WO2019106522A1 - Pooled crispr/cas9 screening in primary cells using guide swap technology - Google Patents

Pooled crispr/cas9 screening in primary cells using guide swap technology Download PDF

Info

Publication number
WO2019106522A1
WO2019106522A1 PCT/IB2018/059313 IB2018059313W WO2019106522A1 WO 2019106522 A1 WO2019106522 A1 WO 2019106522A1 IB 2018059313 W IB2018059313 W IB 2018059313W WO 2019106522 A1 WO2019106522 A1 WO 2019106522A1
Authority
WO
WIPO (PCT)
Prior art keywords
cell
cells
cas9
grna
encoded
Prior art date
Application number
PCT/IB2018/059313
Other languages
French (fr)
Inventor
Scott Lee
Christian SCHMEDT
Jennifer SNEAD
Pamela YF TING
Original Assignee
Novartis Ag
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Novartis Ag filed Critical Novartis Ag
Publication of WO2019106522A1 publication Critical patent/WO2019106522A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111—General methods applicable to biologically active non-coding nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/10—Applications; Uses in screening processes
    • C12N2320/11—Applications; Uses in screening processes for the determination of target sites, i.e. of active nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/10—Applications; Uses in screening processes
    • C12N2320/12—Applications; Uses in screening processes in functional genomics, i.e. for the determination of gene function
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2330/00—Production
    • C12N2330/30—Production chemically synthesised
    • C12N2330/31—Libraries, arrays

Definitions

  • genome-scale knockout screening is limited to cell lines and Cas9 knock-in mice that can be engineered to express Cas9. While these are valuable systems that allow for controlled experimentation to understand cellular and biological processes, they do not entirely recapitulate human biology (Breschi, A., et al., Nature Reviews Genetics 18, 425 (2017)). Human primary cells more closely mimic the physiological state in vivo - retaining normal markers, functions, heterogeneity and finite lifespan. However, often, their limited proliferative capacity, propensity to differentiate in culture or poor transfection and transduction efficiency precludes the engineering of stable, clonal Cas9-expressing cells.
  • Some embodiments disclosed herein provide methods of inducing one or more genetic modifications in a cell, e.g., in a primary cell, said method comprising: a) introducing into said cell a ribonuclear protein complex (RNP) comprising a Cas9 molecule and a precomplexed RNA; and b) introducing into said cell one or more nucleic acid sequences encoding one or more encoded gRNA molecules, each of said one or more encoded gRNA molecules comprising a targeting domain.
  • RNP ribonuclear protein complex
  • a genetic modification e.g., an indel
  • the precomplexed RNA comprises a gRNA molecule comprising a targeting domain.
  • the precomplexed gRNA molecule is a dual guide RNA
  • the precomplexed gRNA molecule is a single guide RNA (sgRNA) molecule.
  • the targeting domain of the precomplexed gRNA molecule specifically binds to a target sequence in the genome of the cell to which it is introduced.
  • the targeting domain of the precomplexed gRNA molecule does not specifically bind to a target sequence in the genome of the cell to which it is introduced.
  • the target sequence is located in a target gene.
  • the target gene is selected from the group consisting of beta-2-macroglobulin (B2M), CD33, CD45, PD-1 .
  • each of the one or more encoded gRNA molecules specifically binds to a target sequence of an encoded target gene.
  • each of the one or more encoded RNA molecules is encoded by a vector.
  • the vector is selected from the group consisting of a viral vector (e.g., a lentiviral vector, a retroviral vector, etc.), a plasmid, a minicircle, and a nanoplasmid.
  • each of the one or more encoded gRNA molecules is a member of a library of encoded gRNA molecules.
  • the library of encoded gRNA molecules is a human or mouse genome-wide dgRNA or sgRNA library, preferably an sgRNA library.
  • the Cas9 molecule is a Cas9 protein from Streptococcus pyogenes, Streptococcus Aureus, or Streptococcus thermophilus.
  • the cell is a primary cell. In some embodiments, the cell is a human primary cell or a mouse primary cell.
  • the primary cell is a hematopoietic stem cell (HSC), a cancer cell, a lymphocyte, a macrophage, a dendritic cell, an adipocyte, a neuron, or a combination thereof.
  • HSC hematopoietic stem cell
  • the target gene is modified at an efficiency of at least 70%.
  • one or more of the encoded target gene is modified at an efficiency of at least 50%.
  • the methods further comprise introducing into said cell a ssDNA.
  • the ssDNA is introduced with the RNP.
  • Some embodiments disclosed herein provide methods of screening one or more encoded gRNA molecules in a population of cells, e.g., a population of primary cells, comprising: a) introducing into said population of cells a ribonuclear protein complex (RNP) comprising a Cas9 molecule and a precomplexed RNA or an apo-Cas9 molecule with a ssDNA; b) introducing into said population of cells a library of nucleic acid sequences encoding one or more encoded gRNA molecules, each of said one or more encoded gRNA molecules comprising a targeting domain; c) assaying a cell of the population of cells for a property; and d) identifying the encoded gRNA molecule introduced into said cell.
  • RNP ribonuclear protein complex
  • a genetic modification e.g., an indel
  • the property is selected from the group consisting of cell survival, cell death, cell growth, cell differentiation, cell activation, gene expression (single gene expression or multiple gene expression), a phenotypic change, and any combination thereof.
  • the identifying comprises genetic analysis of the cell having the property.
  • the genetic analysis comprises sequencing, hybridization, PCR, or a combination thereof.
  • the identifying comprises comparing the level of the encoded gRNA molecule to a reference level.
  • the encoded gRNA molecule is identified if the difference in the level of the encoded gRNA molecule compared to the reference level has a Z-score of less than -3 or greater than 3. In some embodiments, the identifying comprises calculating an enrichment score of the encoded gRNA molecule. In some embodiments, the encoded gRNA molecule is identified if the enrichment score of the encoded gRNA molecule is greater than 2 or less than 0.5. In some embodiments, the population of cells expresses a reporter gene product. In some embodiments, the assaying a cell of the population of cells for a property comprises comparing the level of the reporter gene product in the cell to a reference level.
  • the cell is identified as having the property if the difference in the level of the reporter gene product of the cell compared to the reference level has a Z-score of less than -3 or greater than 3.
  • the precomplexed RNA is a gRNA molecule comprising a targeting domain.
  • the precomplexed gRNA molecule is a dual guide RNA (dgRNA) molecule.
  • the precomplexed gRNA molecule is a single guide RNA (sgRNA) molecule.
  • the targeting domain of the precomplexed gRNA molecule specifically binds to a target sequence in the genome of the cell to which it is introduced.
  • the targeting domain of the precomplexed gRNA molecule does not specifically bind to a target sequence in the genome of the cell to which it is introduced.
  • the target sequence is located in a target gene.
  • the target gene is selected from the group consisting of beta-2-macroglobulin (B2M), CD33, CD45, PD-1 .
  • B2M beta-2-macroglobulin
  • the targeting domain of each of the one or more encoded gRNA molecules specifically binds to a target sequence of an encoded target gene.
  • each nucleic acid sequence encoding one or more encoded gRNA molecules comprises a vector.
  • the vector is a lentiviral vector.
  • the library of encoded gRNA molecules is a human or mouse genome-wide dgRNA or sgRNA library, preferably an sgRNA library.
  • the Cas9 molecule is a Cas9 protein from Streptococcus pyogenes,
  • the population of cells is a population of primary cells. In some embodiments, the population of primary cells is a population of human primary cells or a population of mouse primary cells. In some
  • the population of primary cells comprises a hematopoietic stem cell (HSC), a cancer cell, a lymphocyte, a macrophage, a dendritic cell, an adipocyte, a neuron, or a combination thereof.
  • HSC hematopoietic stem cell
  • one or more of the target gene is modified at an efficiency of at least 70%.
  • the encoded target gene is modified at an efficiency of at least 50%.
  • the methods further comprise introducing into said population of cells a ssDNA.
  • FIGs. 1A-1 F show efficient gene disruption and protein knockout by RNP- mediated delivery of Cas9 to lenti-gRNA transduced cells.
  • FIG. 1 A shows a schematic of experiment comparing editing at lenti gRNA-directed target location using different methods of Cas9 delivery.
  • FIG. 1 B shows representative plots of FACS gating strategy. Live cells were gated by DAPI exclusion. Doublets were discriminated using FSC-W vs. FSC-H, followed by SSC-W vs. SSC-H. Representative RFP gating is shown.
  • FIG. 1 D shows representative histogram of CD33 expression (top) and CD45 expression (bottom) 4 days after nt_A RNP electroporation of HSPC transduced with the indicated lenti gRNA. Gated on RFP+ cells. The experiment was repeated in three independent donors with similar results.
  • FIG. 1 E shows representative FACS plots of CD45 expression in human primary CD3+ T cells 4 days post-electroporation. The experiment was performed with two technical replicates and repeated once with independent gRNAs with similar results.
  • FIG. 1 F shows Western blot analysis of MTAP knockout in CT26; representative of four independent experiments.
  • FIGs. 2A-2E show that RNP-mediated Cas9 delivery enables efficient editing with lentivirus-encoded gRNA.
  • FIG. 2D shows time course TIDE analysis of CD45 editing efficiency in HSPC transduced with lentivirus encoding the indicated gRNA.
  • FIG. 2E shows comparison of Guide Swap versus standard RNP (grey) in HSPC.
  • CD45 (left) or CD33 (right) knockout efficiency was assessed by flow cytometry.
  • the letters on the x-axis denote the identity of the CD45 or CD33 gRNA.
  • Lenti gRNA-expressing cells were gated using RFP.
  • nt non-targeting.
  • n 2 technical replicates.
  • FIGs. 3A-3B show that RNP-mediated Cas9 delivery outperforms Cas9 alone in enabling efficient editing with lenti gRNA in CD34+ HSPC and CD4+ T cells.
  • FIG. 3A shows flow cytometry analysis of CD45 knockout efficiency 4 days post-electroporation.
  • Transduced CD34+ HSPC were electroporated with indicated amounts of Cas9, or non-targeting RNP (6 pg Cas9 pre-complexed with 6 pg non-targeting synthetic split gRNA).
  • Lenti gRNA-expressing cells were gated using RFP.
  • FIG. 3B shows flow cytometry analysis of CD45 (left) and CXCR4 (right) knockout. Experiment was similar to (A) except performed in T cells.
  • FIGs. 4A-4C show efficient CD45 knockout using lenti gRNA and RNPs of varied gRNA targets and formats.
  • FIGs. 4A-4C are representative of multiple lenti gRNAs tested in two independent experiments with similar results.
  • FIG. 4C shows representative FACS plots of CD33 and CD45 expression 4 days post-electroporation with indicated RNPs. Lenti gRNA-expressing cells were gated using the RFP marker.
  • FIGs. 5A-5E show that gRNA-binding enhances Cas9 delivery by
  • FIG. 5A shows representative histograms of Cas9 FACS staining.
  • tr tracrRNA.
  • scram scrambled sequence RNA.
  • sg single synthetic guide. The experiment was repeated once with similar results.
  • FIG. 5B shows fold change in MFI (median fluorescence intensity) of intracellular Cas9 FACS staining, compared to appropriate non-permeabilized control for each condition.
  • FIGs. 6A-6C show that Guide Swap is amenable to genome-scale screening.
  • FIG. 6A shows the indicated numbers of transduced HSPC were pelleted and resuspended in 20 pL for electroporation. CD45 knockout was assessed by flow cytometry 4 days post-electroporation. Representative of multiple gRNAs tested in two independent experiments with similar results.
  • FIGs. 7A-7D show that Guide Swap enables pooled enrichment and depletion screens in human primary CD4+ T cells.
  • FIG. 7A shows the design of genetic screen.
  • FIG. 7B shows RSA analysis for guides depleted in Day 6 RFP+CD4+CD45+CXCR4+ versus Day 0 samples plotted against maximal fold change. Top scoring genes are highlighted.
  • FIG. 7C shows Gene Ontology enrichment analysis of the top ranked 100 hits in Day 6
  • FIG. 7D shows Day 6 RFP+CXCR4- versus Day 0 comparison of log2 fold changes in replicates for gRNAs that regulate CXCR4 surface expression.
  • CXCR4 spike-in gRNAs are colored in blue.
  • CXCR4 gRNAs present in the library are colored in magenta.
  • FIGs. 8A-8F show data of pooled Guide Swap screens in human primary CD4+
  • FIG. 8A shows cumulative distribution of the Log2 normalized reads per million per gRNA at Day 0 (magenta) and Day 6 RFP+CD4+CD45+CXCR4+ (blue) for one replicate.
  • FIG. 8D shows Day 6 RFP+CD4- versus Day 0 comparison of log2 fold changes in replicates for gRNAs that regulate CD4 surface expression.
  • CD4 spike-in gRNAs are colored in blue.
  • CD4 gRNAs present in the library are colored in magenta.
  • FIG. 8E shows Day 6 RFP+CD45- versus Day 0 comparison of log2 fold changes in replicates for gRNAs that regulate CD45 surface expression.
  • CD45 spike-in gRNAs are colored in blue.
  • CD45 gRNAs present in the library are colored in magenta.
  • Two gRNAs that were spiked in were also present in the library, and these are colored in purple.
  • FIG. 8F shows Venn diagram of gene hits from RSA and 2nd best gRNA analyses of Day 6 RFP+CD4+CD45+CXCR4+ versus Day 0 samples.
  • FIGs 9A-9D show that Guide Swap is amenable to genome-scale screening in CD34+ HSPC.
  • FIG. 9A shows CD33 (left) and CD45 (right) knockout efficiency in CD34+ HSPC from indicated donors. Gated on RFP+ cells; two technical replicates in one experiment.
  • mPB mobilized peripheral blood.
  • CB cord blood.
  • FIG. 9B shows representative FACS plots of CD45 knockout in cord blood CD34+CD90+ cells (top). Gating strategy for CD34+CD90- and
  • FIG. 9D shows representative FACS plots of CD45RA and CD34 expression 7 and 14 days post-electroporation; two technical replicates in one experiment.
  • FIGs. 10A-10D show that genome-scale Guide Swap screen in human primary CD34+ HSPC reveals genes whose loss regulates ex vivo hematopoiesis.
  • FIG. 10A shows representative FACS plots of CD45RA and CD34 expression 10 days post-electroporation or post-addition of 750 nM SR1 . The experiment was performed with two technical replicates, and repeated twice independently with similar results.
  • FIG. 10B shows guide RNAs ranked by normalized score.
  • FIG. 10C shows representative FACS plots of CD45RA and CD34 expression 10 and 20 days post-electroporation (dpe) with indicated RNPs. The experiment was performed with two technical replicates, and twice independently with similar results.
  • FIGs 11A-11C show additional validated hits from HSPC screen.
  • FIG. 11 A shows cumulative distribution of the Log2 normalized reads per million per gRNA in the CD34- (blue) and CD34+ (magenta) populations.
  • FIG. 11 B shows representative FACS plots of CD45RA and CD34 expression 10 days post-electroporation with indicated RNPs; two technical replicates in one experiment.
  • FIG. 11 C shows representative FACS plots of fluorescence in the APC channel and CD34 expression 10 days post electroporation with indicated RNPs; two technical replicates in one experiment.
  • FIGs 12 shows surface phenotype of selected HSPC hits. FACS plots of CD90, CD34, CD45RA, CD41 a and CD71 expression 10 and 20 days post-electroporation with indicated RNPs; representative of two technical replicates; two independent experiments.
  • A“gene” refers to a polynucleotide containing at least one open reading frame (ORF) that is capable of encoding a particular polypeptide or protein after being transcribed and translated.
  • ORF open reading frame
  • a polynucleotide sequence can be used to identify larger fragments or full-length coding sequences of the gene with which they are associated. Methods of isolating larger fragment sequences are known to those of skill in the art.
  • isolated refers to altered or removed from the natural state.
  • a nucleic acid or a peptide naturally present in a living animal is not“isolated,” but the same nucleic acid or peptide partially or completely separated from the coexisting materials of its natural state is“isolated.”
  • An isolated nucleic acid or protein can exist in substantially purified form, or can exist in a non-native environment such as, for example, a host cell.
  • nucleic acid or“polynucleotide” refers to deoxyribonucleic acids (DNA) or ribonucleic acids (RNA) and polymers thereof in either single- or double-stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogues of natural nucleotides that have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses
  • degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues (Batzer et al., Nucleic Acid Res. 19:5081 (1991 ); Ohtsuka et al., J. Biol. Chem. 260:2605-2608 (1985) ; and Rossolini et al., Mol. Cell. Probes 8:91 -98 (1994)).
  • peptide “polypeptide,” and“protein” are used interchangeably, and refer to a compound comprised of amino acid residues covalently linked by peptide bonds.
  • a protein or peptide must contain at least two amino acids, and no limitation is placed on the maximum number of amino acids that can comprise a protein’s or peptide’s sequence.
  • Polypeptides include any peptide or protein comprising two or more amino acids joined to each other by peptide bonds. As used herein, the term refers to both short chains, which also commonly are referred to in the art as peptides, oligopeptides and oligomers, for example, and to longer chains, which generally are referred to in the art as proteins, of which there are many types.“Polypeptides” include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives, analogs, fusion proteins, among others. A polypeptide includes a natural peptide, a recombinant peptide, or a combination thereof. A“microprotein” or “micropeptide” refers to a protein or polypeptide that is less than 100 amino acids long.
  • the term“homologous” or“identity” refers to the subunit sequence identity between two polymeric molecules, e.g., between two nucleic acid molecules, such as, two DNA molecules or two RNA molecules, or between two polypeptide molecules. When a subunit position in both of the two molecules is occupied by the same monomeric subunit; e.g., if a position in each of two DNA molecules is occupied by adenine, then they are homologous or identical at that position.
  • the homology between two sequences is a direct function of the number of matching or homologous positions; e.g., if half (e.g., five positions in a polymer ten subunits in length) of the positions in two sequences are homologous, the two sequences are 50% homologous; if 90% of the positions (e.g., 9 of 10), are matched or homologous, the two sequences are 90% homologous.
  • Percentage of “sequence identity” can be determined by comparing two optimally aligned sequences over a comparison window, where the fragment of the amino acid sequence in the comparison window may comprise additions or deletions (e.g., gaps or overhangs) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences.
  • the percentage can be calculated by determining the number of positions at which the identical amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison, and multiplying the result by 100 to yield the percentage of sequence identity.
  • the output is the percent identity of the subject sequence with respect to the query sequence.
  • promoter refers to a DNA sequence recognized by the synthetic machinery of the cell, or introduced synthetic machinery, required to initiate the specific transcription of a polynucleotide sequence.
  • promoter/regulatory sequence refers to a nucleic acid sequence which is required for expression of a gene product operably linked to the promoter/regulatory sequence.
  • this sequence may be the core promoter sequence and in other instances, this sequence may also include an enhancer sequence and other regulatory elements which are required for expression of the gene product.
  • the promoter/regulatory sequence may, for example, be one which expresses the gene product in a tissue specific manner.
  • operably linked is intended herein to mean that the nucleotide sequence of interest is linked to regulatory sequence(s) in a manner which allows for expression of the nucleotide sequence.
  • regulatory sequence is intended to include, for example, promoters, enhancers and other expression control elements (e.g., polyadenylation signals). Such regulatory sequences are well known in the art and are described, for example, in Goeddel; Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990).
  • Regulatory sequences include those which direct constitutive expression of a nucleotide sequence in many types of host cell and those which direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences). It will be appreciated by those skilled in the art that the design of the expression vector can depend on such factors as the choice of the target cell, the level of expression desired, and the like.
  • the term“constitutive” promoter refers to a nucleotide sequence which, when operably linked with a polynucleotide which encodes or specifies a gene product, causes the gene product to be produced in a cell under most or all physiological conditions of the cell.
  • inducible promoter refers to a nucleotide sequence which, when operably linked with a polynucleotide which encodes or specifies a gene product, causes the gene product to be produced in a cell substantially only when an inducer which corresponds to the promoter is present in the cell.
  • tissue-specific promoter refers to a nucleotide sequence which, when operably linked with a polynucleotide encodes or specified by a gene, causes the gene product to be produced in a cell substantially only if the cell is a cell of the tissue type corresponding to the promoter.
  • the term“gene editing system” refers to a system comprising one or more DNA-binding domains or components and one or more DNA-modifying domains or components, or isolated nucleic acids, e.g., one or more vectors, encoding said DNA-binding and DNA-modifying domains or components.
  • Gene editing systems are used for modifying the nucleic acid of a target gene and/or for modulating the expression of a target gene.
  • the one or more DNA-binding domains or components are associated with the one or more DNA-modifying domains or components, such that the one or more DNA-binding domains target the one or more DNA-modifying domains or components to a specific nucleic acid site.
  • Gene editing systems include but are not limited to, zinc finger nucleases, transcription activator-like effector nucleases (TALENs); clustered regularly interspaced short palindromic repeats (CRISPR)/Cas systems, and meganuclease systems.
  • TALENs transcription activator-like effector nucleases
  • CRISPR clustered regularly interspaced short palindromic repeats
  • meganuclease systems include but are not limited to, zinc finger nucleases, transcription activator-like effector nucleases (TALENs); clustered regularly interspaced short palindromic repeats (CRISPR)/Cas systems, and meganuclease systems.
  • CRISPR refers to a set of clustered regularly interspaced short palindromic repeats, or a system comprising such a set of repeats.
  • Cas refers to a CRISPR-associated protein.
  • the diverse CRISPR-Cas systems can be divided into two classes according to the configuration of their effector modules: class 1 CRISPR systems utilize several Cas proteins and the crRNA to form an effector complex, whereas class 2 CRISPR systems employ a large single-component Cas protein in conjunction with crRNAs to mediate interference.
  • class 2 CRISPR-Cas system employs Cpf 1 (CRISPR from Prevotella and Francisella 1 ).
  • Cpf 1 as used herein includes all orthologs, and variants that can be used in a CRISPR system.
  • Naturally-occurring CRISPR systems are found in approximately 40% of sequenced eubacteria genomes and 90% of sequenced archaea. Grissa et al. (2007) BMC Bioinformatics 8: 172. This system is a type of prokaryotic immune system that confers resistance to foreign genetic elements such as plasmids and phages and provides a form of acquired immunity. Barrangou et al. (2007) Science 315: 1709-1712; Marragini et al. (2008) Science 322: 1843-1845.
  • the CRISPR system has been modified for use in gene editing (silencing, enhancing or changing specific genes) in eukaryotes such as mice, primates and humans. Wiedenheft et al. (2012) Nature 482: 331 -8. This is accomplished by, for example, introducing into the eukaryotic cell one or more vectors encoding a specifically engineered guide RNA (gRNA) (e.g., a gRNA comprising sequence complementary to sequence of a eukaryotic genome, herein referred to as a targeting domain) and one or more appropriate RNA-guided nucleases, e.g., Cas proteins.
  • gRNA specifically engineered guide RNA
  • RNA guided nuclease forms a complex with the gRNA, which is then directed to the target DNA site by hybridization of the gRNA’s sequence to complementary sequence of a eukaryotic genome, where the RNA-guided nuclease then induces a double or single-strand break in the DNA. Insertion or deletion of nucleotides at or near the strand break creates the modified genome.
  • Cse (Cas subtype, E. coli) proteins form a functional complex, Cascade, that processes CRISPR RNA transcripts into spacer-repeat units that Cascade retains. Brouns et al. (2008) Science 321 : 960-964.
  • Cas6 processes the CRISPR transcript.
  • the CRISPR-based phage inactivation in E. coli requires Cascade and Cas3, but not Cas1 or Cas2.
  • the Cmr (Cas RAMP module) proteins in Pyrococcus furiosus and other prokaryotes form a functional complex with small CRISPR RNAs that recognizes and cleaves complementary target RNAs.
  • a simpler CRISPR system relies on the protein Cas9, which is a nuclease with two active cutting sites, one for each strand of the double helix. Combining Cas9 and modified CRISPR locus RNA can be used in a system for gene editing. Pennisi (2013) Science 341 : 833-836.
  • the RNA-guided nuclease is a Cas molecule, e.g., a Cas9 molecule.
  • A“Cas9 molecule,” as used herein, refers to a molecule that can interact with a gRNA molecule (e.g., sequence of a domain of a tracr) and, in concert with the gRNA molecule, localize (e.g., target or home) to a site which comprises a target sequence and PAM sequence.
  • Cas9 molecules of, derived from, or based on the Cas9 proteins of a variety of species can be used in the methods and compositions described herein.
  • Cas9 molecules can be used in the systems, methods and compositions described herein. Additional Cas9 species include: Acidovorax avenae, Actinobacillus pleuropneumoniae, Actinobacillus succinogenes, Actinobacillus suis, Actinomyces sp., cycliphilus denitrificans, Aminomonas paucivorans, Bacillus cereus, Bacillus smithii, Bacillus thuringiensis, Bacteroides sp.,
  • Corynebacterium matruchotii Dinoroseobacter sliibae, Eubacterium dolichum, gamma proteobacterium, Gluconacetobacler diazotrophicus, Haemophilus parainfluenzae, Haemophilus sputorum, Helicobacter canadensis, Helicobacter cinaedi, Helicobacter mustelae, llyobacler polytropus, Kingella kingae, Lactobacillus crispatus, Listeria ivanovii, Listeria monocytogenes, Listeriaceae bacterium, Methylocystis sp., Methylosinus trichosporium, Mobiluncus mulieris, Neisseria bacilliformis, Neisseria cinerea, Neisseria flavescens, Neisseria lactamica.
  • Neisseria sp. Neisseria wadsworthii, Nitrosomonas sp., Parvibaculum lavamentivorans, Pasteurella multocida, Phascolarctobacterium succinatutens, Ralstonia syzygii, Rhodopseudomonas palustris, Rhodovulum sp., Simonsiella muelleri, Sphingomonas sp., Sporolactobacillus vineae, Staphylococcus lugdunensis, Streptococcus sp., Subdoligranulum sp., Tislrella mobilis, Treponema sp., or Verminephrobacter eiseniae.
  • the ability of an active Cas9 molecule to interact with and cleave a target nucleic acid is PAM sequence dependent.
  • a PAM sequence is a sequence in the target nucleic acid.
  • cleavage of the target nucleic acid occurs upstream from the PAM sequence.
  • Active Cas9 molecules from different bacterial species can recognize different sequence motifs (e.g., PAM sequences).
  • an active Cas9 molecule of S. pyogenes recognizes the sequence motif NGG and directs cleavage of a target nucleic acid sequence 1 to 10, e.g., 3 to 5, base pairs upstream from that sequence.
  • an active Cas9 molecule of N. meningitidis recognizes the sequence motif NNNNGATT (SEQ ID NO: 62) and directs cleavage of a target nucleic acid sequence 1 to 10, e.g., 3 to 5, base pairs upstream from that sequence.
  • Cas9 molecule to recognize a PAM sequence can be determined, e.g., using a transformation assay described in Jinek et al , SCIENCE 2012, 337:816.
  • Exemplary naturally occurring Cas9 molecules are described in Chylinski et al., RNA Biology 2013; 10:5, 727-737.
  • Such Cas9 molecules include Cas9 molecules of a cluster 1 bacterial family, cluster 2 bacterial family, cluster 3 bacterial family, cluster 4 bacterial family, cluster 5 bacterial family, cluster 6 bacterial family, a cluster 7 bacterial family, a cluster 8 bacterial family, a cluster 9 bacterial family, a cluster 10 bacterial family, a cluster 1 1 bacterial family, a cluster 12 bacterial family, a cluster 13 bacterial family, a cluster 14 bacterial family, a cluster 1 bacterial family, a cluster 16 bacterial family, a cluster 17 bacterial family, a cluster 1 8 bacterial family, a cluster 19 bacterial family, a cluster 20 bacterial family, a cluster 21 bacterial family, a cluster 22 bacterial family, a cluster 23 bacterial family, a cluster 24 bacterial family, a cluster 25 bacterial family, a cluster 26 bacterial family, a cluster 27 bacterial family, a cluster 28 bacterial family, a cluster 29 bacterial family, a cluster 30 bacterial family, a cluster 31 bacterial family, a cluster
  • Exemplary naturally occurring Cas9 molecules include a Cas9 molecule of a cluster 1 bacterial family.
  • Examples include a Cas9 molecule of: S. pyogenes (e.g., strain SF370, MGAS 10270, MGAS 10750, MGAS2096, MGAS315, MGAS5005, MGAS6180, MGAS9429, NZ131 and SSI- 1 ), S. thermophilus (e.g., strain LMD-9), S. pseudoporcinus (e.g., strain SPIN 20026), S. mutans (e.g., strain UA 159, NN2025), S. macacae (e.g., strain NCTC1 1558), S.
  • S. pyogenes e.g., strain SF370, MGAS 10270, MGAS 10750, MGAS2096, MGAS315, MGAS5005, MGAS6180, MGAS9429, NZ131 and SS
  • gallolylicus e.g., strain UCN34, ATCC BAA-2069
  • S. equines e.g., strain ATCC 9812, MGCS 124
  • S. dysdalactiae e.g., strain GGS 124
  • S. bovis e.g., strain ATCC 700338
  • S. cmginosus e.g.; strain F021 1
  • S. agalactia * e.g., strain NEM316, A909
  • Listeria monocytogenes e.g., strain F6854
  • Listeria innocua L.
  • Additional exemplary Cas9 molecules are a Cas9 molecule of Neisseria meningitidis (Hou et al., PNAS Early Edition 2013, 1 -6) and a S. aureus Cas9 molecule.
  • a Cas9 molecule e.g., an active Cas9 molecule or inactive Cas9 molecule, comprises an amino acid sequence: having 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology with; differs at no more than 1 %, 2%, 5%, 10%, 15%, 20%, 30%, or 40% of the amino acid residues when compared with; differs by at least 1 ,
  • any Cas9 molecule sequence described herein or a naturally occurring Cas9 molecule sequence e.g., a Cas9 molecule from a species listed herein or described in Chylinski et al., RNA Biology 2013, 10:5, ⁇ 2 ⁇ -T, 1 Hou et al. PNAS Early Edition 2013, 1 -6.
  • a Cas9 molecule comprises an amino acid sequence having 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology with; differs at no more than 1 %, 2%, 5%, 10%, 15%, 20%, 30%, or 40% of the amino acid residues when compared with; differs by at least 1 , 2, 5, 10 or 20 amino acids but by no more than 100, 80, 70, 60, 50, 40 or 30 amino acids from; or is identical to; S. pyogenes Cas9 (UniProt Q99ZW2).
  • the Cas9 molecule is a S. pyogenes Cas9 variant, such as a variant described in Slaymaker et al., Science Express, available online December 1 , 2015 at Science DOI:
  • the Cas9 molecule is catalytically inactive, e.g., dCas9. Tsai et al. (2014), Nat. Biotech. 32:569-577; U.S. Patent No.: 8,871 ,445; 8,865,406; 8,795,965; 8,771 ,945; and 8,697,359, the contents of which are hereby incorporated by reference in their entireties.
  • a catalytically inactive Cas9, e.g., dCas9, molecule may be fused with a transcription modulator, e.g., a transcription repressor or transcription activator.
  • the Cas9 molecule of the invention can be any of the Cas9 variants, including chimeric Cas9 molecules, described in, e.g., US8,889,356, US8,889,418, US8,932,814, WO2016022363, US201501 18216, WO2014152432, US20140295556,
  • the Cas9 molecule e.g., a Cas9 of S. pyogenes, may additionally comprise one or more amino acid sequences that confer additional activity and/or enhanced specificity.
  • the Cas9 molecule may comprise one or more nuclear localization sequences (NLSs), such as at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, or more NLSs.
  • an NLS consists of one or more short sequences of positively charged lysines or arginines exposed on the protein surface, but other types of NLS are known.
  • NLSs include an NLS sequence comprising or derived from: the NLS of the SV40 virus large T-antigen, having the amino acid sequence PKKKRKV (SEQ ID NO: 63) or a bipartite SV40 NLS having the amino acid sequence KRTADGSEFESPKKKRKVE (SEQ ID NO: 64).
  • Other suitable NLS sequences are known in the art (e.g., Sorokin, Biochemistry (Moscow) (2007) 72:13, 1439-1457; Lange J Biol Chem. (2007) 282:8, 5101 -5). In any of the
  • the Cas9 molecule may additionally (or alternatively) comprise a tag, e.g., a His tag, e.g., a His(6) tag (SEQ ID NO: 80) or His(8) tag (SEQ ID NO: 81 ), e.g., at the N terminus or the C terminus.
  • a His tag e.g., a His(6) tag (SEQ ID NO: 80) or His(8) tag (SEQ ID NO: 81 , e.g., at the N terminus or the C terminus.
