhibitor. In another aspect, a method of suppressing growth of a PROCR+ TNBC tumor in a patient is provided, the method comprising administering to the patient an effective amount of a PROCR inhibitor. In yet another aspect, a method of treating a patient for a PROCR+ TNBC tumor is provided, the method comprising administering to the patient an effective amount of a PROCR inhibitor. In still another aspect, a method of treating a breast cancer tumor in a patient is provided, the method comprising: selecting a patient with a PROCR+ TNBC tumor; and administering to the patient an effective amount of a PROCR inhibitor. In one embodiment of any of the above methods, the PROCR inhibitor is an anti-PROCR antibody. An exemplary anti-PROCR antibody is GS5, GS4, GS2, HD13, HD21, HD44, HD58 or HD61 or an antigen binding  fragment thereof, or an antibody that cross-competes with GS5, GS4, GS2, HD13, HD21, HD44, HD58 or HD61 in PROCR binding.
Preparation of Anti-PROCR Antibodies
Antibodies typically comprise two identical pairs of polypeptide chains, each pair having one full-length “light” chain (typically having a molecular weight of about 25 kDa) and one full-length “heavy” chain (typically having a molecular weight of about 50-70 kDa) . The amino-terminal portion of each chain typically includes a variable region of about 100 to 110 or more amino acids that typically is responsible for antigen recognition. The carboxy-terminal portion of each chain typically defines a constant region responsible for effector function. The variable regions of each of the heavy chains and light chains typically exhibit the same general structure comprising four relatively conserved framework regions (FR) joined by three hyper variable regions, also called complementarity determining regions or CDRs. The CDRs from the two chains of each pair typically are aligned by the framework regions, which alignment may enable binding to a specific epitope. From N-terminal to C-terminal, both light and heavy chain variable regions typically comprise the domains FR1, CDR1, FR2, CDR2, FR3, CDR3 and FR4. The assignment of amino acids to each domain is typically in accordance with the definitions of Kabat Sequences of Proteins of Immunological Interest (1987 and 1991, National Institutes of Health, Bethesda, Md. ) , Chothia &Lesk, 1987, J. Mol. Biol. 196: 901-917, or Chothia et al., 1989, Nature 342: 878-883) .
Antibodies became useful and of interest as pharmaceutical agents with the development of monoclonal antibodies. Monoclonal antibodies are produced using any method that produces antibody molecules by continuous cell lines in culture. Examples of suitable methods for preparing monoclonal antibodies include the hybridoma methods of Kohler et al. (1975, Nature 256: 495-497) and the human B-cell hybridoma method (Kozbor, 1984, J. Immunol. 133: 3001; and Brodeur et al., 1987, Monoclonal Antibody Production Techniques and Applications, Marcel Dekker, Inc., New York, pp. 51-63) .
Monoclonal antibodies may be modified for use as therapeutics. One example is a “chimeric” antibody in which a portion of the heavy chain and/or light chain is identical with or homologous to a corresponding sequence in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain (s) is/are identical with or homologous to a corresponding sequence in antibodies derived from another species or belonging to another antibody class or subclass. Other examples are fragments of such antibodies, so long as they exhibit the desired biological activity. See, U.S. Pat. No. 4,816,567; and Morrison et al. (1985) , Proc. Natl. Acad. Sci. USA 81: 6851-6855. A related development is the “CDR-grafted” antibody, in which the antibody comprises one or more complementarity determining regions (CDRs) from a  particular species or belonging to a particular antibody class or subclass, while the remainder of the antibody chain (s) is/are identical with or homologous to a corresponding sequence in antibodies derived from another species or belonging to another antibody class or subclass.
Another development is the “humanized” antibody. Methods for humanizing non-human antibodies are well known in the art (see U.S. Pat. Nos. 5,585,089, and 5,693,762; see also Cécile Vincke et al. J. Biol. Chem. 2009; 284: 3273-3284 for humanization of llama antibodies) . Generally, a humanized antibody is produced by a non-human animal, and then certain amino acid residues, typically from non-antigen recognizing portions of the antibody, are modified to be homologous to said residues in a human antibody of corresponding isotype. Humanization can be performed, for example, using methods described in the art (Jones et al., 1986, Nature 321: 522-525; Riechmann et al., 1988, Nature 332: 323-327; Verhoeyen et al., 1988, Science 239: 1534-1536) , by substituting at least a portion of a rodent variable region for the corresponding regions of a human antibody.
More recent is the development of human antibodies without exposure of antigen to human beings ( “fully human antibodies” ) . Using transgenic animals (e.g., mice) that are capable of producing a repertoire of human antibodies in the absence of endogenous mouse immunoglobulin production, such antibodies are produced by immunization with an antigen (typically having at least 6 contiguous amino acids) , optionally conjugated to a carrier. See, for example, Jakobovits et al., 1993, Proc. Natl. Acad. Sci. USA 90: 2551-2555; Jakobovits et al., 1993, Nature 362: 255-258; and Bruggermann et al., 1993, Year in Immunol. 7: 33. In one example of these methods, transgenic animals are produced by incapacitating the endogenous mouse immunoglobulin loci encoding the mouse heavy and light immunoglobulin chains therein, and inserting loci encoding human heavy and light chain proteins into the genome thereof. Partially modified animals, which have less than the full complement of modifications, are then cross-bred to obtain an animal having all of the desired immune system modifications. When administered an immunogen, these transgenic animals produce antibodies that are immunospecific for these antigens having human (rather than murine) amino acid sequences, including variable regions. See PCT Publication Nos. WO96/33735 and WO94/02602, incorporated by reference. Additional methods are described in U.S. Pat. No. 5,545,807, PCT Publication Nos. WO91/10741, WO90/04036, and in EP 546073B1 and EP 546073A1, incorporated by reference. Human antibodies may also be produced by the expression of recombinant DNA in host cells or by expression in hybridoma cells as described herein.
Fully human antibodies can also be produced from phage-display libraries (as disclosed in Hoogenboom et al., 1991, J. Mol. Biol. 227: 381; and Marks et al., 1991, J. Mol. Biol. 222: 581) . These processes mimic immune selection through the display of antibody repertoires on the surface of filamentous bacteriophage, and subsequent selection of phage by their binding to an antigen of choice. One such technique is described in PCT Publication No. WO99/10494, incorporated by reference, which describes the isolation of high affinity and functional agonistic antibodies for  MPL-and msk-receptors using such an approach.
Once the nucleotide sequences encoding the above antibodies have been determined, chimeric, CDR-grafted, humanized, and fully human antibodies also may be produced by recombinant methods. Nucleic acids encoding the antibodies are introduced into host cells and expressed using materials and procedures generally known in the art.
The disclosure provides one or more monoclonal antibodies against PROCR. Preferably, the antibodies bind PROCR. In preferred embodiments, the disclosure provides nucleotide sequences encoding, and amino acid sequences comprising, heavy and light chain immunoglobulin molecules, particularly sequences corresponding to the variable regions thereof. In preferred embodiments, sequences corresponding to CDRs, specifically from CDR1 through CDR3, are provided. In additional embodiments, the disclosure provides hybridoma cell lines expressing such immunoglobulin molecules and monoclonal antibodies produced therefrom, preferably purified human monoclonal antibodies against human PROCR.
The CDRs of the light and heavy chain variable regions of anti-PROCR antibodies of the disclosure can be grafted to framework regions (FRs) from the same, or another, species. In certain embodiments, the CDRs of the light and heavy chain variable regions of anti-PROCR antibody may be grafted to consensus human FRs. To create consensus human FRs, FRs from several human heavy chain or light chain amino acid sequences are aligned to identify a consensus amino acid sequence. The FRs of the anti-PROCR antibody heavy chain or light chain can be replaced with the FRs from a different heavy chain or light chain. Rare amino acids in the FRs of the heavy and light chains of anti-PROCR antibody typically are not replaced, while the rest of the FR amino acids can be replaced. Rare amino acids are specific amino acids that are in positions in which they are not usually found in FRs. The grafted variable regions from anti-PROCR antibodies of the disclosure can be used with a constant region that is different from the constant region of anti-PROCR antibody. Alternatively, the grafted variable regions are part of a single chain Fv antibody. CDR grafting is described, e.g., in U.S. Pat. Nos. 6,180,370, 5,693,762, 5,693,761, 5,585,089, and 5,530,101, which are hereby incorporated by reference for any purpose.
In certain embodiments, the disclosure provides an anti-PROCR antibody GS5, GS4, GS2, HD13, HD21, HD44, HD58 or HD61. In other embodiments, the disclosure provides anti-PROCR antibodies that comprise one or more CDRs of GS5, GS4, GS2, HD13, HD21, HD44, HD58 or HD61.
In some embodiments, antibodies of the disclosure can be produced by hybridoma lines. In these embodiments, the antibodies of the disclosure bind to PROCR with a dissociation constant (Kd) of between approximately 4 pM and 1 μM. In certain embodiments of the disclosure, the antibodies bind to PROCR with a Kd of less than about 100 nM, less than about 50 nM or less than about 10  nM.
In preferred embodiments, the antibodies of the disclosure are of the IgG1, IgG2, or IgG4 isotype, with the IgG1 isotype most preferred. In preferred embodiments of the disclosure, the antibodies comprise a human kappa light chain and a human IgG1, IgG2, or IgG4 heavy chain. In particular embodiments, the variable regions of the antibodies are ligated to a constant region other than the constant region for the IgG1, IgG2, or IgG4 isotype. In certain embodiments, the antibodies of the disclosure have been cloned for expression in mammalian cells.
In alternative embodiments, antibodies of the disclosure can be expressed in cell lines other than hybridoma cell lines. In these embodiments, sequences encoding particular antibodies can be used for transformation of a suitable mammalian host cell. According to these embodiments, transformation can be achieved using any known method for introducing polynucleotides into a host cell, including, for example packaging the polynucleotide in a virus (or into a viral vector) and transducing a host cell with the virus (or vector) or by transfection procedures known in the art. Such procedures are exemplified by U.S. Pat. Nos. 4,399,216, 4,912,040, 4,740,461, and 4,959,455 (all of which are hereby incorporated herein by reference for any purpose) . Generally, the transformation procedure used may depend upon the host to be transformed. Methods for introducing heterologous polynucleotides into mammalian cells are well known in the art and include, but are not limited to, dextran-mediated transfection, calcium phosphate precipitation, polybrene-mediated transfection, protoplast fusion, electroporation, encapsulation of the polynucleotide (s) in liposomes, and direct microinjection of the DNA into nuclei.
According to certain embodiments of the methods of the disclosure, a nucleic acid molecule encoding the amino acid sequence of a heavy chain constant region, a heavy chain variable region, a light chain constant region, or a light chain variable region of a PROCR antibody of the disclosure is inserted into an appropriate expression vector using standard ligation techniques. In a preferred embodiment, the PROCR heavy or light chain constant region is appended to the C-terminus of the appropriate variable region and is ligated into an expression vector. The vector is typically selected to be functional in the particular host cell employed (i.e., the vector is compatible with the host cell machinery such that amplification of the gene and/or expression of the gene can occur) . For a review of expression vectors, see, Goeddel (ed. ) , 1990, Meth. Enzymol. Vol. 185, Academic Press. N.Y.
Typically, expression vectors used in any of the host cells will contain sequences for plasmid maintenance and for cloning and expression of exogenous nucleotide sequences. Such sequences typically include one or more of the following nucleotide sequences: a promoter, one or more enhancer sequences, an origin of replication, a transcriptional termination sequence, a complete intron sequence containing a donor and acceptor splice site, a sequence encoding a leader sequence  for polypeptide secretion, a ribosome binding site, a polyadenylation sequence, a polylinker region for inserting the nucleic acid encoding the polypeptide to be expressed, and a selectable marker element. These sequences are well known in the art.
Expression vectors of the disclosure may be constructed from a starting vector such as a commercially available vector. Such vectors may or may not contain all of the desired flanking sequences. Where one or more of the flanking sequences described herein are not already present in the vector, they may be individually obtained and ligated into the vector. Methods used for obtaining each of the flanking sequences are well known to one skilled in the art.
After the vector has been constructed and a nucleic acid molecule encoding light chain or heavy chain or light chain and heavy chain comprising an anti-PROCR antibody has been inserted into the proper site of the vector, the completed vector may be inserted into a suitable host cell for amplification and/or polypeptide expression. The transformation of an expression vector for an anti-PROCR antibody into a selected host cell may be accomplished by well-known methods including transfection, infection, calcium phosphate co-precipitation, electroporation, microinjection, lipofection, DEAE-dextran mediated transfection, or other known techniques. The method selected will in part be a function of the type of host cell to be used. These methods and other suitable methods are well known to the skilled artisan, and are set forth, for example, in Sambrook et al., supra.
The host cell, when cultured under appropriate conditions, synthesizes an anti-PROCR antibody that can subsequently be collected from the culture medium (if the host cell secretes it into the medium) or directly from the host cell producing it (if it is not secreted) . The selection of an appropriate host cell will depend upon various factors, such as desired expression levels, polypeptide modifications that are desirable or necessary for activity (such as glycosylation or phosphorylation) and ease of folding into a biologically active molecule.
Mammalian cell lines available as hosts for expression are well known in the art and include, but are not limited to, many immortalized cell lines available from the American Type Culture Collection (ATCC) , including but not limited to Chinese hamster ovary (CHO) cells, HeLa cells, baby hamster kidney (BHK) cells, monkey kidney cells (COS) , human hepatocellular carcinoma cells (e.g., Hep G2) , and a number of other cell lines. In certain embodiments, one may select cell lines by determining which cell lines have high expression levels and produce antibodies with constitutive PROCR binding properties. In another embodiment, one may select a cell line from the B cell lineage that does not make its own antibody but has a capacity to make and secrete a heterologous antibody (e.g., mouse myeloma cell lines NS0 and SP2/0) .
Pharmaceutical Compositions and Use Thereof
In another aspect, pharmaceutical compositions are provided that can be used in the methods disclosed herein, i.e., pharmaceutical compositions for treating PROCR+ TNBC.
In one embodiment, the pharmaceutical composition for treating TNBC comprises a PROCR inhibitor and a pharmaceutical carrier. The PROCR inhibitor can be formulated with the pharmaceutical carrier into a pharmaceutical composition. Additionally, the pharmaceutical composition can include, for example, instructions for use of the composition for the treatment of patients for PROCR+ TNBC.
In one embodiment, the PROCR inhibitor in the composition is an anti-PROCR antibody, e.g., GS5, GS4, GS2, HD13, HD21, HD44, HD58 or HD61 or an antibody comprising the CDRs of GS5, GS4, GS2, HD13, HD21, HD44, HD58 or HD61 positioned in the antibody in the same relative order as they are present in GS5, GS4, GS2, HD13, HD21, HD44, HD58 or HD61 so as to provide immunospecific binding of PROCR. In some embodiments, antibodies or antigen binding fragments thereof that can cross-compete with GS5, GS4, GS2, HD13, HD21, HD44, HD58 or HD61 in PROCR binding are provided by the present disclosure.
As used herein, “pharmaceutically acceptable carrier” includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, and other excipients that are physiologically compatible. Preferably, the carrier is suitable for parenteral, oral, or topical administration. Depending on the route of administration, the active compound, e.g., small molecule or biologic agent, may be coated in a material to protect the compound from the action of acids and other natural conditions that may inactivate the compound.
Pharmaceutically acceptable carriers include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion, as well as conventional excipients for the preparation of tablets, pills, capsules and the like. The use of such media and agents for the formulation of pharmaceutically active substances is known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the pharmaceutical compositions provided herein is contemplated. Supplementary active compounds can also be incorporated into the compositions.
A pharmaceutically acceptable carrier can include a pharmaceutically acceptable antioxidant. Examples of pharmaceutically-acceptable antioxidants include: (1) water soluble antioxidants, such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite and the like; (2) oil-soluble antioxidants, such as ascorbyl palmitate, butylated hydroxyanisole (BHA) , butylated hydroxytoluene (BHT) , lecithin, propyl gallate, alpha-tocopherol, and the like; and (3) metal chelating agents, such as citric acid, ethylenediamine tetraacetic acid (EDTA) , sorbitol, tartaric acid, phosphoric acid, and the like.
Examples of suitable aqueous and nonaqueous carriers which may be employed in the  pharmaceutical compositions provided herein include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like) , and suitable mixtures thereof, and injectable organic esters, such as ethyl oleate. When required, proper fluidity can be maintained, for example, by the use of coating materials, such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. In many cases, it will be useful to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent that delays absorption, for example, monostearate salts and gelatin.
These compositions may also contain functional excipients such as preservatives, wetting agents, emulsifying agents and dispersing agents.
Therapeutic compositions typically must be sterile, non-phylogenic, and stable under the conditions of manufacture and storage. The composition can be formulated as a solution, microemulsion, liposome, or other ordered structure suitable to high drug concentration.
Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by sterilization, e.g., by microfiltration. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle that contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, methods of preparation include vacuum drying and freeze-drying (lyophilization) that yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof. The active agent (s) may be mixed under sterile conditions with additional pharmaceutically acceptable carrier (s) , and with any preservatives, buffers, or propellants which may be required.
Prevention of presence of microorganisms may be ensured both by sterilization procedures, supra, and by the inclusion of various antibacterial and antifungal agents, for example, paraben, chlorobutanol, phenol sorbic acid, and the like. It may also be desirable to include isotonic agents, such as sugars, sodium chloride, and the like into the compositions. In addition, prolonged absorption of the injectable pharmaceutical form may be brought about by the inclusion of agents which delay absorption such as aluminum monostearate and gelatin.
Pharmaceutical compositions comprising a PROCR inhibitor can be administered alone or in combination therapy. For example, the combination therapy can include a composition provided herein comprising a PROCR inhibitor and at least one or more additional therapeutic agents, such as one or more chemotherapeutic agents known in the art, discussed in further detail below. Pharmaceutical compositions can also be administered in conjunction with radiation therapy and/or  surgery.
Dosage regimens are adjusted to provide the optimum desired response (e.g., a therapeutic response) . For example, a single bolus may be administered, several divided doses may be administered over time or the dose may be proportionally reduced or increased as indicated by the exigencies of the therapeutic situation.
Exemplary dosage ranges for administration of an antibody include: 10-1000 mg (antibody) /kg (body weight of the patient) , 10-800 mg/kg, 10-600 mg/kg, 10-400 mg/kg, 10-200 mg/kg, 30-1000 mg/kg, 30-800 mg/kg, 30-600 mg/kg, 30-400 mg/kg, 30-200 mg/kg, 50-1000 mg/kg, 50-800 mg/kg, 50-600 mg/kg, 50-400 mg/kg, 50-200 mg/kg, 100-1000 mg/kg, 100-900 mg/kg, 100-800 mg/kg, 100-700 mg/kg, 100-600 mg/kg, 100-500 mg/kg, 100-400 mg/kg, 100-300 mg/kg and 100-200 mg/kg. Exemplary dosage schedules include once every three days, once every five days, once every seven days (i.e., once a week) , once every 10 days, once every 14 days (i.e., once every two weeks) , once every 21 days (i.e., once every three weeks) , once every 28 days (i.e., once every four weeks) and once a month.
