WO2019108014A1

WO2019108014A1 - Method for measuring integrity of uid nucleic acid sequence in nucleic acid sequencing analysis

Info

Publication number: WO2019108014A1
Application number: PCT/KR2018/015086
Authority: WO
Inventors: 정종석; 박동현; 박웅양
Original assignee: 사회복지법인 삼성생명공익재단
Priority date: 2017-11-30
Filing date: 2018-11-30
Publication date: 2019-06-06
Also published as: KR101967879B1

Abstract

Provided are a polynucleotide for measuring the integrity of UID and a method for measuring the integrity of UID in nucleic acid sequencing by using the same, the polynucleotide comprising: a first region including a UID nucleic acid sequence; a second region including a nucleic acid sequence having no homology with a reference genome; and a third region including a nucleic acid sequence having homology with the reference genome.

Description

How to measure the purity of UID nucleic acid sequence in nucleic acid sequence analysis

A polynucleotide for measuring the degree of purity of a UID nucleic acid sequence, and a method for measuring the degree of purity of a UID nucleic acid sequence in nucleic acid sequence analysis using the polynucleotide.

A genome or genome is any genetic information that a creature has. Several techniques have been developed for sequencing or sequencing genomes of a single individual, such as DNA chip and Next Generation Sequencing (NGS), and Next Generation Sequencing (NNGS). NGS is widely used for research and diagnostic purposes. Although NGS differs depending on the kind of equipment, it can be broadly divided into three stages: sampling, library production, and nucleic acid sequence analysis. After the nucleic acid sequence analysis, the presence or absence of the gene mutation is detected based on the produced sequence analysis data.

To analyze multiple samples at the same time, a number of samples may be mixed into one nucleic acid sequencing kit. In this case, the sample to be mixed should have a label that can distinguish each sample before mixing. The label may cause errors in nucleic acid sequence analysis results due to polymerase-induced errors in polymerase chain reaction and / or detection errors during nucleic acid sequence analysis, There is a problem that it inhibits. Therefore, there is a need for a method that can identify whether a label capable of distinguishing a large number of samples correctly binds to a sample to be analyzed and correctly labels the sample.

One aspect provides a polynucleotide for measuring the purity of a UID nucleic acid sequence.

Another aspect provides a method for determining the purity of the UID nucleic acid sequence in nucleic acid sequencing.

One aspect includes a first region in which two or more consecutive nucleotides comprise a unique identification (UID) nucleic acid sequence, a second region in which at least two consecutive nucleotides comprise a non-homologous nucleic acid sequence Region and a third region comprising two or more contiguous nucleotides of the nucleic acid sequence homologous to the reference genome.

The first region in the polynucleotide may comprise a unique identification (UID) nucleic acid sequence.

UID refers to a nucleic acid fragment that serves to identify a sample during nucleic acid sequencing. That is, the UID is a marker for distinguishing different samples from each other in nucleic acid sequence analysis for a plurality of samples. Therefore, in order to distinguish a plurality of samples, the UID may have different nucleic acid sequences among the samples. When performing a nucleic acid sequence analysis for one or more samples requiring nucleic acid sequence analysis and a sample for measuring the degree of purity of UID, the polynucleotide for measuring the degree of purity of UID may be one kind of nucleic acid sequence analysis Or a different UID nucleic acid sequence from the above-mentioned samples. When a polynucleotide for measuring the degree of purity of UID is produced, the polynucleotide may be synthesized or prepared so as to have the same UID nucleic acid sequence among a plurality of polynucleotides. The polynucleotide may have one common UID nucleic acid sequence such as AGTC, or may have one or more identical UID nucleic acid sequences, for example, AGTC and TGAC in common. The UID nucleic acid sequence may be mixed with unique molecular identifiers (UMI), an index, or a barcode.

The UID nucleic acid sequence may include, but is not limited to, a base of A, G, C, or T. Also, the UID nucleic acid sequence may be from about 2 bp to about 40 bp, from about 2 bp to about 35 bp, from about 2 bp to about 30 bp, from about 2 bp to about 25 bp, from about 2 bp to about 30 bp, About 3 bp to about 20 bp, about 4 bp to about 20 bp, or about 4 bp to about 16 bp, but the length is not limited thereto.

The polynucleotide may be for application to multiplexing. Multiplexing means mixing two or more samples so that two or more samples can be sequenced in one nucleic acid sequencing lane or chip.

The integrity of the UID means the number or percentage of unique UIDs present in the sample in the sequence analysis data. The degree of purity of the UID may be affected by the library production process and / or the nucleic acid sequencing process. The degree of purity of the UID may be expressed as a relative level.

The second region in the polynucleotide may comprise a nucleic acid sequence that is non-homologous to the reference genome.