  • engineered CRISPR gene editing systems typically involve (1 ) a guide RNA molecule (gRNA) comprising a targeting domain (which is capable of hybridizing to the genomic DNA target sequence), and sequence which is capable of binding to a Cas, e.g., Cas9 enzyme, and (2) a Cas, e.g., Cas9, protein.
  • gRNA guide RNA molecule
  • Cas e.g., Cas9 enzyme
  • This second domain may comprise a domain referred to as a tracr domain.
  • the targeting domain and the sequence which is capable of binding to a Cas may be disposed on the same (sometimes referred to as a single gRNA, chimeric gRNA or sgRNA) or different molecules (sometimes referred to as a dual gRNA or dgRNA). If disposed on different molecules, each includes a hybridization domain which allows the molecules to associate, e.g., through hybridization.
  • the terms“guide RNA,”“guide RNA molecule,”“gRNA molecule” or“gRNA” are used interchangeably, and refer to a set of nucleic acid molecules that promote the specific directing of a RNA-guided nuclease or other effector molecule (typically in complex with the gRNA molecule) to a target sequence.
  • said directing is accomplished through hybridization of a portion of the gRNA to DNA (e.g., through the gRNA targeting domain), and by binding of a portion of the gRNA molecule to the RNA-guided nuclease or other effector molecule (e.g., through at least the gRNA tracr).
  • a gRNA molecule consists of a single contiguous polynucleotide molecule, referred to herein as a“single guide RNA” or“sgRNA” and the like.
  • a gRNA molecule consists of a plurality, usually two, polynucleotide molecules, which are themselves capable of association, usually through hybridization, referred to herein as a“dual guide RNA” or“dgRNA,” and the like.
  • gRNA molecules are described in more detail below, but generally include a targeting domain and a tracr. In embodiments the targeting domain and tracr are disposed on a single polynucleotide.
  • the targeting domain and tracr are disposed on separate
  • targeting domain is the portion of the gRNA molecule that recognizes, e.g., is complementary to, a target sequence, e.g., a target sequence within the nucleic acid of a cell, e.g., within a gene.
  • crRNA as the term is used in connection with a gRNA molecule, is a portion of the gRNA molecule that comprises a targeting domain and a region that interacts with a tracr to form a flagpole region.
  • target sequence refers to a sequence of nucleic acids complimentary, for example fully complimentary, to a gRNA targeting domain.
  • the target sequence is disposed on genomic DNA.
  • the target sequence is adjacent to (either on the same strand or on the complementary strand of DNA) a protospacer adjacent motif (PAM) sequence recognized by a protein having nuclease or other effector activity, e.g., a PAM sequence recognized by Cas9.
  • the target sequence is a target sequence of an allogeneic T cell target.
  • the target sequence is a target sequence of an inhibitory molecule.
  • the target sequence is a target sequence of a
  • the term“flagpole” as used herein in connection with a gRNA molecule refers to the portion of the gRNA where the crRNA and the tracr bind to, or hybridize to, one another.
  • tracr refers to the portion of the gRNA that binds to a nuclease or other effector molecule.
  • the tracr comprises nucleic acid sequence that binds specifically to Cas9.
  • the tracr comprises nucleic acid sequence that forms part of the flagpole.
  • nucleic acid refers to the pairing of bases, A with T or U, and G with C.
  • complementary refers to nucleic acid molecules that are completely complementary, that is, form A to T or U pairs and G to C pairs across the entire reference sequence, as well as molecules that are at least 80%, 85%, 90%, 95%, 99% complementary.
  • Temporal Nucleic Acid refers to nucleic acid to be inserted at the site of modification by the CRISPR system donor sequence for gene repair (insertion) at site of cutting.
  • the template nucleic acid comprises nucleic acid sequence encoding a chimeric antigen receptor (CAR), e.g., as described herein.
  • the template nucleic acid comprises a vector comprising nucleic acid sequence encoding a chimeric antigen receptor (CAR), e.g., as described herein.
  • An“indel,” as the term is used herein, refers to a nucleic acid comprising one or more insertions of nucleotides, one or more deletions of nucleotides, or a combination of insertions and deletions of nucleotides, relative to a reference nucleic acid, that results after being exposed to a composition comprising a gRNA molecule, for example a CRISPR system. Indels can be determined by sequencing nucleic acid after being exposed to a composition comprising a gRNA molecule, for example, by NGS.
  • an indel is said to be“at or near” a reference site (e.g., a site complementary to a targeting domain of a gRNA molecule) if it comprises at least one insertion or deletion within about 10, 9 , 8, 7, 6, 5, 4, 3, 2, or 1 nucleotide(s) of the reference site, or is overlapping with part or all of said reference site (e.g., comprises at least one insertion or deletion overlapping with, or within 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotides of a site complementary to the targeting domain of a gRNA molecule, e.g., a gRNA molecule described herein).
  • a reference site e.g., a site complementary to a targeting domain of a gRNA molecule
  • An“indel pattern,” as the term is used herein, refers to a set of indels that results after exposure to a composition comprising a gRNA molecule.
  • the indel pattern consists of the top three indels, by frequency of appearance.
  • the indel pattern consists of the top five indels, by frequency of appearance.
  • the indel pattern consists of the indels which are present at greater than about 5% frequency relative to all sequencing reads.
  • the indel pattern consists of the indels which are present at greater than about 10% frequency relative to the total number of indel sequencing reads (i.e., those reads that do not consist of the unmodified reference nucleic acid sequence).
  • the indel pattern includes any 3 of the top five most frequently observed indels. The indel pattern may be determined, for example, by sequencing cells of a population of cells which were exposed to the gRNA molecule.
  • an“off-target indel,” as the term is used herein, refers to an indel at or near a site other than the target sequence of the targeting domain of the gRNA molecule. Such sites may comprise, for example, 1 , 2, 3, 4, 5 or more mismatch nucleotides relative to the sequence of the targeting domain of the gRNA. In exemplary embodiments, such sites are detected using targeted sequencing of in silico predicted off-target sites, or by an insertional method known in the art.
  • a“precomplexed RNA” refers to one or more RNA molecules that are bound to a Cas9 molecule.
  • the precomplexed RNA is a gRNA molecule, e.g., as described herein. In embodiments, the precomplexed RNA is a dgRNA. In embodiments, the precomplexed RNA is an sgRNA. In embodiments, the precomplexed RNA is a portion of a gRNA molecule that binds to Cas9, e.g., is a tracr. In embodiments, the precomplexed RNA is a gRNA molecule comprising a targeting domain. In embodiments, the targeting domain does not have a target sequence (e.g., a fully complementary target sequence) in the genome of the cell to which it is introduced. In other embodiments, the targeting domain does have a target sequence (e.g., a fully complementary target sequence) in the genome of the cell to which it is introduced.
  • a target sequence e.g., a fully complementary target sequence
  • an“encoded gRNA molecule” refers to a gRNA molecule that is introduced into a cell.
  • the encoded gRNA molecule is present in a vector, e.g., as described herein, e.g., a retroviral vector or a lentiviral vector.
  • the encoded gRNA molecule is a member of a library of encoded gRNA molecules, e.g., is present in a composition comprising a plurality of nucleic acid sequences encoding a plurality of gRNA molecules, e.g., is present in a composition comprising a plurality of vectors, e.g., lentiviral vectors, each of said vectors encoding one or more, e.g., one, encoded gRNA molecules.
  • a primary cell e.g., as described herein
  • the encoded gRNA molecule(s) is produced (e.g., transcribed).
  • CRISPR gene editing systems known in the art, e.g., are described in U.S. Publication No.2014/0068797, WO2015/048577, and Cong (2013) Science 339: 819-823, the contents of which are hereby incorporated by reference in their entireties.
  • Such systems can be generated which inhibit a target gene, by, for example, engineering a CRISPR gene editing system to include a gRNA molecule comprising a targeting domain that hybridizes to a sequence of the target gene.
  • the gRNA comprises a targeting domain which is fully complementary to 15-25 nucleotides, e.g., 20 nucleotides, of a target gene.
  • the 15-25 nucleotides, e.g., 20 nucleotides, of the target gene are disposed immediately 5’ to a protospacer adjacent motif (PAM) sequence recognized by the RNA-guided nuclease, e.g., Cas protein, of the CRISPR gene editing system (e.g., where the system comprises a S. pyogenes Cas9 protein, the PAM sequence comprises NGG, where N can be any of A, T, G or C).
  • PAM protospacer adjacent motif
  • the gRNA molecule and RNA-guided nuclease, e.g., Cas protein, of the CRISPR gene editing system can be complexed to form a RNP complex.
  • RNP complexes may be used in the methods and apparatus described herein.
  • nucleic acid encoding one or more components of the CRISPR gene editing system may be used in the methods and apparatus described herein.
  • foreign DNA can be introduced into the cell along with the CRISPR gene editing system, e.g., DNA encoding a desired transgene, with or without a promoter active in the target cell type.
  • the CRISPR gene editing system e.g., DNA encoding a desired transgene, with or without a promoter active in the target cell type.
  • this process can be used to integrate the foreign DNA into the genome, at or near the site targeted by the CRISPR gene editing system.
  • 3’ and 5’ sequences flanking the transgene may be included in the foreign DNA which are homologous to the gene sequence 3’ and 5’ (respectively) of the site in the genome cut by the gene editing system.
  • Such foreign DNA molecule can be referred to“template DNA.”
  • the CRISPR gene editing system of the present invention comprises Cas9, e.g., S. pyogenes Cas9, and a gRNA comprising a targeting domain which hybridizes to a sequence of a gene of interest.
  • the gRNA and Cas9 are complexed to form a RNP.
  • the CRISPR gene editing system comprises nucleic acid encoding a gRNA and nucleic acid encoding a Cas protein, e.g., Cas9, e.g., S. pyogenes Cas9.
  • the CRISPR gene editing system comprises a gRNA and nucleic acid encoding a Cas protein, e.g., Cas9, e.g., S. pyogenes Cas9.
  • inducible control over Cas9, sgRNA and p53DD expression can be utilized to optimize efficiency while reducing the frequency of off-target effects thereby increasing safety.
  • examples include, but are not limited to, transcriptional and post-transcriptional switches listed as follows; doxycycline inducible transcription Loew et al. (2010) BMC Biotechnol. 10:81 , Shieldl inducible protein stabilization Banaszynski et al. (2016) Cell 126: 995-1004, Tamoxifen induced protein activation Davis et al. (2015) Nat. Chem. Biol.
  • 61 /915,267 and 61 /915,260 each filed December 12, 2013; 61 /757,972 and 61 /768,959, filed on January 29, 2013 and February 25, 2013; 61 /835,936, 61 /836,127, 61/836,101 , 61/836,080, 61 /835,973, and 61 /835,931 , filed June 17, 2013; 62/010,888 and 62/010,879, both filed June 1 1 , 2014; 62/010,329 and 62/010,441 , each filed June 10, 2014; 61/939,228 and 61/939,242, each filed February 12, 2014; 61/980,012, filed April 15,2014; 62/038,358, filed August 17,
  • RNA-guided nuclease technology This ability to use RNA to program sequence specific DNA cleavage in cells defined a new class of genome engineering tools.
  • CRISPR loci are likely to be transplantable into mammalian cells and can also mediate mammalian genome cleavage.
  • CRISPR/Cas system can be further improved to increase its efficiency and versatility.
  • Jiang et al. used the clustered, regularly interspaced, short palindromic repeats (CRISPR)-associated Cas9 endonuclease complexed with dual-RNAs to introduce precise mutations in the genomes of Streptococcus pneumoniae and Escherichia coli.
  • CRISPR clustered, regularly interspaced, short palindromic repeats
  • the approach relied on dual-RNA:Cas9-directed cleavage at the targeted genomic site to kill unmutated cells and circumvents the need for selectable markers or counter-selection systems
  • the study reported reprogramming dual-RNA:Cas9 specificity by changing the sequence of short CRISPR RNA (crRNA) to make single- and multinucleotide changes carried on editing templates.
  • crRNA short CRISPR RNA
  • Konermann et al. addressed the need in the art for versatile and robust technologies that enable optical and chemical modulation of DNA-binding domains based CRISPR Cas9 enzyme and also Transcriptional Activator Like Effectors.
  • Hsu et al. (2013) characterized SpCas9 targeting specificity in human cells to inform the selection of target sites and avoid off-target effects.
  • the authors further showed that SpCas9-mediated cleavage is unaffected by DNA methylation and that the dosage of SpCas9 and sgRNA can be titrated to minimize off-target modification.
  • Ran et al. (2013-B) described a set of tools for Cas9-mediated genome editing via non-homologous end joining (NHEJ) or homology-directed repair (HDR) in mammalian cells, as well as generation of modified cell lines for downstream functional studies.
  • NHEJ non-homologous end joining
  • HDR homology-directed repair
  • the authors further described a double-nicking strategy using the Cas9 nickase mutant with paired guide RNAs.
  • the protocol provided by the authors experimentally derived guidelines for the selection of target sites, evaluation of cleavage efficiency and analysis of off- target activity.
  • the studies showed that beginning with target design, gene modifications can be achieved within as little as 1 -2 weeks, and modified clonal cell lines can be derived within 2-3 weeks.
  • Nishimasu et al. reported the crystal structure of Streptococcus pyogenes Cas9 in complex with sgRNA and its target DNA at 2.5 A 0 resolution. The structure revealed a bi bbed architecture composed of target recognition and nuclease lobes, accommodating the sgRNA:DNA heteroduplex in a positively charged groove at their interface. Whereas the recognition lobe is essential for binding sgRNA and DNA, the nuclease lobe contains the HNH and RuvC nuclease domains, which are properly positioned for cleavage of the complementary and non-complementary strands of the target DNA, respectively.
  • the nuclease lobe also contains a carboxyl-terminal domain responsible for the interaction with the protospacer adjacent motif (PAM).
  • PAM protospacer adjacent motif
  • Wu et al. mapped genome-wide binding sites of a catalytically inactive Cas9 (dCas9) from Streptococcus pyogenes loaded with single guide RNAs (sgRNAs) in mouse embryonic stem cells (mESCs).
  • sgRNAs single guide RNAs
  • mESCs mouse embryonic stem cells
  • Piatt et al. established a Cre-dependent Cas9 knockin mouse. The authors demonstrated in vivo as well as ex vivo genome editing using adeno-associated virus (AAV)-, lentivirus-, or particle-mediated delivery of guide RNA in neurons, immune cells, and endothelial cells.
  • AAV adeno-associated virus
  • Hsu et al. (2014) is a review article that discusses generally CRISPR-Cas9 history from yogurt to genome editing, including genetic screening of cells.
  • Doench et al. created a pool of sgRNAs, tiling across all possible target sites of a panel of six endogenous mouse and three endogenous human genes and quantitatively assessed their ability to produce null alleles of their target gene by antibody staining and flow cytometry. The authors showed that optimization of the PAM improved activity and also provided an on-line tool for designing sgRNAs.
  • Konermann et al. (2015) discusses the ability to attach multiple effector domains, e.g., transcriptional activator, functional and epigenomic regulators at appropriate positions on the guide such as stem or tetraloop with and without linkers.
  • effector domains e.g., transcriptional activator, functional and epigenomic regulators
  • Chen et al relates to multiplex screening by demonstrating that a genome- wide in vivo CRISPR-Cas9 screen in mice reveals genes regulating lung metastasis.
  • Xu et al. (2015) assessed the DNA sequence features that contribute to single guide RNA (sgRNA) efficiency in CRISPR-based screens. The authors explored efficiency of CRISPR/Cas9 knockout and nucleotide preference at the cleavage site. The authors also found that the sequence preference for CRISPRi/a is substantially different from that for CRISPR Cas9 knockout.
  • Parnas et al. (2015) introduced genome- wide pooled CRISPR-Cas9 libraries into dendritic cells (DCs) to identify genes that control the induction of tumor necrosis factor (Tnf) by bacterial lipopolysaccharide (LPS).
  • DCs dendritic cells
  • Tnf tumor necrosis factor
  • LPS bacterial lipopolysaccharide
  • cccDNA viral episomal DNA
  • the HBV genome exists in the nuclei of infected hepatocytes as a 3.2kb double- stranded episomal DNA species called covalently closed circular DNA (cccDNA), which is a key component in the HBV life cycle whose replication is not inhibited by current therapies.
  • cccDNA covalently closed circular DNA
  • the authors showed that sgRNAs specifically targeting highly conserved regions of HBV robustly suppresses viral replication and depleted cccDNA.
  • Nishimasu et al. (2015) reported the crystal structures of SaCas9 in complex with a single guide RNA (sgRNA) and its double-stranded DNA targets, containing the 5'-TTGAAT-3' (SEQ ID NO: 65) PAM and the 5'-TTGGGT-3' (SEQ ID NO: 66) PAM.
  • sgRNA single guide RNA
  • SEQ ID NO: 65 the 5'-TTGAAT-3'
  • SEQ ID NO: 66 5'-TTGGGT-3'
  • SpCas9 Streptococcus pyogenes Cas9
  • the authors developed "enhanced specificity" SpCas9 (eSpCas9) variants which maintained robust on-target cleavage with reduced off-target effects.
  • Tsai et al "Dimeric CRISPR A-guided Fokl nucleases for highly specific genome editing," Nature Biotechnology 32(6): 569-77 (2014) which is not believed to be prior art to the instant invention or application, but which may be considered in the practice of the instant invention. Mention is also made of Konermann et al., “Genome-scale transcription activation by an engineered CRISPR-Cas9 complex,” doi:10.1038/naturel4136, incorporated herein by reference.
  • CRISPR-Cas or CRISPR system is as used in the foregoing documents, such as WO 2014/093622 (PCT/US2013/074667) and refers collectively to transcripts and other elements involved in the expression of or directing the activity of CRISPR- associated (“Cas") genes, including sequences encoding a Cas gene, a tracr (trans-activating CRISPR) sequence (e.g.
  • RNA(s) as that term is herein used (e.g., RNA(s) to guide Cas9, e.g. CRISPR RNA and transactivating (tracr) RNA or a single guide RNA (sgRNA) (chimeric RNA)) or other sequences and transcripts from a CRISPR locus.
  • RNA(s) to guide Cas9, e.g. CRISPR RNA and transactivating (tracr) RNA or a single guide RNA (sgRNA) (chimeric RNA)
  • a CRISPR system is characterized by elements that promote the formation of a CRISPR complex at the site of a target sequence (also referred to as a protospacer in the context of an endogenous CRISPR system).
  • target sequence refers to a sequence to which a guide sequence is designed to have
  • a target sequence may comprise any polynucleotide, such as DNA or RNA polynucleotides.
  • a target sequence is located in the nucleus or cytoplasm of a cell.
  • direct repeats may be identified in silico by searching for repetitive motifs that fulfill any or all of the following criteria: 1 . found in a 2Kb window of genomic sequence flanking the type II CRISPR locus; 2. span from 20 to 50 bp; and 3. interspaced by 20 to 50 bp. In some embodiments, 2 of these criteria may be used, for instance 1 and 2, 2 and 3, or 1 and 3.
  • the tracr sequence has one or more hairpins and is 30 or more nucleotides in length, 40 or more nucleotides in length, or 50 or more nucleotides in length; the guide sequence is between 10 to 30 nucleotides in length, the CRISPR/Cas enzyme is a Type II Cas9 enzyme.
  • the terms guide sequence and guide RNA are used interchangeably as in foregoing cited documents such as WO 2014/093622 (PCT US2013/074667).
  • a guide sequence is any polynucleotide sequence having sufficient complementarity with a target polynucleotide sequence to hybridize with the target sequence and direct sequence-specific binding of a CRISPR complex to the target sequence.
  • the degree of complementarity between a guide sequence and its corresponding target sequence when optimally aligned using a suitable alignment algorithm, is about or more than about 50%, 60%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, or more.
  • Optimal alignment may be determined with the use of any suitable algorithm for aligning sequences, non-limiting example of which include the Smith- Waterman algorithm, the Needleman-Wunsch algorithm, algorithms based on the Burrows- Wheeler Transform (e.g.
  • a guide sequence is about or more than about 5, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 75, or more nucleotides in length. In some embodiments, a guide sequence is less than about 75, 50, 45, 40, 35, 30, 25, 20, 15, 12, or fewer nucleotides in length.
  • the guide sequence is 10 - 30 nucleotides long.
  • the ability of a guide sequence to direct sequence- specific binding of a CRISPR complex to a target sequence may be assessed by any suitable assay.
  • the components of a CRISPR system sufficient to form a CRISPR complex, including the guide sequence to be tested may be provided to a host cell having the corresponding target sequence, such as by transfection with vectors encoding the components of the CRISPR sequence, followed by an assessment of preferential cleavage within the target sequence, such as by Surveyor assay as described herein.
  • cleavage of a target polynucleotide sequence may be evaluated in a test tube by providing the target sequence, components of a CRISPR complex, including the guide sequence to be tested and a control guide sequence different from the test guide sequence, and comparing binding or rate of cleavage at the target sequence between the test and control guide sequence reactions.
  • a guide sequence may be selected to target any target sequence.
  • the target sequence is a sequence within a genome of a cell.
  • Exemplary target sequences include those that are unique in the target genome. For example, for the S.
  • a unique target sequence in a genome may include a Cas9 target site of the form MMMMMMMMNNNNNNNNNNNNNNXGG where NNNNNNNNNNXGG (N is A, G, T, or C; and X can be anything) has a single occurrence in the genome.
  • a unique target sequence in a genome may include an S. pyogenes Cas9 target site of the form
  • a unique target sequence in a genome may include a Cas9 target site of the form
  • a unique target sequence in a genome may include an S. thermophilus CRISPR Cas9 target site of the form
  • N is A, G, T, or C; X can be anything; and W is A or T
  • SEQ ID NO: 70 has a single occurrence in the genome.
  • a unique target sequence in a genome may include a Cas9 target site of the form
  • a unique target sequence in a genome may include an S. pyogenes Cas9 target site of the form
  • a guide sequence is selected to reduce the degree secondary structure within the guide sequence. In some embodiments, about or less than about 75%, 50%, 40%, 30%, 25%, 20%, 15%, 10%, 5%, 1 %, or fewer of the nucleotides of the guide sequence participate in self complementary base pairing when optimally folded. Optimal folding may be determined by any suitable polynucleotide folding algorithm.
  • Some programs are based on calculating the minimal Gibbs free energy.
  • An example of one such algorithm is mFold, as described by Zuker and Stiegler (Nucleic Acids Res. 9 (1981 ), 133-148).
  • Another example folding algorithm is the online Webserver RNAfold, developed at Institute for Theoretical Chemistry at the University of Vienna, using the centroid structure prediction algorithm (see e.g. A.R. Gruber et al., 2008, Cell 106(1 ): 23-24; and PA Carr and GM Church, 2009, Nature Biotechnology 27(12): 1 151 -62).
  • a“primary cell” refers to a cell which is isolated directly from a living organism’s tissue.
  • the primary cell is a mammalian cell.
  • the primary cell is a human cell. In embodiments, the primary cell is a mouse cell. In embodiments, the primary cell does not comprise nucleic acid sequence encoding a Cas9 molecule. Without being bound by theory, in embodiments, a primary cell is a cell which has limited lifespan and/or duplication potential, and/or does not tolerate stable integration and/or expression of a Cas9 molecule.
  • a“library” refers to a composition comprising a plurality of members of the library.
  • the member of the library is nucleic acid sequence encoding an encoded gRNA molecule.
  • the library is a vector library.
  • the library is random.
  • the library is rationally designed.
  • the library comprises a combination of random and rationally designed members.
  • the members of the library include a means for identifying a particular member of the library (e.g., a tag or code).
  • the present disclosure relates to methods for introducing a genetic modification in a cell using the CRISPR/Cas9 gene editing system, without the need for generating a stable cell line expressing a Cas9 protein.
  • Generating a stable cell line expressing Cas9 is not necessarily possible or desired for all cells, such as human or mouse primary cells, and cells can accumulate mutations and lose homogeneity during expansion from a single cell.
  • the present disclosure relates to introduction of a ribonuclear protein complex (RNP) comprising a Cas9 molecule and a precomplexed RNA or an apo-Cas9 molecule with ssDNA into a cell, coupled with delivery of one or more nucleic acid sequences encoding one or more encoded gRNA molecules comprising a targeting domain, which introduces a genetic modification at or near an encoded target sequence in the cell.
  • RNP ribonuclear protein complex
  • some embodiments of the present disclosure provide methods of inducing one or more genetic modifications in a cell using an RNP comprising a Cas9 molecule and a precomplexed RNA or an apo-Cas9 molecule with ssDNA, and one or more nucleic acid sequences encoding one or more encoded gRNA molecules, each of said one or more encoded gRNA molecules comprising a targeting domain.
  • the methods disclosed herein comprise: a) introducing into said cell an RNP comprising a Cas9 molecule and a precomplexed RNA or an apo-Cas9 molecule with ssDNA; and b) introducing into said cell one or more nucleic acid sequences encoding one or more encoded gRNA molecules, each of said one or more encoded gRNA molecules comprising a targeting domain.
  • introducing into said cell an RNP or an apo-Cas9 molecule with ssDNA precedes introducing into said cell one or more nucleic acid sequences.
  • introducing into said cell one or more nucleic acid sequences precedes introducing into said cell an RNP or an apo-Cas9 molecule with ssDNA. In some embodiments, introducing into said cell an RNP or an apo-Cas9 molecule with ssDNA and introducing into said cell one or more nucleic acid sequences are performed simultaneously, e.g., by a single electroporation step.
  • a“precomplexed RNA” refers to one or more RNA molecules that are bound to a Cas9 molecule.
  • the precomplexed RNA is a gRNA molecule, e.g., as described herein, or any nucleic acid that has the same secondary structure as a gRNA.
  • the precomplexed RNA is a dgRNA.
  • the precomplexed RNA is an sgRNA.
  • the precomplexed RNA is a portion of a gRNA molecule that binds to Cas9, e.g., is a tracr.
  • the precomplexed RNA is a gRNA molecule comprising a targeting domain.
  • the targeting domain does not have a target sequence (e.g., a fully complementary target sequence) in the genome of the cell to which it is introduced.
  • the targeting domain does have a target sequence (e.g., a fully complementary target sequence) in the genome of the cell to which it is introduced.
  • the target sequence is located in a target gene, e.g., the coding sequence of the target gene, the promoter of the target gene, the non-coding region of the target gene, etc.
  • Non-limiting examples of target genes include: an oncogene, a tumor suppressor gene, a gene encoding a tumor antigen, a gene encoding a transmembrane receptor, a gene encoding a checkpoint protein, a gene encoding an immunostimulatory protein, a gene encoding a cytokine, a gene encoding a growth factor, a disease gene, etc.
  • the target gene is selected from the group consisting of beta-2-macroglobulin (B2M), CD33, CD45, and PD-1 .
  • the target sequence is located in a non-coding region of the genome, for example, non-coding RNAs, regulatory regions, repetitive DNA, etc.
  • the precomplexed RNA molecule and Cas9 molecule can be formulated (in one or more compositions), directly delivered or administered to a cell in which a genetic modification event is desired.
  • the precomplexed RNA molecule and Cas9 molecule can be formulated (in one or more compositions), directly delivered or administered to a cell in which a genetic modification event is desired.
  • the precomplexed RNA molecule and Cas9 molecule can be formulated (in one or more compositions), directly delivered or administered to a cell in which a genetic modification event is desired.
  • the precomplexed RNA molecule and Cas9 molecule can be formulated (in one or more compositions), directly delivered or administered to a cell in which a genetic modification event is desired.
  • precomplexed RNA is mixed with the Cas9 molecule to form an RNP prior to introduction of the RNP into the cell, e.g., by electroporation.
  • This may contain RNA bound to Cas9 as well as unbound RNA.
  • the methods disclosed herein comprise introducing ssDNA with an apo-Cas9 molecule into the cell.
  • the ssDNA is introduced into the cell in a single step with the introduction of the apo-Cas9.
  • the ssDNA is mixed with the apo-Cas9 prior to instruction into the cell, e.g., by electroporation.
  • the RNP or an apo-Cas9 molecule with ssDNA can be delivered into cells, e.g., described herein, by any art-known method, e.g., electroporation.
  • delivery of the RNP or an apo-Cas9 molecule with ssDNA may result in a high % (e.g., >50%, >60%, >70%, >80%, >85%, >90%, >95%, >98%, or >99%) of the target cells containing the RNP or Cas9.
  • a precomplexed RNA molecule and Cas9 molecule which result in high % editing at the target sequence (e.g., >50%, >60%, >70%, >80%, >85%, >90%, >95%, >98%, or >99%) in the target cell, e.g., described herein, even when the concentration of RNP delivered to the cell is reduced.
  • delivering a reduced or low concentration of RNP comprising a precomplexed RNA molecule that produces a high % editing at the target sequence in the target cell (including at the low RNP
  • RNP concentration
  • the following procedure can be used to generate the RNP:
  • the above procedure may be modified for use with sgRNA molecules by omitting step 2, above, and in step 1 , providing the Cas9 molecule and the sgRNA molecule in solution at high concentration, and allowing the components to equilibrate.
  • the above procedure may be modified by annealing crRNA and tracr first, and then adding the Cas9 molecule.
  • the Cas9 molecule and each gRNA component are provided in solution at a 1 :1 ratio (Cas9:gRNA), e.g., a 1 :1 molar ratio of Cas9:gRNA molecule.
  • Cas9 molecule and each gRNA component are provided in solution at a 1 :2 ratio (Cas9:gRNA), e.g., a 1 :2 molar ratio of Cas9:gRNA molecule.
  • Cas9 molecule and each gRNA component are provided in solution at a 1 :3 ratio (Cas9:gRNA), e.g., a 1 :3 molar ratio of Cas9:gRNA molecule.
  • Cas9 molecule and each gRNA component are provided in solution at a 1 :4 ratio (Cas9:gRNA), e.g., a 1 :4 molar ratio of Cas9:gRNA molecule.
  • Cas9 molecule and each gRNA component are provided in solution at a 1 :5 ratio (Cas9:gRNA), e.g., a 1 :5 molar ratio of Cas9:gRNA molecule.
  • Cas9 molecule and each gRNA component are provided in solution at a 1 :6 ratio (Cas9:gRNA), e.g., a 1 :6 molar ratio of Cas9:gRNA molecule.
  • the ratio e.g., molar ratio, is 1 :1 :1 (Cas9:tracr:crRNA).
  • the ratio, e.g., molar ratio is 1 :2:2 (Cas9:tracr:crRNA).
  • the ratio, e.g., molar ratio is 1 :3:3 (Cas9:tracr:crRNA).
  • the ratio, e.g., molar ratio is 1 :4:4 (Cas9:tracr:crRNA).
  • the ratio, e.g., molar ratio is 1 :5:5 (Cas9:tracr:crRNA).
  • the ratio, e.g., molar ratio is 1 :6:6 (Cas9:tracr:crRNA).
  • the ratio, e.g., molar ratio is 1 :1 :2 (Cas9:tracr:crRNA).
  • the ratio, e.g., molar ratio is 1 :2:4 (Cas9:tracr:crRNA).
  • the ratio, e.g., molar ratio is 1 :3:6 (Cas9:tracr:crRNA).
  • the ratio, e.g., molar ratio is 1 :4:8 (Cas9:tracr:crRNA). Where dgRNA molecules are used, the ratio, e.g., molar ratio, is 1 :5:10 (Cas9:tracr:crRNA). Where dgRNA molecules are used, the ratio, e.g., molar ratio, is 1 :6:12 (Cas9:tracr:crRNA). In embodiments, the RNP is formed at a
  • the RNP is formed at a concentration of 10 uM or higher, e.g., a concentration from about 10 uM to about 30 uM.
  • the RNP is diluted to a final concentration of 10uM or less (e.g., a concentration from about 0.01 uM to about 10uM) in a solution comprising the target cell (e.g., described herein) for delivery to said target cell.
  • the target cell e.g., described herein
  • the RNP is diluted to a final concentration of 3uM or less (e.g., a concentration from about 0.01 uM to about 3uM) in a solution comprising the target cell (e.g., described herein) for delivery to said target cell.
  • the RNP is diluted to a final concentration of 1 uM or less (e.g., a concentration from about 0.01 uM to about 1 uM) in a solution comprising the target cell (e.g., described herein) for delivery to said target cell.
  • the RNP is diluted to a final concentration of 0.3uM or less (e.g., a concentration from about 0.01 uM to about 0.3uM) in a solution comprising the target cell (e.g., described herein) for delivery to said target cell.
  • the RNP is provided at a final concentration of about 3uM in a solution comprising the target cell (e.g., described herein) for delivery to said target cell.