It may be advantageous to formulate parenteral compositions in unit dosage form for ease of administration and uniformity of dosage. Unit dosage form as used herein refers to physically discrete units suited as unitary dosages for the patients to be treated; each unit contains a predetermined quantity of active agent calculated to produce the desired therapeutic effect in association with any required pharmaceutical carrier. The specification for unit dosage forms are dictated by and directly dependent on (a) the unique characteristics of the active compound and the particular therapeutic effect to be achieved, and (b) the limitations inherent in the art of compounding such an active compound for the treatment of sensitivity in individuals.
Actual dosage levels of the active ingredients in the pharmaceutical compositions disclosed herein may be varied so as to obtain an amount of the active ingredient which is effective to achieve the desired therapeutic response for a particular patient, composition, and mode of administration, without being toxic to the patient. “Parenteral” as used herein in the context of administration means modes of administration other than enteral and topical administration, usually by injection, and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, epidural and intrasternal injection and infusion.
The phrases “parenteral administration” and “administered parenterally” as used herein refer to modes of administration other than enteral (i.e., via the digestive tract) and topical administration, usually by injection or infusion, and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal,  transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, epidural and intrasternal injection and infusion. Intravenous injection and infusion are often (but not exclusively) used for antibody administration.
When agents provided herein are administered as pharmaceuticals, to humans or animals, they can be given alone or as a pharmaceutical composition containing, for example, 0.001 to 90% (e.g., 0.005 to 70%, e.g., 0.01 to 30%) of active ingredient in combination with a pharmaceutically acceptable carrier.
In certain embodiments, the methods and uses provided herein for suppressing growth of PROCR+TNBC cells or for treating a patient with PROCR+ TNBC can comprise administration of a PROCR inhibitor and at least one additional anti-cancer agent that is not a PROCR inhibitor.
In one embodiment, the at least one additional anti-cancer agent comprises at least one chemotherapeutic drug. Non-limiting examples of such chemotherapeutic drugs include platinum-based chemotherapy drugs (e.g., cisplatin, carboplatin) , taxanes (e.g., paclitaxel
Figure PCTCN2017115198-appb-000019
docetaxel
Figure PCTCN2017115198-appb-000020
EndoTAG-1TM (a formulation of paclitaxel encapsulated in positively charged lipid-based complexes; MediGene) , 
Figure PCTCN2017115198-appb-000021
 (a formulation of paclitaxel bound to albumin) ) , tyrosine kinase inhibitors (e.g., 
Figure PCTCN2017115198-appb-000022
Figure PCTCN2017115198-appb-000023
) , and combinations thereof.
In another embodiment, the at least one additional anti-cancer agent comprises an EGFR inhibitor, such as an anti-EGFR antibody or a small molecule inhibitor of EGFR signaling. An exemplary anti-EGFR antibody is cetuximab
Figure PCTCN2017115198-appb-000024
Cetuximab is commercially available from ImClone Systems Incorporated. Other examples of anti-EGFR antibodies include matuzumab (EMD72000) , panitumumab (
Figure PCTCN2017115198-appb-000025
Amgen) ; nimotuzumab (TheraCIMTM) and mAb 806. An exemplary small molecule inhibitor of the EGFR signaling pathway is gefitinib
Figure PCTCN2017115198-appb-000026
which is commercially available from AstraZeneca and Teva. Other examples of small molecule inhibitors of the EGFR signaling pathway include erlotinib HCL (OSI-774; 
Figure PCTCN2017115198-appb-000027
OSI Pharma) ; lapatinib (
Figure PCTCN2017115198-appb-000028
GlaxoSmithKline) ; canertinib (canertinib dihydrochloride, Pfizer) ; pelitinib (Pfizer) ; PKI-166 (Novartis) ; PD158780; and AG 1478 (4- (3-Chloroanillino) -6, 7-dimethoxyquinazoline) .
In yet another embodiment, the at least one additional anti-cancer agent comprises a VEGF inhibitor. An exemplary VEGF inhibitor comprises an anti-VEGF antibody, such as bevacizumab (
Figure PCTCN2017115198-appb-000029
Genentech) .
In still another embodiment, the at least one additional anti-cancer agent comprises an anti-ErbB2 antibody. Suitable anti-ErbB2 antibodies include trastuzumab and pertuzumab.
In one aspect, the improved effectiveness of a combination according to the disclosure can be  demonstrated by achieving therapeutic synergy.
The term “therapeutic synergy” is used when the combination of two products at given doses is more efficacious than the best of each of the two products alone at the same doses. In one example, therapeutic synergy can be evaluated by comparing a combination to the best single agent using estimates obtained from a two-way analysis of variance with repeated measurements (e.g., time factor) on parameter tumor volume.
The term “additive” refers to when the combination of two or more products at given doses is equally efficacious than the sum of the efficacies obtained with of each of the two or more products, whilst the term “superadditive” refers to when the combination is more efficacious than the sum of the efficacies obtained with of each of the two or more products.
Another measure by which effectiveness (including effectiveness of combinations) can be quantified is by calculating the log10 cell kill, which is determined according to the following equation: log10 cell kill=T-C (days) /3.32×Td
in which T-C represents the delay in growth of the cells, which is the average time, in days, for the tumors of the treated group (T) and the tumors of the control group (C) to have reached a predetermined value (1 g, or 10 mL, for example) , and Td represents the time, in days necessary for the volume of the tumor to double in the control animals. When applying this measure, a product is considered to be active if log10 cell kill is greater than or equal to 0.7 and a product is considered to be very active if log10 cell kill is greater than 2.8.
Using this measure, a combination, used at its own maximum tolerated dose, in which each of the constituents is present at a dose generally less than or equal to its maximum tolerated dose, exhibits therapeutic synergy when the log10 cell kill is greater than the value of the log10 cell kill of the best constituent when it is administered alone. In an exemplary case, the log10 cell kill of the combination exceeds the value of the log10 cell kill of the best constituent of the combination by at least one log cell kill.
EXAMPLES
The following examples, including the experiments conducted and results achieved are provided for illustrative purposes only and are not to be construed as limiting the disclosure.
Example 1: Targeting Protein C Receptor to inhibit cancer stem cells in a subgroup of triple negative breast cancer
Breast Cancer is a heterogeneous disease. In particular, triple-negative breast cancer (TNBC) comprises various molecular subgroups with unclear identities and currently has few targeted treatment options. We have recently identified the Protein C Receptor (Procr) as surface  marker on mammary stem cells (MaSCs) , located in the basal layer of the normal mammary gland. Given the possible origin of TNBC from basal layer stem cells, we conducted comparative analyses of Procr in breast cancer of mouse and human origin. In mouse mammary tissues, Procr was required for the mammary development and homeostasis. Shown by xenograft and lineage tracing experiments, Procr+ cells were enriched for cancer stem cells (CSCs) in Wnt1 basal-like tumor, but not Brca1 basal-like tumor or PyVT luminal tumor. In human cancers, PROCR was robustly expressed in half of TNBC cases. Experiments with patient-derived xenograft (PDX) reveal that PROCR marks CSCs in this discrete subgroup (referred to as PROCR+ BC) . Interfering the function of PROCR using an inhibitory nanobody arrested tumor growth and prevented rapid tumor recurrence. Our data reveal the essential role of Procr in MaSC maintenance and suggest a key role of MaSC in breast tumorigenesis. Moreover, our work suggests PROCR as a biomarker to stratify TNBC into clinically relevant subgroups and may provide a novel targeted treatment strategy for this clinically important tumor subtype.
As summarized in Figure 15, (1) Procr is essential for mouse MaSC properties and marks CSCs in Wnt1 basal-like mammary tumor; (2) PROCR is a biomarker to stratify human TNBC into clinically relevant subgroups, PROCR+ TNBC (PROCR+ BC) and PROCR-TNBC; (3) PROCR expression is enriched for CSCs in PROCR+ BC; and (4) development of a PROCR inhibitory antibody such as a nanobody can effectively suppress PDX tumor formation.
Results
Introduction
Breast cancer (BC) comprises many biologically different entities with distinct clinical outcomes. To classify BC, immunohistochemistry (IHC) markers such as estrogen receptor (ER) , progesterone receptor (PR) and HER2, together with clinicopathological features, are conventionally used for patient prognosis and management. IHC markers separate patients into four subgroups, Luminal A (ER+, PR+) , Luminal B (ER+, PR+, HER2/Ki67+) , HER2 (HER2+) and Triple-negative breast cancer (TNBC, i.e. lack of ER and PR expression, and absence of HER2 amplification or overexpression) (Foulkes et al., 2010) . TNBCs account for 15-20%of newly diagnosed breast cancer cases, and are generally associated with a high risk of disease recurrence and poor patient survival (Foulkes et al., 2010; Lehmann et al., 2011) . TNBC is a difficult and complex disease and its clinical outcome has been unsatisfactory, even when diagonosed at an early stage of the disease (Carey et al., 2010; Foulkes et al., 2010; Metzger-Filho et al., 2012) . TNBCs are heterogeneous in terms of biology, prognosis and response to treatment (Adamo and Anders, 2011; Perou et al., 2000; Prat et al., 2010) . The absence of well-defined molecular targets is a major challenge in treating patients with TNBC. Thus, stratifying TNBCs into well-defined molecular subgroups and identifying molecular drivers on which to base targeted therapy is of utmost importance.
Gene profiling studies suggest that TNBC is similar in gene expression to normal stem cells in the mammary gland (Lim et al., 2009; Prat et al., 2010) . Despite these advances, the putative link between normal mammary stem cells (MaSCs) and breast cancer stem cells remains elusive. On the other hand, there are evidences suggesting that TNBCs derived from BRCA1-mutant carriers are originated from mammary luminal progenitors (Lim et al., 2009; Molyneux et al., 2010; Nolan et al., 2016; Proia et al., 2011; Sau et al., 2016) , thus implying that normal MaSCs are less relevant to CSCs in these cancers. Based on the increasing awareness that cancer of distinct subtypes may derive from different cell-of-origin (Li et al., 2003; Visvader, 2011) , the seemingly paradox regarding the relationship of MaSCs and TNBC is likely due to the heterogeneity of TNBCs. In this work, we have therefore investigated whether MaSCs are associated with a particular subtype of TNBC. Our previous study identifies Procr as a surface marker for MaSCs (Lin-, CD24+, CD29hi, Procr+) in the normal mouse mammary gland (Wang et al., 2015) . In this work, we investigated the functional role of Procr in mouse MaSCs, mammary tumor models and human breast cancers, and reveal the biological significance of Procr expression. Finally, we explored its potential utility in the diagnosis and therapy of TNBC.
Procr is required for MaSCs during development and homeostasis
To investigate the functional role of Procr in MaSCs, we generated Procr conditional deletion allele (Procrflox/+) , with two loxP sites inserted to flank exon 2-4 (Figure 1a, Figure 8a-b and Methods for detail) . Procrflox/+ and homozygeous mutant (Procrflox/flox) mice are grossly normal (data not shown) . To delete Procr specifically in MaSCs, the ProcrCreER-IRES-tdTomat/+ mice (Wang et al., 2015) , hereafter referred to as ProcrCreER/+, were bred to Procrflox/+ mice. The resulting ProcrCreER/flox (cKO) mice developed normally and their mammary glands displayed no discernable phenotypes (data not shown) . Tamoxifen (TAM) was administered in the control (Procrflox/+) and cKO pre-pubertal mice (2-week old) . The phenotype resulted from Procr deletion was evaluated in adult (8-week old) . The control mammary gland has completed the epithelium extension and occupied the whole fat pad (Figure 1b) . Strikingly, in cKO mice, the growth of the epithelium was strongly retarded: the mammary gland had very few branches close to the nipple (Figure 1b) . When deletion of Procr was induced at puberty (4-week old) , the development of the mutant mammary gland was also halted: when examined in adult (8-week old) , the growth of the epithelium stopped at a position close to the lymph node, where pubertal mammary epithelium is (Figure 8c-d) .
To investigate the role of Procr in homeostasis of adult mice, deletion was induced in mice of 8-weeks, in which both control and cKO mammary gland had finished epithelium extension. At 3 weeks post deletion, cKO mammary branches appeared sparser with fewer side branches (Figure 8e-f) . More noticeably, cKO mammary gland had significantly fewer numbers of basal cells shown by whole mount immunostaining and fluorescence-activating cell sorting (FACS) (Figure 1c-d) . The successful knockout of Procr in animals of all stages was confirmed (Figure 8g) .
Since Procr is also expressed in other tissues, e.g. endothelium and mesenchyme, to avoid the potential systemic effects, we transplanted 100 MaSCs (Lin-, CD24+, CD29hi, Procr+) isolated from control or cKO (prior to Procr deletion) to Nude recipient animals. TAM was administered at various time points (2-week or 4-week) post transplantation to commence Procr deletion in the transplants; the outgrowths were evaluated at 9-week post transplantation (Figure 8h) . When TAM was injected at 2-week, deletion of Procr in the transplant resulted in smaller mammary outgrowth compared to the control (Figure 8i) . When TAM was injected at 4-week post transplantation, allowing enough time for the wild type outgrowth to fill the fat pad, deletion of Procr in the transplant resulted in fewer side branches and reduced basal cells compared to the control (Figure 8j-k) , reminiscent of phenotype seen in Procr KO in adult. Together, these data suggest that Procr is essential for MaSCs in developing mammary gland, mammary homeostasis and regeneration.
Procr marks CSCs in MMTV-Wnt1 mammary basal-like tumor
We next investigated the role of Procr in tumor formation using three distinct mammary tumor models, MMTV-Wnt1 that preferentially induces tumor from stem/progenitor cells (Li et al., 2003) , and shares transcriptional patterns with human basal-like breast cancer and TNBC (Herschkowitz et al., 2007; Tsukamoto et al., 1988) , MMTV-PyVT tumor that is closely clustered to the luminal B subtype (Guy et al., 1992; Herschkowitz et al., 2007) , and MMTV-Cre; Brca1f/+; p53f/+ tumor associated with the human BRCA1 basal-like tumor (Herschkowitz et al., 2007; Xu et al., 1999) . In all three tumors, Procr+ cells are distributed in a small portion of basal cells and some stromal cells (Figure 9a-c) . To investigate whether Procr+ cells are enriched for CSCs in these tumors, Procr+ cells (Lin-, CD24+, CD29hi, Procr+) and Procr-cells (Lin-, CD24+, CD29hi, Procr-) were isolated from the tumors and xenografted to fat pads of recipients in limiting dilution. For MMTV-Wnt1/FVB tumor grafting to FVB recipients, Procr+ cells reconstituted tumors robustly, whereas in sharp contrast, Procr-cells failed to form tumors (Figure 2a, Figure 9d) . Same results were observed when using Nude recipients (Figure 9e-g) . These results suggest that Procr+ cells are enriched for CSCs of MMTV-Wnt1 tumors. Of note, a previous study suggests that transplantation of a mixture of MMTV-Wnt1 basal and luminal cells, but not MMTV-Wnt1 basal cells alone (in mixed genetic background) , can reconstitute tumors in transplantation assays (Cleary et al., 2014) . However our data suggest that MMTV-Wnt1 basal cells alone in FVB background, in particular Procr+ basal cells, can efficiently generate tumors upon transplantation. The observed discrepancies could be explained by differences in genetic background that has been reported to affect the dynamics of MMTV-Wnt1 tumor formation (Li et al., 2000) . Similar experiments were carried out using MMTV-PyVT tumor and MMTV-Cre; Brca1f/+; p53f/+ tumor. Procr+ and Procr-cells were isolated and xenografted to Nude recipients. Interestingly, they displayed no discernable tumor-initiating capacity (Figure 2b-c) , suggesting that Procr expression is not enriched for CSCs in these tumor subtypes. These results suggest that Procr may mark CSCs in a particular stem-cell origin  tumor (Wnt1 basal-like) .
To further investigate the contribution of Procr+ cells towards MMTV-Wnt1 basal-like tumor formation and progression, we carried out genetic lineage tracing experiments using MMTV-Wnt1; Procr-CreERT2; R26-mTmG mice. First, tracing was initiated at 8-week old premalignant mice by TAM to spontaneously label Procr+ cells; subsequently the distribution of their progeny, marked by the expression of mGFP (mG) , was examined over time (Figure 2d) . At 2 days, mG+ cells were sparsely located in the basal layer of the premalignant mammary gland (mG+, K14+, K8-) , indicating that individual Procr+ cells were labeled initially (Figure 2e-f) . At 6 months of age, some MMTV-Wnt1 mammary glands remained premalignant, while other developed tumor as previous reported (Li et al., 2000) . In both scenarios, large mG+ clones were observed (Figure 2g-h, Figure 9h-j) . Quantification indicated an increased percentage of mG+ cells in mammary tissue over time, suggesting that Procr+ MaSCs had generated increasing numbers of descendants along tumorigenesis (Figure 2i) . Of note, in premalignant mammary gland, where a bi-layered epithelium structure is preserved, it was apparent that mG+ cells contribute to both basal and luminal lineages (Figure 9i-j) . Next we traced Procr+ cells in tumor by injecting TAM in 6-month old MMTV-Wnt1; Procr-CreERT2; R26-mTmG mice when tumor has just formed (in early stage) (Figure 2j) . We observed individual mG+ cells at 2 days (Figure 2k-i) , and these labeled cells generated more tumor cells during 3 weeks of rapid tumor growth (Figure 2m-n) . Together, genetic lineage tracing results support that Procr+ cells in MMTV-Wnt1 mammary tumor are enriched for CSCs.
Procr is critical for MMTV-Wnt1 mammary tumor growth
To address whether Procr is required for the MMTV-Wnt1 tumor formation, we knocked down Procr expression and examined its impact in tumor xenograft experiments. Single cells were dissociated from MMTV-Wnt1 primary tumors and virally infected by sh-Procr with GFP tag. The infected cells were sorted using GFP and xenografted to fat pads of immunocompromised recipients. We found that inhibition of Procr drastically attenuates tumor formation of the engrafted cells, while cells infected by control scramble shRNA form tumor potently (Figure 10a-d) . Similar results were observed when MMTV-Wnt1 tumor cells were grafted to syngeneic FVB mammary fat pads (Figure 10e-g) . Thus, inhibition of Procr diminishes the tumor formation capacity of CSCs in MMTV-Wnt1 tumors, suggesting that Procr is important for certain basal-like mammary tumor formation.
PROCR is highly expressed in half of TNBC cases that are associated with poorer clinical outcome compared to PROCR-low TNBC patients
In human breast tissues, we first examined PROCR expression in clinical non-cancerous breast tissues. Immunohistochemical staining (IHC) showed that, in most areas, PROCR is expressed in individual basal cells sparsely located in ductal epithelium (Figure 3a, n=4 patients) .  In few areas, PROCR staining could also be detected in more basal cells (Figure 11a) , an observation similar to a previous report (Shipitsin et al., 2007) . FACS quantification indicated that PROCR is expressed in 3%of basal cells and 3.5%of mesenchymal cells, while absent in the luminal populations (Figure 3b, Figure 11b) . Thus, the expression of PROCR in non-cancerous human tissues is reminiscent of its pattern in the mouse mammary gland (Wang et al., 2015) .
Next, we performed PROCR staining in a cohort with 80 breast tumors (20 whole-section specimens for each subtype, including Luminal A, Luminal B, HER2+, and TNBC) . We found that PROCR expression is markedly more robust in TNBC compared to Luminal and HER2+ subtypes (Figure 11c) . Within TNBC, 13 out of 20 (65%) exhibited an H-score higher than 80 (Figure 11d) . To increase sample size, we used tissue microarrays (TMAs) to examine PROCR expression in a larger cohort comprising 449 breast tumors and 71 non-cancerous mammary controls. Consistently, TNBCs exhibited a markedly high prevalence of PROCR-high cases (52.35%PROCR-high (score= 2, 3) ; 47.64%PROCR-low (score=0, 1) , n= 149) . The frequency of PROCR-high cases was drastically lower (ranging from 2-7%) in non-cancerous and other subtypes of carcinomas (Figure 2c-d) . We further investigated the relationship between PROCR expression levels and various clinical characteristics. Consistently, PROCR expression was reversely associated with ER status (P<0.001) , PR status (P<0.001) and HER2 status (P<0.001) in breast cancers, but there was no other correlation between PROCR levels and other clinicopathological features (Table 1) .
Table 1. Clinicopathological variables and the expression of PROCR in the study cohort
Figure PCTCN2017115198-appb-000030
Abbreviations: PROCR, protein C receptor; ER, estrogen receptor; PR, progesterone receptor; HER-2, human epidermal growth factor receptor 2; TNBC, triple negative breast cancer
a Based on Pearson X2 test (Fisher exact test was used when needed) .
b Definition of subtypes: Luminal (ER and/or PR positive) , HER-2 Enrichment (ER and PR negative, HER-2 positive) , and TNBC (ER negative, PR negative, and HER-2 negative)
The clinical significance of PROCR expression in breast cancer was assessed. In TNBC patients, PROCR-high was correlated with poorer disease-free survival (DFS) compared with PROCR-low by Kaplan-Meier analysis (Figure 3e) . In hormone-receptor positive subtype and HER2+ subtype, no significant association was found between PROCR levels and disease events (Figure 3f-g) . In accordance with the results of our cohort, further analysis of a large public clinical database of breast cancer (Kaplan-Meier Plotter) also supported that high level of PROCR expression correlates with a poorer clinical outcome in patients with hormone receptor-negative breast cancer (Figure 11e) , whereas PROCR expression has no prognostic value in hormone receptor-positive patients (Figure 11f) . Additionally, elevated PROCR expression indicated a higher likelihood for disease events in univariate analysis and exhibited a similar trend upon multivariate analysis (Table 2) . Together, these results suggest that PROCR-high BCs consist about half of TNBC cases, and that PROCR expression level as detected by IHC may stratify TNBCs into two subgroups with different prognoses.