Sequence analysis data for one or more samples for which nucleic acid sequence analysis is required To minimize or not to be affected by sequencing data for the sample to determine the purity of the UID, In order to be clearly distinguishable from the required sample, the second region in the polynucleotide may comprise a nucleic acid sequence which is not homologous to the reference genome. In the case of producing a polynucleotide for measuring the degree of purity of UID, the polynucleotide may be synthesized or prepared so as to have the same nucleic acid sequence having no homology with the reference genome among a plurality of polynucleotides.

Sequences that do not have homology with the reference genome, after nucleic acid sequence analysis, are designed to remove synthetic fragments (polynucleotides to measure the purity of the UIDs) artificially injected from the sequence analysis results of the original sequence analysis sample , Sequences that are not homologous to the reference genome can be separated if the consecutive nucleotide sequence of at least 4 bp or more is different from the reference genome in order to prevent the sequencing data of the generated fragment from being located in the reference genome. Nucleic acid sequences that are not homologous to the reference genome may be from about 2 bp to about 250 bp, from about 2 bp to about 40 bp, from about 2 bp to about 35 bp, from about 2 bp to about 30 bp, from about 2 bp From about 2 bp to about 30 bp, from about 3 bp to about 20 bp, from about 4 bp to about 20 bp, or from about 4 bp to about 16 bp, although the length is not limited thereto .

The reference genomic data may be a database already known in the art such as National Center for Biotechnology Information (NCBI), Gene Expression Omnibus (GEO), Food and Drug Administration (FDA), My Cancer Genome, TCGA , Or may be obtained from a control, i.e., a biological sample of a normal person. The normal person may be a healthy person who has not found a specific disease, for example, a tumor. The reference genome may be a human reference genome, and may be hg18 or hg19. The homology means the degree to which the homology matches the nucleotide sequence of a given reference genome.

The third region in the polynucleotide may comprise a nucleic acid sequence having homology with the reference genome. In order to obtain alignment or mapped sequence analysis data in the nucleic acid sequence analysis, the third region in the polynucleotide may comprise a nucleic acid sequence homologous to the reference genome.

The nucleic acid sequence that is homologous to the reference genome may be homologous to two or more consecutive nucleotides of the nucleic acid sequence of the target region. To search for the causative gene of the disease, the whole genome can be sequenced using the next-generation nucleic acid sequencing method, or the nucleic acid sequence can be analyzed only in the exosome region or a specific region. This method of analysis is called target sequence analysis or targeted resequencing. The polynucleotide may be for application in target sequence analysis. The target region may be a whole or a partial region of the gene of interest, and the kind of the gene is not limited.

The second region is located at the 5 'end of the third region, the 3' end of the third region, or the 5 'end and the 3' end of the third region, Terminus of the first region, the 3 'terminus of the third region, the 5' terminus of the second region, the 3 'terminus of the second region, or the 5' terminus of the second region and the 3 'terminus of the second region. For example, the polynucleotide may comprise a first region, a second region and a third region, or a third region, a second region and a first region, in the direction from the 5 'end to the 3' end have. Alternatively, the polynucleotide may include a nucleotide sequence that does not have homology with the UID nucleic acid sequence and / or the reference genome at both ends of the polynucleotide, for example, at the 5 'end to the 3' , A second region, a third region, a second region and a first region. The second region may comprise a nucleic acid sequence that is the same as or different from the second region and not homologous to the reference genome and wherein the first region comprises a UID nucleic acid sequence identical or different than the first region Lt; / RTI > The first region, the second region, and the third regions may be immediately adjacent to each other, or may be located at a certain distance further including any other nucleic acid sequence therebetween.

Fig. 1 is an image showing the structure of a synthetic fragment for measuring the degree of purity of UID (the above-described polynucleotide). As shown in Fig. 1, a synthetic fragment for measuring purity of a plurality of UIDs may include the same UID nucleic acid sequence, a nucleic acid sequence that is not homologous to the reference genome, and a nucleic acid sequence that is homologous to the reference genome have. The synthetic fragment for measuring the purity of the UID may further comprise a primer and / or an adapter. The synthetic fragment for measuring the degree of purity of the UID may be inserted into a library preparation step for one or more samples requiring nucleic acid sequence analysis and subjected to nucleic acid sequence analysis together. In this case, one or more samples for which nucleic acid sequence analysis is required and a sample for measuring the degree of purity of UID may be those having the same primer and / or adapter nucleic acid sequence, while having different UID nucleic acid sequences.

Another aspect provides a composition comprising the polynucleotides described above.

Another aspect provides a kit comprising the polynucleotides described above.