  • the RNP is provided at a final concentration of about 1 uM in a solution comprising the target cell (e.g., described herein) for delivery to said target cell.
  • the RNP is provided at a final concentration of about 0.3uM in a solution comprising the target cell (e.g., described herein) for delivery to said target cell. In embodiments, the RNP is provided at a final concentration of about 0.1 uM in a solution comprising the target cell (e.g., described herein) for delivery to said target cell. In
  • the RNP is provided at a final concentration of about 0.05uM in a solution comprising the target cell (e.g., described herein) for delivery to said target cell.
  • the target cell e.g., described herein
  • the RNP is provided at a final concentration of about 0.03uM in a solution comprising the target cell (e.g., described herein) for delivery to said target cell.
  • the target cell e.g., described herein
  • the RNP is provided at a final concentration of about 0.01 uM in a solution comprising the target cell (e.g., described herein) for delivery to said target cell.
  • Introduction of the complexes, polypeptides, and nucleic acids of the disclosure into cells can occur by viral or bacteriophage infection, transfection, conjugation, protoplast fusion, lipofection, electroporation, nucleofection, calcium phosphate precipitation, polyethyleneimine (PEI)-mediated transfection, DEAE-dextran mediated transfection, liposome- mediated transfection, particle gun technology, direct micro-injection, nanoparticle-mediated nucleic acid delivery, and the like.
  • PEI polyethyleneimine
  • RNP or apo-Cas9 molecule with ssDNA may be accomplished by, for example, electroporation (e.g., as known in the art) or other method that renders the cell membrane permeable to nucleic acid and/or polypeptide molecules. Additional techniques for rendering the membrane permeable are known in the art and include, for example, cell squeezing (e.g., as described in WO2015/023982 and WO2013/059343, the contents of which are hereby incorporated by reference in their entireties), nanoneedles (e.g., as described in Chiappini et al., Nat.
  • nanostraws e.g., as described in Xie, ACS Nano, 7(5); 4351 -58, the contents of which are hereby incorporated by reference in their entireties
  • gold nanoparticles e.g., as described in Dykman et al., Acta Naturae. 201 1 Apr-Jun; 3(2): 34-55, the content of which is hereby incorporated by reference in its entirety
  • lipid nanoparticles e.g., as described in Naseri et al., Adv Pharm Bull. 2015 Sep; 5(3): 305-313, the content of which is hereby incorporated by reference in its entirety
  • gRNA molecule formats are known in the art.
  • An exemplary gRNA molecule, e.g., dgRNA molecule, of the present invention comprises, e.g., consists of, a first nucleic acid having the sequence:
  • nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnGUUUUAGAGCUAUGCUGUUUUG (SEQ ID NO: 71 ), where the“n”’s refer to the residues of the targeting domain, e.g., as described herein, and may consist of 15-25 nucleotides, e.g., consists of 20 nucleotides;
  • the second nucleic acid molecule may alternatively consist of a fragment of the sequence above, wherein such fragment is capable of hybridizing to the first nucleic acid.
  • An example of such second nucleic acid molecule is: AACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCA CCGAGUCGGUGC, optionally with 1 , 2, 3, 4, 5, 6, or 7 (e.g., 4 or 7, e.g., 7) additional U nucleotides at the 3’ end (SEQ ID NO: 73).
  • Another exemplary gRNA molecule, e.g., a sgRNA molecule, of the present invention comprises, e.g., consists of a first nucleic acid having the sequence:
  • the“n”’s refer to the residues of the targeting domain, e.g., as described herein, and may consist of 15- 25 nucleotides, e.g., consist of 20 nucleotides, optionally with 1 , 2, 3, 4, 5, 6, or 7 (e.g.
  • the one or more nucleic acid sequences encoding one or more encoded gRNA molecules is provided as DNA molecules encoding one or more encoded gRNA molecules.
  • the DNA molecules may include a control region, e.g., comprising a promoter, to effect expression.
  • Useful promoters for the encoded gRNAs include H1 , EF- 1 a and U6 promoters. Promoters with similar or dissimilar strengths can be selected to tune the expression of components.
  • a promoter for an encoded gRNA molecule can be inducible, tissue specific, or cell specific.
  • DNA encoding encoded gRNA molecules can be administered to subjects or delivered into cells by art-known methods or as described herein.
  • gRNA- encoding DNA can be delivered, e.g., by vectors (e.g., viral or non-viral vectors), non-vector based methods (e.g., using naked DNA or DNA complexes), or a combination thereof.
  • the gRNA-encoding DNA is delivered by a vector (e.g., viral vector/virus, plasmid, minicircle or nanoplasmid).
  • a vector can comprise a sequence that encodes an encoded gRNA molecule.
  • a promoter e.g., a promoter, an enhancer, an intron, a polyadenylation signal, a Kozak consensus sequence, internal ribosome entry sites (IRES), a 2A sequence, and a splice acceptor or donor can be included in the vectors.
  • the promoter is recognized by RNA polymerase II (e.g., a CMV promoter).
  • the promoter is recognized by RNA polymerase III (e.g., a U6 promoter).
  • the promoter is a regulated promoter (e.g., inducible promoter).
  • the promoter is a constitutive promoter.
  • the promoter is a tissue specific promoter.
  • the promoter is a viral promoter.
  • the promoter is a non-viral promoter.
  • the vector or delivery vehicle is a minicircle. In some embodiments, the vector or delivery vehicle is a nanoplasmid.
  • the vector or delivery vehicle is a viral vector (e.g., for generation of recombinant viruses).
  • the virus is a DNA virus (e.g., dsDNA or ssDNA virus).
  • the virus is an RNA virus (e.g., an ssRNA virus).
  • Exemplary viral vectors/viruses include, e.g., retroviruses, lentiviruses, adenovirus, adeno- associated virus (AAV), vaccinia viruses, poxviruses, and herpes simplex viruses.
  • retroviruses e.g., retroviruses, lentiviruses, adenovirus, adeno- associated virus (AAV), vaccinia viruses, poxviruses, and herpes simplex viruses.
  • retroviruses e.g., retroviruses, lentiviruses, adenovirus, adeno- associated virus (AAV), vaccinia viruses, poxviruses, and herpes simplex viruses.
  • AAV adeno- associated virus
  • vaccinia viruses poxviruses
  • herpes simplex viruses e.g., retroviruses, lentiviruses, adenovirus, adeno- associated virus (AAV),
  • the virus infects dividing cells. In other words, the virus infects dividing cells.
  • the virus infects non-dividing cells. In some embodiments, the virus infects both dividing and non-dividing cells. In some embodiments, the virus can integrate into the host genome. In some embodiments, the virus is engineered to have reduced immunity, e.g., in an animal. In some embodiments, the virus is replication-competent. In other embodiments, the virus is replication- defective, e.g., having one or more coding regions for the genes necessary for additional rounds of virion replication and/or packaging replaced with other genes or deleted. In some embodiments, the virus causes transient expression of the encoded gRNA molecule.
  • the virus causes long-lasting, e.g., at least 1 week, 2 weeks, 1 month, 2 months, 3 months, 6 months, 9 months, 1 year, 2 years, or permanent expression, of the encoded gRNA molecule.
  • the packaging capacity of the viruses may vary, e.g., from at least about 4 kb to at least about 30 kb, e.g., at least about 5 kb, 10 kb, 15 kb, 20 kb, 25 kb, 30 kb, 35 kb, 40 kb, 45 kb, or 50 kb.
  • the gRNA-encoding DNA is delivered by a recombinant retrovirus.
  • the retrovirus e.g., Moloney murine leukemia vims
  • the retrovirus comprises a reverse transcriptase, e.g., that allows integration into the host genome.
  • the retrovirus is replication-competent.
  • the retrovirus is replication-defective, e.g., having one or more coding regions for the genes necessary for additional rounds of virion replication and packaging replaced with other genes, or deleted.
  • the gRNA-encoding DNA is delivered by a recombinant lentivirus.
  • the lentivirus is replication-defective, e.g., does not comprise one or more genes required for viral replication.
  • the gRNA-encoding DNA is delivered by a recombinant adenovirus.
  • the adenovirus is engineered to have reduced immunity in human.
  • the gRNA-encoding DNA is delivered by a recombinant adeno-associated virus (AAV).
  • AAV recombinant adeno-associated virus
  • the AAV can incorporate its genome into that of a host cell, e.g., a target cell as described herein.
  • the AAV is a self- complementary adeno-associated virus (scAAV), e.g., a scAAV that packages both strands which anneal together to form double stranded DNA.
  • scAAV self- complementary adeno-associated virus
  • AAV serotypes that may be used in the disclosed methods include, e.g., AAV1 , AAV2, modified AAV2 (e.g., modifications at Y444F, Y500F, Y730F and/or S662V), AAV3, modified AAV3 (e.g., modifications at Y705F, Y73 1 F and/or. T492V), AAV4, AAV5, AAV6, modified AAV6 (e.g., modifications at S663V and/or T492V), AAV8, AAV 8.2, AAV9, AAV rh 10, and pseudotyped AAV, such as AAV2/8, AAV2/5 and AAV2/6 can also be used in the disclosed methods.
  • AAV1 e.g., AAV2, modified AAV2 (e.g., modifications at Y444F, Y500F, Y730F and/or S662V), AAV3, modified AAV3 (e.g., modifications at Y705F,
  • the gRNA-encoding DNA is delivered by a hybrid virus, e.g., a hybrid of one or more of the viruses described herein.
  • a packaging cell may be used to form a virus particle that is capable of infecting a host or target cell.
  • a cell includes a 293 cell, which can package adenovirus, and a y2 cell or a PA317 cell, which can package retrovirus.
  • a viral vector used in gene therapy is usually generated by a producer cell line that packages a nucleic acid vector into a viral particle.
  • the vector typically contains the minimal viral sequences required for packaging and subsequent integration into a host or target cell (if applicable), with other viral sequences being replaced by an expression cassette encoding the protein to be expressed.
  • an AAV vector used in gene therapy typically only possesses inverted terminal repeat (ITR) sequences from the AAV genome which are required for packaging and gene expression in the host or target cell. The missing viral functions are supplied in trans by the packaging cell line.
  • ITR inverted terminal repeat
  • the viral DNA is packaged in a cell line, which contains a helper plasmid encoding the other AAV genes, namely rep and cap, but lacking ITR sequences.
  • the cell line is also infected with adenovirus as a helper.
  • the helper virus promotes replication of the AAV vector and expression of AAV genes from the helper plasmid.
  • the helper plasmid is not packaged in significant amounts due to a lack of ITR sequences. Contamination with adenovirus can be reduced by, e.g., heat treatment to which adenovirus is more sensitive than AAV.
  • the viral vector has the ability of cell type and/or tissue type recognition.
  • the viral vector can be pseudotyped with a different/alternative viral envelope glycoprotein; engineered with a cell type-specific receptor (e.g., genetic modification of the viral envelope glycoproteins to incorporate targeting ligands such as a peptide ligand, a single chain antibody, a growth factor); and/or engineered to have a molecular bridge with dual specificities with one end recognizing a viral glycoprotein and the other end recognizing a moiety of the target cell surface (e.g., ligand-receptor, monoclonal antibody, avidin-biotin and chemical conjugation).
  • ligand-receptor monoclonal antibody, avidin-biotin and chemical conjugation
  • the viral vector achieves cell type specific expression.
  • a tissue-specific promoter can be constructed to restrict expression of the transgene (encoded gRNA) in only the target cell.
  • the specificity of the vector can also be mediated by microRNA- dependent control of transgene expression.
  • the viral vector has increased efficiency of fusion of the viral vector and a target cell membrane.
  • a fusion protein such as fusion-competent hemagglutin (HA) can be incorporated to increase viral uptake into cells.
  • the viral vector has the ability of nuclear localization.
  • a virus that requires the breakdown of the cell wall (during cell division) and therefore will not infect a non-diving cell can be altered to incorporate a nuclear localization peptide in the matrix protein of the virus thereby enabling the transduction of non proliferating cells.
  • the gRNA-encoding DNA is delivered by a non vector based method (e.g., using naked DNA or DNA complexes).
  • the DNA can be delivered, e.g., by organically modified silica or silicate (Ormosil), electroporation, gene gun, sonoporation, magnetofection, lipid-mediated transfection, dendrimers, inorganic nanoparticles, calcium phosphates, or a combination thereof.
  • the gRNA-encoding DNA is delivered by a combination of a vector and a non-vector based method.
  • a virosome comprises a liposome combined with an inactivated virus (e.g., HIV or influenza virus), which can result in more efficient gene transfer, e.g., in a respiratory epithelial cell than either a viral or a liposomal method alone.
  • the vector may also contain a ribosome binding site for translation initiation and a transcription terminator.
  • the expression vector may also include appropriate sequences for amplifying expression.
  • the expression vector may also include nucleotide sequences encoding non-native tags (e.g., histidine tag, hemagglutinin tag, green fluorescent protein, etc.) that are fused to the site-directed polypeptide, thus resulting in a fusion protein.
  • a promoter is an inducible promoter (e.g., heat shock promoter, tetracycline-regulated promoter, steroid-regulated promoter, metal-regulated promoter, estrogen receptor-regulated promoter, etc.).
  • a promoter is a constitutive promoter (e.g., CMV promoter, UBC promoter).
  • the promoter is a spatially restricted and/or temporally restricted promoter (e.g., a tissue specific promoter, a cell type specific promoter, etc.).
  • the delivery vehicle is a non-viral vector.
  • the non-viral vector is an inorganic nanoparticle (e.g., attached to the payload to the surface of the nanoparticle).
  • exemplary inorganic nanoparticles include, e.g., magnetic nanoparticles (e.g., Fe Ivln02), or silica.
  • the outer surface of the nanoparticle can be conjugated with a positively charged polymer (e.g., polyethylenimine, polylysine, polyserine) which allows for attachment (e.g., conjugation or entrapment) of payload.
  • the non-viral vector is an organic nanoparticle (e.g., entrapment of the payload inside the nanoparticle).
  • organic nanoparticles include, e.g., SNALP liposomes that contain cationic lipids together with neutral helper lipids which are coated with polyethylene glycol (PEG) and protamine and nucleic acid complex coated with lipid coating.
  • PEG polyethylene glycol
  • Exemplary lipids and/or polymers for transfer of CRISPR systems or nucleic acid include, for example, those described in WO201 1/076807, WO2014/136086, W02005/060697,
  • the vehicle has targeting modifications to increase target cell update of nanoparticles and liposomes, e.g., cell specific antigens, monoclonal antibodies, single chain antibodies, aptamers, polymers, sugars, and cell penetrating peptides.
  • the vehicle uses fusogenic and endosome- destabilizing peptides/polymers.
  • the vehicle undergoes acid-triggered conformational changes (e.g., to accelerate endosomal escape of the cargo).
  • a stimuli-cleavable polymer is used, e.g., for release in a cellular compartment.
  • a stimuli-cleavable polymer e.g., for release in a cellular compartment.
  • disulfide-based cationic polymers that are cleaved in the reducing cellular environment can be used.
  • the delivery vehicle is a biological non-viral delivery vehicle.
  • the vehicle is an attenuated bacterium (e.g., naturally or artificially engineered to be invasive but attenuated to prevent pathogenesis and expressing the transgene (e.g., Listeria monocytogenes, certain Salmonella strains, Bifidobacterium longum, and modified Escherichia coli), bacteria having nutritional and tissue-specific tropism to target specific tissues, bacteria having modified surface proteins to alter target tissue specificity).
  • the transgene e.g., Listeria monocytogenes, certain Salmonella strains, Bifidobacterium longum, and modified Escherichia coli
  • the vehicle is a genetically modified bacteriophage (e.g., engineered phages having large packaging capacity, less immunogenic, containing mammalian plasmid maintenance sequences and having incorporated targeting ligands).
  • the vehicle is a mammalian virus-like particle.
  • modified viral particles can be generated (e.g., by purification of the "empty" particles followed by ex vivo assembly of the virus with the desired cargo).
  • the vehicle can also be engineered to incorporate targeting ligands to alter target tissue specificity.
  • the vehicle is a biological liposome.
  • the biological liposome is a phospholipid-based particle derived from human cells (e.g., erythrocyte ghosts, which are red blood cells broken down into spherical structures derived from the subject (e.g., tissue targeting can be achieved by attachment of various tissue or cell-specific ligands), or secretory exosomes - subject (i.e., patient) derived membrane-bound nanovesicle (30 - 100 nm) of endocytic origin (e.g., can be produced from various cell types and can therefore be taken up by cells without the need of for targeting ligands).
  • human cells e.g., erythrocyte ghosts, which are red blood cells broken down into spherical structures derived from the subject (e.g., tissue targeting can be achieved by attachment of various tissue or cell-specific ligands), or secretory exosomes - subject (i.e., patient) derived membrane-bound nanoves
  • the presently disclosed methods can achieve higher efficiency of introducing the Cas9 molecule into a cell and/or generating a genetic modification at the target sequence of one or more encoded gRNA molecules than other known methods, for example, methods of inducing one or more encoded gRNA molecules into a cell using a Cas9 molecule without a precomplexed RNA or associated ssDNA.
  • the methods disclosed herein can introduce the Cas9 molecule into a cell at an efficiency of at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or more.
  • the methods disclosed herein introduces a genetic modification to an encoded target gene in the cell.
  • A“genetic modification” as used herein refers to an alteration of a target sequence, e.g., an indel; an alteration of the epigenetic modification of the target sequence, e.g., methylation; an alteration of the transcription of the target sequence, e.g., inhibition/enhancement of promoter activity, etc.
  • the genetic modification results in reduced or increased expression of the encoded target gene and/or the encoded target gene product.
  • the encoded target gene is modified at an efficiency that is at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or more.
  • “modified at an efficiency” means the percentage of cells in a population of cells containing an encoded gRNA that comprises a genetic modification, e.g., an indel, at or near the target sequences of the encoded target gene, as measured by NGS, e.g., with at least 1 ,000, 10,000, 100,000, 1 ,000,000 sequence reads.
  • the expression level of the encoded target gene is reduced or increased by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or more.
  • “expression level” means the average, median or combined expression level of the encoded target gene of all cells containing an encoded gRNA, as measured by RT-PCR, RNA-seq, RASL-seq, FACS, etc.
  • the methods disclosed herein introduces a genetic modification to the target sequence of a target gene in the cell.
  • the genetic modification results in reduced or increased expression of the target gene and/or the target gene product.
  • the target gene is modified at an efficiency that is at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or more.
  • the methods disclosed herein introduces a genetic modification to the encoded target gene and the target gene in the same cell.
  • the expression level of the target gene is reduced or increased by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or more.
  • the presently disclosed methods are valuable for introducing a genetic modification using the CRISPR/Cas9 gene editing system into cells that have limited proliferative capacity, cells that have low transfection/transduction efficiency, and/or cells that are rapidly differentiating, such as primary human cells, stem cells, etc.
  • the presently disclosed methods are valuable for introducing a genetic modification using the CRISPR/Cas9 gene editing system into stem cells such as embryonic stem cells, hematopoietic stem cells, mesenchymal stem cells, neural stem cells, epithelial stem cells, endothelial stem cells, skin stem cells, induced pluripotent stem (iPS) cells, etc.
  • the presently disclosed methods are valuable for introducing a genetic modification using the CRISPR/Cas9 gene editing system into a tumor cell, a lymphocyte, a macrophage, a monocyte, a dendritic cell, an erythrocyte, an adipocyte, a neuron, an astrocyte, a myocyte, an epithelial cell, an endothelial cell, a beta cell, a keratinocyte, etc.
  • Exemplary tumor cells include, but are not limited to, tumor cells from lung cancer, lung adenocarcinoma, lung squamous cell carcinoma, acute myeloid leukemia, basal cell (skin) carcinoma, bladder cancer, breast cancer, carcinoid cancer, chronic lymphocytic leukemia, colorectal cancer, lymphoma, diffuse large B-cell lymphoma, endometrial cancer, esophageal cancer, esophageal adenocarcinoma, glioblastoma multiforme, glioma, head and neck cancer, kidney cell cancer, medulloblastoma, melanoma, multiple myeloma, nasopharyngeal cancer, neuroblastoma, ovarian cancer; prostate cancer, rhabdoid tumor, thyroid cancer, urinary bladder cancer, etc.
  • a“primary cell” refers to a cell which is isolated directly from a living organism’s tissue.
  • the primary cell is a mammalian cell.
  • the primary cell is a human cell.
  • the primary cell does not comprise nucleic acid sequence encoding a Cas9 molecule.
  • a primary cell is a cell which has limited lifespan and/or duplication potential, and/or does not tolerate stable integration and/or expression of a Cas9 molecule.
  • the presently disclosed methods are valuable for introducing a genetic modification using the CRISPR/Cas9 gene editing system into cells without the need to first establish and/or characterize stable Cas9 expressing subclones, into cells where the stable Cas9 expression is not desired because it would be immunogenic when transplanted in vivo, e.g., screening in syngeneic tumor models, or cells that silence Cas9.
  • Exemplary cell lines that can be used with the presently disclosed methods include , but are not limited to, C8161 , CCRF-CEM, MOLT, mlMCD-3, NHDF, HeLa-S3, Huh1 , Huh4, Huh7,
  • HUVEC HASMC, HEKn, HEKa, MiaPaCell, Panel , PC-3, TF1 , CTLL-2, C1 R, Rat6, CV1 , RPTE, A10, T24, J82, A375, ARH-77, Calul , SW480, SW620, SKOV3, SK-UT, CaCo2,
  • EMT6/AR1 EMT6/AR10.0, FM3, H1299, H69, HB54, HB55, HCA2, HEK-293, HeLa,
  • a cell transfected with one or more vectors described herein is used to establish a new cell line comprising one or more vector-derived sequences.
  • ATCC American Type Culture Collection
  • a cell transfected with one or more vectors described herein is used to establish a new cell line comprising one or more vector-derived sequences.
  • a cell transiently transfected with the components of a CRISPR system as described herein (such as by transient transfection of one or more vectors, or transfection with RNA), and modified through the activity of a CRISPR complex, is used to establish a new cell line comprising cells containing the modification but lacking any other exogenous sequence.
  • cells transiently or non-transiently transfected with one or more vectors described herein, or cell lines derived from such cells are used in assessing one or more test compounds.
  • Stem cells also referred to as progenitor cells herein
  • progenitor cells such as erythroid or hematopoietic progenitor cells
  • the daughter cells themselves can be induced to proliferate and produce progeny that subsequently differentiate into one or more mature cell types, while also retaining one or more cells with parental developmental potential.
  • stem cell refers then, to a cell with the capacity or potential, under particular circumstances, to differentiate to a more specialized or differentiated phenotype, and which retains the capacity, under certain circumstances, to proliferate without substantially differentiating.
  • progenitor or stem cell refers to a generalized mother cell whose descendants (progeny) specialize, often in different directions, by differentiation, e.g., by acquiring completely individual characters, as occurs in progressive diversification of embryonic cells and tissues.
  • Cellular differentiation is a complex process typically occurring through many cell divisions.
  • a differentiated cell may derive from a multipotent cell which itself is derived from a multipotent cell, and so on. While each of these multipotent cells may be considered stem cells, the range of cell types each can give rise to may vary considerably.
  • Some differentiated cells also have the capacity to give rise to cells of greater developmental potential. Such capacity may be natural or may be induced artificially upon treatment with various factors.
  • stem cells are also
  • Self-renewal is another important aspect of the stem cell, as used in this document. In theory, self-renewal can occur by either of two major mechanisms. Stem cells may divide asymmetrically, with one daughter retaining the stem state and the other daughter expressing some distinct other specific function and phenotype.
  • stem cells in a population can divide symmetrically into two stems, thus maintaining some stem cells in the population as a whole, while other cells in the population give rise to differentiated progeny only.
  • progenitor cells have a cellular phenotype that is more primitive (i.e., is at an earlier step along a developmental pathway or progression than is a fully differentiated cell). Often, progenitor cells also have significant or very high proliferative potential. Progenitor cells can give rise to multiple distinct differentiated cell types or to a single differentiated cell type, depending on the developmental pathway and on the environment in which the cells develop and differentiate.
  • differentiated is a relative term.
  • a “differentiated cell” is a cell that has progressed further down the developmental pathway than the cell to which it is being compared.
  • stem cells can differentiate to lineage-restricted precursor cells (such as a hematopoietic progenitor cell), which in turn can differentiate into other types of precursor cells further down the pathway (such as an erythrocyte precursor), and then to an end-stage differentiated cell, such as an erythrocyte, which plays a characteristic role in a certain tissue type, and may or may not retain the capacity to proliferate further.
  • Hematopoietic progenitor cell refers to cells of a stem cell lineage that give rise to all the blood cell types including the erythroid
  • a "cell of the erythroid lineage" indicates that the cell being contacted is a cell that undergoes erythropoiesis such that upon final differentiation it forms an erythrocyte or red blood cell. Such cells originate from bone marrow hematopoietic progenitor cells. Upon exposure to specific growth factors and other components of the hematopoietic
  • hematopoietic progenitor cells can mature through a series of intermediate differentiation cellular types, all intermediates of the erythroid lineage, into RBCs.
  • cells of the "erythroid lineage,” as the term is used herein, comprise hematopoietic progenitor cells, rubriblasts, prorubricytes, erythroblasts, metarubricytes, reticulocytes, and erythrocytes.
  • the hematopoietic progenitor cell has at least one of the cell surface marker characteristic of hematopoietic progenitor cells: CD34+, CD59+, Thyl/CD90+, CD381 lo/-, and C-kit/CD1 17+.
  • the hematopoietic progenitor are CD34+.
  • the hematopoietic progenitor cell is a peripheral blood stem cell obtained from the patient after the patient has been treated with granulocyte colony stimulating factor (optionally in combination with Plerixaflor).
  • CD34+ cells are enriched using CliniMACS® Cell Selection System (Miltenyi Biotec).
  • CD34+ cells are weakly stimulated in serum-free medium (e.g., StemSpan SFEM (Stemcell Technologies)) with cytokines (e.g., SCF, rhTPO, rhFLT3, IL6, etc.) before genome editing.
  • serum-free medium e.g., StemSpan SFEM (Stemcell Technologies)
  • cytokines e.g., SCF, rhTPO, rhFLT3, IL6, etc.
  • addition of SR1 and dmPGE2 and/or other factors is
  • CD34+ cells are cord blood CD34+ cells or bone marrow CD34+ cells.
  • the hematopoietic progenitor cells of the erythroid lineage have the cell surface marker characteristic of the erythroid lineage: such as CD71 and CD235a.
  • the cells described herein are induced pluripotent stem cells (iPSCs).
  • iPSCs induced pluripotent stem cells
  • a somatic cell can be obtained from a subject, reprogrammed to an induced pluripotent stem cell, and then re-differentiated into a
  • the stem cells used in the disclosed methods are not embryonic stem cells.
  • differentiation is generally irreversible under physiological contexts, several methods have been recently developed to reprogram somatic cells to iPSCs. Exemplary methods are known to those of skill in the art and are described briefly herein below.
  • reprogramming refers to a process that alters or reverses the differentiation state of a differentiated cell (e.g., a somatic cell). Stated another way, reprogramming refers to a process of driving the differentiation of a cell backwards to a more undifferentiated or more primitive type of cell. It should be noted that placing many primary cells in culture can lead to some loss of fully differentiated characteristics. Thus, simply culturing such cells included in the term differentiated cells does not render these cells non-differentiated cells (e.g., undifferentiated cells) or pluripotent cells.
  • a differentiated cell to pluripotency requires a reprogramming stimulus beyond the stimuli that lead to partial loss of differentiated character in culture.
  • Reprogrammed cells also have the characteristic of the capacity of extended passaging without loss of growth potential, relative to primary cell parents, which generally have capacity for only a limited number of divisions in culture.
  • the cell to be reprogrammed can be either partially or terminally differentiated prior to reprogramming.
  • reprogramming encompasses complete reversion of the differentiation state of a differentiated cell (e.g., a somatic cell) to a pluripotent state or a multipotent state.
  • reprogramming encompasses complete or partial reversion of the differentiation state of a differentiated cell (e.g., a somatic cell) to an undifferentiated cell (e.g., an embryonic-like cell).
  • Reprogramming can result in expression of particular genes by the cells, the expression of which further contributes to reprogramming.
  • reprogramming of a differentiated cell causes the differentiated cell to assume an undifferentiated state (e.g., is an undifferentiated cell).
  • the resulting cells are referred to as "reprogrammed cells,” or "induced pluripotent stem cells (iPSCs or iPS cells)."
  • Reprogramming can involve alteration, e.g., reversal, of at least some of the heritable patterns of nucleic acid modification (e.g., methylation), chromatin condensation, epigenetic changes, genomic imprinting, etc., that occur during cellular differentiation.
  • nucleic acid modification e.g., methylation
  • chromatin condensation e.g., chromatin condensation
  • epigenetic changes e.g., genomic imprinting, etc.
  • Reprogramming is distinct from simply maintaining the existing undifferentiated state of a cell that is already pluripotent or maintaining the existing less than fully differentiated state of a cell that is already a multipotent cell (e.g., a hematopoietic stem cell). Reprogramming is also distinct from promoting the self- renewal or proliferation of cells that are already pluripotent or multipotent, although the compositions and methods described herein can also be of use for such purposes, in some embodiments.
  • Mouse somatic cells can be converted to ES cell-like cells with expanded developmental potential by the direct transduction of Oct4, Sox2, Klf4, and c-Myc; see, e.g., Takahashi and Yamanaka, Cell 726(4): 663-76 (2006).
  • iPSCs resemble ES cells as they restore the pluripotency- associated transcriptional circuitry and much of the epigenetic landscape.
  • mouse iPSCs satisfy all the standard assays for pluripotency: specifically, in vitro differentiation into cell types of the three germ layers, teratoma formation, contribution to chimeras, germline transmission [see, e.g., Maherali and Hochedlinger, Cell Stem Cell. 3(6):595-605 (2008)], and tetraploid
  • iPSCs can be obtained using similar transduction methods, and the transcription factor trio, OCT4, SOX2, and NANOG, has been established as the core set of transcription factors that govern pluripotency; see, e.g., Budniatzky and Gepstein, Stem Cells Transl Med. 3(4):448-57 (2014); Barrett et al., Stem Cells Trans Med 3:1 -6 sctm.2014-0121 (2014); Focosi et al., Blood Cancer Journal 4: e21 1 (2014); and references cited therein.
  • the production of iPSCs can be achieved by the introduction of nucleic acid sequences encoding stem cell-associated genes into an adult, somatic cell, historically using viral vectors.
  • iPSCs can be generated or derived from terminally differentiated somatic cells, as well as from adult stem cells, or somatic stem cells. That is, a non-pluripotent progenitor cell can be rendered pluripotent or multipotent by reprogramming. In such instances, it may not be necessary to include as many reprogramming factors as required to reprogram a terminally differentiated cell.
  • reprogramming can be induced by the non-viral introduction of reprogramming factors, e.g., by introducing the proteins themselves, or by introducing nucleic acids that encode the reprogramming factors, or by introducing messenger RNAs that upon translation produce the reprogramming factors (see e.g., Warren et al., Cell Stem Cell, 7(5):618-30 (2010).
  • Reprogramming can be achieved by introducing a combination of nucleic acids encoding stem cell-associated genes including, for example Oct-4 (also known as Oct- 3/4 or Pouf51 ), Soxl, Sox2, Sox3, Sox 15, Sox 18, NANOG, Klfl, Klf2, Klf4, Klf5,
  • reprogramming using the methods and compositions described herein can further comprise introducing one or more of Oct-3/4, a member of the Sox family, a member of the Klf family, and a member of the Myc family to a somatic cell.
  • the methods and compositions described herein further comprise introducing one or more of each of Oct 4, Sox2, Nanog, c-MYC and Klf4 for reprogramming. As noted above, the exact method used for reprogramming is not necessarily critical to the methods and compositions described herein.
  • the reprogramming is not effected by a method that alters the genome.
  • reprogramming is achieved, e.g., without the use of viral or plasmid vectors.
  • the efficiency of reprogramming i.e., the number of reprogrammed cells derived from a population of starting cells can be enhanced by the addition of various small molecules as shown by Shi et al., Cell-Stem Cell 2:525-528 (2008); Huangfu et al, Nature Biotechnology 26(7) :795-797 (2008) and Marson et al., Cell-Stem Cell 3: 132-135 (2008).
  • an agent or combination of agents that enhance the efficiency or rate of induced pluripotent stem cell production can be used in the production of patient-specific or disease-specific iPSCs.