Table 2. Univariate and Multivariate analysis of factors associated with disease-free survival in TNBC patient cohort
Figure PCTCN2017115198-appb-000031
Abbreviations: PROCR, protein C receptor; TNBC, triple negative breast cancer
The expression of PROCR was also investigated in a panel of human breast cancer cell lines. qPCR analysis indicated that all ER+/PR+ lines (T-47D, ZR75-1, MB415 and MCF-7) and HER2+ lines (SK-BR-3, MDA-MB-453 and BT474) tested exhibit relatively low PROCR expression. A subset of TNBC lines (MDA-MB-231, Hs578T, HCC38, CAL51 and HCC1806) highly expressed PROCR, whereas some TNBC lines (MDA-MB-468, BT549, MDA-MB-436, HCC1937, HCC1599 and HCC2157) exhibited low expression of PROCR (Figure 12a) . These results are in line with our observations in patient tissue samples (52%of TNBC cases are PROCR-high) , supporting the idea that PROCR expression stratifies TNBCs.
PROCR-high TNBC is a subset distinct from BRCA1 mutant carrier TNBC
Intriguingly, cell lines that contain BRCA1 (MDA-MB-436, HCC1937, and HCC2157) or BRCA2 (HCC1599) mutation fell into the PROCR-low TNBC subgroup (Figure 12a-b) . Thus, we further investigated whether PROCR expression level is reversely correlated with BRCA1 mutation status using tissue samples from a cohort of 58 TNBC patients (28 of BRCA1 mutant carriers; 30 of  BRCA1 wild type patients) . We found that the majority of BRCA1 mutant carriers have low expression of PROCR (89.3%, n=28) , whereas the majority of BRCA1 wild type TNBCs are PROCR-high (70%, n=30) , exhibiting an H-score higher than 80 (Figure 12c-d; Table 3) . Together, these cell line and patient tissue data indicate a reverse correlation of PROCR-high TNBCs and BRCA1 mutant TNBCs, suggesting an intriguing hypothesis that they are discrete subgroups with distinct biology.
Table 3. Clinicopathological variables in the TNBC cohort with BRCA1 status
Figure PCTCN2017115198-appb-000032
Abbreviations: PROCR, protein C receptor; TNBC, triple negative breast cancer
aBased on Pearson X2 test (Fisher exact test was used when needed) .
Based on genome-wide gene expression studies, it has been reported that these TNBC cell lines can be subdivided into basal-like and Claudin-low subsets (Prat et al., 2010) , or proliferation-related, mesenchymal-related and immune-related subsets (Lehmann et al., 2011) . However, PROCR status did not appear to correlate with these stratifications (Figure 12b) . qPCR analysis also confirmed that either PROCR-high TNBC lines (MDA-MB-231, Hs578T) or PROCR-low TNBC lines (MDA-MB-436, HCC1599, and HCC2157) can display low expression of Claudins (Claudin3/4/7) (Figure 12e) , another evidence indicating that PROCR status does not correlate with  basal-like and Claudin-low classification.
PROCR enriches CSCs in human PROCR+ BC
Next we investigated whether PROCR enriches CSCs in PROCR-high TNBC (referred to as PROCR+ BC hereafter) . All cells in MDA-MB-231 express PROCR, making it not suitable for investigating CSCs (see discussion) . Thus, we utilized patient-derived xenografts (PDXs) for a better representative of primary tumor tissues. IHC indicated negative expression of ER, PR and HER2, and robust expression of PROCR in all three PDX tumors we used (Figure 4A, a, Figure 13a-c) . FACS analysis indicated that PROCR+ cells compose about 50%of total tumor cells in these PDXs (Figure 4A, b, Figure 13, d-e) , representing a drastic increase of PROCR+ cells compared to those (3%) in non-cancerous breast tissues. Both PROCR+ and PROCR-tumor cells were proliferative, but PROCR+ tumor cells exhibited about 2-fold more G2/M phase cells (4N) (Figure 4A, c) , EdU+ cells and Ki67+ cells (Figure 4A, d-e) . TUNEL staining suggested no difference of apoptosis between these two populations (Figure 4A, f) . To examine their tumor-initiating ability, PROCR+ and PROCR-cells were isolated from PDX tumors and engrafted to immunocompromised recipients in limiting dilution. PROCR+ cells can potently form tumors (1/64 CSC frequency) . Even when engrafting as few as 1 single cell, 30% (9 out of 30) of transplants formed tumors (Figure 4A, g) . Although PROCR-cells are proliferative, they displayed drastically lower tumor-initiating capacity (1/29475 CSC frequency) , suggesting that they are likely not the driver cells fueling tumor formation (Figure 4A, g) . FACS analysis indicated that tumor outgrowths derived from engrafted PROCR+ cells comprise both PROCR+ and PROCR-cells, at similar percentages as the parental PDX tumor (Figure 4A, h) , suggesting that some PROCR+ cells have differentiated into PROCR-cells. Gene Set Enrichment Analysis (GSEA) of two PDXs revealed that signatures of epithelial-mesenchymal transition (EMT) , Myc targets and mammary stem cells are significantly enriched in PROCR+ cells (Figure 4A, i) . Heat map and Western analyses confirmed the decreased E-cad, increased Slug and c-Myc expressions in PROCR+ cells compared to PROCR-cells (Figure 4A, j-k) . Collectively, these results establish that PROCR+ cells are enriched for CSCs in PROCR+ BCs (PROCR-high TNBC) .
Inhibition of PROCR potently suppress PROCR+ BC formation
We next investigated the possibility of targeting PROCR to inhibit PROCR+ BC growth. Tumor cells in the three PROCR+ BC PDXs were dissociated and infected with sh-PROCR viruses with GFP tag, infected cells were FACS-isolated and xenografted to fat pads of recipients (Figure 5a) . We found that knockdown of PROCR dramatically reduced tumor formation in all three PDX tumor xenograft experiments compared with the scramble control (Figure 5b-g) . In addition, the effect of PROCR knockdown was further examined using CRISPR interference (Gilbert et al., 2013) . PDXs tumor cells were infected with dCas9-KRAB and sgRNA (sg-PROCR) (Figure 5h) .  PROCR knockdown with sgRNA also drastically inhibited tumor formation in Xenograft experiments (Figure 5i-j) . The impact of PROCR attenuation was also investigated in cell lines. In MDA-MB-231 cells, knockdown of PROCR using two independent shRNAs significantly inhibited cell proliferation (Figure 13f-g) . In xenograft experiments, sh-PROCR drastically delayed tumor formation of MDA-MB-231 cells and inhibited tumor growth, when compared with the scramble control (Figure 13h) . In contrast, knockdown of PROCR was ineffective in influencing PROCR-low TNBC (BT549) or ER+/PR+ luminal tumor cell (MCF-7) growth (Figure 13i-j) . Together, these data provide proof of concept that PROCR can be targeted to inhibit PROCR+ BCs.
PROCR inhibitory nanobody suppress PROCR+ BC growth
Next, we evaluated the therapeutic benefit of targeting PROCR using a more clinically applicable approach. A single-domain antibody GS5 containing camelid VHHs (Hamers-Casterman et al., 1993) (also referred to as Nanobody) targeting the extracellular domain of PROCR was developed, which blocks the interaction with its ligand Protein C (Figure 6a, Figure 14a-b, see Methods for detail) . In MDA-MB-231 cell culture, addition of the inhibitory antibody significantly repressed cell proliferation as evidenced by decreased cell number in passaging and reduced EdU incorporation (Figure 6b-c) . No obvious difference in cell death was observed as shown by TUNEL staining (Figure 6d) . Our recent work delineates PROCR signaling in TNBC cells, in that PROCR activates pSrc, subsequently activates IGF-1R and both MEK-ERK and PI3K-Akt-mTOR pathways; concomitantly PROCR activates RhoA-ROCK-p38 pathways via a surface effector F2R (JBC in revision, see supplementary manuscript) . Here, we investigated the mechanism of action of the PROCR inhibitory nanobody. In culture, the inhibitory effects on pSrc, pIGF-1R and all of the known PROCR-dependent intracellular signaling activities were evident by 12h following the antibody treatment, and became more pronounced by 16h (Figure 6e) . The activity of EGFR-T845, a site known to be phosphorylated by Src (Tice et al., 1999) , was also diminished, while other activities of EGFR (T1068 and T1173) were not affected (Figure 14c) . This also reflected the specificity of the antibody on targeting the PROCR-dependent signaling. Furthermore, considering the EMT characteristic that PROCR+ cells have, we investigated whether the nanobody affects EMT. As expected, the nanobody blocked the mesenchymal traits. The treated cells had increased level of E-cad, and decreased levels of Vimentin, Slug and Zeb1 (Figure 6f) .
The anti-tumor efficacy of the antibody was further investigated in vivo. Mice bearing PROCR+ BC PDX were treated with the antibody. The treatment was started soon after the engraftment (at day 5) , and the antibody was injected for a total of 5 times. We observed marked inhibition of tumor growth (6 fold inhibition, Figure 6g) . Similar inhibitory effects were observed in all three PDXs (Figure 14d-e) . The remaining tumors were further analyzed. We found that the percentage of PROCR+ cells post IgG treatment remains similar to their parental tumor (48.2%) , while the percentage of PROCR+ cells was decreased to 22.1%post the antibody treatment,  supporting that the nanobody directly targets PROCR+ cells thus resulting in the growth inhibition (Figure 6h) . Next, we asked whether the nanobody is able to affect established PDX tumors. The treatment began when tumors had developed to be about 200 mm3. The nanobody or chemotherapeutic agents (paclitaxel and doxorubicin; PTX/DOX) alone or in combination were administered to the mice. We found that the nanobody alone exhibits more pronounced tumor suppressive effects (3-fold inhibition, blue line) than PTX/DOX (2-fold inhibition) (Figure 6i, green line) . Remarkably, combination treatment completely inhibited the growth of the established tumors (32 fold inhibition) (Figure 6i, black line) . The remaining tumors were analyzed. Intriguingly, post PTX/DOX treatment, the percentage of PROCR+ cells was enriched to 77.7%, suggesting a possibility that PTX/DOX preferentially eliminate PROCR-cells and PROCR+ cells are innately chemoresistant (Figure 14f) . The EMT characteristics of PROCR+ cells may contribute to the potential chemoresistent. The remaining tumors were also dissociated and their proliferation was assessed in culture. Tumor epithelial cells post PTX/DOX treatment had a 1.5-fold increase in cell number by day 3 compared to control, whereas tumor cells post the antibody treatment had a 1.8-fold decrease in proliferation by day 3 (Figure 14g) . Both the decreased proportion of PROCR+cells (CSCs) and reduced proliferation post the antibody treatment forecasted a slower tumor relapse. Thus, we further investigated the behavior of the tumor post the above treatments. Withdrawal of PTX/DOX treatment led to a rapid recurrence shown by sharply increasing tumor sizes (green line in Figure 6i) , consistent with the increased proportion of TICs (PROCR+ cells) upon PTX/DOX treatment. In contrast, the rapid relapse was not observed upon withdrawal of the antibody treatment (blue and black lines, Figure 6i) . Collectively, these data reinforce the notion that inhibition of PROCR is able to suppress the growth of PROCR+ BC through directly targeting the TICs, and demonstrate the potential for PROCR inhibitory monoclonal antibodies as a targeting agent to inhibit this subgroup of breast cancer.
Discussion
Our study reveals the functional role and biological significance of PROCR in normal MaSCs and in CSCs of a discrete subgroup of TNBC. TNBC is viewed as a group of different diseases that have similar phenotype but different genotypes with varying prognoses and responses to chemotherapy. Our study, as illustrated in Figure 7a, suggests a further stratification of TNBC based on PROCR expression, revealing a PROCR+ BC subgroup, which constitutes about half of TNBC cases in the current study cohort, and is associated with poorer prognosis compared with PROCR-low TNBCs; furthermore, in PROCR+ BCs, PROCR+ cells are CSCs that can be targeted by PROCR-inhibitory nanobody. The new stratification based on PROCR expression has a broad clinical implication. First, PROCR can be measured by IHC, a routine practice in breast cancer diagnosis and treatment planning. Second, providing that the tumor-surviving/driving molecular pathways in PROCR+ BC have been identified, the new stratification will foster a novel treatment  strategy for these patients, potentially employing a combined inhibition of these pathways.
There have been seminal studies demonstrating the existence of cancer stem cells in breast cancers using potential markers (Al-Hajj et al., 2003; Ginestier et al., 2007) . Interestingly, PROCR expression has been detected in CSCs enriched by one of those markers, CD44 (Shipitsin et al., 2007) . One potential caveat of these studies is that variability among different breast cancer subtypes is likely extensive, and it may thus be challenging and imprecise to designate a single CSC population for all breast cancers. The idea that PROCR expression marks cancer stem cells in TNBC has been eluded in previous studies using MDA-MB-231 (Hwang-Verslues et al., 2009; Schaffner et al., 2013) . However, MDA-MB-231 as a tamed cell line that has ubiquitous PROCR expression is not suitable to investigate CSC population (JBC in revision, see supplementary manuscript) . Here, we propose that PROCR+ cells are CSCs in PROCR+ BC subtype, defined by the following functional assays for CSCs (Clarke et al., 2006; Kreso and Dick, 2014) . They can 1) be prospectively purified (Lin-, Epcam+, PROCR+) ; 2) be passaged in a xenograft assay at clonal cell doses; 3) generate a xenograft that is representative of the parent tumor; and 4) give rise to daughter cells (PROCR-cells) that may possess proliferative capacity but are unable to establish the tumor. Our study further demonstrates that PROCR is a druggable target on the surface of CSCs. Inhibition of PROCR by an inhibitory nanobody results in a concomitant blockade of MEK-ERK, PI3K-Akt-mTOR and RhoA-ROCK pathways and repression of EMT, rendering a high degree of tumor suppression. Of note, PROCR inhibition has no effect on growth of PROCR-low TNBC (QNBC) or ER+/PR+ tumor, highlighting that the identity of CSC and the costumed intervention are dependent on the BC subtype.
The putative connection between MaSCs of normal tissues and CSCs remains unclear despite some recent advances (Chakrabarti et al., 2014; Su et al., 2016; Zhang et al., 2008) . Evidences support that BRCA1 TNBCs originate from luminal progenitors (Lim et al., 2009; Molyneux et al., 2010; Nolan et al., 2016; Proia et al., 2011; Sau et al., 2016) . Intriguingly, our data suggest that PROCR+ BC and BRCA1 TNBC are distinct subgroups. It is likely that they have distinct cell-of-origins. Procr expression marks mouse normal MaSCs that exhibit EMT characteristics (Wang et al., 2015) . In this study, our data demonstrate that PROCR expression also marks EMT-featuring CSCs in human PROCR+ BC. Thus, it is tempting to hypothesize that PROCR+ BC is a malignancy originated from normal MaSCs, and that after MaSCs acquire genetic alterations and become CSCs, the expression and molecular mechanism of PROCR are still coupled with these cells (Figure 7b) .
In conclusion, our findings identify PROCR as a biomarker to stratify TNBC into clinically relevant subgroups and reveal the key roles of PROCR in tumorigenesis of PROCR+ BCs. Remarkably, a PROCR inhibitory nanobody effectively suppresses the growth of PROCR+ BCs. Our study suggests that PROCR is a promising cell surface target for therapeutic intervention of PROCR+ breast cancers.
Methods
Patients and specimens
Human breast tissue was obtained from Fudan University Shanghai Cancer Center, with approval from the Human Research Ethics Committee of Fudan University Shanghai Cancer Center. Fresh samples were histologically normal para-tumor breast tissue. For the immunohistochemical analysis of PRCOR in breast tumor whole-sections, a total of 80 stage I to III primary breast cancer samples from females with invasive ductal carcinoma were randomly collected at the Department of Breast Surgery at the Fudan University Shanghai Cancer Center between August 2013 and March 2014. The clinical pathologic diagnosis of breast cancer cases was determined by pathologists in the Department of Pathology. In our study, ER, PR, and human epidermal growth factor receptor 2 (HER2) expression statuses were also determined by IHC staining. Most, but not all, patients with HER2 expression status (IHC, score ≥2) were subjected to florescence in situ hybridization (FISH) screening for HER2 gene amplification. The HER2 overexpression subgroup was defined as FISH positive or an IHC staining score ≥3. As a result, the breast cancer patients were classified into four molecular subtypes according to the ER, PR, and HER2 status, including luminal A subtype (ER+ and/or PR+, low Ki67) , luminal B subtype (ER+ and/or PR+, high Ki67 or HER2+) , HER2+ subtype (HER2+, ER-and PR-) , and triple-negative subtype (ER-, PR-, and HER2-) . Total 80 breast cancer samples (20 for each of subtypes) were obtained to examine the PROCR protein level by immunohistochemical analysis using breast tumor whole-sections.
To evaluate the prognostic value of PROCR in a large breast cancer patient cohort, we used Tissue microarrays (TMAs) containing 450 pathologically proven breast cancer samples and 72 non-cancerous mammary controls to examine the PROCR expression level. The eligibility criteria of breast cancer samples have been described in a previous study (Ye et al., 2015) . Briefly, the breast cancer patients in this cohort fulfilled the following inclusion criteria: (i) female patients diagnosed with stage I to III primary breast cancer; (ii) patients with unilateral invasive ductal carcinoma (IDC) ; ductal carcinomas in situ were excluded; (iii) patients without any evidence of metastasis at diagnosis; (iv) patients underwent a mastectomy and axillary lymph node dissection or breast conservation surgery followed by adjuvant chemotherapy; the therapeutic regimen decisions were based on the Chinese Anti-Cancer Association guidelines for the diagnosis and treatment of breast cancer.
For tissue microarrays (TMAs) , we used the complete random sampling method to collect 207 luminal-like subtype cases, 93 HER2-enriched subtype cases and 150 triple-negative subtype cases from 1, 709 cases that met the eligibility criteria and were diagnosed as breast cancer at the Department of Breast Surgery in FDSCC between August 2001 and January 2008. In addition, as described preciously (Ye et al., 2015) , a total of 72 non-cancerous mammary tissues controls with  pathologically confirmed benign mammary diseases were also collected from women who had come to the Outpatient Department at FDSCC for breast cancer screening during the period from January 2013 to February 2013. This study was approved by the institutional review board (IRB) of Fudan University Shanghai Cancer Center (FDSCC) , and all participants provided informed consent to participate in this research.
Tissue microarray (TMA)
TMAs were constructed using above 450 paraffin-embedded blocks of breast tumors and 72 blocks of non-cancerous mammary controls using a tissue micro arrayer (UNITMA Instruments, Seoul, Korea) . The hematoxylin and eosin (HE) -stained slides from tumors were evaluated to identify representative tumor regions. TMAs were composed of two 1.0-mm tissue cores from different areas of the same tumor to compare staining patterns. TMA sections were subsequently dewaxed in xylene and rehydrated in ethanol for IHC staining. PROCR staining was quantified in parallel by two experienced breast disease pathologists who were blinded to all clinical data.
Evaluation of IHC variables in breast tumor whole-sections and in TMAs
In 80-cases breast tumor whole-sections, expression of PROCR were semiquantitatively classified according to the immunoreactive H-score (HS; range 0–300) which was calculated as the result of the intensity score (1, faint/week; 2, moderate; 3, strong) multiplied by the distribution score (between 1 [percentage] to 100 [percentage] ) .
In TMAs, a total of 450 IDC breast cancer cases and 72 non-cancerous mammary tissues were included. Of these cases, 7 breast cancer cases and 1 non-cancerous sample experienced duplicate tissue core loss after IHC staining. Thus, the remaining 443 cancerous and 71 non-cancerous mammary samples were included in the subsequent analysis. The duplicate tissue cores from each case were also stained and scored semi-quantitatively using the same H-score evaluating criteria in breast tumor whole-sections. Subsequently, stratification scoring was conducted according to H-score as follow: HS<80, scored as 0; 80<HS<120, scored as 1; 120<HS<150, scored as 2, HS>200, scored as 3. If the score was equal to or greater than 2, the tumor was considered to have high PROCR expression; otherwise, low PROCR expression was classified.
Based on the evaluation standard, scoring was reviewed in parallel by DS Wang and F Qiao; both examiners were blinded to all clinical data.
Kaplan-Meier analysis using TMAs and Kaplan-Meier Plotter
In the above cohort in TMAs, the breast cancer patients were regularly followed, and the clinical outcome of 415 cases was obtained, with the last update occurring in October 2014. The follow-up period was defined as the time from surgery to the last observation for censored cases or relapse/death for complete observations. Disease-free survival (DFS) was defined as the time from the date of primary surgery to the date of relapse/breast cancer-specific death or October 2014. The categories analyzed for DFS were first recurrence of disease at a local, regional, or distant site and breast cancer-specific death. Patients with study end date and loss of follow-up were considered  censored. Thus, these 415 cancerous cases were analyzed in the Kaplan-Meier analysis.
In addition, a large public clinical database (Kaplan-Meier Plotter) of breast cancer was used to explore the association between PROCR expression and clinical outcomes, with the following restricted condition: 1) 140 months of follow-up time, 2) : select media cutoff, 3) cases with ER status. Primary purpose of the tool is a meta-analysis based in silico biomarker assessment. We evaluated the effects of PROCR expression on disease-free survivals (DFS) of 671 hormone receptor-negative patients and 1802 hormone receptor-positive patients with the latest version of this database (2014 version; http: //www. kmplot. com/analysis/index. php? p=service) .