In another aspect, there is provided a method for producing a polynucleotide comprising the steps of: preparing a first library for measuring purity of a UID comprising the polynucleotide described above; Fragmenting a nucleic acid isolated from a biological sample and ligating a polynucleotide comprising a unique identification (UID) nucleic acid sequence to one or more ends of the fragmented nucleic acid to prepare a second library for nucleic acid sequence analysis; Nucleic acid sequence analysis of said first library and said second library to obtain sequencing data; Extracting a lead including a second region from a read of the obtained sequence analysis data; Calculating a ratio of the lead including the first region out of the leads including the extracted second region; And a step of measuring the degree of purity of the UID from the ratio of the lead containing the calculated first region to the degree of purity of the UID in the nucleic acid sequence analysis.

The library means a nucleic acid fragment prepared in a form suitable for nucleic acid sequence analysis. The library may be a fragment in which a primer, an adapter, a unique identifier or a combination thereof is ligated to a nucleic acid fragment for which nucleic acid sequence analysis is required, It may be an amplification product thereof. For example, the library may comprise a nucleic acid fragment set prepared in a form suitable for nucleic acid sequence analysis before or after pre-capture polymerase chain reaction (PCR), target enrichment, or post capture PCR Lt; / RTI >

The library may be, for example, a genomic library, a complementary DNA library, a randomized mutant library, or a combination thereof.

The method includes the step of constructing a first library for measuring purity of a UID comprising the polynucleotide. The first library may be prepared by ligating primers and / or adapters to one or more ends of the polynucleotide. The primers and / or adapters may be adapters suitable for nucleic acid sequencing, primers for polymerase chain reaction, primers suitable for nucleic acid sequencing, regions in which primers suitable for nucleic acid sequencing can be annealed, or combinations thereof . The primers and / or adapters can be selected according to the nucleic acid sequencing method by a person skilled in the art.

The method comprises fragmenting a nucleic acid isolated from a biological sample and ligation of a polynucleotide comprising a UID nucleic acid sequence at one or more ends of the fragmented nucleic acid to prepare a second library for nucleic acid sequence analysis.

The biological sample may be one obtained from a suspected individual having a disease, a suspected individual having a tumor, a normal person, or a combination thereof, or a compound. The subject may be a human being, a cow, a horse, a pig, a sheep, a goat, a dog, a cat, or a rodent. The biological sample may be obtained from blood, plasma, serum, urine, saliva, mucous secretion, sputum, feces, tears or a combination thereof.

The nucleic acid may be a genome or a fragment thereof, and may be used interchangeably with a polynucleotide having an arbitrary length. The genome or genome refers to the entire chromosome, chromatin, or gene. The nucleic acid may be DNA (deoxyribonucleic acid), RNA (ribonucleic acid) or a combination thereof, and may be, for example, cell-free DNA (cf DNA).

The method of separating the nucleic acid from the sample can be carried out by a method known to a person skilled in the art.

The method of fragmenting the isolated nucleic acid may be performed by methods known to those of ordinary skill in the art, and may be physical, chemical, or enzymatic cleavage of the genome, such as by digesting the genome with a restriction enzyme Lt; / RTI >

The method may comprise selecting the size of the fragmented nucleic acid. The step of selecting the size may be performed by electrophoresis, centrifugation, chromatography, or a combination thereof. The isolated nucleic acid fragment may be from about 10 bp to about 2000 bp, from about 15 bp to about 1500 bp, from about 20 bp to about 1000 bp, from about 20 bp to about 500 bp, or from about 20 to about 300 bp.

The second library may be prepared by ligating a polynucleotide comprising a UID nucleic acid sequence to one or more ends of the fragmented nucleic acid. When one or more samples requiring nucleic acid sequence analysis are required, one sample may be one having a different UID nucleic acid sequence from another sample and a sample for measuring the degree of purity of the UID.

The second library may be prepared by ligating primers and / or adapters to one or more ends of the fragmented nucleic acid. The primers and / or adapters may be adapters suitable for nucleic acid sequencing, primers for polymerase chain reaction, primers suitable for nucleic acid sequencing, regions in which primers suitable for nucleic acid sequencing can be annealed, or combinations thereof . The primers and / or adapters can be selected according to the nucleic acid sequencing method by a person skilled in the art.

The method may comprise subjecting to enrichment. The target enrichment means increasing the frequency of the gene or other region of interest to be subjected to the nucleic acid sequence analysis. The target enrichment may be carried out in a manner known to those skilled in the art, for example, by in-solution capture, hybridization of a sample with a bait, polymerase chain reaction, or a combination thereof . The method may include performing pre capture polymerase chain reaction (PCR) prior to target enrichment, post capture PCR after target enrichment, or a combination thereof.

The step of producing the first library and the step of producing the second library may be performed before the nucleic acid sequence analysis. Therefore, the step of producing the first library may be performed first, and the step of producing the second library may be performed first, or the step of producing the first library and the second library may be performed simultaneously.

The method comprises nucleic acid sequencing the first library and the second library to obtain sequencing data.