  • agents that enhance reprogramming efficiency include soluble Wnt, Wnt conditioned media, BIX- 01294 (a G9a histone methyltransferase), PD0325901 (a MEK inhibitor), DNA methyltransferase inhibitors, histone deacetylase (HDAC) inhibitors, valproic acid, 5'- azacytidine, dexamethasone, suberoylanilide, hydroxamic acid (SAHA), vitamin C, and trichostatin (TSA), among others.
  • soluble Wnt Wnt conditioned media
  • BIX- 01294 a G9a histone methyltransferase
  • PD0325901 a MEK inhibitor
  • HDAC histone deacetylase
  • valproic acid 5'- azacytidine
  • dexamethasone suberoylanilide
  • SAHA hydroxamic acid
  • TSA trichostatin
  • reprogramming enhancing agents include: Suberoylanilide Hydroxamic Acid (SAHA (e.g., MK0683, vorinostat) and other hydroxamic acids), BML-210, Depudecin (e.g., (-)-Depudecin), HC Toxin, Nullscript (4- (l,3-Dioxo-IH,3H- benzo[de]isoquinolin-2-yl)-N-hydroxybutanamide), Phenylbutyrate (e.g., sodium phenylbutyrate) and Valproic Acid ((VP A) and other short chain fatty acids), Scriptaid, Suramin Sodium, Trichostatin A (TSA), APHA Compound 8, Apicidin, Sodium Butyrate, pivaloyloxymethyl butyrate (Pivanex, AN-9), Trapoxin B, Chlamydocin, Depsipeptide (also known as FR901228 or
  • reprogramming enhancing agents include, for example, dominant negative forms of the HDACs (e.g., catalytically inactive forms), siRNA inhibitors of the HDACs, and antibodies that specifically bind to the HDACs.
  • HDACs e.g., catalytically inactive forms
  • siRNA inhibitors of the HDACs e.g., siRNA inhibitors of the HDACs
  • antibodies that specifically bind to the HDACs are available, e.g., from BIOMOL International, Fukasawa, Merck Biosciences, Novartis, Gloucester Pharmaceuticals, Titan Pharmaceuticals, MethylGene, and Sigma Aldrich.
  • Some embodiments disclosed herein provides methods of screening one or more encoded gRNA molecules in a population of cells for a property to identify an encoded gRNA molecule, wherein the methods use an RNP comprising a Cas9 molecule and a precomplexed RNA or an apo-Cas9 complexed with a ssDNA and a library of nucleic acid sequences encoding one or more encoded gRNA molecules, each of said one or more encoded gRNA molecules comprising a targeting domain.
  • the methods disclosed herein comprise: a) introducing into said population of cells an RNP comprising a Cas9 molecule and a
  • RNA or an apo-Cas9 molecule with a ssDNA b) introducing into said population of cells a library of nucleic acid sequences encoding one or more encoded gRNA molecules, each of said one or more encoded gRNA molecules comprising a targeting domain; c) assaying a cell of the population of cells for a property; and d) identifying the encoded gRNA molecule introduced into said cell.
  • introducing into said population of cells an RNP or an apo-Cas9 molecule with a ssDNA precedes introducing into said population of cells a library of nucleic acid sequences.
  • introducing into said population of cells a library of nucleic acid sequences precedes introducing into said population of cells an RNP or an apo-Cas9 molecule with a ssDNA. In some embodiments, introducing into said population of cells an RNP or an apo-Cas9 molecule with a ssDNA and introducing into said population of cells a library of nucleic acid sequences are performed simultaneously.
  • the population of cells may include a reporter gene.
  • a "reporter gene” encodes proteins that are readily detectable due to their biochemical characteristics, such as enzymatic activity or chemifluorescent features, e.g., fluorescent proteins, or confer resistance to a selection agent.
  • Exemplary fluorescent proteins include, but are not limited to, green fluorescence protein (GFP), EGFP, red fluorescence protein (RFP), blue fluorescence protein (EBFP), cyan fluorescence protein (ECFP), yellow fluorescence protein (YFP), and derivatives or variants thereof.
  • GFP green fluorescence protein
  • RFP red fluorescence protein
  • EBFP blue fluorescence protein
  • ECFP cyan fluorescence protein
  • YFP yellow fluorescence protein
  • derivatives or variants thereof include, but are not limited to, green fluorescence protein (GFP), EGFP, red fluorescence protein (RFP), blue fluorescence protein (EBFP), cyan fluorescence protein (ECFP), yellow fluorescence protein (Y
  • the reporter can also be an enzyme that generates a detectable signal when contacted with an appropriate substrate.
  • the reporter can be an enzyme that catalyzes the formation of a detectable product. Suitable enzymes include, but are not limited to, proteases, nucleases, lipases, phosphatases and hydrolases.
  • the reporter can encode an enzyme whose substrates are substantially impermeable to eukaryotic plasma membranes, thus making it possible to tightly control signal formation.
  • reporter genes that encode enzymes include, but are not limited to, CAT (chloramphenicol acetyl transferase; Alton and Vapnek (1979) Nature 282: 864-869); luciferase (lux); b-galactosidase; LacZ; b. - glucuronidase; aminoglycoside 3'-phosphotransferase, APT 3' II; puromycin Af-acetyl- transferase (PAG); and alkaline phosphatase (Toh, et al. (1980) Eur. J. Biochem. 182: 231 -238; and Hall et al. (1983) J. Mol. Appl. Gen. 2: 101 ), each of which are incorporated by reference herein in its entirety.
  • Other suitable reporters include those that encode for a particular epitope that can be detected with a labeled antibody that specifically recognizes the epitope.
  • the reporter gene may be used for analyzing the effect of the encoded gRNA molecules in a defined region.
  • regions include for example a regulatory region in the vicinity of a coding region.
  • a coding sequence for a reporter gene may be inserted into the genome (e.g., in place of the native coding sequence) and its expression or the functional activity of its gene product may be used as the readout.
  • the coding sequence of a reporter gene is fused to the native coding sequence, and the readout is the mRNA or protein expression of the resultant fusion protein or the functional activity of the fusion protein.
  • the method can be used to screen and identify sequences involved in cellular processes, including for example gene expression, cell division, cell metabolism, etc.
  • the method can be used to identify mutations that result in loss of function or gain of function, or decrease or increase of transcription.
  • the method may be used to identify the effect of one or more encoded gRNA molecules simultaneously.
  • the method may be used to identify the effect of one or more encoded gRNA molecules in two or more genes, including two or more regulatory regions, two or more coding sequences, or some combination thereof.
  • the methods disclosed herein are suitable for pooled screens, i.e., without compartmentalization of the population of cells or the encoded gRNA molecules. Instead, the population of cells is introduced with the library of nucleic acid sequences encoding one or more gRNA molecules, and an RNP comprising a Cas9 molecule and a precomplexed RNA or an apo-Cas9 molecule with a ssDNA, without separating individual cells.
  • Methods of conducting pooled screens using CRISPR have been disclosed in the literature, e.g., Joung et al., Nat Protoc. 2017 Apr;12(4):828-863; Jaitin et al., Cell. 2016 Dec 15;167(7) :1883-1896; Cross et al, Sci Rep. 2016 Aug 22;6:31782; Munoz et al.,
  • the pooled screening methods disclosed herein also eliminate the need for co-introduction of Cas9 and gRNA in a lentiviral vector as described in, e.g., Shalem et al., Science 343:84-87 (2014), which is limited by the size of the lentiviral vector.
  • a selection agent is used to remove cells that have not been introduced with a nucleic acid sequence encoding an encoded gRNA molecule.
  • Exemplary selection agents include, but are not limited to, G418 (Geneticin), puromycin, etc.
  • flow cytometry is used to remove cells that have not been introduced with a nucleic acid sequence encoding an encoded gRNA molecule, for example, by removing cells that do not express a selection marker, e.g., a fluorescent protein.
  • the population of cells can be a single cell type, a mixture of cell types.
  • the population of cells can be a biological sample, such as a blood sample, a biopsy, a tissue, a tumor sample, an organ, etc.
  • the population of cells contains at least 1 x 10 3 cells, at least 1 x 10 4 cells, at least 1 x 10 5 cells, at least 1 x 10 6 cells, at least 1 x 10 7 cells, at least 1 x 10 8 cells, at least 1 x 10 9 cells, at least 1 x 10 10 cells, or more.
  • the methods may further comprise introducing a nucleic acid encoding one or more transcription activation factors, such as VP64, p65, HSF1 , etc., or one or more transcription activation domains, such as p300 histone acetyltransferase domain, etc.
  • the nucleic acids comprise a vector.
  • the Cas9 may be a catalytically inactive Cas9 (dCas9).
  • the dCas9 may be fused directly or recruit activation and repression domains, such as VP64 and KRAB, respectively.
  • the dCas9 may be fused to a cytidine deaminase domain, such as an apolipoprotein B mRNA-editing complex 1 (APOBEC1 ) deaminase domain or an E. coli TadA variant deaminase domain, as described in WO2017070632 and Gaudelli et al., Nature 551 , 464 ⁇ 71 (23 November 2017), the contents of which are hereby incorporated by reference in their entireties.
  • APOBEC1 apolipoprotein B mRNA-editing complex 1
  • a“library” refers to a composition comprising a plurality of members of the library.
  • the member of the library is nucleic acid sequence encoding an encoded gRNA molecule.
  • the library is a vector library.
  • the library is random.
  • the library is rationally designed.
  • the library comprises a combination of random and rationally designed members.
  • the members of the library include a means for identifying a particular member of the library (e.g., a tag or code).
  • the library of nucleic acid sequences disclosed herein can encode one or more gRNA molecules.
  • the library of nucleic acid sequences can encode at least 10, at least 100, at least 1 ,000, at least 10,000, at least 100,000, at least 1 ,000,000, or more gRNA molecules.
  • the encoded gRNA molecules may each comprise a targeting domain.
  • the targeting domain of the encoded gRNA molecules specifically binds to a target sequence of an encoded target gene.
  • the targeting domain of the encoded gRNA molecules specifically binds to a promoter region, an exon, an intron, or a combination thereof, of an encoded target gene.
  • more than one encoded gRNA molecules may specifically binds to an encoded target gene.
  • 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, or more encoded gRNA molecules may specifically binds to an encoded target gene.
  • the library of nucleic acid sequences can encode gRNA molecules that target a whole genome, such as a human genome.
  • the library of nucleic acid sequences can encode gRNA molecules comprising MS2 binding loops to recruit two different activation domains, p65 and HSF1 . Genome-wide gRNA libraries have been described in Shalem et al., Science 343:84-87 (2014); Kolke-Yusa et al., Nature Biotech.
  • the library may be a barcoded gRNA library as described in Wong et al., Proc Natl Acad Sci U S A. 2016 Mar 1 ;1 13(9):2544-9, the content of which is hereby incorporated by reference in its entirety.
  • the library of nucleic acids comprises a vector.
  • a "vector” is a tool that allows or facilitates the transfer of an entity from one environment to another. It is a replicon, such as a plasmid, phage, or cosmid, into which another DNA segment may be inserted so as to bring about the replication of the inserted segment.
  • a vector is capable of replication when associated with the proper control elements.
  • vector refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked.
  • Vectors include, but are not limited to, nucleic acid molecules that are single-stranded, double- stranded, or partially double-stranded; nucleic acid molecules that comprise one or more free ends, no free ends (e.g. circular); nucleic acid molecules that comprise DNA, RNA, or both; and other varieties of polynucleotides known in the art.
  • plasmid refers to a circular double stranded DNA loop into which additional DNA segments can be inserted, such as by standard molecular cloning techniques.
  • viral vector Another type of vector is a viral vector, wherein virally-derived DNA or RNA sequences are present in the vector for packaging into a virus (e.g., lentiviruses, retroviruses, replication defective retroviruses, adenoviruses, replication defective adenoviruses, and adeno- associated viruses (AAVs)).
  • viruses e.g., lentiviruses, retroviruses, replication defective retroviruses, adenoviruses, replication defective adenoviruses, and adeno- associated viruses (AAVs)
  • Viral vectors also include polynucleotides carried by a virus for transfection into a host cell.
  • Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g. bacterial vectors having a bacterial origin of replication and episomal mammalian vectors).
  • vectors e.g., non-episomal mammalian vectors
  • Other vectors are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome.
  • certain vectors are capable of directing the expression of genes to which they are operatively- linked. Such vectors are referred to herein as "expression vectors.”
  • Common expression vectors of utility in recombinant DNA techniques are often in the form of plasmids.
  • Recombinant expression vectors can comprise a nucleic acid of the invention in a form suitable for expression of the nucleic acid in a host cell, which means that the recombinant expression vectors include one or more regulatory elements, which may be selected on the basis of the host cells to be used for expression, that is operatively-linked to the nucleic acid sequence to be expressed.
  • "operably linked" is intended to mean that the nucleotide sequence of interest is linked to the regulatory element(s) in a manner that allows for expression of the nucleotide sequence (e.g. in an in vitro transcription/translation system or in a host cell when the vector is introduced into the host cell).
  • the vectors can include a selection marker gene, e.g., that encodes puromycin /V-acetyl-transferase (PAC), aminoglycoside 3'-phosphotransferase II (APT 3' II), or a fluorescent protein.
  • a selection marker gene e.g., that encodes puromycin /V-acetyl-transferase (PAC), aminoglycoside 3'-phosphotransferase II (APT 3' II), or a fluorescent protein.
  • Exemplary fluorescent proteins include, but are not limited to, green fluorescence protein (GFP), EGFP, red fluorescence protein (RFP), blue fluorescence protein (EBFP), cyan fluorescence protein (ECFP), yellow fluorescence protein (YFP), and derivatives or variants thereof.
  • the marker gene may encode a luciferase.
  • the vector(s) can include the regulatory element(s), e.g., promoter(s).
  • the vector(s) can comprise Cas, and/or a single, but possibly also can comprise at least 3 or 8 or 16 or 32 or 48 or 50 RNA(s) (e.g., sgRNAs), such as 1 -2, 1 -3, 1 -4 1 -5, 3-6, 3-7, 3-8, 3-9, 3- 10, 3-8, 3-16, 3-30, 3-32, 3-48, 3-50 RNA(s) (e.g., sgRNAs).
  • RNA(s) e.g., sgRNAs
  • a promoter for each RNA there can be a promoter for each RNA (e.g., sgRNA), advantageously when there are up to about 16 RNA(s) (e.g., sgRNAs); and, when a single vector provides for more than 16 RNA(s) (e.g., sgRNAs), one or more promoter(s) can drive expression of more than one of the RNA(s) (e.g., sgRNAs), e.g., when there are 32 RNA(s) (e.g., sgRNAs), each promoter can drive expression of two RNA(s) (e.g., sgRNAs), and when there are 48 RNA(s) (e.g., sgRNAs), each promoter can drive expression of three RNA(s) (e.g., sgRNAs).
  • RNA(s) e.g., sgRNA(s) for a suitable exemplary vector such as AAV
  • a suitable promoter such as the U6 promoter
  • U6-sgRNAs the packaging limit of AAV is -4.7 kb.
  • the length of a single U6-sgRNA (plus restriction sites for cloning) is 361 bp. Therefore, the skilled person can readily fit about 12-16, e.g., 13 U6-sgRNA cassettes in a single vector.
  • the skilled person can also use a tandem guide strategy to increase the number of U6-sgRNAs by approximately 1 .5 times, e.g., to increase from 12-16, e.g., 13 to approximately 18-24, e.g., about 19 U6- sgRNAs. Therefore, one skilled in the art can readily reach approximately 18-24, e.g., about 19 promoter-RNAs, e.g., U6- sgRNAs in a single vector, e.g., an AAV vector.
  • a further means for increasing the number of promoters and RNAs, e.g., sgRNA(s) in a vector is to use a single promoter (e.g., U6) to express an array of RNAs, e.g., sgRNAs separated by cleavable sequences.
  • a single promoter e.g., U6
  • promoter-RNAs e.g., sgRNAs in a vector
  • express an array of promoter-RNAs e.g., sgRNAs separated by cleavable sequences in the intron of a coding sequence or gene; and, in this instance it is advantageous to use a polymerase II promoter, which can have increased expression and enable the transcription of long RNA in a tissue specific manner (see, e.g.,
  • AAV may package U6 tandem sgRNA targeting up to about 50 genes.
  • vector(s) e.g., a single vector, expressing multiple RNAs or guides or sgRNAs under the control or operatively or functionally linked to one or more promoters— especially as to the numbers of RNAs or guides or sgRNAs discussed herein, without any undue experimentation.
  • RNA(s) can be functionally or operatively linked to regulatory element(s) and hence the regulatory element(s) drive expression.
  • the promoter(s) can be constitutive promoter(s) and/or inducible promoter(s) and/or tissue specific promoter(s).
  • the promoter can be selected from the group consisting of RNA polymerases, pol I, pol II, pol III, T7, U6, HI, retroviral Rous sarcoma virus (RSV) LTR promoter, the cytomegalovirus (CMV) promoter, the SV40 promoter, the dihydrofolate reductase promoter, the b-actin promoter, the phosphoglycerol kinase (PGK) promoter, and the EFIa promoter.
  • RSV Rous sarcoma virus
  • CMV cytomegalovirus
  • SV40 promoter the SV40 promoter
  • the dihydrofolate reductase promoter the b-actin promoter
  • PGK phosphoglycerol kinase
  • EFIa promoter EFIa promoter
  • aspects of the invention also relate to bicistronic vectors for chimeric RNA and Cas.
  • Bicistronic expression vectors for chimeric RNA and Cas are preferred.
  • Cas is preferably driven by the CBh promoter.
  • the chimeric RNA may preferably be driven by a Pol III promoter, such as a U6 promoter. Ideally the two are combined.
  • the chimeric guide RNA typically consists of a 20bp guide sequence (Ns) and this may be joined to the tracr sequence (running from the first "U" of the lower strand to the end of the transcript).
  • the tracr sequence may be truncated at various positions as indicated.
  • the guide and tracr sequences are separated by the tracr-mate sequence, which may be
  • GUUUUAGAGCUA SEQ ID NO: 75. This may be followed by the loop sequence GAAA (SEQ ID NO: 76). Both of these are preferred examples. ChiRNAs are indicated by their "+n" designation, and crRNA refers to a hybrid RNA where guide and tracr sequences are expressed as separate transcripts. Throughout this application, chimeric RNA may also be called single guide, or synthetic guide RNA (sgRNA).
  • the loop is preferably GAAA (SEQ ID NO: 76), but it is not limited to this sequence or indeed to being only 4bp in length. Indeed, preferred loop forming sequences for use in hairpin structures are four nucleotides in length, and most preferably have the sequence GAAA (SEQ ID NO: 76).
  • a suitable vector can be introduced to a cell or an embryo via one or more methods known in the art, including without limitation, microinjection, electroporation, sonoporation, biolistics, calcium phosphate-mediated transfection, cationic transfection, liposome transfection, dendrimer transfection, heat shock transfection, nucleofection
  • the vector is introduced into an embryo by microinjection.
  • the vector or vectors may be microinjected into the nucleus or the cytoplasm of the embryo. In some methods, the vector or vectors may be introduced into a cell by nucleofection.
  • regulatory element is intended to include promoters, enhancers, internal ribosomal entry sites (IRES), and other expression control elements (e.g. transcription termination signals, such as polyadenylation signals and poly-U sequences).
  • promoters e.g. promoters, enhancers, internal ribosomal entry sites (IRES), and other expression control elements (e.g. transcription termination signals, such as polyadenylation signals and poly-U sequences).
  • IRES internal ribosomal entry sites
  • Regulatory elements include those that direct constitutive expression of a nucleotide sequence in many types of host cell and those that direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences).
  • tissue-specific promoter may direct expression primarily in a desired tissue of interest, such as muscle, neuron, bone, skin, blood, specific organs (e.g. liver, pancreas), or particular cell types (e.g. lymphocytes).
  • a vector comprises one or more pol III promoter (e.g. 1 , 2, 3, 4, 5, or more pol III promoters), one or more pol II promoters (e.g. 1 , 2, 3, 4, 5, or more pol II promoters), one or more pol I promoters (e.g. 1 , 2, 3, 4, 5, or more pol I promoters), or combinations thereof.
  • pol III promoters include, but are not limited to, U6 and HI promoters.
  • pol II promoters include, but are not limited to, the retroviral Rous sarcoma virus (RSV) LTR promoter (optionally with the RSV enhancer), the cytomegalovirus (CMV) promoter (optionally with the CMV enhancer) [see, e.g., Boshart et al, Cell, 41 :521 -530 (1985)], the SV40 promoter, the dihydrofolate reductase promoter, the b-actin promoter, the phosphoglycerol kinase (PGK) promoter, and the EF-1 a promoter.
  • RSV Rous sarcoma virus
  • CMV cytomegalovirus
  • PGK phosphoglycerol kinase
  • enhancer elements such as WPRE; CMV enhancers; the R-U5' segment in LTR of HTLV-I (Mol. Cell. Biol., Vol. 8(1 ), p. 466-472, 1988); SV40 enhancer; and the intron sequence between exons 2 and 3 of rabbit b-globin (Proc. Natl. Acad. Sci. USA., Vol. 78(3), p. 1527-31 , 1981 ). It will be appreciated by those skilled in the art that the design of the expression vector can depend on such factors as the choice of the host cell to be transformed, the level of expression desired, etc.
  • a vector can be introduced into host cells to thereby produce transcripts, proteins, or peptides, including fusion proteins or peptides, encoded by nucleic acids as described herein (e.g., clustered regularly interspersed short palindromic repeats (CRISPR) transcripts, proteins, enzymes, mutant forms thereof, fusion proteins thereof, etc.).
  • CRISPR clustered regularly interspersed short palindromic repeats
  • Vectors can be designed for expression of CRISPR transcripts (e.g. nucleic acid transcripts, proteins, or enzymes) in prokaryotic or eukaryotic cells.
  • CRISPR transcripts e.g. nucleic acid transcripts, proteins, or enzymes
  • CRISPR transcripts can be expressed in bacterial cells such as Escherichia coli, insect cells (using baculovirus expression vectors), yeast cells, or mammalian cells. Suitable host cells are discussed further in Goeddel, GENE EXPRESSION TECHNOLOGY: METHODS IN ENZYMOLOGY 185, Academic Press, San Diego, Calif. (1990).
  • the recombinant expression vector can be transcribed and translated in vitro, for example using T7 promoter regulatory sequences and T7 polymerase.
  • Vectors may be introduced and propagated in a prokaryote or prokaryotic cell.
  • a prokaryote is used to amplify copies of a vector to be introduced into a eukaryotic cell or as an intermediate vector in the production of a vector to be introduced into a eukaryotic cell (e.g. amplifying a plasmid as part of a viral vector packaging system).
  • a prokaryote is used to amplify copies of a vector and express one or more nucleic acids, such as to provide a source of one or more proteins for delivery to a host cell or host organism.
  • Fusion vectors add a number of amino acids to a protein encoded therein, such as to the amino terminus of the recombinant protein.
  • Such fusion vectors may serve one or more purposes, such as: (i) to increase expression of recombinant protein; (ii) to increase the solubility of the recombinant protein; and (iii) to aid in the purification of the recombinant protein by acting as a ligand in affinity purification.
  • a proteolytic cleavage site is introduced at the junction of the fusion moiety and the recombinant protein to enable separation of the recombinant protein from the fusion moiety subsequent to purification of the fusion protein.
  • enzymes, and their cognate recognition sequences include Factor Xa, thrombin and enterokinase.
  • Example fusion expression vectors include pGEX (Pharmacia Biotech Inc; Smith and Johnson, 1988. Gene 67: 31 -40), pMAL (New England Biolabs, Beverly, Mass.) and pRIT5 (Pharmacia, Piscataway, N.J.) that fuse
  • a vector is a yeast expression vector.
  • a vector drives protein expression in insect cells using baculovirus expression vectors.
  • Baculovirus vectors available for expression of proteins in cultured insect cells include the pAc series (Smith, et al., 1983. Mol. Cell. Biol. 3: 2156-2165) and the pVL series (Lucklow and Summers, 1989. Virology 170: 31 -39).
  • a vector is capable of driving expression of one or more sequences in mammalian cells using a mammalian expression vector.
  • mammalian expression vectors include pCDM8 (Seed, 1987. Nature 329: 840) and pMT2PC (Kaufman, et al., 1987. EMBO J. 6: 187-195).
  • the expression vector's control functions are typically provided by one or more regulatory elements.
  • commonly used promoters are derived from polyoma, adenovirus 2, cytomegalovirus, simian virus 40, and others disclosed herein and known in the art.
  • the recombinant mammalian expression vector is capable of directing expression of the nucleic acid preferentially in a particular cell type (e.g., tissue-specific regulatory elements are used to express the nucleic acid).
  • tissue-specific regulatory elements are known in the art.
  • suitable tissue-specific promoters include the albumin promoter (liver-specific; Pinkert, et al., 1987. Genes Dev. 1 : 268- 277), lymphoid-specific promoters (Calame and Eaton, 1988. Adv. Immunol. 43: 235-275), in particular promoters of T cell receptors (Winoto and Baltimore, 1989. EMBO J.
  • pancreas-specific promoters (Edlund, et al., 1985. Science 230: 912-916), and mammary gland-specific promoters (e.g., milk whey promoter; U.S. Pat. No. 4,873,316 and European Application Publication No. 264,166).
  • a regulatory element is operably linked to one or more elements of a CRISPR system so as to drive expression of the one or more elements of
  • CRISPRs Clustered Regularly Interspaced Short Palindromic Repeats
  • SPIDRs Sacer Interspersed Direct Repeats
  • the CRISPR locus comprises a distinct class of interspersed short sequence repeats (SSRs) that were recognized in E. coli (Ishino et al., J. Bacteriol., 169:5429-5433 [1987]; and Nakata et al., J. Bacteriol., 171 :3553- 3556 [1989]), and associated genes. Similar interspersed SSRs have been identified in E. coli (Ishino et al., J. Bacteriol., 169:5429-5433 [1987]; and Nakata et al., J. Bacteriol., 171 :3553- 3556 [1989]), and associated genes. Similar interspersed SSRs have been identified in E. coli (Ishino et al., J. Bacteriol., 169:5429-
  • Haloferax mediterranei, Streptococcus pyogenes, Anabaena, and Mycobacterium tuberculosis See, Groenen et al., Mol. Microbiol., 10:1057-1065 [1993]; Hoe et al., Emerg. Infect. Dis., 5:254-263 [1999]; Masepohl et al., Biochim. Biophys. Acta 1307:26-30 [1996]; and Mojica et al., Mol. Microbiol., 17:85-93 [1995]).
  • the CRISPR loci typically differ from other SSRs by the structure of the repeats, which have been termed short regularly spaced repeats (SRSRs) (Janssen et al., OMICS J. Integ. Biol., 6:23-33 [2002]; and Mojica et al., Mol. Microbiol., 36:244- 246 [2000]).
  • SRSRs short regularly spaced repeats
  • the repeats are short elements that occur in clusters that are regularly spaced by unique intervening sequences with a substantially constant length (Mojica et al., [2000], supra).
  • the repeat sequences are highly conserved between strains, the number of interspersed repeats and the sequences of the spacer regions typically differ from strain to strain (van Embden et al, J.
  • CRISPR loci have been identified in more than 40 prokaryotes (See e.g., Jansen et al., Mol. Microbiol., 43:1565-1575 [2002]; and Mojica et al., [2005]) including, but not limited to Aeropyrum, Pyrobaculum, Sulfolobus, Archaeoglobus, Halocarcula, Methanobacterium, Methanococcus, Methanosarcina, Methanopyrus, Pyrococcus, Picrophilus, Thermoplasma, Corynebacterium, Mycobacterium, Streptomyces, Aquifex, Porphyromonas, Chlorobium, Thermus, Bacillus, Listeria,
  • Staphylococcus Clostridium, Thermoanaerobacter, Mycoplasma, Fusobacterium, Azarcus, Chromobacterium, Neisseria, Nitrosomonas, Desulfovibrio, Geobacter, Myxococcus,
  • one or more vectors driving expression of one or more elements of a CRISPR system are introduced into a host cell such that expression of the elements of the CRISPR system direct formation of
  • a Cas enzyme, a guide sequence linked to a tracr-mate sequence, and a tracr sequence could each be operably linked to separate regulatory elements on separate vectors.
  • two or more of the elements expressed from the same or different regulatory elements, may be combined in a single vector, with one or more additional Vectors providing any components of the CRISPR system not included in the first vector.
  • CRISPR system elements that are combined in a single vector may be arranged in any suitable orientation, such as one element located 5' with respect to
  • a single promoter drives expression of a transcript encoding a Cas and one or more of the guide sequence, tracr mate sequence (optionally operably linked to the guide sequence), and a tracr sequence embedded within one or more intron sequences (e.g. each in a different intron, two or more in at least one intron, or all in a single intron).
  • the Cas, guide sequence, tracr mate sequence, and tracr sequence are operably linked to and expressed from the same promoter.
  • Delivery vehicles, vectors, particles, nanoparticles, formulations and components thereof for expression of one or more elements of a CRISPR system are as used in the foregoing documents, such as WO 2014/093622 (PCT/US2013/074667).
  • a vector comprises one or more insertion sites, such as a restriction
  • a vector comprises an insertion site upstream of a tracr mate sequence, and optionally downstream of a regulatory element operably linked to the tracr mate sequence, such that following insertion of a guide sequence into the insertion site and upon expression the guide sequence directs sequence-specific binding of a CRISPR complex to a target sequence in a eukaryotic cell.
  • a vector comprises two or more insertion sites, each insertion site being located between two tracr mate sequences so as to allow insertion of a guide sequence at each site.
  • the two or more guide sequences may comprise two or more copies of a single guide sequence, two or more different guide sequences, or combinations of these.
  • a single expression construct may be used to target CRISPR activity to multiple different, corresponding target sequences within a cell.
  • a single vector may comprise about or more than about 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, or more guide sequences.
  • a vector comprises a regulatory element operably linked to an enzyme coding sequence encoding a Cas protein.
  • Cas protein or Cas mRNA or CRISPR guide RNA or RNA(s) can be delivered separately; and advantageously at least one of these is delivered via a particle complex.
  • Cas mRNA can be delivered prior to the guide RNA to give time for Cas to be expressed.
  • Cas mRNA might be administered 1 -12 hours (preferably around 2-6 hours) prior to the administration of guide RNA.
  • Cas mRNA and guide RNA can be administered together.
  • a second booster dose of guide RNA can be administered 1 -12 hours (preferably around 2-6 hours) after the initial administration of Cas mRNA + guide RNA. Additional administrations of Cas mRNA and/or guide RNA might be useful to achieve the most efficient levels of genome modification.
  • the library of nucleic acids is introduced to the population of cells to achieve a low multiplicity of infection (MOI) such that most cells receive a single vector.
  • MOI multiplicity of infection
  • the library of nucleic acids is introduced to the population of cells to achieve an MOI of less than 1 .
  • a variety of properties can be assessed by assaying the population of cells after the introduction of the library of nucleic acid sequences encoding one or more encoded gRNA molecules, such as cell survival, cell death, cell growth, cell differentiation, cell activation, gene expression (single gene expression, e.g., fetal haemoglobin, multiple gene expression, reporter gene expression, etc.), a phenotypic change, or a combination thereof.
  • the population of cells may be assessed for a modification, e.g., a reduction or an enhancement, of a phenotype resulting from introducing the precomplexed gRNA.
  • the assays can be used to assess any phenotypic change that affect cell growth or that are selectable by cell sorting using intracellular or cell surface markers (e.g., FACS).
  • the population of cells may be labelled by an antibody that specifically binds to a cell surface marker or an epitope encoded by a reporter gene.
  • Exemplary cell surface markers include, but are not limited to, CD44, CD133, CD24, CD90, CD271 , CD49f, CD13, CXCR4, CD48, CD150, CD244, CD34, CD38, SCA-1 , Thy1 .1 , C-kit, lin, CD135, CD1 1 b, CD31 , CD1 17, CD45, CD4, CD8, CD15, CD24, CD1 14, CD182, CD14, CD1 1 a, CD91 , CD16, CD3, CD25, FAXP3, CD19, CD20, CD22, CD61 , CD56, CD30, etc.
  • the population of cells may be stained for an intracellular marker, e.g., intracellular Zn 2+ , etc.
  • the population of cells may be sorted by the expression of a reporter protein as disclosed herein.
  • the assaying a cell of the population of cells for a property comprises comparing the level of the reporter gene product in the cell to a reference level.
  • the assaying a cell of the population of cells for a property comprises growing the population of cells in the presence of a selection agent.
  • Exemplary selection agents include, but are not limited to, G418 (Geneticin), puromycin, etc.
  • assaying a cell of the population of cells for a property may comprise analyzing the expression level of one or more reporter genes in the cell.