Experimental animals
We generated the targeting construct of Procrflox in which loxP site was inserted upstream of exon 2, and an frt-flanked PGK-neo cassette followed by a second loxP site was inserted downstream of exon 4 of Procr gene. After genotyping, Procrflox mice were breed with a germline Flpase strain to remove the frt-flanked neomycin selection cassette. ProcrCreERT2-IRES-tdTomato mouse was describe in a previous study (Wang et al., 2015) . For inducing Procr knockout, mice received intraperitoneal injection of 4 mg/25g body weight of Tamoxifen (TAM, Sigma-Aldrich) diluted in sunflower oil every other day for a total of three times. MMTV-Wnt1, MMTV-PyVT, MMTV-Cre, Brca1f/+, p53f/+ , Nude, and SCID/Beige mice strains were used. Experimental procedures were approved by Animal Care and Use Committee of Shanghai Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences.
Cell lines and cell culture
The MCF7, SK-BR-3, MDA-MB-231, Hs578T, T-47D, ZR-75-1, MDA-MB-415, MDA-MB-453, BT474, MDA-MB-436, BT549, HCC38, CAL51, HCC1806, MDA-MB-468, HCC1937, HCC1599 and HCC2157 human breast cancer cell lines and the HEK293T cell line were obtained from the Shanghai Cell Bank Type Culture Collection Committee or American Type Culture Collection (ATCC) and maintained in complete growth medium as recommended by the distributor.
Antibodies
Antibodies used in immunohistochemistry: Mouse anti human PROCR (1: 300, Abcam) , rabbit anti human K14 (1: 100, Thermo) , mouse anti ER (1: 50, DAKO) , mouse anti PR (1: 50 DAKO) , rabbit anti HER2 (1: 50, Proteintech) .
Antibodies used in Western blotting: Rabbit anti human PROCR (1: 200, Novus) , rabbit anti human phospho-Src (1: 1000, Cell Signaling Technology) , rabbit anti human total Src (1: 1000, Cell Signaling Technology) , rabbit anti human phosphor-MEK (1: 1000, Cell Signaling Technology) , mouse anti human total MEK (1: 1000, Cell Signaling Technology) , rabbit anti human phosphor-ERK (1: 1000, Cell Signaling Technology) , rabbit anti human total ERK (1: 100, Santa Cruz) , rabbit anti human phosphor-Raf (1: 100, Santa Cruz) , rabbit anti human total Raf (1: 100, Santa Cruz) , rabbit anti human phosphor-Akt (1: 1000, Cell Signaling Technology) , rabbit anti human total Akt (1: 1000, Cell Signaling Technology) , rabbit anti human phosphor-GSK3β (1: 1000,  Cell Signaling Technology) , rabbit anti human total GSK3β (1: 1000, Cell Signaling Technology) , rabbit anti human phosphor-CREB (1: 1000, Cell Signaling Technology) , rabbit anti human total CREB (1: 1000, Cell Signaling Technology) , rabbit anti human phosphor-S6K (1: 1000, Cell Signaling Technology) , rabbit anti human total S6K (1: 1000, Cell Signaling Technology) , mouse anti human c-Myc (1: 100, Santa Cruz) , mouse anti-human Cyclin D1 (1: 100, Santa Cruz) , mouse anti human RhoA (1: 100, Santa Cruz) , rabbit anti human ROCK2 (1: 1000, Cell Signaling Technology) , rabbit anti human phosphor-p38 (1: 1000, Cell Signaling Technology) , rabbit anti human p38 (1: 1000, Cell Signaling Technology) , rabbit anti human phosphor-IGF1R (1: 1000, Cell Signaling Technology) , rabbit anti human IGF-1R (1: 1000, Cell Signaling Technology) , rabbit anti human phosphor-EGFR (Tyr1068, Tyr1173, Tyr845) (1: 1000, Cell Signaling Technology) , rabbit anti human EGFR (1: 1000, Cell Signaling Technology) , mouse anti tubulin (1: 5000, Sigma) and rabbit anti GAPDH (1: 5000, Proteintech) .
The Human Phospho-Kinase Array (R&D system, ARY003B) was performed as the procedure attached in the Kit. 106 of MDA-MB-231 cells were used. The Human Phospho-RTK Array (R&D system, ARY001B) was performed as the procedure attached in the Kit. 106 of freshly isolated PROCR+ and PROCR-cells from PDX tumors were used. Protein samples are normalized by Tubulin level through western blotting before using in array analysis.
Primary cell preparation
The minced primary tumor or mammary tissue was placed in culture medium (RPMI 1640 with 25 mM HEPES, 5%fetal bovine serum, 1%PSQ (Penicillin-Streptomycin-Glutamine) , 300U ml-1 Collagenase III [Worthington] ) and digested for up to 3 hrs at 37℃. After lysis of the red blood cells in NH4Cl, a single-cell suspension was obtained by sequential incubation with 0.25%trypsin-EDTA at 37℃ for 5 min and 0.1 mg/ml DNase I (Sigma) for 5 mins with gentle pipetting, followed by filtration through 70 um cell strainers.
Cell Labeling and flow cytometry
The following antibodies in 1: 200 dilutions were used: PE/cy7-anti-human EpCam, APC-anti human CD49f, Biotin-anti human CD49f, FITC-anti human CD31, FITC-anti human CD45, FITC-anti human CD235a (Biolegend) , APC-anti human PROCR (eBioscience) , Streptavidin-V450 (BD PharMingen) . Antibody incubation was performed on ice for 20 min in HBSS with 10%fetal bovine serum. For DNA content analysis, Hoechst (1ug/ml) was used. All sortings were performed using a FCASJazz (Becton Dickinson) . The purity of sorted population was routinely checked and ensured to be more than 95%.
Immunohistochemistry
Tissue paraffin or frozen sections were incubated with primary antibodies at 4℃ overnight, followed by washes, incubation with secondary antibodies for 2 hrs at 25℃, and counterstaining with DAPI (Sigma) . For all of the immunoflourescence staining at least 3 independent experiments  were conducted. Representative images are shown in the figures.
Immunohistochemistry for PROCR was performed using anti-PROCR antibody (1: 300, Abcam) and Goat Anti-mouse HRP (1: 1000, Santa Cruz) as secondary antibody followed by color development (DAKO) before counterstaining with hematoxylin.
Overexpression, shRNA and sgRNA constructs
Expression constructs for sPROCR (1-214 aa, extracellular domain) and Protein C (1-252 aa, a truncation of the kinase domain) were made using pCMV-Fc vector (Addgene) . Lentiviral expression constructs for hPROCR overexpression were made using pHIV-zsgreen vectors carrying FLAG tag at the N terminus (Addgene) .
The shRNAs targeting hPROCR sequences were constructed in lentivirus-based pLKO. 1-EGFP constructs (Addgene) . The efficiency of individual shRNA was validated by Western blotting or qPCR. The sequences for hPROCR-shRNA-1 and hPROCR-shRNA-3 were
5’GCAGCAGCTCAATGCCTACAA 3’ (SEQ ID NO: 23) and
5’TGGCCTCCAAAGACTTCATAT 3’ (SEQ ID NO: 24) .
If not specified, sh-PROCR represents hPROCR-shRNA-1.
dCas9-VP64 and dCas9-KRAB plasmids for the activation or suppression are from Addgene. The sgRNAs targeting hPROCR genome sequence were constructed in lentivirus-based plasmid (MP177 from Addgene) . The efficiency of individual sgRNA was validated by Western blotting. Sequence for hPROCR activation: TCCTGCCGGCGCTGACTCAG (SEQ ID NO: 25) Sequence for hPROCR suppression: CAGACTCCGCCCCTCCCAGA (SEQ ID NO: 26)
Competitive ELISA
Purified Protein C (100ul, 0.2ug/ml) was pre-coated to the bottom of a 96-well plate at 4℃overnight. The wells were washed with PBS containing 0.5%Tween-20 and blocked with 1%BSA. A mixture of purified sPROCR (100ul, 3ug/ml) and the competing antibody or control antibody (in limiting dilution) were added into the wells and incubated for 2 h at 37C. The bound sPROCR was detected after subsequent incubation with a biotin conjugated PROCR primary antibody (R&D Systems) for 1.5 hours and Streptavidin-HRP secondary antibody (R&D Systems) for 30 minutes. After HRP color detection, the absorbance was determined with a microplate reader at 450 nm. All tests were performed in triplicate.
In vitro cell proliferation assays
MDA-MB-231 or BT549 cells infected with scramble or PROCR shRNA were plated at similar cell number and passaged every 2 days. During each passage, cell numbers are counted. To evaluate the inhibitory antibody effect on cell proliferation, control non-neutralizing or neutralizing antibodies (200ug/ml) were added every 24hrs. To measure the proliferation of PDX cells post IgG, chemotherapy or antibody treatment, in each group, 4X104 of EpCAM+ epithelial cells were plated in complete growth medium, cell numbers were quantified every day.
EdU labeling assay
In PDX samples, the PROCR+ and PROCR-cells were FACS isolated and cultured in 2D overnight in complete growth medium. Cells are then incubated with EdU for 1h. After 15min fixation with PFA, the EdU color development is performed following manufacturer’s protocol (Life Technology, C10339) .
MDA-MB-231 cells were plated at a low density (5×104) onto coverslips in 12-well plate and cultured with antibodies in complete culture medium. After 16hrs, cells were incubated with EdU for 1h, followed by PBS washes and fixation with 4%PFA for 10min. the EdU/TUNEL color development is performed following manufacturer’s protocol (EdU: Life Technology, C10339, TUNEL: Roche, 12156792910) .
Mammary fat pad xenograft and analysis
Sorted cells were resuspended in 50%Matrigel, PBS with 20%FBS, and 0.04%Trypan Blue (Sigma) , and injected in 10-20 ul volumes into the fat pads of 8-week-old Nude. For in vivo knockdown with shRNA, MDA-MB-231, MCF-7 and PDXs were virally infected by scramble or sh-PROCR. The infected cells were sorted based on the tagged GFP expression in the shRNA vector and resuspended in the above condition for transplantation. Tumor diameters were serially measured with calipers, and mouse weight was determined 3 times weekly. Tumor volume (in mm3) was calculated by the following formula: volume = length X width2 X 0.52. Mouse weight was monitored closely. For tumor inhibition, PROCR non-neutralizing (control) antibody or neutralizing antibody (8mg/kg body weight) , Doxorubicin (3mg/kg body weight) and Paclitaxel (20mg/kg body weight) were intraperitoneal administered following the protocol described in Figure 6 and Figure 14. At least 4 mice per experimental group were used in animal experiments. All animals were of the same age and sex at the time of mammary epithelial cell injection or tumor cell injection. No statistical method was used to pre-determine sample size. The experiments were not randomized. There was no blinded allocation during experiments and outcome assessment. Generation of patient-derived xenografts from human breast cancers
PDX lines were originally initiated by implantation of a fresh patient tumor fragment into the mammary fat pad of recipient SCID/Beige mice and were maintained by serial passage in vivo at intervals characteristic for each line, and in accordance with Institutional Animal Care and Use Committee requirements.
Generation of PROCR monoclonal antibody
The naive llama (camelid) sdAb phagemid library (Genscript) was used for selection of PROCR-specific single domain antibodies. Fc–PROCR extracellular domain (ECD) (1-214aa) protein produced in HEK293T cells was used as target antigen for several rounds of selection to enrich the specific sdAb binders. The plasmids were isolated from the output of phage display and constructed into a vector containing human IgG1 for soluble sdAb screening. Soluble sdAb clones were screened by ELISA using Fc–sPROCR, and their binding to PROCR was further verified by FACS analysis using HEK293 cells stably expressing PROCR full length. The inhibitory activity of  the antibody was further examined by competitive Elisa as described above. Clone GS-5 was used in all the in vitro cell culture and in vivo studies.
Statistical analysis.
Student’s t-test was performed and the P value was calculated in Prism on data represented by bar charts, which consisted of results from three independent experiments unless specified otherwise. For all experiments with error bars, the standard deviation (s.e.m. ) was calculated to indicate the variation within each experiment.
Reference:
Adamo, B., and Anders, C.K. (2011) . Stratifying triple-negative breast cancer: which definition (s) to use? Breast cancer research :  BCR  13, 105.
Al-Hajj, M., Wicha, M.S., Benito-Hernandez, A., Morrison, S.J., and Clarke, M.F. (2003) .
Prospective identification of tumorigenic breast cancer cells. Proc Natl Acad Sci U S A 100, 3983-3988.
Carey, L., Winer, E., Viale, G., Cameron, D., and Gianni, L. (2010) . Triple-negative breast cancer: disease entity or title of convenience? Nature reviews Clinical oncology 7, 683-692.
Chakrabarti, R., Wei, Y., Hwang, J., Hang, X., Andres Blanco, M., Choudhury, A., Tiede, B., Romano, R.A., DeCoste, C., Mercatali, L., et al. (2014) . DeltaNp63 promotes stem cell activity in mammary gland development and basal-like breast cancer by enhancing Fzd7 expression and Wnt signalling. Nat Cell Biol 16, 1004-1015, 1001-1013.
Clarke, M.F., Dick, J.E., Dirks, P.B., Eaves, C.J., Jamieson, C.H., Jones, D.L., Visvader, J., Weissman, I.L., and Wahl, G.M. (2006) . Cancer stem cells--perspectives on current status and future directions: AACR Workshop on cancer stem cells. Cancer research 66, 9339-9344.
Cleary, A.S., Leonard, T.L., Gestl, S.A., and Gunther, E.J. (2014) . Tumour cell heterogeneity maintained by cooperating subclones in Wnt-driven mammary cancers. Nature 508, 113-117.
Foulkes, W.D., Smith, I.E., and Reis-Filho, J.S. (2010) . Triple-negative breast cancer. The New England journal of medicine 363, 1938-1948.
Gilbert, L.A., Larson, M.H., Morsut, L., Liu, Z., Brar, G.A., Torres, S.E., Stern-Ginossar, N., Brandman, O., Whitehead, E.H., Doudna, J.A., et al. (2013) . CRISPR-mediated modular RNA-guided regulation of transcription in eukaryotes. Cell 154, 442-451.
Ginestier, C., Hur, M.H., Charafe-Jauffret, E., Monville, F., Dutcher, J., Brown, M., Jacquemier, J., Viens, P., Kleer, C.G., Liu, S., et al. (2007) . ALDH1 is a marker of normal and malignant human mammary stem cells and a predictor of poor clinical outcome. Cell Stem Cell 1, 555-567.
Guy, C.T., Cardiff, R.D., and Muller, W.J. (1992) . Induction of mammary tumors by expression of polyomavirus middle T oncogene: a transgenic mouse model for metastatic disease. Molecular and cellular biology 12, 954-961.
Hamers-Casterman, C., Atarhouch, T., Muyldermans, S., Robinson, G., Hamers, C., Songa, E.B., Bendahman, N., and Hamers, R. (1993) . Naturally occurring antibodies devoid of light chains. Nature 363, 446-448.
Herschkowitz, J.I., Simin, K., Weigman, V.J., Mikaelian, I., Usary, J., Hu, Z.Y., Rasmussen, K.E., Jones, L.P., Assefnia, S., Chandrasekharan, S., et al. (2007) . Identification of conserved gene expression features between murine mammary carcinoma models and human breast tumors. Genome Biol 8.
Hwang-Verslues, W.W., Kuo, W.H., Chang, P.H., Pan, C.C., Wang, H.H., Tsai, S.T., Jeng, Y.M., Shew, J.Y., Kung, J.T., Chen, C.H., et al. (2009) . Multiple lineages of human breast cancer stem/progenitor cells identified by profiling with stem cell markers. PLoS One 4, e8377.
Kreso, A., and Dick, J.E. (2014) . Evolution of the cancer stem cell model. Cell Stem Cell 14, 275-291.
Lehmann, B.D., Bauer, J.A., Chen, X., Sanders, M.E., Chakravarthy, A.B., Shyr, Y., and Pietenpol, J.A. (2011) . Identification of human triple-negative breast cancer subtypes and preclinical models for selection of targeted therapies. The Journal of clinical investigation 121, 2750-2767.
Li, Y., Hively, W.P., and Varmus, H.E. (2000) . Use of MMTV-Wnt-1 transgenic mice for studying the genetic basis of breast cancer. Oncogene 19, 1002-1009.
Li, Y., Welm, B., Podsypanina, K., Huang, S., Chamorro, M., Zhang, X., Rowlands, T., Egeblad, M., Cowin, P., Werb, Z., et al. (2003) . Evidence that transgenes encoding components of the Wnt signaling pathway preferentially induce mammary cancers from progenitor cells. Proc Natl Acad Sci U S A 100, 15853-15858.
Lim, E., Vaillant, F., Wu, D., Forrest, N.C., Pal, B., Hart, A.H., Asselin-Labat, M.L., Gyorki, D.E., Ward, T., Partanen, A., et al. (2009) . Aberrant luminal progenitors as the candidate target population for basal tumor development in BRCA1 mutation carriers. Nature medicine 15, 907-913.
Metzger-Filho, O., Tutt, A., de Azambuja, E., Saini, K.S., Viale, G., Loi, S., Bradbury, I., Bliss, J.M., Azim, H.A., Jr., Ellis, P., et al. (2012) . Dissecting the heterogeneity of triple-negative breast cancer. Journal of clinical oncology : official journal of the American Society of Clinical Oncology 30, 1879-1887.
Molyneux, G., Geyer, F.C., Magnay, F.A., McCarthy, A., Kendrick, H., Natrajan, R., Mackay, A., Grigoriadis, A., Tutt, A., Ashworth, A., et al. (2010) . BRCA1 basal-like breast cancers originate from luminal epithelial progenitors and not from basal stem cells. Cell Stem Cell 7, 403-417.
Nolan, E., Vaillant, F., Branstetter, D., Pal, B., Giner, G., Whitehead, L., Lok, S.W., Mann, G.B., Kathleen Cuningham Foundation Consortium for Research into Familial Breast, C., Rohrbach, K., et al. (2016) . RANK ligand as a potential target for breast cancer prevention in BRCA1-mutation carriers. Nature medicine 22, 933-939.
Perou, C.M., Sorlie, T., Eisen, M.B., van de Rijn, M., Jeffrey, S.S., Rees, C.A., Pollack, J.R., Ross, D.T., Johnsen, H., Akslen, L.A., et al. (2000) . Molecular portraits of human breast tumours. Nature 406, 747-752.
Prat, A., Parker, J.S., Karginova, O., Fan, C., Livasy, C., Herschkowitz, J.I., He, X., and Perou, C.M. (2010) . Phenotypic and molecular characterization of the claudin-low intrinsic subtype of breast cancer. Breast cancer research : BCR 12, R68.
Proia, T.A., Keller, P.J., Gupta, P.B., Klebba, I., Jones, A.D., Sedic, M., Gilmore, H., Tung, N., Naber, S.P., Schnitt, S., et al. (2011) . Genetic predisposition directs breast cancer phenotype by dictating progenitor cell fate. Cell Stem Cell 8, 149-163.
Sau, A., Lau, R., Cabrita, M.A., Nolan, E., Crooks, P.A., Visvader, J.E., and Pratt, M.A. (2016) . Persistent Activation of NF-kappaB in BRCA1-Deficient Mammary Progenitors Drives Aberrant Proliferation and Accumulation of DNA Damage. Cell Stem Cell 19, 52-65.
Schaffner, F., Yokota, N., Carneiro-Lobo, T., Kitano, M., Schaffer, M., Anderson, G.M., Mueller, B.M., Esmon, C.T., and Ruf, W. (2013) . Endothelial protein C receptor function in murine and human breast cancer development. PLoS One 8, e61071.
Shipitsin, M., Campbell, L.L., Argani, P., Weremowicz, S., Bloushtain-Qimron, N., Yao, J., Nikolskaya, T., Serebryiskaya, T., Beroukhim, R., Hu, M., et al. (2007) . Molecular definition of breast tumor heterogeneity. Cancer cell 11, 259-273.
Su, X., Napoli, M., Abbas, H.A., Venkatanarayan, A., Bui, N.H., Coarfa, C., Gi, Y.J., Kittrell, F., Gunaratne, P.H., Medina, D., et al. (2016) . TAp63 suppresses mammary tumorigenesis through regulation of the Hippo pathway. Oncogene.
Tice, D.A., Biscardi, J.S., Nickles, A.L., and Parsons, S.J. (1999) . Mechanism of biological synergy between cellular Src and epidermal growth factor receptor. Proc Natl Acad Sci U S A 96, 1415-1420.
Tsukamoto, A.S., Grosschedl, R., Guzman, R.C., Parslow, T., and Varmus, H.E. (1988) .
Expression of the int-1 gene in transgenic mice is associated with mammary gland hyperplasia and adenocarcinomas in male and female mice. Cell 55, 619-625.
Visvader, J.E. (2011) . Cells of origin in cancer. Nature 469, 314-322.
Wang, D., Cai, C., Dong, X., Yu, Q.C., Zhang, X.O., Yang, L., and Zeng, Y.A. (2015) .
Identification of multipotent mammary stem cells by protein C receptor expression. Nature 517, 81-84.
Xu, X., Wagner, K.U., Larson, D., Weaver, Z., Li, C., Ried, T., Hennighausen, L., Wynshaw-Boris, A., and Deng, C.X. (1999) . Conditional mutation of Brca1 in mammary epithelial cells results in blunted ductal morphogenesis and tumour formation. Nature genetics 22, 37-43.
Ye, F.G., Song, C.G., Cao, Z.G., Xia, C., Chen, D.N., Chen, L., Li, S., Qiao, F., Ling, H., Yao, L., et al. (2015) . Cytidine Deaminase Axis Modulated by miR-484 Differentially Regulates Cell Proliferation and Chemoresistance in Breast Cancer. Cancer research 75, 1504-1515.
Zhang, M., Behbod, F., Atkinson, R.L., Landis, M.D., Kittrell, F., Edwards, D., Medina, D., Tsimelzon, A., Hilsenbeck, S., Green, J.E., et al. (2008) . Identification of tumor-initiating cells in a p53-null mouse model of breast cancer. Cancer research 68, 4674-4682.
Example 2: Protein C Receptor Stimulates Multiple Signaling Pathways in Breast Cancer Cells
Protein C receptor (PROCR) has emerged as a stem cell marker in several normal tissues. PROCR has also been implicated in tumor progression. However, the functional role of PROCR and the signaling mechanisms downstream of PROCR remain poorly understood. Here we dissected the PROCR signaling pathways in breast cancer cells. Combining protein array, knockdown and overexpression methods, we found that PROCR activates multiple pathways concomitantly. PROCR-dependent ERK and PI3k-Akt-mTOR signaling proceed through Src and trans-activation of IGF-1R, which leads to the accumulation of c-Myc and Cyclin D1; while PROCR-dependent RhoA-ROCK-p38 signaling activation relies on F2R. These findings were confirmed in primary cells isolated from a triple negative breast cancer patient-derived xenograft (PDX) that has high expression of PROCR. This is the first comprehensive study of PROCR signaling in breast cancer cells. These findings also shed light on the molecular mechanisms of PROCR in normal tissue stem cells.
Introduction
The Protein C receptor (PROCR) has emerged as a stem cell marker in several tissues, including the mammary gland (1) , hematopoietic system (2-5) , and vascular endothelial cells (6) . Besides being a surface marker, its signaling mechanisms in the stem cells are unknown. PROCR  has also been implicated in tumor progression. However, there is conflicting evidence the mechanisms of action of PROCR. It has been reported that PROCR promotes tumor growth (7-9) , but it has also been suggested that PROCR inhibits tumor progression (10) . Hence, the functional roles as well as the signaling pathways of PROCR in cancer cells are also poorly understood.
PROCR is a single-pass transmembrane receptor, and is best known for its expression on vascular cells and its anti-coagulation activity (11) . PROCR activates its ligand, a protease precursor protein C (PC) , to become activated PC (aPC) , which is then dissociated from PROCR and exerts anti-coagulation effect directly via inactivation of FVa and FVIIIa (reviewed in (12, 13) ) .
There is evidence that PROCR activates intracellular signaling, resulting in cytoprotective effects in endothelial cells, monocyte, keratinocyte, and intestinal epithelial cells (14-18) . It is widely accepted that the central event of PROCR intracellular signaling is the activation of a G protein-coupled receptor (GPCR) , F2R (also called protease-activated receptor-1, PAR-1) (19) . aPC uses PROCR as a co-receptor for the cleavage of F2R, enabling F2R to activate downstream signaling events (reviewed in (12, 13) ) . The PROCR-F2R axis has been shown to increase endothelial cell barrier function, survival, proliferation or migration through activation of the mitogen activated protein kinase (MAPK) , phosphatidylinositol-3 kinase (PI3K) , or endothelial nitric oxide synthase (eNOS) pathways or through inhibition of p53 (20-23) . There are limited data on PROCR induced signal transduction in non-endothelial cells. In lymphocytes, epithermal keratinocytes and breast cancer epithelial cells, it has been reported that aPC-PROCR-F2R can stimulate the MAPK pathway via activation of epidermal growth factor receptor (EGFR) (17, 24, 25) .