The nucleic acid sequence analysis may be next generation sequencing (NGS). Nucleic acid sequence analysis may be used interchangeably with sequencing, sequencing, or sequencing. The NGS may be used interchangeably with massive parallel sequencing or second-generation sequencing. The NGS is a technique for simultaneously sequencing large amounts of nucleic acid of a fragment, which is a chip-based and polymerase chain reaction (PCR) -based paired end format , And performing sequencing at a very high speed based on hybridization of the fragment. Illumina HiSeq, Illumina HiSeq 2500, Illumina Genome Analyzer, Solexa platform, SOLiD System (Applied Biosystems), Ion Proton (Life Technologies), Complete Genomics , Helicos Biosciences Heliscope, Pacific Biosciences single molecule real time (SMRT (TM)) technology, or a combination thereof.

The nucleic acid sequence analysis may be a nucleic acid sequence analysis for analyzing only the region of interest. The nucleic acid sequence analysis may include, for example, NGS-based targeted sequencing, targeted deep sequencing or panel sequencing.

The sequence analysis data means the data obtained by the nucleic acid sequence analysis, and may include the sequence, frequency, and quality index of the individual leads to the nucleic acid sequence analyzing object. The " read " means the nucleic acid sequence information of the nucleic acid fragment obtained by the nucleic acid sequence analysis, and may be data derived from nucleic acid sequence analysis or a fragment of the nucleic acid sequence. The sequence analysis data may be obtained, for example, from binary version of SAM (SAM) format and / or Sequence Alignment / Map (SAM) format data. The BAM format and / or the SAM format may typically be used in a format that describes data about short leads. The data in the BAM format and / or the SAM format includes a start point of a lead, a direction of a lead, a mapping quality, a FLAG indicating a degree of alignment, a text related to a CIGAR (Compact Idiosyncratic Gapped Alignment Report) Data may be included. Various supporting pairs can be obtained by creating various alignment pairs.

The method includes extracting a lead comprising a second region from the leads of the obtained sequence analysis data. It is possible to select only the lid including the second region in the lead of the sequence analysis data, specifically, the lid containing the nucleic acid sequence not having homology with the reference genome of the polynucleotide.

The method includes calculating the ratio of leads comprising the first region among the leads comprising the extracted second region. The ratio of the lid including the first region among the leads including the extracted second region, specifically, the lid having the UID nucleic acid sequence of the polynucleotide can be calculated.

The method includes measuring the degree of purity of the UID from the ratio of leads comprising the calculated first region. In the case where no error occurs in which part or all of the UID is deleted, substituted, deleted, or replaced in the nucleic acid sequence analysis process, the leads including the extracted second region may all have the same UID nucleic acid sequence. In this case, the degree of purity of the UID in the nucleic acid sequence analysis may be 100%. However, when an error occurs in which a part or all of the UID is deleted, substituted, deleted, or replaced in the nucleic acid sequence analysis process, some or all of the leads including the extracted second region have the polynucleotide, The UID nucleic acid sequence may be different from the UID nucleic acid sequence of the synthetic fragment for measuring purity. In this case, the degree of purity of the UID in the nucleic acid sequence analysis may be from 0% to less than 100%.

In the case of using the synthetic fragment for measuring the purity of the UID of the present invention, it is possible to determine whether or not the nucleic acid sequence is in error by the UID, and the ratio of the nucleic acid sequence to the nucleic acid sequence, Reliability can be predicted.

In another aspect, there is provided a method for producing a polynucleotide comprising the steps of: preparing a first library for measuring purity of a UID comprising the polynucleotide described above; Nucleic acid sequence analysis of said first library to obtain nucleic acid sequence analysis data; Extracting a lead containing the second region from the leads of the obtained sequence analysis data; Calculating a ratio of the lead including the first region out of the leads including the extracted second region; And a step of measuring the degree of purity of the UID from the ratio of the lead containing the calculated first region to the degree of purity of the UID in the nucleic acid sequence analysis.

The above method is the same as the method of measuring the degree of purity of UID described above, except that nucleic acid sequence analysis is performed on one or more samples requiring nucleic acid sequence analysis. This method can be performed to test the probability of occurrence of an error in the whole process of library production and nucleic acid sequence analysis even when there is no sample requiring nucleic acid sequence analysis.

A first region comprising a UID nucleic acid sequence, a second region comprising a nucleic acid sequence which is not homologous to the reference genome, and a third region comprising a nucleic acid sequence homologous to the reference genome, A polynucleotide for measuring integrity and a method for measuring purity of UID in nucleic acid sequence analysis using the polynucleotide. According to this, in the nucleic acid sequence analysis process, it is possible to confirm whether a label capable of distinguishing a plurality of samples is correctly bound to a sample to be analyzed, and the sample is correctly labeled.