  • the cell is identified as having the property if the difference in the level of the reporter gene product of the cell compared to the reference level has a Z-score of less than -3 or greater than 3.
  • assaying a cell of the population of cells for a property may comprise analyzing the expression level of one or more genes in the cell.
  • the population of cells can be grown for a period of time in vitro, ex vivo or in vivo.
  • the population of cells after the introduction of the library of nucleic acid sequences encoding one or more encoded gRNA molecules, can be grown in vitro, ex vivo or in vivo for a length that is, is about, is less than, is more than, 1 hr, 2 hr, 3 hr, 4 hr, 5 hr, 6 hr, 12 hr, 18 hr, 1 d, 2 d, 3 d, 4 d, 5 d, 6 d, 7 d, 8 d, 9 d, 10 d, 1 1 d, 12 d, 13 d, 14 d, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 2 months, 3 months, 4 months, 5 months, 6 months, or a range between any two of the above values.
  • the population of cells can be subjected to a variety of treatments or conditions such as an anti-tumor agent, an anti-inflammatory agent, an immunomodulatory, a growth factor, a cytokine, a differentiation factor, an antibacterial agent, a physical shock, a tumorigenesis agent, etc.
  • corticosteroid anti inflammatory agents may be used to treat the population of cells.
  • Corticosteroids for use may be selected from any of methylprednisolone, hydrocortisone, prednisone, budenisonide, mesalamine, and dexamethasone.
  • immunomodulator selected from any of 6-mercaptopurine, azathioprine, cyclosporine A, tacrolimus, and methotrexate.
  • an immunomodulator is selected from an anti-TNF agent (e.g., infliximab, adalimumab, certolizumab, golimumab), natalizumab, and vedolizumab.
  • antibacterial agents include without limitation sulfonamides (e.g., sulfanilamide, sulfadiazine, sulfamethoxazole, sulfisoxazole, sulfacetamide), trimethoprim, quinolones (e.g., nalidixic acid, cinoxacin, norfloxacin, ciprofloxacin, ofloxacin, sparfloxacin, fleroxacin, perloxacin, levofloxacin, garenoxacin and gemifloxacin), methenamine, nitrofurantoin, penicillins (e.g., penicillin G, penicillin V, methicilin oxacillin, cloxacillin, dicloxacillin, nafcilin, ampicillin, amoxicillin, carbenicillin, ticarcillin, mezlocillin, and piperacillin), cephalosporins (e.g., cefa
  • an anti-tumor agent is selected from tyrosine kinase inhibitors, including but not limited to, EGFR inhibitors, Her2 inhibitors, Her3 inhibitors, IGFR inhibitors, and Met inhibitors.
  • tyrosine kinase inhibitors include but are not limited to, Erlotinib hydrochloride (Tarceva®); Linifanib (N-[4-(3-amino-1 H-indazol-4-yl)phenyl]- N'-(2-fluoro-5-methylphenyl)urea, also known as ABT 869, available from Genentech); Sunitinib malate (Sutent®); Bosutinib (4-[(2,4-dichloro-5-methoxyphenyl)amino]-6-methoxy-7-[3-(4- methylpiperazin-1 -yl)propoxy]quinoline-3-carbonitrile, also known as SKI-606, and described in US Patent No. 6,780,996); Dasatinib (Sprycel®); Pazopanib (Votrient®) ; Sorafenib
  • Epidermal growth factor receptor (EGFR) inhibitors include but are not limited to, Erlotinib hydrochloride (Tarceva®), Gefitnib (Iressa®); N-[4-[(3- Chloro-4-fluorophenyl)amino]-7-[[(3"S")-tetrahydro-3-furanyl]oxy]-6-quinazolinyl]- 4(dimethylamino)-2-butenamide, Tovok®); Vandetanib (Caprelsa®); Lapatinib (Tykerb®); (3R,4R)-4-Amino-1 -((4-((3-methoxyphenyl)amino)pyrrolo[2,1 -f][1 ,2,4]triazin-5- yl)methyl)piperidin-3-ol (BMS690514) ; Canertinib dihydrochloride (CI-1033); 6-[4-[(4-Ethyl
  • Matuzumab EMD-72000
  • Nimotuzumab hR3
  • Zalutumumab TheraCIM h-R3
  • MDX0447 CAS 339151 -96-1
  • ch806 mAb-806, CAS 946414-09-1 .
  • HER2 receptor Human Epidermal Growth Factor Receptor 2 (HER2 receptor) (also known as Neu, ErbB-2, CD340, or p185) inhibitors include but are not limited to, Trastuzumab (Herceptin®); Pertuzumab (Omnitarg®); Neratinib (HKI-272, (2E)-N-[4-[[3-chloro-4-[(pyridin-2-yl)methoxy]phenyl]amino]-3-cyano-7-ethoxyquinolin- 6-yl]-4-(dimethylamino)but-2-enamide, and described PCT Publication No.
  • HER3 inhibitors include but are not limited to, LJM716, MM-121 , AMG-888, RG71 16, REGN-1400, AV-203, MP-RM-1 , MM-1 1 1 , and ME HD-7945 A.
  • MET inhibitors include but are not limited to, Cabozantinib (XL184, CAS 849217-68-1 ); Foretinib (GSK1363089, formerly XL880, CAS 849217-64-7); Tivantinib (ARQ197, CAS 1000873-98-2); 1 -(2-Hydroxy-2- methylpropyl)-N-(5-(7-methoxyquinolin-4-yloxy)pyridin-2-yl)-5-methyl-3-oxo-2-phenyl-2,3- dihydro-1 H-pyrazole-4-carboxamide (AMG 458); Cryzotinib (Xalkori®, PF-02341066); (3Z)-5- (2,3-Dihydro-1 H-indol-1 -ylsulfonyl)-3-( ⁇ 3,5-dimethyl-4-[(4-methylpiperazin-1 -yl)carbonyl]-1
  • IGF1 R inhibitors include but are not limited to, BMS-754807, XL-228, OSI-906, GSK0904529A, A-928605, AXL1717, KW-2450, MK0646, AMG479, IMCA12, MEDI-573, and BI836845. See e.g., Yee, JNCI, 104; 975 (2012) for review.
  • an anti-tumor agent is selected from FGF downstream signaling pathway inhibitors, including but not limited to, MEK inhibitors, Braf inhibitors, PI3K/Akt inhibitors, SHP2 inhibitors, and also mTor inhibitors.
  • FGF downstream signaling pathway inhibitors including but not limited to, MEK inhibitors, Braf inhibitors, PI3K/Akt inhibitors, SHP2 inhibitors, and also mTor inhibitors.
  • MEK mitogen- activated protein kinase
  • XL-518 also known as GDC-0973, Cas No.
  • Phosphoinositide 3-kinase (PI3K) inhibitors include but are not limited to, 4-[2-(1 H-lndazol-4-yl)-6-[[4-(methylsulfonyl)piperazin-1 -yl]methyl]thieno[3,2- d]pyrimidin-4-yl]morpholine (also known as GDC 0941 and described in PCT Publication Nos.
  • mTor inhibitors include but are not limited to, Temsirolimus (Torisel®); Ridaforolimus (formally known as deferolimus, (1 R,2R,4S)-4-[(2R)-2 [(1 R.9S.12S,15R,16E,18R,19R.21 R,
  • an anti-tumor agent is selected from pro- apoptotics, including but not limited to, IAP inhibitors, Bcl2 inhibitors, MCI1 inhibitors, Trail agents, Chk inhibitors.
  • IAP inhibitors include but are not limited to, NVP-LCL161 , GDC-0917, AEG-35156, AT406, and TL3271 1 .
  • IAP inhibitors include but are not limited to those disclosed in W004/005284, WO 04/007529, W005/097791 , WO 05/069894, WO 05/069888, WO 05/094818, US2006/0014700, US2006/0025347, WO 06/069063, WO 06/0101 18, WO 06/017295, and WO08/134679.
  • BCL-2 inhibitors include but are not limited to, 4-[4-[[2-(4-Chlorophenyl)-5,5-dimethyl-1 -cyclohexen-1 -yl]methyl]-1 -piperazinyl]-N-[[4-[[(1 R)-3-(4- morpholinyl)-1 -[(phenylthio)methyl]propyl]amino]-3-
  • Proapoptotic receptor agonists including DR4 (TRAILR1 ) and DR5 (TRAILR2), including but are not limited to, Dulanermin (AMG-951 , RhApo2L/TRAIL); Mapatumumab (HRS-ETR1 , CAS 658052-09-6); Lexatumumab (HGS-ETR2, CAS 845816-02-6); Apomab (Apomab®); Conatumumab
  • Checkpoint Kinase (CHK) inhibitors include but are not limited to, 7- Hydroxystaurosporine (UCN-01 ); 6-Bromo-3-(1 -methyl-1 H-pyrazol-4-yl)-5-(3R)-3-piperidinyl- pyrazolo[1 ,5-a]pyrimidin-7-amine (SCH900776, CAS 891494-63-6) ; 5-(3-Fluorophenyl)-3- ureidothiophene-2-carboxylic acid N-[(S)-piperidin-3-yl]amide (AZD7762, CAS 860352-01 -8); 4- [((3S)-1 -Azabicyclo[2.2.2]oct-3-yl)amino]-3-(1 H-benzimidazol
  • an anti-tumor agent is selected from FGFR inhibitors.
  • FGFR inhibitors include but are not limited to, Brivanib alaninate (BMS- 582664, (S)-((R)-1 -(4-(4-Fluoro-2-methyl-1 H-indol-5-yloxy)-5-methylpyrrolo[2,1 -f][1 ,2,4]triazin-6- yloxy)propan-2-yl)2-aminopropanoate); Vargatef (BIBF1 120, CAS 928326-83-4); Dovitinib dilactic acid (TKI258, CAS 852433-84-2); 3-(2,6-Dichloro-3,5-dimethoxy-phenyl)-1 - ⁇ 6-[4-(4- ethyl-piperazin-1 -yl)-phenylamino]-pyrimidin-4-yl ⁇ -1 -methyl-urea (BG
  • the present disclosure provides a method of treating cancer by administering to a subject in need thereof an antibody drug conjugate in combination with an FGFR2 inhibitor, such as 3-(2,6- dichloro-3,5-dimethoxyphenyl)-1 -(6((4-(4-ethylpiperazin-1 -yl)phenyl)amino)pyrimidin-4-yl)-1 - methylurea (also known as BGJ-398); or 4-amino-5-fluoro-3-(5-(4-methylpiperazin1 -yl)-1 H- benzo[d]imidazole-2-yl)quinolin-2(1 H)-one (also known as dovitinib or TKI-258).
  • an FGFR2 inhibitor such as 3-(2,6- dichloro-3,5-dimethoxyphenyl)-1 -(6((4-(4-ethylpiperazin-1 -yl)phenyl)amino)pyrimidin-4-y
  • AZD4547 (Gavine et al., 2012, Cancer Research 72, 2045-56, N-[5-[2-(3,5-Dimethoxyphenyl)ethyl]-2H- pyrazol-3-yl]-4-(3R,5S)-diemthylpiperazin-1 -yl)benzamide), Ponatinib (AP24534; Gozgit et al., 2012, Mol Cancer Ther., 1 1 ; 690-99; 3-[2-(imidazo[1 ,2-b]pyridazin-3-yl)ethynyl]-4-methyl-N- ⁇ 4- [(4-methylpiperazin-1 - yl)methyl]-3-(trifluoromethyl)phenyl ⁇ benzamide, CAS 943319-70-8).
  • an anti-tumor agent is selected from antagonists of an immune checkpoint molecule chosen from one or more of PD-1 , PD-L1 , PD-L2, TIM3, CTLA-4, LAG-3, CEACAM-1 , CEACAM-5, VISTA, BTLA, TIGIT, LAIR1 , CD160, 2B4 or TGFR.
  • the immune checkpoint molecule antagonist is an anti-PD-1 inhibitor, wherein the anti-PD-1 antibody is chosen from Nivolumab, Pembrolizumab or Pidilizumab.
  • the anti-PD-1 antibody molecule is Nivolumab.
  • Alternative names for Nivolumab include MDX- 1 106, MDX-1 106-04, ONO-4538, or BMS-936558.
  • the anti-PD- 1 antibody is Nivolumab (CAS Registry Number: 946414-94-4).
  • Nivolumab is a fully human lgG4 monoclonal antibody which specifically blocks PD1 .
  • Nivolumab (clone 5C4) and other human monoclonal antibodies that specifically bind to PD1 are disclosed in US 8,008,449 and W02006/121 168.
  • the anti-PD-1 antibody molecule is Pembrolizumab.
  • Pembrolizumab also referred to as Lambrolizumab, MK- 3475, MK03475, SCH-900475 or KEYTRUDA®; Merck
  • Pembrolizumab and other humanized anti-PD-1 antibodies are disclosed in Hamid, O. et al.
  • the anti-PD-1 antibody molecule is Pidilizumab.
  • Pidilizumab CT-01 1 ; Cure Tech
  • CT-01 1 Cure Tech
  • Pidilizumab and other humanized anti-PD-1 monoclonal antibodies are disclosed in W02009/10161 1 .
  • Other anti-PD1 antibody molecules include AMP 514 (Amplimmune) and, e.g., anti-PD1 antibodies disclosed in US 8,609,089, US 2010/028330, and/or US
  • the anti-tumor agent is the anti- Tim3 antibody disclosed in US2015/0218274. In other embodiments, the anti-tumor agent is the anti-PD-L1 antibody disclosed in US2016/0108123, Durvalumab® (MEDI4736), Atezolizumab® (MPDL3280A) or Avelumab®.
  • the population of cells after the introduction of the library of nucleic acid sequences encoding one or more encoded gRNA molecules, can be co cultured with other cells, such as tumor cells, lymphocytes, dendritic cells, astrocytes, etc.
  • the population of cells e.g., tumor cells
  • the mouse after the introduction of the library of nucleic acid sequences encoding one or more encoded gRNA molecules, can be transferred into an in vivo environment, such as a mouse.
  • the mouse may have a compromised immune system, e.g., a NOD scid gamma (NSG) mouse, a NOG (NOD/Shi-scid/IL-2RY nuN ) mouse, a nude mouse, etc.
  • a compromised immune system e.g., a NOD scid gamma (NSG) mouse, a NOG (NOD/Shi-scid/IL-2RY nuN ) mouse, a nude mouse, etc.
  • NSG NOD scid gamma
  • NOG NOD/Shi-scid/IL-2RY nuN
  • the mouse may have a humanized immune system, e.g., a humanized NSG mouse.
  • the methods disclosed herein are used for in vivo screening of a genome-wide gRNA library for targets involved in tumor growth or metastasis.
  • In vivo CRISPR screening for targets regulating tumor growth and metastasis is described in PCT Patent Pub. No. WO2016108926, the content of which is incorporated herein by reference in its entirety.
  • a population of tumor cells may be transferred into a mouse by, e.g., subcutaneous transplant, intravenous injection, etc. Tumor cells at the site of
  • transplant/injection and/or tumor cells at metastatic site(s) may be collected and assessed as disclosed herein.
  • the gRNA molecule(s) introduced into a cell having the property such as cell survival, cell death, cell growth, cell differentiation, cell activation, gene expression (single gene expression, e.g., fetal haemoglobin, or multiple gene expression), or a combination thereof or subjected to a treatment or condition for a first length of time can be identified by genetic analysis of the cell having the property or subjected to a treatment or condition for a first length of time.
  • genetic analysis may comprise sequencing, e.g., next-gen sequencing (NGS), hybridization, PCR, etc.
  • genetic analysis may comprise comparing the gRNA molecule(s) in the cell having the property with the gRNA molecule(s) in the cell not having the property, and/or the encoded gRNA molecules introduced into the population of cells. In some embodiments, genetic analysis may comprise comparing the gRNA molecule(s) in the cells that have been subjected to a treatment or condition for different lengths of time.
  • the level of the gRNA molecule(s) in a cell having the property or subjected to a treatment or condition for a first length of time can be compared to a reference level of the gRNA molecule(s), e.g., the level of the gRNA molecule(s) in the cell not having the property or subjected to a treatment or condition for a second length of time, and/or the encoded gRNA molecules introduced into the population of cells.
  • a gRNA is identified when its level in the cell having the property or subjected to a treatment or condition for a first length of time is significantly higher or lower than the reference level, e.g., by counting the number of sequencing reads of a gRNA through NGS.
  • a gRNA is identified if the level of the encoded gRNA molecule in a cell having the property or subjected to a treatment or condition for a first length of time is at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, at least 200%, higher or lower than the reference level.
  • a gRNA is identified if the difference in the level of the encoded gRNA molecule in a cell having the property or subjected to a treatment or condition for a first length of time compared to the reference level has a Z- score of less than -5, less than -4, less than -3, less than -2, greater than 2, greater than 3, greater than 4, or greater than 5.
  • the methods disclosed herein provide identifying a target gene that is modified in a cell having the property or subjected to a treatment or condition for a first length of time.
  • a target gene may be identified when at least 1 , at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10 gRNA molecules having a target sequence located in the target gene is identified in the cell having the property or subjected to a treatment or condition for a first length of time.
  • genetic analysis may comprise single cell RNA- sequencing (CRISP-seq, Perturb-seq (Jaitin DA, Weiner A, Yofe I, Lara-Astiaso D, Keren-Shaul H, David E, et al. Dissecting Immune Circuits by Linking CRISPR-Pooled Screens with Single- Cell RNA-Seq. Cell. 2016;167(7):1883-96.e15; Dixit A, Parnas O, Li B, Chen J, Fulco CP, Jerby-Arnon L, et al.
  • Perturb-Seq Dissecting Molecular Circuits with Scalable Single-Cell RNA Profiling of Pooled Genetic Screens. Cell. 201 6;1 67(7) :1 853-66. e1 7; Adamson B, Norman TM, Jost M, Cho MY, Nunez JK, Chen Y, et al. A Multiplexed Single-Cell CRISPR Screening Platform Enables Systematic Dissection of the Unfolded Protein Response. Cell.
  • CRISPR-Cas9 screening enables genome-wide interrogation of gene function. Achieving the high and uniform Cas9 expression desirable for screening currently requires engineering stable and clonal Cas9-expressing cells, an approach that is not applicable in human primary cells.
  • Guide Swap enables genome-scale pooled CRISPR-Cas9 screening in human primary cells by exploiting the unexpected finding that editing by lentivirally-delivered, targeted gRNAs occurs efficiently when Cas9 is delivered complexed with non-targeting gRNA.
  • gRNA target sequences were as follows: non-targeting sequences were from the GeCKO v2 library. CD33-targeting sequences were from Doench JG, et al., Nat Biotech. 2014;32(12):1262-7.
  • AUGUGAGUCGCAAAUAAGGCUGGUACCGCUGUGCAU (SEQ ID NO: 36) was purchased from Integrated DNA Technologies.
  • CD34+ cells were isolated from G-CSF-mobilized peripheral blood
  • HEK293T cells were cultured in DMEM medium (HyClone) supplemented with 10% FBS (Omega Scientific), 10mM HEPES (Hyclone), 1 mM sodium pyruvate (Hyclone),
  • HEK293T were passaged every 2-3 days.
  • CD34+ HSPC were cultured in StemSpan SFEM (Stemcell Technologies) with 50ng/mL SCF (Life Technologies PHC21 13), TPO (R&D Systems 288-TP), Flt3 ligand (Life Technologies PHC9413), IL6 (Life Technologies PHC0063) and 1 x antibiotic antimycotic (Gibco).
  • T cells were cultured in RPMI-1640 supplemented with 10% FBS, 5mM HEPES, 1 % PSG, 1 x MEM NEAA and 1 mM sodium pyruvate with 20U/mL IL-2 (R&D Systems), 1 x BME (Gibco / Thermo Fisher)) and Dynabeads Human T-Activator CD3/28 (Gibco / Thermo Fisher) at a 1 :1 cell to bead ratio.
  • CT26 cells were cultured in RPMI-1640 medium (HyClone)
  • Lentiviral production [00207] Lentivirus was produced by co-transfecting the lentiviral vector with pCMV-dR8.91 and pCMV-VSV-G packaging plasmids into HEK239T cells using Lipofectamine 3000 (Life Technologies). Media was changed 12 hours post-transfection, and virus-containing supernatant was collected 48 hours post-transfection. Viral supernatant was passed through a 0.45 mM filter (Millipore SLHV033RS) and then concentrated using Amicon Ultra-15 Centrifugal Filter Units with Ultracel-100 membrane (Millipore UFC910024). Viral titers were measured by FACS in HEK293T cells and were typically -1 x109.
  • a freshly transformed BL21 (DE3)Star (Novagen) colony containing the pET28-Cas9 construct was isolated. This colony was used to inoculate 25 mL LB Luria
  • Teknova supplemented with kanamycin (25 pg/mL).
  • the culture was grown at 270 RPM and 37°C for approximately 16 hours. This culture was used to seed, at 1 :100 (v/v), two 2.5 L Ultra Yield flasks (Thomson) containing 1 L each of room temperature Terrific Broth Complete (Teknova) supplemented with kanamycin (25 pg/mL).
  • the cultures were grown at 37°C and 270 RPM while monitoring the OD(600 nm). Thirty minutes prior to reaching OD(600 nm) of 1 .0, the incubator temperature was decreased to 18°C.
  • IPTG Isopropyl b-D-l -thiogalactopyranoside
  • the lysate was disrupted by sonication on ice for 2 mins in 100 ml volumes at 70% power, with 1 second sonicate, 2 seconds rest cycles. Supernatant was separated by centrifuging at 15,000 rpm for 30 min. at 4°C (Sorvall RC 6+ centrifuge) before being applied to a HisTrapp FF 5 ml column (GE Healthcare Life Science Corporation) and eluted with buffer containing 20 mM Tris (pH 8.0), 500 mM NaCI, 300 mM imidazole, and 1 mM TCEP.
  • Protein was buffer exchanged to Side A buffer (20 mM Tris (pH 8.0), 150 mM NaCI, 0.5 mM TCEP) before being loaded to a Resource S column (GE Healthcare Life Science Corporation), and eluted with Side B buffer (20 mM Tris (pH 8.0), 500 mM NaCI, 0.5 mM TCEP) using a gradient from 100% Side A buffer to 100% Side B buffer in 15 column volumes.
  • Side A buffer (20 mM Tris (pH 8.0), 150 mM NaCI, 0.5 mM TCEP)
  • Side B buffer 20 mM Tris (pH 8.0), 500 mM NaCI, 0.5 mM TCEP) using a gradient from 100% Side A buffer to 100% Side B buffer in 15 column volumes.
  • the final protein was purified by gel filtration chromatography with a HiLoad 16/600 Supdex 200 prep grade column (GE Healthcare Life Science Corporation) in 20 mM HEPES (pH 7.5), 150mM KCI
  • Lentiviral transduction For human primary CD34+ HSPC, Falcon 96 Well flat bottom non-treated cell culture plates (Corning 351 172) were coated with 50pg/mL retronectin in PBS overnight at 4°C. The following day, the wells were blocked with 1 % BSA in PBS for 30 minutes at room temperature and then washed once with PBS. Concentrated lentivirus (70pL/well) was pre-bound to the retronectin-coated plate by spinning the plate at 2000xg for 2 hours. CD34+ cells were added (up to 1 .5x105 cells/well) after removing the concentrated virus, and the plate was briefly centrifuged for 1 minute at 280xg prior to return to incubation.
  • CD4+ T cells For CD4+ T cells, cells were thawed, washed and resuspended in complete culture media including IL-2, BME and CD3/28 beads to a final concentration of 200K cells per ml_. 4pl of 1 X10 L 9 vp/mL virus was added per mL and cells were divided over 96 well U-bottom plates with each well containing 250pl. Plates were spun for 1 .5 hrs @ 1200x g at RT.
  • CD34+ HSPC were transduced 48 hours post-thaw with lentiviral gRNA vectors. Mobilized peripheral blood (mPB) CD34+ cells were used unless otherwise noted. CD4+ T cells were transduced the day of thaw. 48 hours post-transduction, the HSPC or T cells (5x10 4 -1 x10 6 /reaction) were washed once with PBS and resuspended in 20 pL of supplemented P3 Primary Cell 4D-Nucleofector Solution (Lonza). The 5 pL of RNP was added to the 20 pL of cells, mixed by pipetting up and down and incubated at room temperature for 5 minutes. After incubation, the cell/RNP mixture was transferred into Nucleocuvettes and electroporated using the P3 Primary Cell 4D-Nucleofector X Kit S (Lonza V4XP-3032), program code CM-137.
  • mPB Mobilized peripheral blood
  • CD4+ T cells were transduce
  • CT26 cells were transduced by incubating 1 X 10 4 cells in 100 pL media with 12.5 pL concentrated lentivirus for 48 hours. Post-infection, stably transduced cells were selected by incubation with puromycin at 18 gg/mL for 48 hours. Delivery of Cas9 RNP complexes to CT26 cells was performed as follows. 1 X 10 5 cells were harvested and washed once with 1 X D-PBS. Cells were re-suspended in SE Cell Line 4D-Nucleofector® X Kit solution with Supplement (Lonza) and transferred to 16 well-NucleocuvetteTM Strips and electroporated using program DS-120. Cells were re-suspended in pre-warmed media, transferred to 96-well plates and incubated for 48 hours prior to extraction of genomic DNA for TIDE analysis or 96-hours prior to western blot analysis.
  • Multicolor analysis was performed on an LSRFortessa flow cytometer (Becton Dickinson) using BD FACSDiva and analyzed using FlowJo software.
  • HBSS1 X Gibco 14175- 095
  • FBS HyClone SV30014.03
  • 2 mM EDTA Sigma E7889
  • Antibodies used were as follows: 1 :100 anti CD3-Pacific Blue (Invitrogen MHCD0328), 1 :100 anti CD33- Bv421 (BD Biosciences 565949), 1 :100 anti CD34-APC (BD Biosciences 555824), 1 :100 anti CD34-PE (BD Biosciences 348057), 1 :1000 anti CD41 a-FITC (eBioscience 1 1 -0419-42), 1 :750 anti CD41 a-e450 (eBioscience 48-0419), 1 :100 anti CD45-APC (BD Biosciences 555485),
  • Lentiviral gRNA-expressing cells were gated using RFP, a fluorescent marker derived from the lentiviral vector.
  • CD34+ HSPC were thawed, transduced with lentivirus-encoded gRNA and cultured for 3 days in the presence of 750 nM SR1 .
  • Cells were electroporated with 6 pg Cas9 alone, or 6 pg Cas9 pre-complexed to 6 pg of scrambled RNA, crRNA, tracrRNA, crRNA+ tracrRNA or sgRNA.
  • the cells were harvested for intracellular Cas9 staining. Cells were pelleted and washed once in PBS. Extracellular Cas9 was removed by incubation with Proteinase K (100 pg/mL in PBS, pH 7.2) for 20 minutes at room
  • FACS data were acquired on an LSRFortessa flow cytometer (Becton Dickinson) using BD FACSDiva and analyzed using FlowJo software.
  • the pool of gRNAs consisted of 12,996 elements targeting 2585 genes at 5 gRNAs per gene with 73 controls. 10 gRNAs each for CD4, CD45 and CXCR4 were spiked in at a plasmid concentration equal to 1 /13,000 th of the total pool.
  • CD4+ T cells were thawed, washed and resuspended in complete culture media (RPMI-1640 supplemented with 10% FBS, 5mM HEPES, 1 % PSG,
  • nt_A RNP was formed by heating 45mI_ nt_A crRNA with 45mI_ tracrRNA at 95 S C for 5 min, cooling to RT, then adding 300pg of Cas9 for a total volume of 140mI_. The remaining cells were electroporated with this nt_A RNP using the P3 Primary Cell 4D-Nucleofector X Kit L (Lonza V4XP-3024), program code CM-137 at a density of 5x106 cells/1 10 mI_ electroporation volume (65 mI_ cells
  • Genomic DNA was isolated using the Quick-gDNA miniprep kit (Zymo Research D3025) following the manufacturer’s protocol. Sequencing libraries were generated by PCR-amplifying the lentiviral vector backbone sequence from genomic DNA. For pre- nucleofection and (live RFP+CD4+CD45+CXCR4+) populations, a total of 13 x 2 pg PCR reactions were performed. For low yield negative populations the entire eluate was added to a single PCR reaction.
  • PCR was performed in a volume of 50mI_ containing 1 x Q5 Reaction buffer, 200 mM dNTPs, 0.5 mM forward primer, 0.5 mM reverse primer, 2pg or total gDNA and 0.02 U/pL Q5 polymerase (NEB).
  • the following cycling parameters were used: 1 x 95 °C for 5 min; 30x 95 °C for 15s, 60 °C for 15s, 72°C for 30s; 1 x 72 ⁇ for 5 min.
  • PCR products were purified using DNA Clean & Concentrator-5 columns (Zymo Research D4013) following the manufacturer’s recommendations, normalized, pooled and sequenced with a MiSeq (lllumina).
  • sgRNA libraries were sequenced 1 x50base reads. Sequencing was performed following the manufacturer’s recommendations using custom sequencing primers. Raw sequencing reads were aligned to the appropriate library using BWA (Doench JG, Hartenian E, Graham DB, Tothova Z, Hegde M, Smith I, et al. Rational design of highly active sgRNAs for CRISPR-Cas9-mediated gene inactivation. Nat Biotech.
  • 3.9 x10 6 cells were pelleted, washed with PBS, resuspended in complete culture media and transduced with the lentiviral pool equaling -300 cells/gRNA.
  • the transduced cells ( ⁇ 15x10 6 ) were electroporated with non-targeting nt_A RNP using the P3 Primary Cell 4D-Nucleofector X Kit S (Lonza V4XP-3032), program code CM-137 at a density of 1 x10 6 cells/25 pL electroporation volume (20 mI_ cells resuspended in
  • the cells were seeded in complete culture media and cultured for 10-1 1 days, expanding the culture as needed to keep the cell density ⁇ 1 x10 6 cells/mL.
  • Genomic DNA was isolated using the DNeasy Blood and Tissue Kit (Qiagen 69504) following the manufacturer’s protocol. Sequencing libraries were generated by PCR-amplifying the lentiviral vector backbone sequence from genomic DNA. For each sample (RFP+ CD34+ and RFP+ CD34-), a total of 15 x 2 pg PCR reactions were performed. PCR reactions were performed in a volume of 50mI_ containing 1 x Q5 Reaction buffer, 200 mM dNTPs, 0.5 mM forward primer, 0.5 mM reverse primer, 2 pg gDNA and 0.02 U/pL Q5 polymerase (NEB).
  • the following cycling parameters were used: 1 x 95 °C for 1 min; 28x 95 °C for 15s, 65 °C for 15s, 72°C for 30s; 1 x 72 °C for 5 min.
  • the PCR products were purified and sequenced as above with a HiSeq 1000 (lllumina).
  • RSA analysis (Konig R, et al., Nature Methods. 2007;4:847) was run as described in Li W, et al., Genome biology. 2014;15(12):554. Briefly, read counts within samples were mean normalized, and used to calculate guide scores as (normalized read count in Day 6 sample)/(normalized read count in Day 0). Scores were calculated separately for each replicate, then averaged before being used as the input for the most recent version of RSA (v1 .8) using default parameters. For the enrichment experiments the following parameters were used: -r (reverse picking), -u 1 .0e8 (upper bound of fold enrichment) , -1 (the lower bound of fold enrichment).
  • Gene Ontology analysis was performed using Metascape (Tripathi S, et al., Cell host & microbe. 2015;18(6) :723-35) (www.metascape.org).
  • Mobilized peripheral blood CD34+ HSPC were transduced 48 hours post thaw with lentiviral guide vectors. 48 hours post-transduction, the cells (5x1 0 4 -1 x1 0 6 /reaction) were washed once with PBS and resuspended in 20mI_ of supplemented P3 Primary Cell 4D- Nucleofector Solution (Lonza). Per reaction, 6pg of Cas9 was mixed with ssDNA and incubated at room temperature for 5 minutes. The Cas9/ssDNA mixture was then added to the 20mI_ of cells for a final concentration of 4mM ssDNA.
  • the cell/Cas9/ssDNA mixture was transferred into Nucleocuvettes and electroporated using the P3 Primary Cell 4D-Nucleofector X Kit S (Lonza V4XP-3032), program code CM-137.