In this study, we utilized breast cancer cell lines and patient-derived xenograft (PDX) tumor cells to investigate the signaling pathways of PROCR in breast cancer cells. The results described here provide evidence that PROCR induces the activation of ERK, PI3K-Akt and RohA signaling. Distinct from previous reports, the PROCR-dependent ERK and PI3K-Akt activities in breast cancer cells are not via F2R and EGFR, instead they are through Src and IGF-1R activation.
PROCR activates ERK, PI3K-Akt-mTOR and RhoA-ROCK pathways in TNBC cells
We found that PROCR is differentially expressed in breast cancer cell lines. Overall, PROCR expression was relatively lower in ER+/PR+ (estrogen receptor, Progesterone receptor) and HER2+ cells, and higher in triple negative breast cancer (TNBC) (Figure 12a) . Within TNBC, MDA-MB-231, Hs578T, HCC38, CAL51, HCC1806 cells exhibited higher PROCR expression level compared to other lines (MDA-MB-468, BT549, MDA-MB-436, HCC1937, HCC1599, HCC2157) , ER+/PR+ lines and HER+ lines (Figure 12a) . To dissect the intracellular pathways that PROCR activates, we performed a phospho-kinase antibody array using lysates of MDA-MB-231 cells (a PROCR-high TNBC line) harvested at 48 hrs post lentiviral infection. PROCR silencing with shRNA (sh-PROCR) led to inhibition of the phosphorylation of several kinases, including  p38α (T180Y182) , ERK (T202Y204, T221Y223) , Src (Y419) , Ampka1 (T183) , CREB (S133) , S6K (T389) and Wnk1 (T60) (Figure 16a) . We investigated whether inhibition of PROCR affects MAPK signaling (in view of the downregulation of pSrc and pERK) , PI3K-Akt-mTOR signaling (given the observed downregulation of pCREB and pS6K) and RhoA-ROCK signaling cascades (given the downregulation of p38α) , which are key signaling pathways in breast cancer (26) . Western analysis confirmed the downregulation of pSrc (Y416) and pERK (T202Y204) , and further revealed reduced levels of pRaf (S338T341) and pMEK (S217S221) , indicating a reduced ERK signaling activity when PROCR is inhibited (Figure 16b) . In addition, Western analysis confirmed that pAkt (S473) level and indicators of Akt activity such as pGSK3β (S21S9) and pCREB (S133) were also decreased upon PROCR silencing (Figure 16b) . Further downstream, the activity of mTOR1 signaling was also suppressed, as seen by reduced levels of pS6K (T389) , and decreased protein levels of c-Myc and Cyclin D1 (Figure 16b) . These results indicated that PI3K-Akt-mTOR signaling activity is reduced upon PROCR inhibition. Moreover, the decreased RhoA, ROCK2 and p-p38α (T180Y182) levels were detected when PROCR is inhibited (Figure 16b) . These data suggest that PROCR induces the activation of ERK, PI3K-Akt-mTOR and RhoA-ROCK signaling cascades in MDA-MB-231 cells.
Next, we chose an additional PROCR-high TNBC line, Hs578T, and two PROCR-low TNBC lines, MDA-MB-468 and BT549, further examined the association of PROCR expression with the activities of the three pathways. Western analysis validated their statuses of PROCR level (Figure 16c) . Indeed, all three pathways were activated in both PROCR-high TNBC lines, MDA-MB-231 and Hs578T (Figure 16c) . In contrast, in both PROCR-low TNBC lines, no concomitant activation of the three pathways was observed (Figure 16c) . Of note, PI3K-Akt-mTOR pathway activation in MDA-MB-468 is likely due to the known EGFR amplification in this line (27) . In BT549, all three pathways were in low activities (Figure 16c) . Overall, these results support our model that PROCR activates ERK, PI3K-Akt-mTOR and RhoA-ROCK signaling cascades in PROCR-high TNBC cells.
Validate ERK, PI3K-Akt-mTOR and RhoA-ROCK signaling activities in PDX cells
Next we investigated the signaling activities in PROCR+ cells in tumors. We used patient-derived xenograft (PDX) TNBC cells with high expression of PROCR (Figure 17a) . In order to properly isolate PROCR+ and PROCR-cells, we looked for an antibody effective for fluorescence-associated cell sorting (FACS) . We found that clone RCR-227 can accurately distinguish PROCR+ and PROCR-cells by FACS, while clone RCR-252 cannot. The comparisons were using both MDA-MB-231 cells and TNBC PDX tumor cells. First, in MDA-MB-231 cells, RCR-252 antibody detected a small portion (18.1%) of PROCR+ cells by FACS (Figure 18a) . However, the isolated cells displayed no differential expression of PROCR by qPCR analysis (Figure 18b) , suggesting an inaccurate separation of PROCR+ and PROCR-cells using this antibody. In contrast, FACS  analysis using RCR-227 showed that almost all MDA-MB-231 cells (98.3%) are PROCR+ (Figure 18a) , suggesting RCR-227 is a more potent antibody in this assay compared to RCR-252. The comparison of the two antibodies was further carried out using freshly dissociated cells from PROCR-high TNBC PDX. RCR-252 was ineffective in recognizing PROCR+ cells by FACS (Figure 18c) , whereas FCAS analysis using RCR-227 established that 48.7%of the PDX cells are PROCR+ (Figure 17b and 18c) . Western analysis of PROCR protein levels confirmed the correct isolation using RCR-227 (Figure 17c) .
Upon proper isolation of PROCR+ and PROCR-cells, the signaling activities of the three pathways (ERK, PI3K-Akt and RhoA) were examined. Western analyses showed that PROCR+tumor cells exhibit markedly more robust signaling activities in all three pathways compared to PROCR-tumor cells (Figure 17d) . PROCR+ cells also had distinctly higher expression of c-Myc and Cyclin D1 compared to PROCR-cells (Figure 17d) . These data reinforce that ERK, PI3K-Akt-mTOR and RhoA-ROCK-p38 signaling cascades are intracellular effectors of PROCR in breast cancer cells.
PROCR activates RhoA-ROCK-p38 signaling via F2R
Next, we investigated the cell surface components through which PROCR activate downstream signaling. We established a PROCR overexpression system that can activate its downstream signaling. In a PROCR-low TNBC cell line BT549, which has low baseline activities of the three above signaling pathways, we employed the CRISPR interference system to activate endogenous PROCR expression (28) . BT549 cells were virally infected with dCas9-VP64 and sg-RNA (sg-PROCR) (Figure 19a) . Enhancement of PROCR expression is confirmed using this system (Figure 19b) . ERK, PI3K-Akt-mTOR signaling and RhoA-ROCK signaling cascades were all upregulated upon PROCR overexpression, including accumulation of c-Myc and CyclinD1 (Figure 19b) . Change of cell shape was also associated with PROCR overexpression: BT549 cells with enhanced PROCR expression became more elongated compared to the control (Figure 19c) . In this overexpression system, we interrogated which surface effectors are required for PROCR-dependent signaling. Previous studies have reported that the GPCR, F2R, is central for the cytoprotective activity of PROCR in various cell types. Thus, we examined whether F2R is required for PROCR signaling in breast cancer cells. Interestingly, knockdown of F2R only attenuated RhoA-ROCK and p38 signaling induced by PROCR overexpression, leaving the other two pathways (ERK and PI3K-Akt-mTOR) unaffected (Figure 19d) . These results suggest that RhoA-ROCK-p38 signaling induced by PROCR is dependent on F2R, while ERK and PI3K-Akt-mTOR activation is dependent on other surface effectors, not F2R.
PROCR engages IGF-1R for the activation of ERK and PI3K-Akt-mTOR pathways
We asked whether receptor tyrosine kinases (RTKs) are involved in PROCR-dependent ERK  and PI3K-Akt-mTOR signaling activation. To identify potential RTK candidates, we performed a RTK antibody array using lysates of PROCR+ cells and PROCR-cells isolated from PROCR-high TNBC PDX tumor. Higher activities of IGF-1R, Axl, RYK, and EGFR were apparent in PROCR+ cells (Figure 20a) . Therefore, we tested their requirement for ERK and PI3K-Akt-mTOR signaling induced by PROCR overexpression. Successful knockdown of IGF-1R or EGFR expression by shRNA was validated by Western analysis (Figure 20b) . Strikingly, knockdown of IGF-1R exhibited significantly reduced ERK and PI3K-Akt-mTOR signalings, while RhoA-ROCK signaling was unchanged (Figure 20c) . In contrast, knockdown of EGFR by shRNA affected none of the three signaling cascades induced by PROCR (Figure 20c) . Similarly, knockdown of Axl and RYK had no effect on the three signaling cascades induced by PROCR (data not shown) . We reasoned that the increased activity of EGFR, Axl and RYK in PROCR+ cells is likely a correlation or consequence, and they do not mediate the actions of PROCR in activating the three intracellular signalings.
Interestingly, in PROCR overexpression background, knockdown of IGF-1R did not affect the level of pSrc, implying that Src activation is upstream of IGF-1R (Figure 20c) . To further investigate this, we inhibited Src using KX2-391. Inhibition of Src resulted in attenuation of IGF-1R (Figure 20d) , supporting the idea that Src is upstream of IGF-1R for its transactivation. Consistently, Src inhibition led to reduced activities of ERK and PI3k-Akt-mTOR pathways, but did not affect the RhoA-ROCK pathway (Figure 20d) , in line with the notion that Src is upstream of IGF-1R. In addition, inhibition of Src also attenuated EGFR-T845 activity (Figure 20d) , consistent with the idea that increased EGFR activity in PROCR+ cells is a consequence of Src activation. It has been established that Src can phosphorylate EGFR at T845 (29) . Indeed, we found that inhibition of PROCR only attenuates EGFR activity at T845, but not other sites (T1068, T1173) (Figure 20e) . These results further supported that increased EGFR activity in PROCR+ cells is a consequence of Src activation, and EGFR itself is not the key RTK involved in the PROCR signaling relay (illustrated in Figure 20f) . Collectively, these data suggest that PROCR engages Src to transactivate IGF-1R and other RTKs, while IGF-1R is the key RTK for the stimulation of ERK and PI3K-Akt-mTOR signaling in these cells.
Protein C serves as the ligand for the activation of PROCR intracellular signaling in breast cancer cells
To investigate whether the activation of PROCR intracellular signaling in breast cancer cells requires a ligand, we utilized sPROCR (soluble PROCR, extracellular domain of PROCR) that can compete with the membrane form of PROCR (30) . Addition of sPROCR in MDA-MB-231 culture resulted in decreased proliferation, accompanied with cell shape changes: the spindle-shaped morphology of MDA-MB-231 was altered to become more spherical (Figure 21a) . Similar effects on cell proliferation and morphology were observed when PROCR is knockdown by  shRNA (data not shown) . These results suggest that the extracellular domain of PROCR that facilitates ligand binding is important for its function in breast cancer cells. Protein C (PROC) , a coagulation proteases, is a well established ligand in endothelial cells for anti-coagulation, anti-inflammation and cytoprotective activities of PROCR (14, 15, 19, 31-33) . To address the possibility that the same ligand binds to PROCR in breast cancer cells, we generated the protease dead form of PROC (PROC-DN, dominant negative form) . Addition of PROC-DN led to decreased proliferation and similar morphological changes in MDA-MB-231 cells (Figure 21b) . Importantly, the activities of the three intracellular signaling of PROCR were blocked in the presence of PROC-DN (Figure 21c) . In contrast, addition of active PROC (aPC) enhanced the three PROCR-dependent intracellular signaling (Figure 21d) . These data suggest that PROC serves as the ligand for PROCR in breast cancer cells.
Blockage of PROCR intracellular signalings impedes clonogenicity of breast cancer cells
To investigate whether PROCR function through these intracellular signalings to regulate stemness, we performed in vitro colony formation assays. Cells isolated from PDX-1 sample were plated in 3D Matrigel culture and their colony-forming abilities were examined upon inhibition of PROCR or its downstream signalings studied. We found that the colonies occurred at a ratio of 1 colony per 2 PDX epithelial cells plated, in line with the notion that about 50%of PDX cells are PROCR+ (Figure 22a) . Knockdown of PROCR completely blocked the colony formation (Figure 22a, 22c-d) . Inhibition of F2R by sch79797, or inhibition of Src by KX2-391 partially blocked the colony formation shown by decreased colony formation rate and colony sizes, while joint inhibition of F2R and Src delivered strongest effects and completely blocked the colony formation (Figure 22b-d) . These data suggest that the three downstream signalings of PROCR are functionally important for the stem cell activities in breast cancer cells.
Discussion
PROCR has been implicated in tumor progression and is an important surface marker for normal stem cells in several tissues. However, the signaling mechanism of PROCR had remained elusive. In the present study, we investigated PROCR signaling mechanism in breast cancer cells. We revealed that PROCR induces the activation of ERK and PI3K-Akt-mTOR signaling through transactivation of IGF-1R by Src; concomitantly stimulates RhoA-ROCK-p38 signaling through F2R (illustrated in Figure 22e) . These findings were further validated in PROCR+ cells and PROCR-cells isolated from PDX tumors. We also confirmed that PROC is the ligand of PROCR in breast cancer cells.
In this study we found that F2R does not account for all PROCR activities in breast cancer cells, which is in contrast to previously described PROCR intracellular signaling mechanisms, in which F2R is an essential mediator of PROCR in cell survival, anti-inflammation and migration  (15, 17-19, 24, 25) . In breast cancer cells, only the RhoA-ROCK-p38 signaling is dependent on F2R, while ERK and PI3k-Akt-mTOR signaling are F2R-independent, instead are dependent on Src and subsequent activation of IGF-1R. This is the first report that IGF-1R mediates the signaling function of PROCR. Our results agree with previous reports that EGFR is activated by PROCR (17, 24, 25) . However our study indicates that EGFR is not required for PROCR-dependent ERK and PI3k-Akt-mTOR signalings, and that EGFR activation is sequential to PROCR-dependent Src activation. It has been studied how F2R is activated by PROCR-aPC axis. F2R is activated when the N terminus is cleaved by aPC, creating a new N terminus that acts as a tethered ligand that binds intramolecularly to the receptor to initiate transmembrane signaling (34) . There remains a gap in knowing how Src is activated by PROCR-aPC. Our current findings cannot rule out that some of the effects on signaling pathways are indirect.
Considering that PROCR promotes the activities of ERK, PI3K-Akt-mTOR and RhoA pathways, and leads to accumulation of c-Myc and Cyclin D1, which are key signaling events in breast cancer (26) , our findings support the tumor promoting role of PROCR. Previous studies in normal mammary gland and in breast cancer cells have suggested that PROCR+ cells have increased epithelial and mesenchymal transition (EMT) characteristics (1, 35) . In this study, observations on the cell shape changes upon modulation of PROCR expression may also due to alteration of EMT program. EMT could be another channel through which PROCR signaling promotes tumor progression. In current study, the effective RTK, IGF-1R was identified in a screen using phospho antibody array. We are aware that our antibody array approach could have missed some other RTK candidates. Considering the versatile roles of PROCR in the transactivation of various RTKs in different cell types (17, 24, 25) , it would be no surprise that if PROCR triggers a more complex signaling cascade. Nevertheless, selectively blocking single kinases involved in ERK or PI3K pathways has been associated with limited or sporadic responses in clinical studies (36) . Simultaneously attenuating multiple pathways, e.g. with a reagent that inhibits PROCR, can potentially be a more effective means to attenuate the complex signaling network in breast cancer cells.
In conclusion, our study illustrated the signaling mechanisms of PROCR in the breast cancer cells, elucidating the potential functional role of PROCR in TNBC. These findings may guide the development of anti-PROCR therapeutic agents for breast cancer treatment.
Methods
Cell lines and cell culture
The MCF7, SK-BR-3, MDA-MB-231, Hs578T, T-47D, ZR-75-1, MDA-MB-415, MDA-MB-453, BT474, MDA-MB-436, BT549, HCC38, CAL51, HCC1806, MDA-MB-468, HCC1937, HCC1599 and HCC2157 human breast cancer cell lines were obtained from the Shanghai Cell Bank Type Culture Collection Committee or American Type Culture Collection (ATCC) and  maintained in complete growth medium as recommended by the distributor.
Generation of patient-derived xenografts from human breast cancers
PDX lines were originally initiated by implantation of a fresh patient tumor fragment into the mammary fat pad of recipient SCID/Beige mice and were maintained by serial passage in vivo at intervals characteristic for each line, and in accordance with Institutional Animal Care and Use Committee requirements. This study was approved by the institutional review board (IRB) of Fudan University Shanghai Cancer Center (FDSCC) .
Antibodies
Antibodies used in immunohistochemistry: Mouse anti human PROCR (1: 300, Abcam) , mouse anti ER (1: 50, DAKO) , mouse anti PR (1: 50 DAKO) , rabbit anti HER2 (1: 50, Proteintech) , Antibodies used in Western blotting: Rabbit anti human PROCR (1: 200, Novus) , rabbit anti human phospho-Src (1: 1000, Cell Signaling Technology) , rabbit anti human total Src (1: 1000, Cell Signaling Technology) , rabbit anti human phospho-MEK (1: 1000, Cell Signaling Technology) , mouse anti human total MEK (1: 1000, Cell Signaling Technology) , rabbit anti human phospho-ERK (1: 1000, Cell Signaling Technology) , rabbit anti human total ERK (1: 100, Santa Cruz) , rabbit anti human phospho-Raf (1: 100, Santa Cruz) , rabbit anti human total Raf (1: 100, Santa Cruz) , rabbit anti human phospho-Akt (1: 1000, Cell Signaling Technology) , rabbit anti human total Akt (1: 1000, Cell Signaling Technology) , rabbit anti human phospho-GSK3β (1: 1000, Cell Signaling Technology) , rabbit anti human total GSK3β (1: 1000, Cell Signaling Technology) , rabbit anti human phospho-CREB (1: 1000, Cell Signaling Technology) , rabbit anti human total CREB (1: 1000, Cell Signaling Technology) , rabbit anti human phospho-S6K (1: 1000, Cell Signaling Technology) , rabbit anti human total S6K (1: 1000, Cell Signaling Technology) , mouse anti human c-Myc (1: 100, Santa Cruz) , mouse anti-human Cyclin D1 (1: 100, Santa Cruz) , mouse anti human RhoA (1: 100, Santa Cruz) , rabbit anti human ROCK2 (1: 1000, Cell Signaling Technology) , rabbit anti human phospho-p38 (1: 1000, Cell Signaling Technology) , rabbit anti human p38 (1: 1000, Cell Signaling Technology) , rabbit anti human phospho-IGF1R (1: 1000, Cell Signaling Technology) , rabbit anti human IGF-1R (1: 1000, Cell Signaling Technology) , rabbit anti human phospho-EGFR (Tyr1068, Tyr1173, Tyr845) (1: 1000, Cell Signaling Technology) , rabbit anti human EGFR (1: 1000, Cell Signaling Technology) , mouse anti tubulin (1: 5000, Sigma) and mouse anti beta-Actin (1: 2000, Sigma) .
Antibodies for FACS were used in 1: 200 dilutions: PE/cy7-anti-human EpCam, FITC-anti human CD31, FITC-anti human CD45, FITC-anti human CD235a (Biolegend) , APC-anti human PROCR (eBioscience) , PE-anti human PROCR (BD Pharmingen) .
Phospho Protein Array
The Human Phospho-Kinase Array (R&D system, ARY003B) was performed as the procedure attached in the kit. 106 of MDA-MB-231 cells were used. The Human Phospho-RTK Array (R&D system, ARY001B) was performed as the procedure attached in the kit. 106 of freshly  isolated PROCR+ and PROCR-cells from PDX tumors were used. Protein samples are normalized by Tubulin level through western blotting before using in array analysis.
Primary Cell Preparation
The minced primary tumor was placed in culture medium (RPMI 1640 with 25 mM HEPES, 5%fetal bovine serum, 1%PSQ (Penicillin-Streptomycin-Glutamine) , 300U ml-1 Collagenase III [Worthington] ) and digested for up to 3 hrs at 37℃. After lysis of the red blood cells in NH4Cl, a single-cell suspension was obtained by sequential incubation with 0.25%trypsin-EDTA at 37℃ for 5 min and 0.1 mg/ml DNase I (Sigma) for 5 mins with gentle pipetting, followed by filtration through 70 um cell strainers.
Cell Labeling and validate PROCR antibody for Flow Cytometry
Antibody incubation was performed on ice for 20 min in HBSS with 10%fetal bovine serum. All sortings were performed using a FCASJazz (Becton Dickinson) . The purity of sorted population was routinely checked and ensured to be more than 95%. The efficacies of two PROCR antibodies, clone RCR-252 (PE-conjugated, BD Pharmingen, cat. #557950) and clone RCR-227 (APC-conjugated, eBioscience, cat. #17-2018-42) , were compared using both MDA-MB-231 cells and TNBC breast cancer PDX tumor cells. First, in MDA-MB-231 cells, RCR-252 antibody detected a small portion (18.1%) of PROCR+ cells by FACS (Fig. 18a) . However, the isolated cells displayed no differential expression of PROCR by qPCR analysis (Fig. 18b) , suggesting an inaccurate separation of PROCR+ and PROCR-cells using this antibody. In contrast, FACS analysis using RCR-227 showed that almost all MDA-MB-231 cells (98.3%) are PROCR+ (Fig. 18a) , suggesting RCR-227 is a more potent antibody in this assay compared to RCR-252. The comparison of the two antibodies was further carried out using freshly dissociated cells from PROCR-high TNBC PDX. RCR-252 was ineffective in recognizing PROCR+ cells by FACS, whereas FCAS analysis using RCR-227 established that 48.7%of the PDX cells are PROCR+ (Fig. 18c) . Western analysis of PROCR protein levels confirmed the correct isolation using RCR-227 (Figure 17c) . Experiments in both MDA-MB-231 cells and PDX tumor cells indicated the effectiveness of clone RCR-227, and the inefficacy of clone RCR-252 for FACS analysis.
Immunohistochemistry
Tissue paraffin sections were incubated with primary antibodies at 4℃ overnight using anti-PROCR antibody (1: 300, Abcam) and Goat Anti-mouse HRP (1: 1000, Santa Cruz) as secondary antibody for 2 hrs at 25℃ followed by color development (DAKO) before counterstaining with hematoxylin.
Overexpression, shRNA and sgRNA constructs