Figure 1 illustrates the purity of a UID containing a unique identifier (UID) nucleic acid sequence, a non-homologous nucleic acid sequence with the reference genome, and a nucleic acid sequence of a target region homologous to the reference genome Fig. 2 is an image showing the structure of a composite section for use in the present invention.

In FIG. 2, A and B show nucleic acid sequence analysis using synthetic fragments for measuring purity of UID, select leads containing nucleic acid sequences not having homology with the reference genome, This is the result of confirming the ratio of the UID and the UID of the combined intercept. In Figures 1 and 2, ss means a specific sequence with no homology to the reference genome (ss).

FIG. 3 is a flowchart of a procedure for performing nucleic acid sequence analysis using synthetic fragments for measuring the purity of UID. A method for measuring the degree of purity of a UID according to an exemplary embodiment includes performing nucleic acid fragmentation, end-repair, 3'-adenosine tailing, and adapter ligation, introducing synthetic fragments for measuring purity of UID , Purity of UID can be measured by performing capture-pre-polymerase chain reaction, target enrichment, capture-post-polymerase chain reaction, nucleic acid sequence analysis, fastq file extraction, and UID nucleic acid sequence selection.

Hereinafter, the present invention will be described in more detail with reference to examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.

실시예 1. 표적 영역의 핵산 서열분석에서 UID의 순결도(integrity) 측정Example 1. Measurement of integrity of UID in nucleic acid sequence analysis of a target region

1. UID의 순결도 측정용 합성 절편의 제작1. Fabrication of synthetic slice for measuring purity of UID

For the next generation sequencing (NGS), the genes KRAS, IDH1, BRAC1, ALK, and ERBB2, which are known to have mutations in the cancer as the nucleotide sequence of the target region, and the regions of these genes were selected. A reference sequence of about 100 to about 350 bp was selected based on the selected site.

A nucleic acid sequence having a unique identifier (UID) nucleic acid sequence, a non-homologous nucleic acid sequence having no homology with the reference genome, and a nucleic acid sequence having a homology with the reference genome and having an illumina P5 Adapter and a P7 adapter nucleic acid sequence (hereinafter referred to as "synthetic fragments for measuring purity of UID").

The nucleotide sequences of the selected fragments for the determination of the purity of the selected gene, the reference sequence and the UID, and the nucleic acid sequences extracted from the sequence analysis are shown in Table 1 below. In Table 1, the nucleic acid sequence that is not homologous to the reference genome is 4 bp in front of the extraction sequence and is shown in bold color. UID nucleic acid sequences are shown in bold and underlined text in the synthetic fragments for UID purity measurement. The P5 and P7 sequences are shown in slanted text. Sequence analysis primer binds after P5 and before GTCT sequence. Sequence from P7 to P7 is combined with sequence analysis primer and index sequence analysis primer. The target region corresponds to all sequences other than the nucleic acid sequence 4 bp that is not homologous to the reference genome in the extracted sequence.