  • CT26 cells were transduced by incubating 1 X 1 0 4 cells in 100 pL media with 1 2.5 pL concentrated lentivirus for 48 hours. Post-infection, stably transduced cells were selected by incubation with puromycin 1 8 pg/mL for 48 hours. Delivery of Cas9/ssDNA was as above, except CT26 cells were resuspended in SE Cell line solution and electroporated using program code DS-1 20. Two ssDNA sequences were used with Cas9: ssDNA (GFP) :
  • PCR amplicons were purified using 1 8x Agencourt AmpureXP beads
  • Tagmented amplicons were then PCR amplified in a final volume of 50 mI using a final concentration of 0.2 mM dNTP (Life Technologies), 0.2 mM lllumina index PCR primers (Integrated DNA Technologies), 1 x Phusion DNA polymerase buffer (New England Biolabs) and 1 U of Phusion DNA polymerase (New England Biolabs).
  • PCR cycling conditions used were as follows: 72 S C for 3 min, 98 S C for 2 min and 15 cycles of 98 S C for 10 sec, 63 S C for 30 sec, and 72 S C for 3 min. Sequencing libraries were then purified using 1 0x Agencourt AmpureXP beads (Beckman Coulter) following the manufacture’s recommendations. Sequencing libraries were quantified using the Quant-iT PicoGreen dsDNA assay (Life Technologies), 0.2 mM lllumina index PCR primers (Integrated DNA Technologies), 1 x Phusion DNA polymerase buffer (New England Biolabs) and 1 U of Phusion DNA polymerase
  • Sequencing libraries were sequenced with 150 base paired-end reads on a MiSeq sequencer following the manufacture’s recommendations (lllumina). A minimum of a 1000-fold sequencing coverage was generated per amplicon.
  • Variants in the edited samples were further filtered to exclude variants identified in the untreated controls, variants with a VarDict strand bias of 2:1 , variants located outside a 10Obp window around the Cas9 cut site, and single nucleotide variants within a 100bp window around the Cas9 cut site.
  • templates for in vitro transcription (IVT) of single gRNAs were generated by appending the minimal T7 promoter sequence upstream of sgRNAs by PCR amplification from lentiviral plasmids using the following primers:
  • PCR primers [00239] This reaction generates the following product: 5’ - G AATT AAT ACG ACT CACT AT AG(N20)GTTT AAG AGCT ATGCTGG AAACAGCAT AGCAAGTTT AAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCT - 3’ (SEQ ID NO: 60). IVT reactions were run for 16 hours at 37°C using 200 ng of purified PCR product and MEGAshortscriptTM T7 Transcription Kits (Ambion). IVT sgRNA was purified using
  • Target DNA for cleavage assays were generated by PCR amplification from CT26 gDNA using Smg8 3.1 and Mtap 1 .1 primer sets.
  • RNP formation was performed as described above but scaled to 300 ng Cas9, 5.625 pmol tracrRNA, and 1 1 .25 pmol crRNA in 2 pL total volume.
  • Cleavage reactions were run in cleavage buffer (20 mM HEPES, 100 mM NaCI, 5 mM MgCI2, 0.1 mM EDTA) containing 100 ng of target DNA with or without IVT sgRNA. Reactions were incubated for 1 hour at 37°C, then 4 pL of 1 mg/mL RNase A was added to each reaction and incubated an additional 15 minutes at 37 °C. Reactions were stopped by adding SDS to a final concentration of 0.1 %. Samples were resolved on 2% TAE- agarose gels and imaged on a ChemiDocTM MP (Bio-Rad).
  • Blots were developed after incubation with Amersham ECL Donkey Anti-Rabbit IgG HRP-linked whole Ab (GE Healthcare Life Sciences) diluted in 5% milk in TBS-T using Luminata Forte Western HRP Substrate (EMD Millipore). Blots were imaged using ChemiDocTM MP (Bio-Rad).
  • EXAMPLE 2 A foundation for CRISPR screening in human primary cells
  • Plasmid-encoded gRNA is a key feature of a cost-effective genome-wide screening platform, and this constraint formed the foundation of our approach.
  • Guide RNA libraries encoded in plasmids and packaged into lentivirus (herein referred to as lenti vector- encoded gRNA) can be amplified as needed, and due to their genomic integration also enable pooled screening formats. While transduction of HSPC with gRNA-encoding lentiviral vectors was successful, we were unable to achieve efficient and homogeneous transduction with Cas9- encoding vectors, presumably because the larger insert size reduces viral packaging efficiency (Kumar, M., et al., Hum Gene Ther 12, 1893-1905 (2001 )).
  • lentiviral vectors encoding only the gRNA into HSPC (Fig. 1 A), constraining the multiplicity of infection to minimize multiple integrations that would contribute to noise in a pooled screening context (Fig. 1 B).
  • HSPC were transduced with lentiviral vectors encoding gRNA targeting the cell surface protein CD45 and incubated for 48 hours to allow gRNA expression.
  • the cells were electroporated in the presence of Cas9 pre-complexed with non-targeting gRNA, or Cas9 alone for comparison.
  • CD45 knockout was assessed by flow cytometry 4 days later (FIG. 1 A).
  • the targeting sequence of the pre-complexed gRNA did not appear to influence the knockout efficiency of the lenti vector-encoded gRNA target (Fig.
  • Cas9 was pre-complexed to a gRNA targeting Smg8, in various ratios, then a second gRNA targeting Mtap was added. Functional Cas9-gRNA RNP activity was assessed with an in vitro cleavage assay. At our standard molar ratio of 3:1 gRNA:Cas9 used for pre-complexing, there was complete cleavage of Smg8 target and no detectable cleavage of Mtap target (Fig. 5D). Even in the presence of an 81 -fold molar excess of Mtap gRNA we could not detect functional Cas9-Mtap gRNA complexes (Fig. 5E).
  • EXAMPLE 4 Guide Swap enables pooled depletion and enrichment screens in T cells
  • Fig. 7A To validate the performance of Guide Swap in pooled screening, we conducted a screen in human primary CD4+ T cells and assessed both depletion and enrichment phenotypes (Fig. 7A). Briefly, we transduced activated T cells with a pool of -13,000 gRNAs representing 2,585 genes at approximately 5 gRNAs/gene. In addition to internal library gRNAs targeting CD4, CD45 and CXCR4, we also spiked-in 10 additional gRNAs for each of these genes. After incubating for two days to allow expression of the lenti vector-encoded gRNAs, we removed a fraction of the cells as a Day 0 sample, and electroporated the remaining cells with non-targeting RNP to deliver Cas9.
  • EXAMPLE 5 Guide Swap screen to elucidate regulators of hematopoiesis
  • Guide Swap was shown to be applicable to multiple donors and HSPC sources.
  • Guide Swap enabled efficient CD33 and CD45 knockout in HSPC isolated from two different mobilized peripheral blood donors and one cord blood donor (Fig. 9A).
  • efficient knockout of a lenti vector- encoded gRNA target was also obtained in CD34+CD90+ cells (Fig. 9B, top), a population further enriched in bona fide hematopoietic stem cells (Majeti R, et al., Cell stem cell.
  • HSPC marker CD34 Modulators of ex vivo hematopoiesis were identified using the HSPC marker CD34.
  • CD34+ HSPC spontaneously differentiate into cells lacking CD34 in culture, thus enrichment of a given gRNA in the remaining HSPC suggests that the target gene knockout promotes self-renewal.
  • Guide RNA libraries were introduced to cord blood-derived CD34+ HSPC by lentiviral transduction. Two days post-transduction, Cas9 was delivered via non targeting RNP electroporation, and the cells were returned to culture. Ten and eleven days post electroporation, cells were separated into HSPC (CD34+) and differentiated (CD34-) populations by fluorescence-activated cell sorting. We isolated genomic DNA and compared encoded gRNA abundance by NGS.
  • electroporation While efficient transduction with lentiviral vector containing the gRNA pool was achievable for human primary HSPC and T cells, some cell types with low transduction efficiency may need higher cell input for library coverage.
  • electroporation step we provide optimized electroporation conditions for human primary HSPC, T cells and CT26 using a commonly used electroporator. While not all cell types will maintain viability under these conditions, many manufacturers provide cell-type specific optimized protocols and kits to further maximize viability and editing. While all factors must be carefully weighed, we find that these challenges are common to currently available pooled (transduction) and arrayed

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention provides novel compositions and methods related to conducting pooled CRISPR/Cas9 screening in primary cells using Guide Swap technology. Some embodiments disclosed herein provide methods of inducing one or more genetic modifications in a cell, e.g., in a primary cell, said method comprising: a) introducing into said cell a ribonuclear protein complex (RNP) comprising a Cas9 molecule and a precomplexed RNA; and b) introducing into said cell one or more nucleic acid sequences encoding one or more encoded gRNA molecules, each of said one or more encoded gRNA molecules comprising a targeting domain.

Description

POOLED CRISPR/CAS9 SCREENING IN PRIMARY CELLS USING GUIDE SWAP TECHNOLOGY
CROSS-REFERENCE TO RELATED APPLICATIONS
[001 ] This application claims the benefit of U.S. Provisional Application No. 62/591 ,648 filed November 28, 2017, the content of which is hereby incorporated by reference in its entirety.
SEQUENCE LISTING
[002] The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on November 24, 2018, is named PAT057992-WO-PCT_SeqListing.txt and is 40,778 bytes in size.
BACKGROUND
[003] Although widely applied across biological disciplines (Arroyo JD, et al., Cell metabolism. 2016;24(6):875-85; Chen S, et al., Cell. 2015;160(6) :1246-60; DeJesus R, et al., eLife. 2016;5:e17290; Kurata M, et al., Scientific reports. 2016;6:36199 ; Ma H, et al., Cell Rep. 2015;12(4):673-83; Park RJ, et al., Nature genetics. 2017;49(2):193-203; Parnas O, et al., Cell. 2015;162(3):675-86; Ruiz S, et al., Molecular cell. 2016;62(2):307-13; Schmid-Burgk JL, et al., The Journal of biological chemistry. 2016;291 (1 ):103-9; Shalem O, et al., Science (New York, NY). 2014;343(6166) :84-7 ; Sidik SM, et al., Cell. 2016;166(6):1423-35 e12; Song CQ, et al., Gastroenterology. 2017;152(5) :1 161 -73 e1 ; Tzelepis K, et al., Cell Rep. 2016;17(4) :1 193-205; Virreira Winter S, et al., Scientific reports. 2016;6:24242; Zhang R, et al., Nature.
2016;535(7610):164-8; Wang T, et al., Science. 2014;343(6166):80-4), genome-scale knockout screening is limited to cell lines and Cas9 knock-in mice that can be engineered to express Cas9. While these are valuable systems that allow for controlled experimentation to understand cellular and biological processes, they do not entirely recapitulate human biology (Breschi, A., et al., Nature Reviews Genetics 18, 425 (2017)). Human primary cells more closely mimic the physiological state in vivo - retaining normal markers, functions, heterogeneity and finite lifespan. However, often, their limited proliferative capacity, propensity to differentiate in culture or poor transfection and transduction efficiency precludes the engineering of stable, clonal Cas9-expressing cells.
[004] Current approaches for CRISPR-Cas9 editing in human primary cells often utilize in vitro transcribed (IVT) or synthetic guide RNA (gRNA) coupled with Cas9 protein or mRNA, which is delivered by electroporation (Gundry MC, et al., Cell reports. 2016;17(5) :1453-61 ; Hendel A, et al., Nat Biotech. 2015;33(9):985-9; Schumann, K. et al., Proceedings of the National Academy of Sciences of the United States of America 1 12, 10437-10442 (2015)).
While these approaches are effective on a limited scale, the requirement for an arrayed format makes large scale screening expensive and in-accessible for most potential users. The development of an easily adaptable and cost-efficient method for genome-scale screening in human primary cells would broaden the range of available biological systems for novel discovery. We focused our work on human primary CD4+ T cells and CD34+ HSPC. Despite the pioneering role of these cell types in the therapeutic application of cell and gene therapies to cure disease, their function cannot be adequately modeled in a cell line or translated from a mouse (Sykes, S.M. & Scadden, D.T., Seminars in hematology 50,
10.1053/j.seminhematol.2013.1003.1029 (2013); Chen, D.S. & Davis, M.M., Springer Seminars in Immunopathology 27, 1 19-127 (2005)).
SUMMARY OF THE INVENTION
[005] Some embodiments disclosed herein provide methods of inducing one or more genetic modifications in a cell, e.g., in a primary cell, said method comprising: a) introducing into said cell a ribonuclear protein complex (RNP) comprising a Cas9 molecule and a precomplexed RNA; and b) introducing into said cell one or more nucleic acid sequences encoding one or more encoded gRNA molecules, each of said one or more encoded gRNA molecules comprising a targeting domain.
[006] In some embodiments, a genetic modification (e.g., an indel) is introduced at or near an encoded target sequence of said one or more encoded gRNA molecules. In some embodiments, the precomplexed RNA comprises a gRNA molecule comprising a targeting domain. In some embodiments, the precomplexed gRNA molecule is a dual guide RNA
(dgRNA) molecule. In some embodiments, the precomplexed gRNA molecule is a single guide RNA (sgRNA) molecule. In some embodiments, the targeting domain of the precomplexed gRNA molecule specifically binds to a target sequence in the genome of the cell to which it is introduced. In some embodiments, the targeting domain of the precomplexed gRNA molecule does not specifically bind to a target sequence in the genome of the cell to which it is introduced. In some embodiments, the target sequence is located in a target gene. In some embodiments, the target gene is selected from the group consisting of beta-2-macroglobulin (B2M), CD33, CD45, PD-1 . In some embodiments, the targeting domain of each of the one or more encoded gRNA molecules specifically binds to a target sequence of an encoded target gene. In some embodiments, each of the one or more encoded RNA molecules is encoded by a vector. In some embodiments, the vector is selected from the group consisting of a viral vector (e.g., a lentiviral vector, a retroviral vector, etc.), a plasmid, a minicircle, and a nanoplasmid. In some embodiments, each of the one or more encoded gRNA molecules is a member of a library of encoded gRNA molecules. In some embodiments, the library of encoded gRNA molecules is a human or mouse genome-wide dgRNA or sgRNA library, preferably an sgRNA library. In some embodiments, the Cas9 molecule is a Cas9 protein from Streptococcus pyogenes, Streptococcus Aureus, or Streptococcus thermophilus. In some embodiments, the cell is a primary cell. In some embodiments, the cell is a human primary cell or a mouse primary cell. In some embodiments, the primary cell is a hematopoietic stem cell (HSC), a cancer cell, a lymphocyte, a macrophage, a dendritic cell, an adipocyte, a neuron, or a combination thereof. In some embodiments, the target gene is modified at an efficiency of at least 70%. In some embodiments, one or more of the encoded target gene is modified at an efficiency of at least 50%. In some embodiments, the methods further comprise introducing into said cell a ssDNA. In some embodiments, the ssDNA is introduced with the RNP.
[007] Some embodiments disclosed herein provide methods of screening one or more encoded gRNA molecules in a population of cells, e.g., a population of primary cells, comprising: a) introducing into said population of cells a ribonuclear protein complex (RNP) comprising a Cas9 molecule and a precomplexed RNA or an apo-Cas9 molecule with a ssDNA; b) introducing into said population of cells a library of nucleic acid sequences encoding one or more encoded gRNA molecules, each of said one or more encoded gRNA molecules comprising a targeting domain; c) assaying a cell of the population of cells for a property; and d) identifying the encoded gRNA molecule introduced into said cell.
[008] In some embodiments, a genetic modification (e.g., an indel) is introduced at or near an encoded target sequence of said one or more encoded gRNA molecules. In some embodiments, the property is selected from the group consisting of cell survival, cell death, cell growth, cell differentiation, cell activation, gene expression (single gene expression or multiple gene expression), a phenotypic change, and any combination thereof. In some embodiments, the identifying comprises genetic analysis of the cell having the property. In some embodiments, the genetic analysis comprises sequencing, hybridization, PCR, or a combination thereof. In some embodiments, the identifying comprises comparing the level of the encoded gRNA molecule to a reference level. In some embodiments, the encoded gRNA molecule is identified if the difference in the level of the encoded gRNA molecule compared to the reference level has a Z-score of less than -3 or greater than 3. In some embodiments, the identifying comprises calculating an enrichment score of the encoded gRNA molecule. In some embodiments, the encoded gRNA molecule is identified if the enrichment score of the encoded gRNA molecule is greater than 2 or less than 0.5. In some embodiments, the population of cells expresses a reporter gene product. In some embodiments, the assaying a cell of the population of cells for a property comprises comparing the level of the reporter gene product in the cell to a reference level. In some embodiments, the cell is identified as having the property if the difference in the level of the reporter gene product of the cell compared to the reference level has a Z-score of less than -3 or greater than 3. In some embodiments, the precomplexed RNA is a gRNA molecule comprising a targeting domain. In some embodiments, the precomplexed gRNA molecule is a dual guide RNA (dgRNA) molecule. In some embodiments, the precomplexed gRNA molecule is a single guide RNA (sgRNA) molecule. In some embodiments, the targeting domain of the precomplexed gRNA molecule specifically binds to a target sequence in the genome of the cell to which it is introduced. In some embodiments, the targeting domain of the precomplexed gRNA molecule does not specifically bind to a target sequence in the genome of the cell to which it is introduced. In some embodiments, the target sequence is located in a target gene. In some embodiments, the target gene is selected from the group consisting of beta-2-macroglobulin (B2M), CD33, CD45, PD-1 . In some embodiments, the targeting domain of each of the one or more encoded gRNA molecules specifically binds to a target sequence of an encoded target gene. In some embodiments, each nucleic acid sequence encoding one or more encoded gRNA molecules comprises a vector. In some embodiments, the vector is a lentiviral vector. In some embodiments, the library of encoded gRNA molecules is a human or mouse genome-wide dgRNA or sgRNA library, preferably an sgRNA library. In some embodiments, the Cas9 molecule is a Cas9 protein from Streptococcus pyogenes,
Streptococcus Aureus, or Streptococcus thermophilus. In some embodiments, the population of cells is a population of primary cells. In some embodiments, the population of primary cells is a population of human primary cells or a population of mouse primary cells. In some
embodiments, the population of primary cells comprises a hematopoietic stem cell (HSC), a cancer cell, a lymphocyte, a macrophage, a dendritic cell, an adipocyte, a neuron, or a combination thereof. In some embodiments, one or more of the target gene is modified at an efficiency of at least 70%. In some embodiments, the encoded target gene is modified at an efficiency of at least 50%. In some embodiments, the methods further comprise introducing into said population of cells a ssDNA. BRIEF DESCRIPTION OF THE DRAWINGS
[009] FIGs. 1A-1 F show efficient gene disruption and protein knockout by RNP- mediated delivery of Cas9 to lenti-gRNA transduced cells. FIG. 1 A shows a schematic of experiment comparing editing at lenti gRNA-directed target location using different methods of Cas9 delivery. FIG. 1 B shows representative plots of FACS gating strategy. Live cells were gated by DAPI exclusion. Doublets were discriminated using FSC-W vs. FSC-H, followed by SSC-W vs. SSC-H. Representative RFP gating is shown. FIG. 1 C shows NGS analysis of CD45 editing efficiency in HSPC 5 days post-electroporation; n=2 two technical replicates and two sequencing replicates. The samples are from the same experiment as in Fig. 2A. FIG. 1 D shows representative histogram of CD33 expression (top) and CD45 expression (bottom) 4 days after nt_A RNP electroporation of HSPC transduced with the indicated lenti gRNA. Gated on RFP+ cells. The experiment was repeated in three independent donors with similar results. FIG. 1 E shows representative FACS plots of CD45 expression in human primary CD3+ T cells 4 days post-electroporation. The experiment was performed with two technical replicates and repeated once with independent gRNAs with similar results. FIG. 1 F shows Western blot analysis of MTAP knockout in CT26; representative of four independent experiments.
[0010] FIGs. 2A-2E show that RNP-mediated Cas9 delivery enables efficient editing with lentivirus-encoded gRNA. FIGs. 2A-2B show cytometry-based assessment of CD45 depletion in (A) HSPC or (B) T cells (see Fig. 1 for experimental details). Lenti gRNA expressing cells were gated using RFP. nt: non-targeting. n=2 technical replicates. FIG. 2C shows TIDE analysis of editing efficiency in CT26 48 hours post-electroporation nt: non-targeting. n=2 technical replicates. FIG. 2D shows time course TIDE analysis of CD45 editing efficiency in HSPC transduced with lentivirus encoding the indicated gRNA. Indicated times are hours post electroporation with nt_A RNP. Lines are plotted through mean of two technical replicates. The experiment was repeated independently with different gRNAs and yielded similar results. FIG. 2E shows comparison of Guide Swap versus standard RNP (grey) in HSPC. CD45 (left) or CD33 (right) knockout efficiency was assessed by flow cytometry. The letters on the x-axis denote the identity of the CD45 or CD33 gRNA. Lenti gRNA-expressing cells were gated using RFP. nt: non-targeting. n=2 technical replicates.
[001 1 ] FIGs. 3A-3B show that RNP-mediated Cas9 delivery outperforms Cas9 alone in enabling efficient editing with lenti gRNA in CD34+ HSPC and CD4+ T cells. FIG. 3A shows flow cytometry analysis of CD45 knockout efficiency 4 days post-electroporation. Transduced CD34+ HSPC were electroporated with indicated amounts of Cas9, or non-targeting RNP (6 pg Cas9 pre-complexed with 6 pg non-targeting synthetic split gRNA). Lenti gRNA-expressing cells were gated using RFP. The four lenti gRNAs were assayed and analyzed separately in four independent experiments, but have been graphed on the same Y-axis for readability. The 6 pg Cas9 and RNP data points are the same as those in Fig. 2A. n=2 technical replicates. FIG. 3B shows flow cytometry analysis of CD45 (left) and CXCR4 (right) knockout. Experiment was similar to (A) except performed in T cells. The 6 pg Cas9 and RNP data points are the same as those in Fig. 1 b. n=2 technical replicates.
[0012] FIGs. 4A-4C show efficient CD45 knockout using lenti gRNA and RNPs of varied gRNA targets and formats. FIGs. 4A-4C are representative of multiple lenti gRNAs tested in two independent experiments with similar results. FIG. 4A shows flow cytometry analysis of CD45 knockout efficiency 4 days post-electroporation of transduced CD34+ HSPC with indicated RNPs. Lentiviral gRNA expressing cells were gated using RFP. n=2 technical replicates. FIG. 4B shows flow cytometry analysis of CD45 knockout efficiency 4 days post electroporation of transduced CD34+ HSPC with indicated RNPs (dg = synthetic split gRNA; sg = synthetic single gRNA). Lenti gRNA expressing cells were gated using the RFP marker. n=2 technical replicates. FIG. 4C shows representative FACS plots of CD33 and CD45 expression 4 days post-electroporation with indicated RNPs. Lenti gRNA-expressing cells were gated using the RFP marker.
[0013] FIGs. 5A-5E show that gRNA-binding enhances Cas9 delivery by
electroporation. FIG. 5A shows representative histograms of Cas9 FACS staining. protK = proteinase K. perm = permeabilization. Representative of two independent experiments with similar results. In FIGs. 5B-5C CD34+ HSPC were transduced with lenti gRNA CD45_B, then electroporated with 6 pg of Cas9 and 6 pg of RNA as indicated cr = crRNA. tr = tracrRNA. scram = scrambled sequence RNA. sg = single synthetic guide. The experiment was repeated once with similar results. FIG. 5B shows fold change in MFI (median fluorescence intensity) of intracellular Cas9 FACS staining, compared to appropriate non-permeabilized control for each condition. n=3 technical replicates, data are presented as mean. FIG. 5C shows flow cytometry analysis of CD45 knockout efficiency 4 days post-electroporation. Lenti gRNA-expressing cells were gated using RFP. n=3 technical replicates, data are presented as mean. FIGs. 5D-5E show agarose gel electrophoresis analysis of indicated dsDNA templates cleaved by indicated Cas9-gRNA RNP complexes. Mtap = Mtap_A. * = uncleaved DNA template. < = excess undigested RNA. dg = split gRNA. IVT = in vitro transcribed gRNA; representative of two independent experiments.
[0014] FIGs. 6A-6C show that Guide Swap is amenable to genome-scale screening. In FIG. 6A CD34+ HSPC were transduced with the indicated lenti gRNAs, then electroporated with indicated amounts of RNP where X pg RNP = X pg Cas9 + X pg nt_A gRNA (1 :1
crRNA:tracrRNA). CD45 expression was assessed by flow cytometry. Lenti gRNA-expressing cells were gated using RFP. n=2 technical replicates. FIG. 6B: same as above except in T cells. CD45 (left) and CXCR4 (right) expression were assessed by flow cytometry. FIG. 6C shows the indicated numbers of transduced HSPC were pelleted and resuspended in 20 pL for electroporation. CD45 knockout was assessed by flow cytometry 4 days post-electroporation. Representative of multiple gRNAs tested in two independent experiments with similar results.
[0015] FIGs. 7A-7D show that Guide Swap enables pooled enrichment and depletion screens in human primary CD4+ T cells. FIG. 7A shows the design of genetic screen. FIG. 7B shows RSA analysis for guides depleted in Day 6 RFP+CD4+CD45+CXCR4+ versus Day 0 samples plotted against maximal fold change. Top scoring genes are highlighted. FIG. 7C shows Gene Ontology enrichment analysis of the top ranked 100 hits in Day 6
RFP+CD4+CD45+CXCR4+ versus Day 0. Statistical significance of each gene function category was calculated using a standard accumulative hypergeometric test. FIG. 7D shows Day 6 RFP+CXCR4- versus Day 0 comparison of log2 fold changes in replicates for gRNAs that regulate CXCR4 surface expression. CXCR4 spike-in gRNAs are colored in blue. CXCR4 gRNAs present in the library are colored in magenta.
[0016] FIGs. 8A-8F show data of pooled Guide Swap screens in human primary CD4+
T cells. FIG. 8A shows cumulative distribution of the Log2 normalized reads per million per gRNA at Day 0 (magenta) and Day 6 RFP+CD4+CD45+CXCR4+ (blue) for one replicate. FIGs. 8B-8C show comparison of normalized reads per million in (B) Day 0 replicates and (C) Day 6 RFP+CD4+CD45+CXCR4+ replicates r = Pearson correlation coefficient calculated from two technical replicates. FIG. 8D shows Day 6 RFP+CD4- versus Day 0 comparison of log2 fold changes in replicates for gRNAs that regulate CD4 surface expression. CD4 spike-in gRNAs are colored in blue. CD4 gRNAs present in the library are colored in magenta. FIG. 8E shows Day 6 RFP+CD45- versus Day 0 comparison of log2 fold changes in replicates for gRNAs that regulate CD45 surface expression. CD45 spike-in gRNAs are colored in blue. CD45 gRNAs present in the library are colored in magenta. Two gRNAs that were spiked in were also present in the library, and these are colored in purple. FIG. 8F shows Venn diagram of gene hits from RSA and 2nd best gRNA analyses of Day 6 RFP+CD4+CD45+CXCR4+ versus Day 0 samples.
[0017] FIGs 9A-9D show that Guide Swap is amenable to genome-scale screening in CD34+ HSPC. FIG. 9A shows CD33 (left) and CD45 (right) knockout efficiency in CD34+ HSPC from indicated donors. Gated on RFP+ cells; two technical replicates in one experiment. mPB = mobilized peripheral blood. CB = cord blood. FIG. 9B shows representative FACS plots of CD45 knockout in cord blood CD34+CD90+ cells (top). Gating strategy for CD34+CD90- and
CD34+CD90+ populations (bottom left). CD45 knockout efficiency in CB CD34+CD90- and CD34+CD90+ cells (bottom right). n=2 technical replicates; representative of multiple gRNAs tested in two independent experiments with similar results. FIG. 9C shows CD34+ HSPC recovery 20 hours post-electroporation, normalized to starting cell number. n=8 technical replicates, data is presented as the mean. FIG. 9D shows representative FACS plots of CD45RA and CD34 expression 7 and 14 days post-electroporation; two technical replicates in one experiment.
[0018] FIGs. 10A-10D show that genome-scale Guide Swap screen in human primary CD34+ HSPC reveals genes whose loss regulates ex vivo hematopoiesis. FIG. 10A shows representative FACS plots of CD45RA and CD34 expression 10 days post-electroporation or post-addition of 750 nM SR1 . The experiment was performed with two technical replicates, and repeated twice independently with similar results. FIG. 10B shows guide RNAs ranked by normalized score. FIG. 10C shows representative FACS plots of CD45RA and CD34 expression 10 and 20 days post-electroporation (dpe) with indicated RNPs. The experiment was performed with two technical replicates, and twice independently with similar results. FIG. 10D shows flow cytometry analysis of CD34 expression 10 dpe with indicated RNPs. nt = nt_A. n=2 technical replicates. Patterned bars indicate screening hits. Solid bars indicate additional build-out gRNAs.
[0019] FIGs 11A-11C show additional validated hits from HSPC screen. FIG. 11 A shows cumulative distribution of the Log2 normalized reads per million per gRNA in the CD34- (blue) and CD34+ (magenta) populations. FIG. 11 B shows representative FACS plots of CD45RA and CD34 expression 10 days post-electroporation with indicated RNPs; two technical replicates in one experiment. FIG. 11 C shows representative FACS plots of fluorescence in the APC channel and CD34 expression 10 days post electroporation with indicated RNPs; two technical replicates in one experiment. [0020] FIGs 12 shows surface phenotype of selected HSPC hits. FACS plots of CD90, CD34, CD45RA, CD41 a and CD71 expression 10 and 20 days post-electroporation with indicated RNPs; representative of two technical replicates; two independent experiments.
DEFINITIONS
[0021 ] A“gene” refers to a polynucleotide containing at least one open reading frame (ORF) that is capable of encoding a particular polypeptide or protein after being transcribed and translated. A polynucleotide sequence can be used to identify larger fragments or full-length coding sequences of the gene with which they are associated. Methods of isolating larger fragment sequences are known to those of skill in the art.
[0022] The term“isolated” refers to altered or removed from the natural state. For example, a nucleic acid or a peptide naturally present in a living animal is not“isolated,” but the same nucleic acid or peptide partially or completely separated from the coexisting materials of its natural state is“isolated.” An isolated nucleic acid or protein can exist in substantially purified form, or can exist in a non-native environment such as, for example, a host cell.
[0023] The term“nucleic acid” or“polynucleotide” refers to deoxyribonucleic acids (DNA) or ribonucleic acids (RNA) and polymers thereof in either single- or double-stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogues of natural nucleotides that have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses
conservatively modified variants thereof (e.g., degenerate codon substitutions), alleles, orthologs, SNPs, and complementary sequences as well as the sequence explicitly indicated. Specifically, degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues (Batzer et al., Nucleic Acid Res. 19:5081 (1991 ); Ohtsuka et al., J. Biol. Chem. 260:2605-2608 (1985) ; and Rossolini et al., Mol. Cell. Probes 8:91 -98 (1994)).
[0024] The terms“peptide,”“polypeptide,” and“protein” are used interchangeably, and refer to a compound comprised of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and no limitation is placed on the maximum number of amino acids that can comprise a protein’s or peptide’s sequence.
Polypeptides include any peptide or protein comprising two or more amino acids joined to each other by peptide bonds. As used herein, the term refers to both short chains, which also commonly are referred to in the art as peptides, oligopeptides and oligomers, for example, and to longer chains, which generally are referred to in the art as proteins, of which there are many types.“Polypeptides” include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives, analogs, fusion proteins, among others. A polypeptide includes a natural peptide, a recombinant peptide, or a combination thereof. A“microprotein” or “micropeptide” refers to a protein or polypeptide that is less than 100 amino acids long.
[0025] The term“homologous” or“identity” refers to the subunit sequence identity between two polymeric molecules, e.g., between two nucleic acid molecules, such as, two DNA molecules or two RNA molecules, or between two polypeptide molecules. When a subunit position in both of the two molecules is occupied by the same monomeric subunit; e.g., if a position in each of two DNA molecules is occupied by adenine, then they are homologous or identical at that position. The homology between two sequences is a direct function of the number of matching or homologous positions; e.g., if half (e.g., five positions in a polymer ten subunits in length) of the positions in two sequences are homologous, the two sequences are 50% homologous; if 90% of the positions (e.g., 9 of 10), are matched or homologous, the two sequences are 90% homologous. Percentage of “sequence identity” can be determined by comparing two optimally aligned sequences over a comparison window, where the fragment of the amino acid sequence in the comparison window may comprise additions or deletions (e.g., gaps or overhangs) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage can be calculated by determining the number of positions at which the identical amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison, and multiplying the result by 100 to yield the percentage of sequence identity. The output is the percent identity of the subject sequence with respect to the query sequence.
[0026] The term“promoter” refers to a DNA sequence recognized by the synthetic machinery of the cell, or introduced synthetic machinery, required to initiate the specific transcription of a polynucleotide sequence.