Expression constructs for sPROCR (1-214 aa, extracellular domain) and Protein C (1-252 aa, a truncation of the protease domain) were made using pCMV-Fc vector (Addgene) . The shRNAs targeting PROCR sequences were constructed in lentivirus-based pLKO. 1-EGFP  constructs (Addgene) . The efficiency of individual shRNA was validated by Western blotting or qPCR. The shRNA sequences were as following:
PROCR: GCAGCAGCTCAATGCCTACAA (SEQ ID NO: 27)
F2R: CCCGGTCATTTCTTCTCAGGA (SEQ ID NO: 28)
IGF-1R: GCGGTGTCCAATAACTACATT (SEQ ID NO: 29)
EGFR: CGCAAAGTGTGTAACGGAATA (SEQ ID NO: 30)
The dCas9-VP64 plasmid was from Addgene. The sgRNAs targeting PROCR genome sequence were constructed in lentivirus-based plasmid (MP177 from Addgene) . The efficiency of individual sgRNA was validated by Western blotting.
sgRNAs sequence for PROCR activation: TCCTGCCGGCGCTGACTCAG (SEQ ID NO: 31)
In vitro MDA-MB-231 and BT549 morphology assay
MDA-MB-231 cells infected with scramble or PROCR shRNA or BT-549 cells infected with control or PROCR sgRNA were plated at a low density (5×104) onto coverslips in 12-well plate using complete culture medium. After 12 hrs when cells are adhered to the coverslip, the plates are washed with PBS followed by fixation with 4%PFA for 10min. Cells on coverslips are stained with Vimentin and DAPI counterstain. To examine the effect of various protein on MDA-MB-231 cell morphology, purified sPROCR (6ug/ml) or Protein C-kinase dead (2ug/ml) were used when cells are plated.
Statistical Analysis.
Student’s t-test was performed and the P value was calculated in Prism on data represented by bar charts, which consisted of results from three independent experiments unless specified otherwise. For all experiments with error bars, the standard deviation (s.e.m. ) was calculated to indicate the variation within each experiment.
Reference:
1. Wang, D., Cai, C., Dong, X., Yu, Q.C., Zhang, X.O., Yang, L., and Zeng, Y.A. (2015) Identification of multipotent mammary stem cells by protein C receptor expression. Nature 517, 81-84
2. Balazs, A.B., Fabian, A.J., Esmon, C.T., and Mulligan, R.C. (2006) Endothelial protein C receptor (CD201) explicitly identifies hematopoietic stem cells in murine bone marrow. Blood 107, 2317-2321
3. Iwasaki, H., Arai, F., Kubota, Y., Dahl, M., and Suda, T. (2010) Endothelial protein C receptor-expressing hematopoietic stem cells reside in the perisinusoidal niche in fetal liver. Blood 116, 544-553
4. Fares, I., Chagraoui, J., Lehnertz, B., MacRae, T., Mayotte, N., Tomellini, E., Aubert, L., Roux, P.P., and Sauvageau, G. (2017) EPCR expression marks UM171-expanded CD34+ cord blood stem cells. Blood 129, 3344-3351
5. Zhou, F., Li, X., Wang, W., Zhu, P., Zhou, J., He, W., Ding, M., Xiong, F., Zheng, X., Li, Z., Ni, Y., Mu, X., Wen, L., Cheng, T., Lan, Y., Yuan, W., Tang, F., and Liu, B. (2016) Tracing haematopoietic stem cell formation at single-cell resolution. Nature 533, 487-492
6. Yu, Q.C., Song, W., Wang, D., and Zeng, Y.A. (2016) Identification of blood vascular endothelial stem cells by the expression of protein C receptor. Cell research 26, 1079-1098
7. Beaulieu, L.M., and Church, F.C. (2007) Activated protein C promotes breast cancer cell migration through interactions with EPCR and PAR-1. Exp Cell Res 313, 677-687
8. Anton, I., Molina, E., Luis-Ravelo, D., Zandueta, C., Valencia, K., Ormazabal, C., Martinez-Canarias, S., Perurena, N., Pajares, M.J., Agorreta, J., Montuenga, L.M., Segura, V., Wistuba, II, De Las Rivas, J., Hermida, J., and Lecanda, F. (2012) Receptor of activated protein C promotes metastasis and correlates with clinical outcome in lung adenocarcinoma. American journal of respiratory and critical care medicine 186, 96-105
9. Schaffner, F., Yokota, N., Carneiro-Lobo, T., Kitano, M., Schaffer, M., Anderson, G.M., Mueller, B.M., Esmon, C.T., and Ruf, W. (2013) Endothelial protein C receptor function in murine and human breast cancer development. PLoS One 8, e61071
10. Keshava, S., Sahoo, S., Tucker, T.A., Idell, S., Rao, L.V., and Pendurthi, U.R. (2013) Endothelial cell protein C receptor opposes mesothelioma growth driven by tissue factor. Cancer research 73, 3963-3973
11. Fukudome, K., and Esmon, C.T. (1994) Identification, cloning, and regulation of a novel endothelial cell protein C/activated protein C receptor. The Journal of biological chemistry 269, 26486-26491
12. Griffin, J.H., Zlokovic, B.V., and Mosnier, L.O. (2012) Protein C anticoagulant and cytoprotective pathways. International journal of hematology 95, 333-345
13. Mohan Rao, L.V., Esmon, C.T., and Pendurthi, U.R. (2014) Endothelial cell protein C receptor: a multiliganded and multifunctional receptor. Blood 124, 1553-1562
14. Bae, J.S., Yang, L., Manithody, C., and Rezaie, A.R. (2007) The ligand occupancy of endothelial protein C receptor switches the protease-activated receptor 1-dependent signaling specificity of thrombin from a permeability-enhancing to a barrier-protective response in endothelial cells. Blood 110, 3909-3916
15. Cheng, T., Liu, D., Griffin, J.H., Fernandez, J.A., Castellino, F., Rosen, E.D., Fukudome, K., and Zlokovic, B.V. (2003) Activated protein C blocks p53-mediated apoptosis in ischemic human brain endothelium and is neuroprotective. Nature medicine 9, 338-342
16. Vetrano, S., Ploplis, V.A., Sala, E., Sandoval-Cooper, M., Donahue, D.L., Correale, C., Arena, V., Spinelli, A., Repici, A., Malesci, A., Castellino, F.J., and Danese, S. (2011) Unexpected role of anticoagulant protein C in controlling epithelial barrier integrity and intestinal inflammation. Proc Natl Acad Sci U S A 108, 19830-19835
17. Xue, M., Chow, S.O., Dervish, S., Chan, Y.K., Julovi, S.M., and Jackson, C.J. (2011) Activated protein C enhances human keratinocyte barrier integrity via sequential activation of epidermal growth factor receptor and Tie2. The Journal of biological chemistry 286, 6742-6750
18. Yang, X.V., Banerjee, Y., Fernandez, J.A., Deguchi, H., Xu, X., Mosnier, L.O., Urbanus, R.T., de Groot, P.G., White-Adams, T.C., McCarty, O.J., and Griffin, J.H. (2009) Activated protein C ligation of ApoER2 (LRP8) causes Dab1-dependent signaling in U937 cells. Proc Natl Acad Sci U S A 106, 274-279
19. Riewald, M., Petrovan, R.J., Donner, A., Mueller, B.M., and Ruf, W. (2002) Activation of endothelial cell protease activated receptor 1 by the protein C pathway. Science 296, 1880-1882
20. Russo, A., Soh, U.J., Paing, M.M., Arora, P., and Trejo, J. (2009) Caveolae are required for protease-selective signaling by protease-activated receptor-1. Proc Natl Acad Sci U S A 106, 6393-6397
21. Uchiba, M., Okajima, K., Oike, Y., Ito, Y., Fukudome, K., Isobe, H., and Suda, T. (2004) Activated protein C induces endothelial cell proliferation by mitogen-activated protein kinase activation in vitro and angiogenesis in vivo. Circulation research 95, 34-41
22. Minhas, N., Xue, M., Fukudome, K., and Jackson, C.J. (2010) Activated protein C utilizes the angiopoietin/Tie2 axis to promote endothelial barrier function. FASEB journal : official publication of the Federation of American Societies for Experimental Biology 24, 873-881
23. Finigan, J.H., Dudek, S.M., Singleton, P.A., Chiang, E.T., Jacobson, J.R., Camp, S.M., Ye, S.Q., and Garcia, J.G. (2005) Activated protein C mediates novel lung endothelial barrier enhancement: role of sphingosine 1-phosphate receptor transactivation. The Journal of biological chemistry 280, 17286-17293
24. Feistritzer, C., Mosheimer, B.A., Sturn, D.H., Riewald, M., Patsch, J.R., and Wiedermann, C.J. (2006) Endothelial protein C receptor-dependent inhibition of migration of human lymphocytes by protein C involves epidermal growth factor receptor. J Immunol 176, 1019-1025
25. Gramling, M.W., Beaulieu, L.M., and Church, F.C. (2010) Activated protein C enhances cell motility of endothelial cells and MDA-MB-231 breast cancer cells by intracellular signal transduction. Exp Cell Res 316, 314-328
26. Polyak, K., and Metzger Filho, O. (2012) SnapShot: breast cancer. Cancer cell 22, 562-562 e561
27. Yunokawa, M., Koizumi, F., Kitamura, Y., Katanasaka, Y., Okamoto, N., Kodaira, M., Yonemori, K., Shimizu, C., Ando, M., Masutomi, K., Yoshida, T., Fujiwara, Y., and Tamura, K. (2012) Efficacy of everolimus, a novel mTOR inhibitor, against basal-like triple-negative breast cancer cells. Cancer science 103, 1665-1671
28. Gilbert, L.A., Larson, M.H., Morsut, L., Liu, Z., Brar, G.A., Torres, S.E., Stern-Ginossar, N., Brandman, O., Whitehead, E.H., Doudna, J.A., Lim, W.A., Weissman, J.S., and Qi, L.S. (2013) CRISPR-mediated modular RNA-guided regulation of transcription in eukaryotes. Cell 154, 442-451
29. Sato, K., Nagao, T., Iwasaki, T., Nishihira, Y., and Fukami, Y. (2003) Src-dependent phosphorylation of the EGF receptor Tyr-845 mediates Stat-p21waf1 pathway in A431 cells. Genes to cells : devoted to molecular &cellular mechanisms 8, 995-1003
30. Kurosawa, S., Stearns-Kurosawa, D.J., Hidari, N., and Esmon, C.T. (1997) Identification of functional endothelial protein C receptor in human plasma. The Journal of clinical investigation 100, 411-418
31. Taylor, F.B., Jr., Peer, G.T., Lockhart, M.S., Ferrell, G., and Esmon, C.T. (2001) Endothelial cell protein C receptor plays an important role in protein C activation in vivo. Blood 97, 1685-1688
32. Taylor, F. B., Jr., Stearns-Kurosawa, D.J., Kurosawa, S., Ferrell, G., Chang, A.C., Laszik, Z., Kosanke, S., Peer, G., and Esmon, C.T. (2000) The endothelial cell protein C receptor aids in host defense against Escherichia coli sepsis. Blood 95, 1680-1686
33. Esmon, C.T. (2003) The protein C pathway. Chest 124, 26S-32S
34. Schuepbach, R.A., Madon, J., Ender, M., Galli, P., and Riewald, M. (2012) Protease-activated receptor-1 cleaved at R46 mediates cytoprotective effects. J Thromb Haemost 10, 1675-1684
35. Hwang-Verslues, W.W., Kuo, W.H., Chang, P.H., Pan, C.C., Wang, H.H., Tsai, S.T., Jeng, Y.M., Shew, J.Y., Kung, J.T., Chen, C.H., Lee, E.Y., Chang, K.J., and Lee, W.H. (2009) Multiple lineages of human breast cancer stem/progenitor cells identified by profiling with stem cell markers. PLoS One 4, e8377
36. Hiscox, S., and Nicholson, R.I. (2008) Src inhibitors in breast cancer therapy. Expert Opin Ther Targets 12, 757-767
Example 3: Generation of PROCR inhibitory antibodies
Antigen hPROCR-extra cellular domain (h-ED) is a 25KD soluble protein fused with human Fc protein. This project focused on discovery and development of anti-h-ED antibody using phage display platform. This report is divided into two parts: Antibodies panning and Screening and future working plan for cloning of antibody expression: It also recorded related activities and results through whole project procedure in current stage and detail plan for next step. For panning and screening procedure, total 118 phage hits were discovered from panning phage libraries (HDB323, HDB169) using two panning formats: solution and immunotube formats. The antigen binding specificity of phage hits were confirmed by sequence analysis and single point ELISA (SPE) . PCR and DNA sequencing analyzed Fab genes were amplified from antigen positive phages and sequenced. VL and VH sequences were analyzed to sort out 41 unique hits for diversity determination. SPE showed that all phage hit have different specific binding toward antigen h-ED. Those candidates were converted into antibody expression vectors, and their binding to PROCR was further verified by SPE and FACS analysis using HEK293 cells stably expressing PROCR full length. The inhibitory activity of the antibody was further examined by competitive Elisa, in vitro cell based assays and in vivo tumor formation assays.
Results
Antibodies panning and Screening
Two Fab Phage display libraries (HDB323 and HDB169) were panned against antigen h-ED separately using either Streptavidin-Magnetic beads solution or immunotube panning format protocol. Three rounds of panning were carried out. After three rounds of panning, proximately 20,000 output-3 (O3) phages were screened for binding to biotin-labeled antigens by filter lift assay (Fig. 23) . Positive hits were then verified by DNA sequencing and phage Single Point ELISA (SPE) (Fig. 24) . VL and VH gene sequences of all hits were checked for quality control before delivered.
Table 1. Library solution panning results against h-ED
Figure PCTCN2017115198-appb-000033
Figure PCTCN2017115198-appb-000034
Table1: two libraries (HDB323 and HDB169) were panned separately against 100 nM (1st round) , 100 nM (2nd round) , 50 nM (3rd round) of h-ED as described in the method section. Output phage titer and Fab positive ratios were obtained after each round of panning.
Table 2. Library immunotube panning results against h-ED
Figure PCTCN2017115198-appb-000035
Table 2: two libraries (HDB323 and HDB169) were panned separately against 100 nM (1st round) , 100 nM (2nd round) , 50 nM (3rd round) of h-ED as described in the method section. Output phage titer and Fab positive ratios were obtained after each round of panning. (Notebook HDBA01007, P1-25, Expt. 1-6)
Cloning into antibody expression vectors
VL and VH gene sequences of selected hits will be amplified by PCR, and cloned into antibody expression vectors pFUSE2ss-CLIg-hk (light chain) and pFUSEss-CHIg-hG1 (heavy chain) and then sequenced. The binding of the antibody to PROCR was further verified by SPE and FACS analysis using HEK293 cells stably expressing PROCR full length (data not shown) .
Screen for antibodies that inhibit Procr function
The inhibitory activity of the antibody was further examined by competitive Elisa. Purified Protein C (100ul, 0.2ug/ml) was pre-coated to the bottom of a 96-well plate at 4℃ overnight. The wells were washed with PBS containing 0.5%Tween-20 and blocked with 1%BSA. A mixture of purified sPROCR (100ul, 3ug/ml) and the competing antibody or control antibody (in limiting dilution) were added into the wells and incubated for 2 h at 37C. The bound sPROCR was detected after subsequent incubation with a biotin conjugated PROCR primary antibody (R&D Systems) for  1.5 hours and Streptavidin-HRP secondary antibody (R&D Systems) for 30 minutes. After HRP color detection, the absorbance was determined with a microplate reader at 450 nm. All tests were performed in triplicate. We found that  clone  13, 21, 44, 58 and 61 are able to interfere the binding of Protein C to sPROCR (Fig. 25a) . Next these antibodies were further examined for their PROCR-inhibitory capacity in vitro and in vivo. MDA-MB-231 cells were plated at a low density (5×104) onto coverslips in 12-well plate using complete culture medium, addition of the above antibodies resulted in cell shape changes: the spindle-shaped morphology of MDA-MB-231 was altered to become more spherical (Fig. 25b) , suggesting that EMT characteristics that are associated with PROCR has been suppressed. The anti-tumor efficacy of the antibody was further investigated in vivo. Mice bearing PROCR+ BC PDX were treated with the antibody. The treatment began when tumors had developed to be about 200 mm3, and the antibody was injected for a total of 5 times (two times per week) . We found that the above antibodies exhibit significant tumor suppressive effects (Fig. 25c) . Together, these data suggest that  clone  13, 21, 44, 58 and 61 of PROCR antibodies antagonize PROCR function and inhibit (PRROCR-high TNBC) tumor formation.
Experimental procedure
Materials
ELISA plate, Greiner Bio-one, Cat No. 650061;
PBS, Life technologies, Cat No. 70013;
Tween 20, Sigma-Aldrich, Cat No. P1379;
PEG, Sigma-Aldrich, Cat No. P2139;
Casein, Thermo scientific, Cat No. 37532;
BSA, Dingguo, Cat No. DH016-3;
TEA, Sigma-Aldrich, Cat No. 90335;
LB broth, Invitrogen, Cat No. 12780-052;
Typton, Oxoid, Cat No. LP0042;
NH4OAC, Sigma-Aldrich, Cat No. A1542;
Tris, Dingguo, Cat No. DH350-3.1;
IPTG, Sigma, Cat No. I5502.
pFUSE2ss-CLIg-hk (light chain) , Invivogen, Cat No. pfuse2ss-hclk;
pFUSEss-CHIg-hG1 (heavy chain) , Invivogen, Cat No. pfusess-hchg1;
Pfu DNA Polymerase, TIANGEN, Cat No. EP101;
dNTP Mixtrue, 2.5 mM each, TaKaRa, Cat No. 4030;
Cycle Pure Kit, Omega Bio-Tek, Cat No. D6492;
DNA Markers, TIANGEN, Marker II Cat No. MD102-01;
DNA Markers, TIANGEN, Marker III Cat No. MD103-02;
Gel Extraction Kit, Omega Bio-Tek, Cat No. D2500;
DNA Ligation Kit Ver. 2.1, TaKaRa, Cat No. 6022;
Taq DNA Polymerase: TaKaRa, Cat No. R001;
Endo-Free Plasmid Mini Kit II: Omega Bio-Tek, Cat No. D6950;
Blasticidin S, Invitrogen, Cat No. ant-bl-1;
Zeocin, Invitrogen, Cat No. ant-zn-1
Phage libraries and library amplification
Library Diversity Efficiency
HDB323 2.05x10e10 83.7%
HDB169 1.73x10e10 85.3%
Libraries were first amplified and induced to obtain Fab-displaying phages before each panning. Input-1 phages were obtained from amplification of 5x10e10 stock phages of each library. All the output phages of each round were also amplified to make input phages for the next round. To amplify library or input phages, 50 ml of XL1-blue cells were grown in 2YT medium containing 10 μg/ml TET to OD600 0.8-1.2, infected with phages and continue to grow at 37℃ for 3 hours in the presence of 1 μM IPTG. Phage supernatant was collected by centrifugation and purified by PEG precipitation following standard protocol. The purified phages were suspended in 1 ml PBS and stored at 4℃. Amplified phages stored more than 4 weeks will be discarded.
Phage library solution panning against h-ED
The input-1 library phages (5x10e12 pfu in 1ml of 0.5%casein) were first incubated in casein-blocked 100 μL streptavdin-Magnetic beads for 15 min to deplete streptavdin beads binders. The depleted library was then incubated with bio-Fc-control, for 2h rolling up and down, followed by incubation with 100 μL casein blocked streptavdin-Magnetic beads for 15 min. The depleted library was then incubated with bio-hIgG1-Fc, for 2h rolling up and down, followed by incubation with 100 μL casein blocked streptavdin-Magnetic beads for 15 min. The depleted library was then incubated with bio-h-ED, for 2h rolling up and down, followed by incubation with 100 μL casein blocked streptavdin-Magnetic beads for 15 min. Unbound phages were removed by washing with PBSt for 10/15 times. The bound phages were eluted with 400 μL of freshly prepared 100 mM Triethylamine and neutralized by addition of 200 μL of 1M Tris-HCl, pH 6.4. The Output-1 phage was kept on ice all the time. Percentage of Fab positive clones in each input and output phage pools was monitored by filter lift assay.
Phage library immunotube panning against h-ED
Immunotube was coated with 1 ml antigen at 4℃ overnight. The input-1 library phages (5x10e12 pfu in 1ml of 1%BSA) were first incubated in casein-coated immunotube for 2h. The depleted library was then incubated in Fc-control -coated immunotube for 2h rolling up and down. The depleted library was then incubated in hIgG1-Fc-coated immunotube for 2h rolling up and down. The depleted library was then incubated in h-ED immunotube for 2h rolling up and down. Unbound phages were removed by washing with PBSt for 5-20 times. The bound phages were eluted with 1 ml of freshly prepared 100 mM Triethylamine and neutralized by addition of 0.5 ml of 1M Tris-HCl, pH 6.4. The Output-1 phage was kept on ice all the time. Percentage of Fab positive clones in each input and output phage pools was monitored by filter lift assay.
Screening O3 phage pool by antigen specific filter lift
h-ED were biotinylated using EZ-link sulfo-NHS-LC-biotin (Thermo) biotinylation kits. O3 phage was diluted and plated out (500-5000 pfu per plate) to grow at 37℃ for 8h and captured by anti-kappa antibody-coated filter overnight at 22℃. Biotinylated h-ED (50 nM) and NeutrAvidin-AP conjugate (1: 1000 dilution) were applied to the filter to detect antigen binding anti-h-ED phages.
Positive phage plaques were picked and eluted into 100 μl of phage elution buffer. About 10-15 μl eluted phages were used to infect 1 ml XL1 blue cells to make high titer phage (HT) for further analysis.
PCR and DNA sequencing analysis
Fab genes were amplified from antigen positive phages by PCR using primers 19939 and 530 and sequenced with primers 355 and 530 at Genewiz Biotech Co. (Shanghai) . VL and VH sequences were analyzed to sort out unique hits and to determine the hit diversity.
Phage single point ELISA
96 well Greiner plate was coated with antigen at 4℃ overnight and blocked with 1%casein. HT phages of antigen positive clones were first blocked with 0.1%BSA for 1 hour and then incubated in the antigen plate for 2 hours. The plate was washed with PBSt between incubations. Antigen bound phages were detected by anti-M13-HRP (1: 5000 dilutions in 1%casein) .
Cloning
Fab genes will be amplified from antigen positive phages (from part I) by PCR with cloning primers, showing in the table below. VL and VH gene sequences of one phage hit will be cloned into expression vectors pFUSE2ss-CLIg-hk and pFUSEss-CHIg-hG1 using amplification conditions as the table below.
Cloning primer Cutting site
Light chain forward primers Primer VLF-EcoRI
Light chain reverse primer Primer VLR-BsiWI
Cloning primer Sequences (5’to 3’)
Heavy chain forward primers Primer VHF-EcoRI
Heavy chain reverse primer Primer VHR-NheI
Amplification conditions
Step 1 94℃ for 2 min
Step
 2 94℃ for 30 sec
Step 3  (Annealing temp. ) for 30 sec
Step
 4 72℃ for 48 sec
Step
 5 Goto Step 2, repeat for additional 24 cycles
Step
 6 72℃ for 5 min
Step
 7 10℃ forever
DNA sequencing analysis
Fab genes will be amplified from antigen positive phages by PCR and sequenced with primers PZH-2-SEP-ZH-BL-FW at Genewiz Biotech Co. (Shanghai) . VL and VH sequences were analyzed with sequence of original unique hits.
Various aspects of the present disclosure may be used alone, in combination, or in a variety of arrangements not specifically discussed in the embodiments described in the foregoing and is therefore not limited in its application to the details and arrangement of components set forth in the foregoing description or illustrated in the drawings. For example, aspects described in one embodiment may be combined in any manner with aspects described in other embodiments.
While specific embodiments of the subject disclosure have been discussed, the above specification is illustrative and not restrictive. Many variations of the disclosure will become apparent to those skilled in the art upon review of this specification. The full scope of the disclosure should be determined by reference to the claims, along with their full scope of equivalents, and the specification, along with such variations.
INCORPORATION BY REFERENCE
All publications, patents and patent applications referenced in this specification are incorporated herein by reference in their entirety for all purposes to the same extent as if each individual publication, patent or patent application were specifically indicated to be so incorporated by reference.