..	참조 게놈의 표적 영역The target region of the reference genome 및 핵산 서열And a nucleic acid sequence	UID의 순결도 측정용 합성 절편(UID 핵산 서열 : AGTC) Synthetic fragment (UID nucleic acid sequence: AGTC) for measuring purity of UID	추출 서열Extracted sequence
1One	KRAS : Chr12 :엑손 번호: 3 : chr12:25380168-25380346KRAS: Chr12: exon number: 3: chr12: 25380168-25380346	5'-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTGTCTATCCTGAGAAGGGAGAAACACAGTCTGGATTATTACAGTGCACCTTTTACTTCAAAAAAGGTGTTATATACAACTCAACAACAAAAAATTCAATTTAAAAATGGGCAAAGGACTTGAAAAGACATTGTTCCTGCTCCAAAGATCTGAGAGAGATCGGAAGAGCACACGTCTGAACTCCAGTCACCACG AGTC ATCTCGTATGCCGTCTTCTGCTTG-3'(서열번호 1)5'- GTCT AATGATACGGCGACCACCGA GATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT ATCCTGAGAAGGGAGAAACACAGTCTGGATTATTACAGTGCACCTTTTACTTCAAAAAAGGTGTTATATACAACTCAACAACAAAAAATTCAATTTAAAAATGGGCAAAGGACTTGAAAAGACATTGTTCCTGCTCCAAAGATCTGAGAGAGATCGGAAGAGCACACGTCTGAACTCCAGTCACCACG AGTC ATCTCGTATGCCGTCTTCTGCTTG -3 '(SEQ ID NO: 1)	5'-GTCTATCCTGAGAAGGGAGAAACACAGTCTGGATTATTACAGTGCACCTTTTACTTCAAAAAAGGTGTTATATACAACTCAACAACAAAAAATTCAATTTAAAAATGGGCAAAGGACTTGAAAAGACATTGTTCCTGCTCCAAAGATCTG-3'(서열번호 2)5'- GTCT ATCCTGAGAAGGGAGAAACACAGTCTGGATTATTACAGTGCACCTTTTACTTCAAAAAAGGTGTTATATACAACTCAACAACAAAAAATTCAATTTAAAAATGGGCAAAGGACTTGAAAAGACATTGTTCCTGCTCCAAAGATCTG-3 '(SEQ ID NO: 2)
22	IDH1 : Chr12엑손 번호: 4 : chr2:209113048-209113359IDH1: Chr12 exon number: 4: chr2: 209113048-209113359	5'-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTGTCTAATGGCTTCTCTGAAGACCGTGCCACCCAGAATATTTCGTATGGTGCCATTTGGTGATTTCCACATTTGTTTCAACTTGAACTCCTCAACCCTCTTCTCATCAGGAGTGATAGTGGCACATTTGACGCCAACATTATGCTTCTCTGAGAGAGATCGGAAGAGCACACGTCTGAACTCC AGTC ACCACGAGTCATCTCGTATGCCGTCTTCTGCTTG-3'(서열번호 3)5'- GTCT AATGATACGGCGACCACCGA GATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT AATGGCTTCTCTGAAGACCGTGCCACCCAGAATATTTCGTATGGTGCCATTTGGTGATTTCCACATTTGTTTCAACTTGAACTCCTCAACCCTCTTCTCATCAGGAGTGATAGTGGCACATTTGACGCCAACATTATGCTTCTCTGAGAGAGATCGGAAGAGCACACGTCTGAACTCC AGTC ACCACGAGTCATCTCGTATGCCGTCTTCTGCTTG -3 '(SEQ ID NO: 3)	5'-GTCTAATGGCTTCTCTGAAGACCGTGCCACCCAGAATATTTCGTATGGTGCCATTTGGTGATTTCCACATTTGTTTCAACTTGAACTCCTCAACCCTCTTCTCATCAGGAGTGATAGTGGCACATTTGACGCCAACATTATGCTTCTCTG-3'(서열번호 4)5'- GTCT AATGGCTTCTCTGAAGACCGTGCCACCCAGAATATTTCGTATGGTGCCATTTGGTGATTTCCACATTTGTTTCAACTTGAACTCCTCAACCCTCTTCTCATCAGGAGTGATAGTGGCACATTTGACGCCAACATTATGCTTCTCTG-3 '(SEQ ID NO: 4)