[0027] The term“promoter/regulatory sequence” refers to a nucleic acid sequence which is required for expression of a gene product operably linked to the promoter/regulatory sequence. In some instances, this sequence may be the core promoter sequence and in other instances, this sequence may also include an enhancer sequence and other regulatory elements which are required for expression of the gene product. The promoter/regulatory sequence may, for example, be one which expresses the gene product in a tissue specific manner.
[0028] The term "operably linked" is intended herein to mean that the nucleotide sequence of interest is linked to regulatory sequence(s) in a manner which allows for expression of the nucleotide sequence. The term "regulatory sequence" is intended to include, for example, promoters, enhancers and other expression control elements (e.g., polyadenylation signals). Such regulatory sequences are well known in the art and are described, for example, in Goeddel; Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990). Regulatory sequences include those which direct constitutive expression of a nucleotide sequence in many types of host cell and those which direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences). It will be appreciated by those skilled in the art that the design of the expression vector can depend on such factors as the choice of the target cell, the level of expression desired, and the like.
[0029] The term“constitutive” promoter refers to a nucleotide sequence which, when operably linked with a polynucleotide which encodes or specifies a gene product, causes the gene product to be produced in a cell under most or all physiological conditions of the cell.
[0030] The term“inducible” promoter refers to a nucleotide sequence which, when operably linked with a polynucleotide which encodes or specifies a gene product, causes the gene product to be produced in a cell substantially only when an inducer which corresponds to the promoter is present in the cell.
[0031 ] The term“tissue-specific” promoter refers to a nucleotide sequence which, when operably linked with a polynucleotide encodes or specified by a gene, causes the gene product to be produced in a cell substantially only if the cell is a cell of the tissue type corresponding to the promoter.
[0032] As used herein, the term“gene editing system” refers to a system comprising one or more DNA-binding domains or components and one or more DNA-modifying domains or components, or isolated nucleic acids, e.g., one or more vectors, encoding said DNA-binding and DNA-modifying domains or components. Gene editing systems are used for modifying the nucleic acid of a target gene and/or for modulating the expression of a target gene. In known gene editing systems, for example, the one or more DNA-binding domains or components are associated with the one or more DNA-modifying domains or components, such that the one or more DNA-binding domains target the one or more DNA-modifying domains or components to a specific nucleic acid site.
[0033] Gene editing systems are known in the art, and include but are not limited to, zinc finger nucleases, transcription activator-like effector nucleases (TALENs); clustered regularly interspaced short palindromic repeats (CRISPR)/Cas systems, and meganuclease systems.
[0034] “CRISPR” as used herein refers to a set of clustered regularly interspaced short palindromic repeats, or a system comprising such a set of repeats. “Cas,” as used herein, refers to a CRISPR-associated protein. The diverse CRISPR-Cas systems can be divided into two classes according to the configuration of their effector modules: class 1 CRISPR systems utilize several Cas proteins and the crRNA to form an effector complex, whereas class 2 CRISPR systems employ a large single-component Cas protein in conjunction with crRNAs to mediate interference. One example of class 2 CRISPR-Cas system employs Cpf 1 (CRISPR from Prevotella and Francisella 1 ). See, e.g., Zetsche et al., Cell 163:759-771 (2015), the content of which is herein incorporated by reference in its entirety. The term“Cpf 1” as used herein includes all orthologs, and variants that can be used in a CRISPR system.
[0035] Naturally-occurring CRISPR systems are found in approximately 40% of sequenced eubacteria genomes and 90% of sequenced archaea. Grissa et al. (2007) BMC Bioinformatics 8: 172. This system is a type of prokaryotic immune system that confers resistance to foreign genetic elements such as plasmids and phages and provides a form of acquired immunity. Barrangou et al. (2007) Science 315: 1709-1712; Marragini et al. (2008) Science 322: 1843-1845.
[0036] The CRISPR system has been modified for use in gene editing (silencing, enhancing or changing specific genes) in eukaryotes such as mice, primates and humans. Wiedenheft et al. (2012) Nature 482: 331 -8. This is accomplished by, for example, introducing into the eukaryotic cell one or more vectors encoding a specifically engineered guide RNA (gRNA) (e.g., a gRNA comprising sequence complementary to sequence of a eukaryotic genome, herein referred to as a targeting domain) and one or more appropriate RNA-guided nucleases, e.g., Cas proteins. The RNA guided nuclease forms a complex with the gRNA, which is then directed to the target DNA site by hybridization of the gRNA’s sequence to complementary sequence of a eukaryotic genome, where the RNA-guided nuclease then induces a double or single-strand break in the DNA. Insertion or deletion of nucleotides at or near the strand break creates the modified genome. [0037] As these naturally occur in many different types of bacteria, the exact arrangements of the CRISPR and structure, function and number of Cas genes and their product differ somewhat from species to species. Haft et al. (2005) PLoS Comput. Biol. 1 : e60; Kunin et al. (2007) Genome Biol. 8: R61 ; Mojica et al. (2005) J. Mol. Evol. 60: 174-182; Bolotin et al. (2005) Microbiol. 151 : 2551 -2561 ; Pourcel et al. (2005) Microbiol. 151 : 653-663; and Stern et al. (2010) Trends. Genet. 28: 335-340. For example, the Cse (Cas subtype, E. coli) proteins (e.g., CasA) form a functional complex, Cascade, that processes CRISPR RNA transcripts into spacer-repeat units that Cascade retains. Brouns et al. (2008) Science 321 : 960-964. In other prokaryotes, Cas6 processes the CRISPR transcript. The CRISPR-based phage inactivation in E. coli requires Cascade and Cas3, but not Cas1 or Cas2. The Cmr (Cas RAMP module) proteins in Pyrococcus furiosus and other prokaryotes form a functional complex with small CRISPR RNAs that recognizes and cleaves complementary target RNAs. A simpler CRISPR system relies on the protein Cas9, which is a nuclease with two active cutting sites, one for each strand of the double helix. Combining Cas9 and modified CRISPR locus RNA can be used in a system for gene editing. Pennisi (2013) Science 341 : 833-836.
[0038] In some embodiments, the RNA-guided nuclease is a Cas molecule, e.g., a Cas9 molecule. A“Cas9 molecule,” as used herein, refers to a molecule that can interact with a gRNA molecule (e.g., sequence of a domain of a tracr) and, in concert with the gRNA molecule, localize (e.g., target or home) to a site which comprises a target sequence and PAM sequence.
[0039] According to the present invention, Cas9 molecules of, derived from, or based on the Cas9 proteins of a variety of species can be used in the methods and compositions described herein. For example, Cas9 molecules of, derived from, or based on, e.g., S.
pyogenes, S. thermophilus, Staphylococcus aureus and/or Neisseria meningitidis Cas9 molecules, can be used in the systems, methods and compositions described herein. Additional Cas9 species include: Acidovorax avenae, Actinobacillus pleuropneumoniae, Actinobacillus succinogenes, Actinobacillus suis, Actinomyces sp., cycliphilus denitrificans, Aminomonas paucivorans, Bacillus cereus, Bacillus smithii, Bacillus thuringiensis, Bacteroides sp.,
Blastopirellula marina, Bradyrhiz' obium sp., Brevibacillus latemsporus, Campylobacter coli, Campylobacter jejuni, Campylobacter lad, Candidatus Puniceispirillum, Clostridiu cellulolyticum, Clostridium perfringens, Corynebacterium accolens, Corynebacterium diphtheria,
Corynebacterium matruchotii, Dinoroseobacter sliibae, Eubacterium dolichum, gamma proteobacterium, Gluconacetobacler diazotrophicus, Haemophilus parainfluenzae, Haemophilus sputorum, Helicobacter canadensis, Helicobacter cinaedi, Helicobacter mustelae, llyobacler polytropus, Kingella kingae, Lactobacillus crispatus, Listeria ivanovii, Listeria monocytogenes, Listeriaceae bacterium, Methylocystis sp., Methylosinus trichosporium, Mobiluncus mulieris, Neisseria bacilliformis, Neisseria cinerea, Neisseria flavescens, Neisseria lactamica. Neisseria sp., Neisseria wadsworthii, Nitrosomonas sp., Parvibaculum lavamentivorans, Pasteurella multocida, Phascolarctobacterium succinatutens, Ralstonia syzygii, Rhodopseudomonas palustris, Rhodovulum sp., Simonsiella muelleri, Sphingomonas sp., Sporolactobacillus vineae, Staphylococcus lugdunensis, Streptococcus sp., Subdoligranulum sp., Tislrella mobilis, Treponema sp., or Verminephrobacter eiseniae.
[0040] In some embodiments, the ability of an active Cas9 molecule to interact with and cleave a target nucleic acid is PAM sequence dependent. A PAM sequence is a sequence in the target nucleic acid. In an embodiment, cleavage of the target nucleic acid occurs upstream from the PAM sequence. Active Cas9 molecules from different bacterial species can recognize different sequence motifs (e.g., PAM sequences). In an embodiment, an active Cas9 molecule of S. pyogenes recognizes the sequence motif NGG and directs cleavage of a target nucleic acid sequence 1 to 10, e.g., 3 to 5, base pairs upstream from that sequence. See, e.g., Mali el al, SCIENCE 2013; 339(6121 ): 823- 826. In an embodiment, an active Cas9 molecule of S. thermophilus recognizes the sequence motif NGGNG and NNAGAAW (W = A or T) (SEQ ID NO: 61 ) and directs cleavage of a core target nucleic acid sequence 1 to 10, e.g., 3 to 5, base pairs upstream from these sequences. See, e.g., Horvath et al., SCIENCE 2010; 327(5962): 167- 170, and Deveau et al, J BACTERIOL 2008; 190(4): 1390- 1400. In an embodiment, an active Cas9 molecule of S. mutans recognizes the sequence motif NGG or NAAR (R = A or G) and directs cleavage of a core target nucleic acid sequence 1 to 10, e.g., 3 to 5 base pairs, upstream from this sequence. See, e.g., Deveau et al., J BACTERIOL 2008; 190(4): 1390- 1400.
[0041 ] In an embodiment, an active Cas9 molecule of S. aureus recognizes the sequence motif NNGRR (R = A or G) and directs cleavage of a target nucleic acid sequence 1 to 10, e.g., 3 to 5, base pairs upstream from that sequence. See, e.g., Ran F. et al., NATURE, vol. 520, 2015, pp. 186-191 . In an embodiment, an active Cas9 molecule of N. meningitidis recognizes the sequence motif NNNNGATT (SEQ ID NO: 62) and directs cleavage of a target nucleic acid sequence 1 to 10, e.g., 3 to 5, base pairs upstream from that sequence. See, e.g., Hou et al., PNAS EARLY EDITION 2013, 1 -6. The ability of a Cas9 molecule to recognize a PAM sequence can be determined, e.g., using a transformation assay described in Jinek et al , SCIENCE 2012, 337:816. [0042] Exemplary naturally occurring Cas9 molecules are described in Chylinski et al., RNA Biology 2013; 10:5, 727-737. Such Cas9 molecules include Cas9 molecules of a cluster 1 bacterial family, cluster 2 bacterial family, cluster 3 bacterial family, cluster 4 bacterial family, cluster 5 bacterial family, cluster 6 bacterial family, a cluster 7 bacterial family, a cluster 8 bacterial family, a cluster 9 bacterial family, a cluster 10 bacterial family, a cluster 1 1 bacterial family, a cluster 12 bacterial family, a cluster 13 bacterial family, a cluster 14 bacterial family, a cluster 1 bacterial family, a cluster 16 bacterial family, a cluster 17 bacterial family, a cluster 1 8 bacterial family, a cluster 19 bacterial family, a cluster 20 bacterial family, a cluster 21 bacterial family, a cluster 22 bacterial family, a cluster 23 bacterial family, a cluster 24 bacterial family, a cluster 25 bacterial family, a cluster 26 bacterial family, a cluster 27 bacterial family, a cluster 28 bacterial family, a cluster 29 bacterial family, a cluster 30 bacterial family, a cluster 31 bacterial family, a cluster 32 bacterial family, a cluster 33 bacterial family, a cluster 34 bacterial family, a cluster 35 bacterial family, a cluster 36 bacterial family, a cluster 37 bacterial family, a cluster 38 bacterial family, a cluster 39 bacterial family, a cluster 40 bacterial family, a cluster 41 bacterial family, a cluster 42 bacterial family, a cluster 43 bacterial family, a cluster 44 bacterial family, a cluster 45 bacterial family, a cluster 46 bacterial family, a cluster 47 bacterial family, a cluster 48 bacterial family, a cluster 49 bacterial family, a cluster 50 bacterial family, a cluster 5 1 bacterial family, a cluster 52 bacterial family, a cluster 53 bacterial family, a cluster 54 bacterial family, a cluster 55 bacterial family, a cluster 56 bacterial family, a cluster 57 bacterial family, a cluster 58 bacterial family, a cluster 59 bacterial family, a cluster 60 bacterial family, a cluster 61 bacterial family, a cluster 62 bacterial family, a cluster 63 bacterial family, a cluster 64 bacterial family, a cluster 65 bacterial family, a cluster 66 bacterial family, a cluster 67 bacterial family, a cluster 68 bacterial family, a cluster 69 bacterial family, a cluster 70 bacterial family, a cluster 71 bacterial family, a cluster 72 bacterial family, a cluster 73 bacterial family, a cluster 74 bacterial family, a cluster 75 bacterial family, a cluster 76 bacterial family, a cluster 77 bacterial family, or a cluster 78 bacterial family.
[0043] Exemplary naturally occurring Cas9 molecules include a Cas9 molecule of a cluster 1 bacterial family. Examples include a Cas9 molecule of: S. pyogenes (e.g., strain SF370, MGAS 10270, MGAS 10750, MGAS2096, MGAS315, MGAS5005, MGAS6180, MGAS9429, NZ131 and SSI- 1 ), S. thermophilus (e.g., strain LMD-9), S. pseudoporcinus (e.g., strain SPIN 20026), S. mutans (e.g., strain UA 159, NN2025), S. macacae (e.g., strain NCTC1 1558), S. gallolylicus (e.g., strain UCN34, ATCC BAA-2069), S. equines (e.g., strain ATCC 9812, MGCS 124), S. dysdalactiae (e.g., strain GGS 124), S. bovis (e.g., strain ATCC 700338), S. cmginosus (e.g.; strain F021 1 ), S. agalactia* (e.g., strain NEM316, A909), Listeria monocytogenes (e.g., strain F6854), Listeria innocua (L. innocua, e.g., strain Clip 11262), EtUerococcus italicus (e.g., strain DSM 15952), or Enterococcus faecium (e.g., strain 1 ,23,408). Additional exemplary Cas9 molecules are a Cas9 molecule of Neisseria meningitidis (Hou et al., PNAS Early Edition 2013, 1 -6) and a S. aureus Cas9 molecule.
[0044] In an embodiment, a Cas9 molecule, e.g., an active Cas9 molecule or inactive Cas9 molecule, comprises an amino acid sequence: having 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology with; differs at no more than 1 %, 2%, 5%, 10%, 15%, 20%, 30%, or 40% of the amino acid residues when compared with; differs by at least 1 ,
2, 5, 10 or 20 amino acids but by no more than 100, 80, 70, 60, 50, 40 or 30 amino acids from; or is identical to; any Cas9 molecule sequence described herein or a naturally occurring Cas9 molecule sequence, e.g., a Cas9 molecule from a species listed herein or described in Chylinski et al., RNA Biology 2013, 10:5, Ί2Ί-T, 1 Hou et al. PNAS Early Edition 2013, 1 -6.
[0045] In an embodiment, a Cas9 molecule comprises an amino acid sequence having 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology with; differs at no more than 1 %, 2%, 5%, 10%, 15%, 20%, 30%, or 40% of the amino acid residues when compared with; differs by at least 1 , 2, 5, 10 or 20 amino acids but by no more than 100, 80, 70, 60, 50, 40 or 30 amino acids from; or is identical to; S. pyogenes Cas9 (UniProt Q99ZW2). In embodiments, the Cas9 molecule is a S. pyogenes Cas9 variant, such as a variant described in Slaymaker et al., Science Express, available online December 1 , 2015 at Science DOI:
10.1 126/science. aad5227; Kleinstiver et al., Nature, 529, 2016, pp. 490-495, available online January 6, 2016 at doi:10.1038/nature16526; or US2016/0102324, the contents of which are incorporated herein in their entireties. In an embodiment, the Cas9 molecule is catalytically inactive, e.g., dCas9. Tsai et al. (2014), Nat. Biotech. 32:569-577; U.S. Patent No.: 8,871 ,445; 8,865,406; 8,795,965; 8,771 ,945; and 8,697,359, the contents of which are hereby incorporated by reference in their entireties. A catalytically inactive Cas9, e.g., dCas9, molecule may be fused with a transcription modulator, e.g., a transcription repressor or transcription activator.
[0046] In an embodiment, the Cas9 molecule of the invention can be any of the Cas9 variants, including chimeric Cas9 molecules, described in, e.g., US8,889,356, US8,889,418, US8,932,814, WO2016022363, US201501 18216, WO2014152432, US20140295556,
US2016153003, US9,322,037, US9,388,430, WO2015089406, US9,267,135, WO2015006294, WO2016106244, WO2016057961 , WO2016131009, CN106916852, and WO2017070632, the content of which are hereby incorporated by reference in their entireties. [0047] In some embodiments, the Cas9 molecule, e.g., a Cas9 of S. pyogenes, may additionally comprise one or more amino acid sequences that confer additional activity and/or enhanced specificity. In some aspects, the Cas9 molecule may comprise one or more nuclear localization sequences (NLSs), such as at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, or more NLSs.
Typically, an NLS consists of one or more short sequences of positively charged lysines or arginines exposed on the protein surface, but other types of NLS are known. Non-limiting examples of NLSs include an NLS sequence comprising or derived from: the NLS of the SV40 virus large T-antigen, having the amino acid sequence PKKKRKV (SEQ ID NO: 63) or a bipartite SV40 NLS having the amino acid sequence KRTADGSEFESPKKKRKVE (SEQ ID NO: 64). Other suitable NLS sequences are known in the art (e.g., Sorokin, Biochemistry (Moscow) (2007) 72:13, 1439-1457; Lange J Biol Chem. (2007) 282:8, 5101 -5). In any of the
aforementioned embodiments, the Cas9 molecule may additionally (or alternatively) comprise a tag, e.g., a His tag, e.g., a His(6) tag (SEQ ID NO: 80) or His(8) tag (SEQ ID NO: 81 ), e.g., at the N terminus or the C terminus.
[0048] Thus, engineered CRISPR gene editing systems, e.g., for gene editing in eukaryotic cells, typically involve (1 ) a guide RNA molecule (gRNA) comprising a targeting domain (which is capable of hybridizing to the genomic DNA target sequence), and sequence which is capable of binding to a Cas, e.g., Cas9 enzyme, and (2) a Cas, e.g., Cas9, protein.
This second domain may comprise a domain referred to as a tracr domain. The targeting domain and the sequence which is capable of binding to a Cas, e.g., Cas9 enzyme, may be disposed on the same (sometimes referred to as a single gRNA, chimeric gRNA or sgRNA) or different molecules (sometimes referred to as a dual gRNA or dgRNA). If disposed on different molecules, each includes a hybridization domain which allows the molecules to associate, e.g., through hybridization.
[0049] The terms“guide RNA,”“guide RNA molecule,”“gRNA molecule” or“gRNA” are used interchangeably, and refer to a set of nucleic acid molecules that promote the specific directing of a RNA-guided nuclease or other effector molecule (typically in complex with the gRNA molecule) to a target sequence. In some embodiments, said directing is accomplished through hybridization of a portion of the gRNA to DNA (e.g., through the gRNA targeting domain), and by binding of a portion of the gRNA molecule to the RNA-guided nuclease or other effector molecule (e.g., through at least the gRNA tracr). In embodiments, a gRNA molecule consists of a single contiguous polynucleotide molecule, referred to herein as a“single guide RNA” or“sgRNA” and the like. In other embodiments, a gRNA molecule consists of a plurality, usually two, polynucleotide molecules, which are themselves capable of association, usually through hybridization, referred to herein as a“dual guide RNA” or“dgRNA,” and the like. gRNA molecules are described in more detail below, but generally include a targeting domain and a tracr. In embodiments the targeting domain and tracr are disposed on a single polynucleotide.
In other embodiments, the targeting domain and tracr are disposed on separate
polynucleotides.
[0050] The term“targeting domain” as the term is used in connection with a gRNA, is the portion of the gRNA molecule that recognizes, e.g., is complementary to, a target sequence, e.g., a target sequence within the nucleic acid of a cell, e.g., within a gene.
[0051 ] The term“crRNA” as the term is used in connection with a gRNA molecule, is a portion of the gRNA molecule that comprises a targeting domain and a region that interacts with a tracr to form a flagpole region.
[0052] The term“target sequence” refers to a sequence of nucleic acids complimentary, for example fully complimentary, to a gRNA targeting domain. In embodiments, the target sequence is disposed on genomic DNA. In an embodiment the target sequence is adjacent to (either on the same strand or on the complementary strand of DNA) a protospacer adjacent motif (PAM) sequence recognized by a protein having nuclease or other effector activity, e.g., a PAM sequence recognized by Cas9. In embodiments, the target sequence is a target sequence of an allogeneic T cell target. In embodiments, the target sequence is a target sequence of an inhibitory molecule. In embodiments, the target sequence is a target sequence of a
downstream effector of an inhibitory molecule.
[0053] The term“flagpole” as used herein in connection with a gRNA molecule, refers to the portion of the gRNA where the crRNA and the tracr bind to, or hybridize to, one another.
[0054] The term“tracr” as used herein in connection with a gRNA molecule, refers to the portion of the gRNA that binds to a nuclease or other effector molecule. In embodiments, the tracr comprises nucleic acid sequence that binds specifically to Cas9. In embodiments, the tracr comprises nucleic acid sequence that forms part of the flagpole.
[0055] The term“complementary” as used in connection with nucleic acid, refers to the pairing of bases, A with T or U, and G with C. The term complementary refers to nucleic acid molecules that are completely complementary, that is, form A to T or U pairs and G to C pairs across the entire reference sequence, as well as molecules that are at least 80%, 85%, 90%, 95%, 99% complementary.
[0056] “Template Nucleic Acid” as used in connection with homology-directed repair or homologous recombination, refers to nucleic acid to be inserted at the site of modification by the CRISPR system donor sequence for gene repair (insertion) at site of cutting. In one aspect, the template nucleic acid comprises nucleic acid sequence encoding a chimeric antigen receptor (CAR), e.g., as described herein. In one aspect, the template nucleic acid comprises a vector comprising nucleic acid sequence encoding a chimeric antigen receptor (CAR), e.g., as described herein.
[0057] An“indel,” as the term is used herein, refers to a nucleic acid comprising one or more insertions of nucleotides, one or more deletions of nucleotides, or a combination of insertions and deletions of nucleotides, relative to a reference nucleic acid, that results after being exposed to a composition comprising a gRNA molecule, for example a CRISPR system. Indels can be determined by sequencing nucleic acid after being exposed to a composition comprising a gRNA molecule, for example, by NGS. With respect to the site of an indel, an indel is said to be“at or near” a reference site (e.g., a site complementary to a targeting domain of a gRNA molecule) if it comprises at least one insertion or deletion within about 10, 9 , 8, 7, 6, 5, 4, 3, 2, or 1 nucleotide(s) of the reference site, or is overlapping with part or all of said reference site (e.g., comprises at least one insertion or deletion overlapping with, or within 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotides of a site complementary to the targeting domain of a gRNA molecule, e.g., a gRNA molecule described herein).
[0058] An“indel pattern,” as the term is used herein, refers to a set of indels that results after exposure to a composition comprising a gRNA molecule. In an embodiment, the indel pattern consists of the top three indels, by frequency of appearance. In an embodiment, the indel pattern consists of the top five indels, by frequency of appearance. In an embodiment, the indel pattern consists of the indels which are present at greater than about 5% frequency relative to all sequencing reads. In an embodiment, the indel pattern consists of the indels which are present at greater than about 10% frequency relative to the total number of indel sequencing reads (i.e., those reads that do not consist of the unmodified reference nucleic acid sequence). In an embodiment, the indel pattern includes any 3 of the top five most frequently observed indels. The indel pattern may be determined, for example, by sequencing cells of a population of cells which were exposed to the gRNA molecule.
[0059] An“off-target indel,” as the term is used herein, refers to an indel at or near a site other than the target sequence of the targeting domain of the gRNA molecule. Such sites may comprise, for example, 1 , 2, 3, 4, 5 or more mismatch nucleotides relative to the sequence of the targeting domain of the gRNA. In exemplary embodiments, such sites are detected using targeted sequencing of in silico predicted off-target sites, or by an insertional method known in the art. [0060] As used herein, a“precomplexed RNA” refers to one or more RNA molecules that are bound to a Cas9 molecule. In embodiments, the precomplexed RNA is a gRNA molecule, e.g., as described herein. In embodiments, the precomplexed RNA is a dgRNA. In embodiments, the precomplexed RNA is an sgRNA. In embodiments, the precomplexed RNA is a portion of a gRNA molecule that binds to Cas9, e.g., is a tracr. In embodiments, the precomplexed RNA is a gRNA molecule comprising a targeting domain. In embodiments, the targeting domain does not have a target sequence (e.g., a fully complementary target sequence) in the genome of the cell to which it is introduced. In other embodiments, the targeting domain does have a target sequence (e.g., a fully complementary target sequence) in the genome of the cell to which it is introduced.
[0061 ] As used herein, an“encoded gRNA molecule” refers to a gRNA molecule that is introduced into a cell. In embodiments, the encoded gRNA molecule is present in a vector, e.g., as described herein, e.g., a retroviral vector or a lentiviral vector. In embodiments, the encoded gRNA molecule is a member of a library of encoded gRNA molecules, e.g., is present in a composition comprising a plurality of nucleic acid sequences encoding a plurality of gRNA molecules, e.g., is present in a composition comprising a plurality of vectors, e.g., lentiviral vectors, each of said vectors encoding one or more, e.g., one, encoded gRNA molecules. In embodiments, when introduced into a cell, e.g., a primary cell, e.g., as described herein, the encoded gRNA molecule(s) is produced (e.g., transcribed).
[0062] Additional components and/or elements of CRISPR gene editing systems known in the art, e.g., are described in U.S. Publication No.2014/0068797, WO2015/048577, and Cong (2013) Science 339: 819-823, the contents of which are hereby incorporated by reference in their entireties. Such systems can be generated which inhibit a target gene, by, for example, engineering a CRISPR gene editing system to include a gRNA molecule comprising a targeting domain that hybridizes to a sequence of the target gene. In embodiments, the gRNA comprises a targeting domain which is fully complementary to 15-25 nucleotides, e.g., 20 nucleotides, of a target gene. In embodiments, the 15-25 nucleotides, e.g., 20 nucleotides, of the target gene, are disposed immediately 5’ to a protospacer adjacent motif (PAM) sequence recognized by the RNA-guided nuclease, e.g., Cas protein, of the CRISPR gene editing system (e.g., where the system comprises a S. pyogenes Cas9 protein, the PAM sequence comprises NGG, where N can be any of A, T, G or C).
[0063] In some embodiments, the gRNA molecule and RNA-guided nuclease, e.g., Cas protein, of the CRISPR gene editing system can be complexed to form a RNP complex. Such RNP complexes may be used in the methods and apparatus described herein. In other embodiments, nucleic acid encoding one or more components of the CRISPR gene editing system may be used in the methods and apparatus described herein.
[0064] In some embodiments, foreign DNA can be introduced into the cell along with the CRISPR gene editing system, e.g., DNA encoding a desired transgene, with or without a promoter active in the target cell type. Depending on the sequences of the foreign DNA and target sequence of the genome, this process can be used to integrate the foreign DNA into the genome, at or near the site targeted by the CRISPR gene editing system. For example, 3’ and 5’ sequences flanking the transgene may be included in the foreign DNA which are homologous to the gene sequence 3’ and 5’ (respectively) of the site in the genome cut by the gene editing system. Such foreign DNA molecule can be referred to“template DNA.”
[0065] In an embodiment, the CRISPR gene editing system of the present invention comprises Cas9, e.g., S. pyogenes Cas9, and a gRNA comprising a targeting domain which hybridizes to a sequence of a gene of interest. In an embodiment, the gRNA and Cas9 are complexed to form a RNP. In an embodiment, the CRISPR gene editing system comprises nucleic acid encoding a gRNA and nucleic acid encoding a Cas protein, e.g., Cas9, e.g., S. pyogenes Cas9. In an embodiment, the CRISPR gene editing system comprises a gRNA and nucleic acid encoding a Cas protein, e.g., Cas9, e.g., S. pyogenes Cas9.
[0066] In some embodiments, inducible control over Cas9, sgRNA and p53DD expression can be utilized to optimize efficiency while reducing the frequency of off-target effects thereby increasing safety. Examples include, but are not limited to, transcriptional and post-transcriptional switches listed as follows; doxycycline inducible transcription Loew et al. (2010) BMC Biotechnol. 10:81 , Shieldl inducible protein stabilization Banaszynski et al. (2016) Cell 126: 995-1004, Tamoxifen induced protein activation Davis et al. (2015) Nat. Chem. Biol. 1 1 : 316-318, Rapamycin or optogenetic induced activation or dimerization of split Cas9 Zetsche (2015) Nature Biotechnol. 33(2): 139-142, Nihongaki et al. (2015) Nature Biotechnol. 33(7): 755- 760, Polstein and Gersbach (2015) Nat. Chem. Biol. 1 1 : 198-200, and SMASh tag drug inducible degradation Chung et al. (2015) Nat. Chem. Biol. 1 1 : 713-720.
[0067] With respect to general information on CRISPR-Cas Systems, components thereof, and delivery of such components, including methods, materials, delivery vehicles, vectors, particles, AAV, and making and using thereof, including as to amounts and
formulations, all useful in the practice of the instant invention, reference is made to: US Patents Nos. 8,697,359, 8,771 ,945, 8,795,965, 8,865,406, 8,871 ,445, 8,889,356, 8,889,418 and 8,895,308; US Patent Publications US 2014-0310830 (US APP. Ser. No. 14/105,031 ), US 2014- 0287938 Al (U.S. App. Ser. No. 14/213,991 ), US 2014-0273234 Al (U.S. App. Ser. No.
14/293,674), US2014-0273232 Al (U.S. App. Ser. No. 14/290,575), US 2014-0273231 (U.S.
App. Ser. No. 14/259,420), US 2014-0256046 Al (U.S. App. Ser. No. 14/226,274), US 2014- 0248702 Al (U.S. App. Ser. No. 14/258,458), US 2014-0242700 Al (U.S. App. Ser. No.
14/222,930), US 2014-0242699 Al (U.S. App. Ser. No. 14/183,512), US 2014-0242664 Al (U.S. App. Ser. No. 14/104,990), US 2014-0234972 Al (U.S. App. Ser. No. 14/183,471 ), US 2014- 0227787 Al (U.S. App. Ser. No. 14/256,912), US 2014-0189896 Al (U.S. App. Ser. No.