Claims (13)

  1. Protein C receptor (PROCR) for use in the diagnosis and/or treatment of PROCR-high triple negative breast cancer (TNBC) , wherein an H-score of at least 120 in an immunohistochemistry assay for detecting PROCR expression level indicates the presence of PROCR-high TNBC.
  2. The PROCR of claim 1, wherein the immunohistochemistry assay uses an anti-PROCR antibody or antigen-binding fragment thereof.
  3. The PROCR of claim 2, wherein the anti-PROCR antibody is selected from the group consisting of: (i) any one of SEQ ID NOS: 1-3 and 11-22 or antigen-binding fragment thereof; (ii) an antibody or antigen binding fragment thereof wherein the antibody cross-competes with (i) for binding to PROCR; (iii) an antibody having CDR1, CDR2 and CDR3 selected from the CDRs of SEQ ID NOS: 1-3 and 11-22; and (iv) an antibody or antigen binding fragment thereof wherein the antibody cross-competes with (iii) for binding to PROCR.
  4. Anti-PROCR antibody, or antigen binding fragment thereof, for use in the diagnosis and/or treatment of PROCR-high TNBC, wherein when the anti-PROCR antibody or antigen-binding fragment thereof is used in an immunohistochemistry assay to detect expression level of PROCR, an H-score of at least 120 indicates the presence of PROCR-high TNBC.
  5. The antibody of claim 4, wherein the anti-PROCR antibody is selected from the group consisting of: (i) any one of SEQ ID NOS: 1-3 and 11-22, or antigen-binding fragment thereof; (ii) an antibody or antigen binding fragment thereof wherein the antibody cross-competes with (i) for binding to PROCR; (iii) an antibody having CDR1, CDR2 and CDR3 selected from the CDRs of SEQ ID NOS: 1-3 and 11-22; and (iv) an antibody or antigen binding fragment thereof wherein the antibody cross-competes with (iii) for binding to PROCR.
  6. An isolated anti-PROCR antibody, or antigen binding fragment thereof, wherein the antibody cross-competes for binding to PROCR with any one of SEQ ID NOS: 1-3 and 11-22.
  7. A kit for diagnosing PROCR-high TNBC, comprising one or more of: (i) any one of SEQ ID NOS: 1-3 and 11-22, or antigen-binding fragment thereof; (ii) an antibody or antigen binding fragment thereof wherein the antibody cross-competes for binding to PROCR with (i) ; (iii) an antibody having CDR1, CDR2 and CDR3 selected from the CDRs of SEQ ID NOS: 1-3 and 11-22; and (iv) an antibody or antigen binding fragment thereof wherein the antibody cross-competes with (iii) for binding to PROCR.
  8. A PROCR inhibitor for use in the preparation of a medicament for: (1) the treatment of PROCR-high TNBC, (2) the inhibition of growth of PROCR-high TNBC cells, (3) the reduction of metastasis of PROCR-high TNBC cells, and/or (4) the inhibition of epithelial-mesenchymal transition (EMT) of PROCR-high TNBC cells; wherein the PROCR inhibitor is selected from the group consisting of: (i) any one of SEQ ID NOS: 1-3 and 11-22, or antigen-binding fragment thereof; (ii) an antibody or antigen binding fragment thereof wherein the  antibody cross-competes for binding to PROCR with (i) ; (iii) an antibody having CDR1, CDR2 and CDR3 selected from the CDRs of SEQ ID NOS: 1-3 and 11-22; and (iv) an antibody or antigen binding fragment thereof wherein the antibody cross-competes for binding to PROCR with (iii) .
  9. A pharmaceutical composition for treating PROCR-high TNBC, comprising the PROCR inhibitor of claim 8 and a pharmaceutically acceptable carrier.
  10. Use of the PROCR inhibitor of claim 8 for the manufacture of a medicament for the treatment of PROCR-high TNBC.
  11. A method of suppressing growth, metastasis and/or EMT of a PROCR-high TNBC cell, comprising contacting the cell with an effective amount of the PROCR inhibitor of claim 8.
  12. A method for treating PROCR-high TNBC, comprising administering a therapeutically effective amount of the PROCR inhibitor of claim 8 to a patient in need thereof.
  13. The method of claim 12, further comprising administering a therapeutically effective amount of an Src inhibitor or IGF-1R inhibitor to the patient.
PCT/CN2017/115198 2017-12-08 2017-12-08 Methods and compositions for tnbc stratification and treatment WO2019109331A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CN201780097527.2A CN111656194B (en) 2017-12-08 2017-12-08 Methods and compositions for TNBC partitioning and treatment
PCT/CN2017/115198 WO2019109331A1 (en) 2017-12-08 2017-12-08 Methods and compositions for tnbc stratification and treatment