33	BRAC1 : Chr17엑손 번호: 15 : chr17:41222945-41223255BRAC1: Chr17 exon number: 15: chr17: 41222945-41223255	5'-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTGTCTTTCTGGCTTCTCCCTGCTCACACTTTCTTCCATTGCATTATACCCAGCAGTATCAGTAGTATGAGCAGCAGCTGGACTCTGGGCAGATTCTGCAACTTTCAACTTTCAATTGGGGAACTTTCAATGCAGAGGTTGAAGATGGTCTGAGAGAGATCGGAAGAGCACACGTCTGAACTCC AGTC ACCACGAGTCATCTCGTATGCCGTCTTCTGCTTG-3'(서열번호 5)5'- GTCT AATGATACGGCGACCACCGA GATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT TTCTGGCTTCTCCCTGCTCACACTTTCTTCCATTGCATTATACCCAGCAGTATCAGTAGTATGAGCAGCAGCTGGACTCTGGGCAGATTCTGCAACTTTCAACTTTCAATTGGGGAACTTTCAATGCAGAGGTTGAAGATGGTCTGAGAGAGATCGGAAGAGCACACGTCTGAACTCC AGTC ACCACGAGTCATCTCGTATGCCGTCTTCTGCTTG -3 '(SEQ ID NO: 5)	5'-GTCTTTCTGGCTTCTCCCTGCTCACACTTTCTTCCATTGCATTATACCCAGCAGTATCAGTAGTATGAGCAGCAGCTGGACTCTGGGCAGATTCTGCAACTTTCAACTTTCAATTGGGGAACTTTCAATGCAGAGGTTGAAGATGGTCTG-3'(서열번호 6)5'- GTCT TTCTGGCTTCTCCCTGCTCACACTTTCTTCCATTGCATTATACCCAGCAGTATCAGTAGTATGAGCAGCAGCTGGACTCTGGGCAGATTCTGCAACTTTCAACTTTCAATTGGGGAACTTTCAATGCAGAGGTTGAAGATGGTCTG-3 '(SEQ ID NO: 6)
44	ALK : Chr2엑손 번호: 20: chr2:29446208-29446394ALK: Chr2 exon number: 20: chr2: 29446208-29446394	5'-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTGTCTACTGATGGAGGAGGTCTTGCCAGCAAAGCAGTAGTTGGGGTTGTAGTCGGTCATGATGGTCGAGGTGCGGAGCTTGCTCAGCTTGTACTCAGGGCTCTGCAGCTCCATCTGCATGGCTTGCAGCTCCTGGTGCTTCCGGCGGTCTGAGAGAGATCGGAAGAGCACACGTCTGAACTCC AGTC ACCACGAGTCATCTCGTATGCCGTCTTCTGCTTG-3'(서열번호 7)5'- GTCT AATGATACGGCGACCACCGA GATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT ACTGATGGAGGAGGTCTTGCCAGCAAAGCAGTAGTTGGGGTTGTAGTCGGTCATGATGGTCGAGGTGCGGAGCTTGCTCAGCTTGTACTCAGGGCTCTGCAGCTCCATCTGCATGGCTTGCAGCTCCTGGTGCTTCCGGCGGTCTGAGAGAGATCGGAAGAGCACACGTCTGAACTCC AGTC ACCACGAGTCATCTCGTATGCCGTCTTCTGCTTG -3 '(SEQ ID NO: 7)	5'-GTCTACTGATGGAGGAGGTCTTGCCAGCAAAGCAGTAGTTGGGGTTGTAGTCGGTCATGATGGTCGAGGTGCGGAGCTTGCTCAGCTTGTACTCAGGGCTCTGCAGCTCCATCTGCATGGCTTGCAGCTCCTGGTGCTTCCGGCGGTCTG-3'(서열번호 8)5'- GTCT ACTGATGGAGGAGGTCTTGCCAGCAAAGCAGTAGTTGGGGTTGTAGTCGGTCTGTGGTCGAGGTGCGGAGCTTGCTCAGCTTGTACTCAGGGCTCTGCAGCTCCATCTGCATGGCTTGCAGCTCCTGGTGCTTCCGGCGGTCTG-3 '(SEQ ID NO: 8)
55	ERBB2 : Chr17엑손 번호: 6: chr17:37864574-37864787ERBB2: Chr17 exon number: 6: chr17: 37864574-37864787	5'-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTGTCTGCTACGTGCTCATCGCTCACAACCAAGTGAGGCAGGTCCCACTGCAGAGGCTGCGGATTGTGCGAGGCACCCAGCTCTTTGAGGACAACTATGCCCTGGCCGTGCTAGACAATGGAGACCCGCTGAACAATACCACCCCTGTTCTGAGAGAGATCGGAAGAGCACACGTCTGAACTCC AGTC ACCACGAGTCATCTCGTATGCCGTCTTCTGCTTG-3'(서열번호 9)5'- GTCT AATGATACGGCGACCACCGA GATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT GCTACGTGCTCATCGCTCACAACCAAGTGAGGCAGGTCCCACTGCAGAGGCTGCGGATTGTGCGAGGCACCCAGCTCTTTGAGGACAACTATGCCCTGGCCGTGCTAGACAATGGAGACCCGCTGAACAATACCACCCCTGTTCTGAGAGAGATCGGAAGAGCACACGTCTGAACTCC AGTC ACCACGAGTCATCTCGTATGCCGTCTTCTGCTTG -3 '(SEQ ID NO: 9)	5'-GTCTGCTACGTGCTCATCGCTCACAACCAAGTGAGGCAGGTCCCACTGCAGAGGCTGCGGATTGTGCGAGGCACCCAGCTCTTTGAGGACAACTATGCCCTGGCCGTGCTAGACAATGGAGACCCGCTGAACAATACCACCCCTGTTCTG-3'(서열번호 10)5'- GTCT GCTACGTGCTCATCGCTCACAACCAAGTGAGGCAGGTCCCACTGCAGAGGCTGCGGATTGTGCGAGGCACCCAGCTCTTTGAGGACAACTATGCCCTGGCCGTGCTAGACAATGGAGACCCGCTGAACAATACCACCCCTGTTCTG-3 '(SEQ ID NO: 10)