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/CN2017/115198 WO2019109331A1 (en) 2017-12-08 2017-12-08 Methods and compositions for tnbc stratification and treatment

Publications (1)

Publication Number Publication Date
WO2019109331A1 true WO2019109331A1 (en) 2019-06-13

Family

ID=66750697

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2017/115198 WO2019109331A1 (en) 2017-12-08 2017-12-08 Methods and compositions for tnbc stratification and treatment

Country Status (2)

Country Link
CN (1) CN111656194B (en)
WO (1) WO2019109331A1 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114702577B (en) * 2022-06-06 2022-08-12 中国人民解放军军事科学院军事医学研究院 Broad-spectrum antibody for recognizing West Nile virus and Zika virus E protein DIII

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104471402A (en) * 2012-04-13 2015-03-25 鹿特丹伊拉斯谟大学医疗中心 Biomarkers for triple negative breast cancer
WO2016026444A1 (en) * 2014-08-20 2016-02-25 Shanghai Institutes For Biological Sciences, Chinese Academy Of Sciences Biomarker and therapeutic target for triple negative breast cancer

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105349618B (en) * 2014-08-20 2020-01-24 中国科学院上海生命科学研究院 Triple negative breast cancer marker and application thereof in diagnosis and treatment
CN106267187A (en) * 2015-06-09 2017-01-04 中国科学院上海生命科学研究院 Treat the monoclonal antibody of three negative breast cancer
CN106947819B (en) * 2017-04-11 2020-07-17 成都望路医药技术有限公司 Marker for diagnosis and treatment of colon adenocarcinoma

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104471402A (en) * 2012-04-13 2015-03-25 鹿特丹伊拉斯谟大学医疗中心 Biomarkers for triple negative breast cancer
WO2016026444A1 (en) * 2014-08-20 2016-02-25 Shanghai Institutes For Biological Sciences, Chinese Academy Of Sciences Biomarker and therapeutic target for triple negative breast cancer

Also Published As

Publication number Publication date
CN111656194A (en) 2020-09-11
CN111656194B (en) 2023-08-08

Similar Documents

Publication Publication Date Title
WO2016026444A1 (en) Biomarker and therapeutic target for triple negative breast cancer
US11130813B2 (en) Treatment of cancer with dual targeting of CD47 and EGFR
JP6879924B2 (en) A combination of taskinimod or a pharmaceutically acceptable salt thereof for use as a pharmaceutical and a PD-1 and / or PD-L1 inhibitor.
US20220185866A1 (en) Tnfrsf14 / hvem proteins and methods of use thereof
US20220144959A1 (en) Amhrii-binding compounds for preventing or treating cancers
US11459391B2 (en) Combination therapies and patient stratification with bispecific anti-EGFR/c-Met antibodies
US20230227566A1 (en) Amhrii-binding compounds for preventing or treating lung cancers
WO2019109331A1 (en) Methods and compositions for tnbc stratification and treatment
US20220380469A1 (en) Methods for treating metastatic triple negative breast cancer with anti-pd-1 antibodies
US20210340274A1 (en) Targeting CLPTMIL for Treatment and Prevention of Cancer
Parakh Novel Anti-ErbB Antibodies in the Treatment of Cancer
JP2023549581A (en) Method of treating cancer with a combination of tucatinib and anti-PD-1/anti-PD-L1 antibodies
WO2017175874A1 (en) Cancer treatment pharmaceutical composition using anti-mct5 antibody
CN112040970A (en) Compositions and methods for cancer therapy

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17933915

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 17933915

Country of ref document: EP

Kind code of ref document: A1