2. 표적 영역의 핵산 서열분석을 위한 라이브러리의 제작 및 핵산 서열분석2. Preparation of library for nucleic acid sequence analysis of target region and nucleic acid sequence analysis

A library for nucleic acid sequence analysis of the target region was constructed as follows.

50 ng of the genomic DNA (genomic DNA: gDNA) of the NA12878 sample of the Coriell institute was prepared. The prepared gDNA samples were subjected to fragmentation, end-repair, 3'-adenosine tailing (3'A-C) using the KAPA hyper illumina production kit (Kapa Biosystems) according to the manufacturer's method. tailing and adapter ligation were performed and purified using AMPure beads (Beckman Coulter, Indiana, USA) to prepare a fragment for nucleic acid sequence analysis.

A synthetic section for measuring the purity of UID prepared in Example 1.1 was quantified and a synthetic section for measuring purity of 5 amole UID was added to the section for nucleic acid sequence analysis. A pre-capture polymerase chain reaction (PCR) was performed on a fragment for nucleic acid sequence analysis to which a synthetic fragment for measurement of purity of UID was added. Subsequently, according to the SureSelect bait hybridization protocol with a modification that replaces the blocking oligonucleotide for the pre-indexed adapter with an IDT x Gen blocking oligonucleotide (IDT, Santa Clara, Calif., USA) And then enriched (target enrichment). Thereafter, post-capture PCR was performed on the target enriched fragments to complete a library for nucleic acid sequence analysis.

The completed library was purified with AMPure beads and quantified by PicoGreen fluorescence analysis using a dsDNA HS assay kit and Qubit 2.0 fluorescence photometer. Based on the DNA concentration and average fragment size, the library was normalized to a concentration of 2 nM. The DNA was denatured using 0.2N NaOH and the denatured library was diluted in a hybridization buffer (Illumina, San Diego, Calif., USA) to 20 pM. The denatured template was cluster amplified according to the manufacturer's instruction (Illumina). Flow cells were sequenced in a 100 bp pair-terminal mode using a HiSeq 2500 v3 Sequencing-by-Synthesis kit (Illumina) and analyzed using RTA software (v.1.12.4.2 or higher). The nucleotide sequence was extracted in BCL format and converted to a fastq format file through the bcl converter. Using BWA-mem (v0.7.5), a BAM file was generated by aligning all the raw data to the hg19 human reference genome. Using SAMTOOLS (v0.1.18), Picard (v1.93), and GATK (v3.1.1), SAM / BAM files were categorized, local realignment was performed, and redundancy was indicated. Through this process, redundancy, mismatch pairs, and leads deviating from the target were removed. A UID nucleic acid sequence, a forward read (r1), and a reverse read (r2).

A lid with the extraction sequence set forth in Table 1 in a separate lid, i.e., a lid containing a nucleic acid sequence that is not homologous to the reference genome, was selected. Then, the ratio of the UID nucleic acid sequence, that is, the lead having the AGTC, in the selected lid was confirmed.

In FIG. 2, A and B show nucleic acid sequence analysis using synthetic fragments for measuring purity of UID, select leads containing nucleic acid sequences not having homology with the reference genome, This is the result of confirming the ratio of the UID and the UID of the combined intercept. As shown in A and B in Fig. 2, it can be seen that a plurality of leads having UID nucleic acid sequences other than the AGTC, which is a UID nucleic acid sequence, can be included. When a synthetic fragment for measuring the purity of the UID of the present invention is used in the process of preparing a nucleic acid sequence analyzing library and performing nucleic acid sequence analysis, the error and the ratio in which the UID is deleted, substituted, deleted, or replaced are measured .

Claims

A first region in which two or more consecutive nucleotides comprise a unique identification (UID) nucleic acid sequence, a second region in which at least two consecutive nucleotides comprise a non-homologous nucleic acid sequence, and A polynucleotide for measuring the integrity of a UID, wherein the at least two consecutive nucleotides comprise a third region comprising a nucleic acid sequence homologous to the reference genome.
2. The polynucleotide of claim 1, wherein the UID nucleic acid sequence is from 2 bp to 40 bp.
The polynucleotide of claim 1, wherein the nucleic acid sequence that is not homologous to the reference genome is between 2 bp and 250 bp.
2. The polynucleotide of claim 1, wherein the nucleic acid sequence homologous to the reference genome is homologous to two or more contiguous nucleotides of the nucleic acid sequence of the target region.
2. The method of claim 1, wherein the second region is located at the 5 'end of the third region, the 3' end of the third region, or the 5 'and 3' ends of the third region, The 5 'end of the third region, the 5' end of the second region, the 3 'end of the second region, or the 5' end of the second region and the 3 'end of the second region Polynucleotide. &Lt; / RTI >
The polynucleotide of claim 1, which is for application to next generation sequencing (NGS).
The polynucleotide of claim 1, for use in targeted sequencing, targeted deep sequencing or panel sequencing.
Preparing a first library for measuring purity of a UID comprising the polynucleotide of claim 1;

Fragmenting a nucleic acid isolated from a biological sample and ligating a polynucleotide comprising a unique identification (UID) nucleic acid sequence to one or more ends of the fragmented nucleic acid to prepare a second library for nucleic acid sequence analysis;

Nucleic acid sequence analysis of said first library and said second library to obtain nucleic acid sequence analysis data;

Extracting a lead containing the second region from the leads of the obtained sequence analysis data;

Calculating a ratio of the lead including the first region out of the leads including the extracted second region; And

And measuring the degree of purity of the UID from the ratio of the lead containing the calculated first region.
9. The method of claim 8, wherein the nucleic acid sequence analysis is next generation sequencing (NGS).
9. The method of claim 8, wherein the nucleic acid sequence analysis is targeted sequencing, targeted deep sequencing or panel sequencing.