14/105,035), US 2014-0186958 (U.S. App. Ser. No. 14/105,017), US 2014-0186919 Al (U.S. App. Ser. No. 14/104,977), US 2014-0186843 Al (U.S. App. Ser. No. 14/104,900), US 2014- 0179770 Al (U.S. App. Ser. No. 14/104,837) and US 2014-0179006 Al (U.S. App. Ser. No. 14/183,486), US 2014-0170753 (US App Ser No 14/183,429); European Patent Applications EP 2 771 468 (EP13818570.7), EP 2 764 103 (EP13824232.6), and EP 2 784 162
(EP14170383.5); and PCT Patent Publications WO 2014/093661 (PCT/US2013/074743), WO 2014/093694 (PCT/US2013/074790), WO 2014/093595 (PCT/US2013/07461 1 ), WO
2014/093718 (PCT/US2013/074825), WO 2014/093709 (PCT/US2013/074812), WO
2014/093622 (PCT/US2013/074667), WO 2014/093635 (PCT/US2013/074691 ), WO
2014/093655 (PCT/US2013/074736), WO 2014/093712 (PCT/US2013/074819), WO
2014/093701 (PCT7US2013/074800), WO 2014/018423 (PCT/US2013/05141 8) , WO
2014/204723 (PCT/US2014/041790), WO 2014/204724 (PCT/US2014/041800), WO
2014/204725 (PCT/US2014/041803), WO 2014/204726 (PCT US2014/041804), WO
2014/204727 (PCT US2014/041806), WO 2014/204728 (PCT/US2014/041808), and WO 2014/204729 (PCT US2014/041809). Reference is also made to US provisional patent applications 1/758,468; 61 /802,174; 61 /806,375; 61 /814,263; 61 /819,803 and 61 /828,130, filed on January 30, 2013; March 15, 2013; March 28, 2013; April 20, 2013; May 6, 2013 and May 28, 2013 respectively. Reference is also made to US provisional patent application 61/836,123, filed on June 17, 2013. Reference is additionally made to US provisional patent applications 61 /835,931 , 61/835,936, 61 /836,127, 61/836, 101 , 61 /836,080 and 61 /835,973, each filed June 17, 2013. Further reference is made to US provisional patent applications 61 /862,468 and 61 /862,355 filed on August 5, 2013; 61/871 ,301 filed on August 28, 2013; 61 /960,777 filed on September 25, 2013 and 61/961 ,980 filed on October 28, 2013. Reference is yet further made to: PCT Patent applications Nos: PCT/US2014/041803, PCT/US2014/041800,
PCT/US2014/041809, PCT/US2014/041804 and PCT US2014/041806, each filed June 10,
2014 6/10/14; PCT US2014/041808 filed June 1 1 , 2014; and PCT/US2014/62558 filed October 28, 2014, and US Provisional Patent Applications Serial Nos.: 61 /915,150, 61 /915,301 ,
61 /915,267 and 61 /915,260, each filed December 12, 2013; 61 /757,972 and 61 /768,959, filed on January 29, 2013 and February 25, 2013; 61 /835,936, 61 /836,127, 61/836,101 , 61/836,080, 61 /835,973, and 61 /835,931 , filed June 17, 2013; 62/010,888 and 62/010,879, both filed June 1 1 , 2014; 62/010,329 and 62/010,441 , each filed June 10, 2014; 61/939,228 and 61/939,242, each filed February 12, 2014; 61/980,012, filed April 15,2014; 62/038,358, filed August 17,
2014; 62/054,490, 62/055,484, 62/055,460 and 62/055,487, each filed September 25, 2014; and 62/069,243, filed October 27, 2014. Reference is also made to US provisional patent applications Nos. 62/055,484, 62/055,460, and 62/055,487, filed September 25, 2014; US provisional patent application 61 /980,012, filed April 15, 2014; and US provisional patent application 61 /939,242 filed February 12, 2014. Reference is made to PCT application designating, inter alia, the United States, application No. PCT/US 14/41806, filed June 10, 2014. Reference is made to US provisional patent application 61 /930,214 filed on January 22, 2014. Reference is made to US provisional patent applications 61 /915,251 ; 61 /915,260 and
61 /915,267, each filed on December 12, 2013. Reference is made to US provisional patent application USSN 61 /980,012 filed April 15, 2014. Reference is made to PCT application designating, inter alia, the United States, application No. PCT/US 14/41806, filed June 10, 2014. Reference is made to US provisional patent application 61 /930,214 filed on January 22, 2014. Reference is made to US provisional patent applications 61 /915,251 ; 61 /915,260 and
61 /915,267, each filed on December 12, 2013. [0054] Mention is also made of US application 62/091 ,455, filed, 12-Dec-14, PROTECTED GUIDE RNAS (PGRNAS); US application
62/096,708, 24-Dec-14, PROTECTED GUIDE RNAS (PGRNAS); US application 62/091 ,462, 12-Dec-14, DEAD GUIDES FOR CRISPR TRANSCRIPTION FACTORS; US application 62/096,324, 23-Dec-14, DEAD GUIDES FOR CRISPR TRANSCRIPTION FACTORS; US application 62/091 ,456, 12-Dec-14, ESCORTED AND FUNCTI ON AL IZED GUIDES FOR CRISPR-CAS SYSTEMS; US application 62/091 ,461 , 12-Dec-14, DELIVERY, USE AND THERAPEUTIC APPLICATIONS OF THE CRISPR-CAS SYSTEMS AND COMPOSITIONS FOR GENOME EDITING AS TO HEMATOPOETIC STEM CELLS (HSCs); US application 62/094,903, 19-Dec-14, UNBIASED IDENTIFICATION OF DOUBLE-STRAND BREAKS AND GENOMIC REARRANGEMENT BY GENOME- WISE INSERT CAPTURE SEQUENCING; US application 62/096,761 , 24-Dec-14, ENGINEERING OF SYSTEMS, METHODS AND
OPTIMIZED ENZYME AND GUIDE SCAFFOLDS FOR SEQUENCE MANIPULATION; US application 62/098,059, 30-Dec-14, RNA-TARGETING SYSTEM; US application 62/096,656, 24-Dec-14, CRISPR HAVING OR ASSOCIATED WITH DESTABILIZATION DOMAINS; US application 62/096,697, 24-Dec-14, CRISPR HAVING OR ASSOCIATED WITH AAV; US application 62/098,158, 30-Dec-14, ENGINEERED CRISPR COMPLEX INSERTIONAL TARGETING SYSTEMS; US application 62/151 ,052, 22-Apr-15, CELLULAR TARGETING FOR EXTRACELLULAR EXOSOMAL REPORTING; US application 62/054,490, 24-Sep-14, DELIVERY, USE AND THERAPEUTIC APPLICATIONS OF THE CRISPR-CAS SYSTEMS AND COMPOSITIONS FOR TARGETING DISORDERS AND DISEASES USING PARTICLE DELIVERY COMPONENTS; US application 62/055,484, 25-Sep-14, SYSTEMS, METHODS AND COMPOSITIONS FOR SEQUENCE MANIPULATION WITH OPTIMIZED FUNCTIONAL CRISPR-CAS SYSTEMS; US application 62/087,537, 4-Dec-14, SYSTEMS, METHODS AND COMPOSITIONS FOR SEQUENCE MANIPULATION WITH OPTIMIZED FUNCTIONAL CRISPR-CAS SYSTEMS; US application 62/054,651 , 24-Sep-14, DELIVERY, USE AND THERAPEUTIC APPLICATIONS OF THE CRISPR-CAS SYSTEMS AND COMPOSITIONS FOR MODELING COMPETITION OF MULTIPLE CANCER MUTATIONS IN VIVO; US application 62/067,886, 23-Oct-14, DELIVERY, USE AND THERAPEUTIC APPLICATIONS OF THE CRISPR-CAS SYSTEMS AND COMPOSITIONS FOR MODELING COMPETITION OF MULTIPLE CANCER MUTATIONS IN VIVO; US application 62/054,675, 24-Sep-14,
DELIVERY, USE AND THERAPEUTIC APPLICATIONS OF THE CRISPR-CAS SYSTEMS AND COMPOSITIONS IN NEURONAL CELLS/TISSUES; US application 62/054,528, 24-Sep- 14, DELIVERY, USE AND THERAPEUTIC APPLICATIONS OF THE CRISPR-CAS SYSTEMS AND COMPOSITIONS IN IMMUNE DISEASES OR DISORDERS; US application 62/055,454, 25-Sep-14, DELIVERY, USE AND THERAPEUTIC APPLICATIONS OF THE CRISPR-CAS SYSTEMS AND COMPOSITIONS FOR TARGETING DISORDERS AND DISEASES USING CELL PENETRATION PEPTIDES (CPP); US application 62/055,460, 25-Sep-14,
MULTIFUNCTIONAL-CRISPR COMPLEXES AND/OR OPTIMIZED ENZYME LINKED
FUNCTION AL-CRISPR COMPLEXES; US application 62/087,475, 4-Dec-14, FUNCTIONAL SCREENING WITH OPTIMIZED FUNCTIONAL CRISPR-CAS SYSTEMS; US application 62/055,487, 25-Sep-14, FUNCTIONAL SCREENING WITH OPTIMIZED FUNCTIONAL CRISPR-CAS SYSTEMS; US application 62/087,546, 4-Dec-14, MULTIFUNCTIONAL CRISPR COMPLEXES AND/OR OPTIMIZED ENZYME LINKED FUNCTIONAL-CRISPR COMPLEXES; and US application 62/098,285, 30-Dec-14, CRISPR MEDIATED IN VIVO MODELING AND GENETIC SCREENING OF TUMOR GROWTH AND METASTASIS.
[0068] Each of these patents, patent publications, and applications, and all documents cited therein or during their prosecution ("appln cited documents") and all documents cited or referenced in the appln cited documents, together with any instructions, descriptions, product specifications, and product sheets for any products mentioned therein or in any document therein and incorporated by reference herein, are hereby incorporated herein by reference, and may be employed in the practice of the invention. All documents (e.g., these patents, patent publications and applications and the appln cited documents) are incorporated herein by reference to the same extent as if each individual document was specifically and individually indicated to be incorporated by reference.
[0069] Also with respect to general information on CRISPR-Cas Systems, mention is made of the following (also hereby incorporated herein by reference):
[0070] Multiplex genome engineering using CRISPR/Cas systems, Cong, L, Ran, F.A., Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, P.D., Wu, X., Jiang, W., Marraffini, L.A., & Zhang, F. Science Feb 15;339(6121 ) :819-23 (2013); RNA-guided editing of bacterial genomes using CRISPR-Cas systems. Jiang W., Bikard D., Cox D., Zhang F, Marraffini LA. Nat Biotechnol Mar;31 (3):233-9 (2013); One-Step Generation of Mice Carrying Mutations in Multiple Genes by CRISPR/Cas-Mediated Genome Engineering. Wang H., Yang H., Shivalila CS., Dawlaty MM., Cheng AW., Zhang F., Jaenisch R. Cell May 9;153(4) :910-8 (2013); Optical control of mammalian endogenous transcription and epigenetic states. Konermann S, Brigham MD, Trevino AE, Hsu PD, Heidenreich M, Cong L, Piatt RJ, Scott DA, Church GM, Zhang F. Nature. 2013 Aug 22;500(7463):472-6. doi: 10.1038/Nature 12466. Epub 2013 Aug 23; Double Nicking by RNA-Guided CRISPR Cas9 for Enhanced Genome Editing Specificity. Ran, FA., Hsu, PD., Lin, CY., Gootenberg, JS., Konermann, S., Trevino, AE„ Scott, DA., Inoue, A., Matoba, S., Zhang, Y„ & Zhang, F. Cell Aug 28. pii: S0092-8674( 13)01015-5. (2013); DNA targeting specificity of RNA-guided Cas9 nucleases. Hsu, P., Scott, D., Weinstein, J., Ran, FA.,
Konermann, S., Agarwala, V., Li, Y., Fine, E., Wu, X., Shalem, O., Cradick, TJ., Marraffini, LA., Bao, G., & Zhang, F. Nat Biotechnol doi:10.1038/nbt.2647 (2013); Genome engineering using the CRISPR-Cas9 system. Ran, FA., Hsu, PD., Wright, J., Agarwala, V., Scott, DA., Zhang, F. Nature Protocols Nov;8(l I) :2281 -308. (2013); Genome-Scale CRISPR-Cas9 Knockout
Screening in Human Cells. Shalem, O., Sanjana, NE., Hartenian, E., Shi, X., Scott, DA., Mikkelson, T., Heckl, D., Ebert, BL., Root, DE., Doench, JG., Zhang, F. Science Dec 12. (2013). [Epub ahead of print]; Crystal structure of cas9 in complex with guide RNA and target DNA. Nishimasu, H., Ran, FA., Hsu, PD., Konermann, S., Shehata, SI., Dohmae, N., Ishitani, R., Zhang, F., Nureki, O. Cell Feb 27. (2014). 156(5) :935-49; Genome-wide binding of the CRISPR endonuclease Cas9 in mammalian cells. Wu X., Scott DA., Kriz AJ., Chiu AC, Hsu PD., Dadon DB., Cheng AW., Trevino AE., Konermann S., Chen S., Jaenisch R., Zhang F., Sharp PA. Nat Biotechnol. (2014) Apr 20. doi: 10.1038/nbt.2889, CRISPR-Cas9 Knockin Mice for Genome Editing and Cancer Modeling, Piatt et al., Cell 159(2): 440-455 (2014) DOI:
10.1016/j.cell.2014.09.014, Development and Applications of CRISPR-Cas9 for Genome Engineering, Hsu et al. Cell 157, 1262-1278 (June 5, 2014) (Hsu 2014), Genetic screens in human cells using the CRISPR/Cas9 system, Wang et al., Science. 2014 January 3; 343(6166): 80-84. doi: 10.1 126/science.1246981 , Rational design of highly active sgRNAs for CRISPR- Cas9-mediated gene inactivation, Doench et al., Nature Biotechnology published online 3 September 2014; doi: 10.1038/nbt.3026, and In vivo interrogation of gene function in the mammalian brain using CRISPR-Cas9, Swiech et al, Nature Biotechnology ; published online 19 October 2014; doi:10.1038/nbt.3055; Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex, onermann S, Brigham MD, Trevino AE, Joung J,
Abudayyeh 00, Barcena C, Hsu PD, Habib N, Gootenberg JS, Nishimasu H, Nureki O, Zhang F., Nature. Jan 29;517(7536) :583-8 (2015); A split-Cas9 architecture for inducible genome editing and transcription modulation, Zetsche B, Volz SE, Zhang F., (published online 02 February 2015) Nat Biotechnol. Feb;33(2): 139-42 (2015); Genome-wide CRISPR Screen in a Mouse Model of Tumor Growth and Metastasis, Chen S, Sanjana NE, Zheng , Shalem O, Lee , Shi X, Scott DA, Song J, Pan JQ, Weissleder R, Lee H, Zhang F, Sharp PA. Cell 160, 1246- 1260, March 12, 2015 (multiplex screen in mouse), and In vivo genome editing using
Staphylococcus aureus Cas9, Ran FA, Cong L, Yan WX, Scott DA, Gootenberg JS, Kriz AJ, Zetsche B, Shalem O, Wu X, Makarova KS, oonin EV, Sharp PA, Zhang F., (published online 01 April 2015), Nature. Apr 9;520(7546): 186-91 (2015); High-throughput functional genomics using CRISPR-Cas9, Shalem et al„ Nature Reviews Genetics 16, 299-31 1 (May 2015);
Sequence determinants of improved CRISPR sgRNA design, Xu et al., Genome Research 25, 1 147-1 157 (August 2015); A Genome-wide CRISPR Screen in Primary Immune Cells to Dissect Regulatory Networks, Parnas et al., Cell 162, 675-686 (July 30, 2015); CRISPR/Cas9 cleavage of viral DNA efficiently suppresses hepatitis B virus, Ramanan et al., Scientific Reports 5:10833. doi: 10.1038/srepl0833 (June 2, 2015); Crystal Structure of Staphylococcus aureus Cas9, Nishimasu et al., Cell 162, 1 1 13-1 126 (Aug. 27, 2015); BCL 1 1 A enhancer dissection by Cas9- mediated in situ saturating mutagenesis, Canver et al., Nature 527(7577): 192-7 (Nov. 12, 2015) doi: 10.1038/naturel 5521 . Epub 2015 Sep 16. each of which is incorporated herein by reference, and discussed briefly below:
[0071 ] Cong et al. engineered type II CRISPR/Cas systems for use in eukaryotic cells based on both Streptococcus thermophilus Cas9 and also Streptoccocus pyogenes Cas9 and demonstrated that Cas9 nucleases can be directed by short RNAs to induce precise cleavage of DNA in human and mouse cells. Their study further showed that Cas9 as converted into a nicking enzyme can be used to facilitate homology-directed repair in eukaryotic cells with minimal mutagenic activity. Additionally, their study demonstrated that multiple guide sequences can be encoded into a single CRISPR array to enable simultaneous editing of several endogenous genomic loci sites within the mammalian genome, demonstrating easy
programmability and wide applicability of the RNA-guided nuclease technology. This ability to use RNA to program sequence specific DNA cleavage in cells defined a new class of genome engineering tools. These studies further showed that other CRISPR loci are likely to be transplantable into mammalian cells and can also mediate mammalian genome cleavage. Importantly, it can be envisaged that several aspects of the CRISPR/Cas system can be further improved to increase its efficiency and versatility.
[0072] Jiang et al. used the clustered, regularly interspaced, short palindromic repeats (CRISPR)-associated Cas9 endonuclease complexed with dual-RNAs to introduce precise mutations in the genomes of Streptococcus pneumoniae and Escherichia coli. The approach relied on dual-RNA:Cas9-directed cleavage at the targeted genomic site to kill unmutated cells and circumvents the need for selectable markers or counter-selection systems, The study reported reprogramming dual-RNA:Cas9 specificity by changing the sequence of short CRISPR RNA (crRNA) to make single- and multinucleotide changes carried on editing templates. The study showed that simultaneous use of two crRNAs enabled multiplex mutagenesis.
Furthermore, when the approach was used in combination with recombineering, in S.
pneumoniae, nearly 100% of cells that were recovered using the described approach contained the desired mutation, and in E. coli, 65% that were recovered contained the mutation.
[0073] Wang et al. (2013) used the CRISPR/Cas system for the one-step generation of mice carrying mutations in multiple genes which were traditionally generated in multiple steps by sequential recombination in embryonic stem cells and/or time-consuming intercrossing of mice with a single mutation. The CRISPR/Cas system will greatly accelerate the in vivo study of functionally redundant genes and of epistatic gene interactions.
[0074] Konermann et al. addressed the need in the art for versatile and robust technologies that enable optical and chemical modulation of DNA-binding domains based CRISPR Cas9 enzyme and also Transcriptional Activator Like Effectors.
[0075] Ran et al. (2013 -A) described an approach that combined a Cas9 nickase mutant with paired guide RNAs to introduce targeted double-strand breaks. This addresses the issue of the Cas9 nuclease from the microbial CRISPR-Cas system being targeted to specific genomic loci by a guide sequence, which can tolerate certain mismatches to the DNA target and thereby promote undesired off-target mutagenesis. Because individual nicks in the genome are repaired with high fidelity, simultaneous nicking via appropriately offset guide RNAs is required for double-stranded breaks and extends the number of specifically recognized bases for target cleavage. The authors demonstrated that using paired nicking can reduce off-target activity by 50- to 1 ,500-fold in cell lines and to facilitate gene knockout in mouse zygotes without sacrificing on-target cleavage efficiency. This versatile strategy enables a wide variety of genome editing applications that require high specificity.
[0076] Hsu et al. (2013) characterized SpCas9 targeting specificity in human cells to inform the selection of target sites and avoid off-target effects. The study evaluated >700 guide RNA variants and SpCas9-induced indel mutation levels at > 100 predicted genomic off-target loci in 293T and 293FT cells. The authors demonstrated that SpCas9 tolerates mismatches between guide RNA and target DNA at different positions in a sequence-dependent manner, sensitive to the number, position and distribution of mismatches. The authors further showed that SpCas9-mediated cleavage is unaffected by DNA methylation and that the dosage of SpCas9 and sgRNA can be titrated to minimize off-target modification. Additionally, to facilitate mammalian genome engineering applications, the authors reported providing a web-based software tool to guide the selection and validation of target sequences as well as off-target analyses.
[0077] Ran et al. (2013-B) described a set of tools for Cas9-mediated genome editing via non-homologous end joining (NHEJ) or homology-directed repair (HDR) in mammalian cells, as well as generation of modified cell lines for downstream functional studies. To minimize off- target cleavage, the authors further described a double-nicking strategy using the Cas9 nickase mutant with paired guide RNAs. The protocol provided by the authors experimentally derived guidelines for the selection of target sites, evaluation of cleavage efficiency and analysis of off- target activity. The studies showed that beginning with target design, gene modifications can be achieved within as little as 1 -2 weeks, and modified clonal cell lines can be derived within 2-3 weeks.
[0078] Shaiem et al. described a new way to interrogate gene function on a genome wide scale. Their studies showed that delivery of a genome-scale CRISPR-Cas9 knockout (GeCKO) library targeted 18,080 genes with 64,751 unique guide sequences enabled both negative and positive selection screening in human cells. First, the authors showed use of the GeCKO library to identify genes essential for cell viability in cancer and pluripotent stem cells. Next, in a melanoma model, the authors screened for genes whose loss is involved in resistance to vemurafenib, a therapeutic that inhibits mutant protein kinase BRAF. Their studies showed that the highest-ranking candidates included previously validated genes NF1 and MED 12 as well as novel hits NF2, CUL3, TADA2B, and TADAL. The authors observed a high level of consistency between independent guide RNAs targeting the same gene and a high rate of hit confirmation, and thus demonstrated the promise of genome-scale screening with Cas9.
[0079] Nishimasu et al. reported the crystal structure of Streptococcus pyogenes Cas9 in complex with sgRNA and its target DNA at 2.5 A0 resolution. The structure revealed a bi bbed architecture composed of target recognition and nuclease lobes, accommodating the sgRNA:DNA heteroduplex in a positively charged groove at their interface. Whereas the recognition lobe is essential for binding sgRNA and DNA, the nuclease lobe contains the HNH and RuvC nuclease domains, which are properly positioned for cleavage of the complementary and non-complementary strands of the target DNA, respectively. The nuclease lobe also contains a carboxyl-terminal domain responsible for the interaction with the protospacer adjacent motif (PAM). This high-resolution structure and accompanying functional analyses have revealed the molecular mechanism of RNA-guided DNA targeting by Cas9, thus paving the way for the rational design of new, versatile genome-editing technologies.
[0080] Wu et al. mapped genome-wide binding sites of a catalytically inactive Cas9 (dCas9) from Streptococcus pyogenes loaded with single guide RNAs (sgRNAs) in mouse embryonic stem cells (mESCs). The authors showed that each of the four sgRNAs tested targets dCas9 to between tens and thousands of genomic sites, frequently characterized by a 5- nucleotide seed region in the sgRNA and an NGG protospacer adjacent motif (PAM). Chromatin inaccessibility decreases dCas9 binding to other sites with matching seed sequences; thus 70% of off-target sites are associated with genes. The authors showed that targeted sequencing of 295 dCas9 binding sites in mESCs transfected with catalytically active Cas9 identified only one site mutated above background levels. The authors proposed a two-state model for Cas9 binding and cleavage, in which a seed match triggers binding but extensive pairing with target DNA is required for cleavage.
[0081 ] Piatt et al. established a Cre-dependent Cas9 knockin mouse. The authors demonstrated in vivo as well as ex vivo genome editing using adeno-associated virus (AAV)-, lentivirus-, or particle-mediated delivery of guide RNA in neurons, immune cells, and endothelial cells. [0082] Hsu et al. (2014) is a review article that discusses generally CRISPR-Cas9 history from yogurt to genome editing, including genetic screening of cells.
[0083] Wang et al, (2014) relates to a pooled, loss-of-function genetic screening approach suitable for both positive and negative selection that uses a genome-scale lentiviral single guide RNA (sgRNA) library.
[0084] Doench et al. created a pool of sgRNAs, tiling across all possible target sites of a panel of six endogenous mouse and three endogenous human genes and quantitatively assessed their ability to produce null alleles of their target gene by antibody staining and flow cytometry. The authors showed that optimization of the PAM improved activity and also provided an on-line tool for designing sgRNAs.
[0085] Swiech et al. demonstrate that AAV-mediated SpCas9 genome editing can enable reverse genetic studies of gene function in the brain.
[0086] Konermann et al. (2015) discusses the ability to attach multiple effector domains, e.g., transcriptional activator, functional and epigenomic regulators at appropriate positions on the guide such as stem or tetraloop with and without linkers.
[0087] Zetsche et al. demonstrates that the Cas9 enzyme can be split into two and hence the assembly of Cas9 for activation can be controlled.
[0088] Chen et al relates to multiplex screening by demonstrating that a genome- wide in vivo CRISPR-Cas9 screen in mice reveals genes regulating lung metastasis.
[0089] Ran et al. (2015) relates to SaCas9 and its ability to edit genomes and demonstrates that one cannot extrapolate from biochemical assays.
[0090] Shalem et al. (2015) described ways in which catalytically inactive Cas9 (dCas9) fusions are used to synthetically repress (CRISPRi) or activate (CRISPRa) expression, showing, advances using Cas9 for genome-scale screens, including arrayed and pooled screens, knockout approaches that inactivate genomic loci and strategies that modulate transcriptional activity.
[0091 ] Xu et al. (2015) assessed the DNA sequence features that contribute to single guide RNA (sgRNA) efficiency in CRISPR-based screens. The authors explored efficiency of CRISPR/Cas9 knockout and nucleotide preference at the cleavage site. The authors also found that the sequence preference for CRISPRi/a is substantially different from that for CRISPR Cas9 knockout. [0092] Parnas et al. (2015) introduced genome- wide pooled CRISPR-Cas9 libraries into dendritic cells (DCs) to identify genes that control the induction of tumor necrosis factor (Tnf) by bacterial lipopolysaccharide (LPS). Known regulators of Tlr4 signaling and previously unknown candidates were identified and classified into three functional modules with distinct effects on the canonical responses to LPS.
[0093] Ramanan et al (2015) demonstrated cleavage of viral episomal DNA (cccDNA) in infected cells. The HBV genome exists in the nuclei of infected hepatocytes as a 3.2kb double- stranded episomal DNA species called covalently closed circular DNA (cccDNA), which is a key component in the HBV life cycle whose replication is not inhibited by current therapies. The authors showed that sgRNAs specifically targeting highly conserved regions of HBV robustly suppresses viral replication and depleted cccDNA.
[0094] Nishimasu et al. (2015) reported the crystal structures of SaCas9 in complex with a single guide RNA (sgRNA) and its double-stranded DNA targets, containing the 5'-TTGAAT-3' (SEQ ID NO: 65) PAM and the 5'-TTGGGT-3' (SEQ ID NO: 66) PAM. A structural comparison of SaCas9 with SpCas9 highlighted both structural conservation and divergence, explaining their distinct PAM specificities and orthologous sgRNA recognition.
[0095] Slaymaker et al (2015) reported the use of structure-guided protein engineering to improve the specificity of Streptococcus pyogenes Cas9 (SpCas9). The authors developed "enhanced specificity" SpCas9 (eSpCas9) variants which maintained robust on-target cleavage with reduced off-target effects.
[0096] Tsai et al, "Dimeric CRISPR A-guided Fokl nucleases for highly specific genome editing," Nature Biotechnology 32(6): 569-77 (2014) which is not believed to be prior art to the instant invention or application, but which may be considered in the practice of the instant invention. Mention is also made of Konermann et al., "Genome-scale transcription activation by an engineered CRISPR-Cas9 complex," doi:10.1038/naturel4136, incorporated herein by reference.
[0097] In general, the CRISPR-Cas or CRISPR system is as used in the foregoing documents, such as WO 2014/093622 (PCT/US2013/074667) and refers collectively to transcripts and other elements involved in the expression of or directing the activity of CRISPR- associated ("Cas") genes, including sequences encoding a Cas gene, a tracr (trans-activating CRISPR) sequence (e.g. tracrRNA or an active partial tracrRNA), a tracr-mate sequence (encompassing a "direct repeat" and a tracrRNA-processed partial direct repeat in the context of an endogenous CRISPR system), a guide sequence (also referred to as a "spacer" in the context of an endogenous CRISPR system), or "RNA(s)" as that term is herein used (e.g., RNA(s) to guide Cas9, e.g. CRISPR RNA and transactivating (tracr) RNA or a single guide RNA (sgRNA) (chimeric RNA)) or other sequences and transcripts from a CRISPR locus. In general, a CRISPR system is characterized by elements that promote the formation of a CRISPR complex at the site of a target sequence (also referred to as a protospacer in the context of an endogenous CRISPR system). In the context of formation of a CRISPR complex, "target sequence" refers to a sequence to which a guide sequence is designed to have
complementarity, where hybridization between a target sequence and a guide sequence promotes the formation of a CRISPR complex. A target sequence may comprise any polynucleotide, such as DNA or RNA polynucleotides. In some embodiments, a target sequence is located in the nucleus or cytoplasm of a cell. In some embodiments, direct repeats may be identified in silico by searching for repetitive motifs that fulfill any or all of the following criteria: 1 . found in a 2Kb window of genomic sequence flanking the type II CRISPR locus; 2. span from 20 to 50 bp; and 3. interspaced by 20 to 50 bp. In some embodiments, 2 of these criteria may be used, for instance 1 and 2, 2 and 3, or 1 and 3. In some embodiments, all 3 criteria may be used. In some embodiments it may be preferred in a CRISPR complex that the tracr sequence has one or more hairpins and is 30 or more nucleotides in length, 40 or more nucleotides in length, or 50 or more nucleotides in length; the guide sequence is between 10 to 30 nucleotides in length, the CRISPR/Cas enzyme is a Type II Cas9 enzyme. In embodiments of the invention the terms guide sequence and guide RNA are used interchangeably as in foregoing cited documents such as WO 2014/093622 (PCT US2013/074667). In general, a guide sequence is any polynucleotide sequence having sufficient complementarity with a target polynucleotide sequence to hybridize with the target sequence and direct sequence-specific binding of a CRISPR complex to the target sequence. In some embodiments, the degree of complementarity between a guide sequence and its corresponding target sequence, when optimally aligned using a suitable alignment algorithm, is about or more than about 50%, 60%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, or more. Optimal alignment may be determined with the use of any suitable algorithm for aligning sequences, non-limiting example of which include the Smith- Waterman algorithm, the Needleman-Wunsch algorithm, algorithms based on the Burrows- Wheeler Transform (e.g. the Burrows Wheeler Aligner), ClustalW, Clustal X, BLAT, Novoalign (Novocraft Technologies; available at www.novocraft.com), ELAND (lllumina, San Diego, CA), SOAP (available at soap.genomics.org.cn), and aq (available at maq.sourceforge.net). In some embodiments, a guide sequence is about or more than about 5, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 75, or more nucleotides in length. In some embodiments, a guide sequence is less than about 75, 50, 45, 40, 35, 30, 25, 20, 15, 12, or fewer nucleotides in length. Preferably the guide sequence is 10 - 30 nucleotides long. The ability of a guide sequence to direct sequence- specific binding of a CRISPR complex to a target sequence may be assessed by any suitable assay. For example, the components of a CRISPR system sufficient to form a CRISPR complex, including the guide sequence to be tested, may be provided to a host cell having the corresponding target sequence, such as by transfection with vectors encoding the components of the CRISPR sequence, followed by an assessment of preferential cleavage within the target sequence, such as by Surveyor assay as described herein. Similarly, cleavage of a target polynucleotide sequence may be evaluated in a test tube by providing the target sequence, components of a CRISPR complex, including the guide sequence to be tested and a control guide sequence different from the test guide sequence, and comparing binding or rate of cleavage at the target sequence between the test and control guide sequence reactions. Other assays are possible, and will occur to those skilled in the art. A guide sequence may be selected to target any target sequence. In some embodiments, the target sequence is a sequence within a genome of a cell. Exemplary target sequences include those that are unique in the target genome. For example, for the S.
pyogenes Cas9, a unique target sequence in a genome may include a Cas9 target site of the form MMMMMMMMNNNNNNNNNNNNXGG where NNNNNNNNNNNNXGG (N is A, G, T, or C; and X can be anything) has a single occurrence in the genome. A unique target sequence in a genome may include an S. pyogenes Cas9 target site of the form
MMMMMMMMMNNNNNNNNNNNXGG where NNNNNNNNNNNXGG (N is A, G, T, or C; and X can be anything) has a single occurrence in the genome. For the S. thermophilus CRISPR Cas9, a unique target sequence in a genome may include a Cas9 target site of the form
MMMMMMMMNNNNNNNNNNNNXXAGAAW (SEQ ID NO: 67) where
NNNNNNNNNNNNXXAGAAW (N is A, G, T, or C; X can be anything; and W is A or T) (SEQ ID NO: 68) has a single occurrence in the genome. A unique target sequence in a genome may include an S. thermophilus CRISPR Cas9 target site of the form
MMMMMMMMMNNNNNNNNNNNXXAGAAW (SEQ ID NO: 69) where
NNNNNNNNNNNXXAGAAW (N is A, G, T, or C; X can be anything; and W is A or T) (SEQ ID NO: 70) has a single occurrence in the genome. For the S. pyogenes Cas9, a unique target sequence in a genome may include a Cas9 target site of the form
MMMMMMMMNNNNNNNNNNNNXGGXG where NNNNNNNNNNNNXGGXG (N is A, G, T, or C; and X can be anything) has a single occurrence in the genome. A unique target sequence in a genome may include an S. pyogenes Cas9 target site of the form
MMMMMMMMMNNNNNNNNNNNXGGXG where NNNNNNNNNNNXGGXG (N is A, G, T, or C; and X can be anything) has a single occurrence in the genome. In each of these sequences "M" may be A, G, T, or C, and need not be considered in identifying a sequence as unique. In some embodiments, a guide sequence is selected to reduce the degree secondary structure within the guide sequence. In some embodiments, about or less than about 75%, 50%, 40%, 30%, 25%, 20%, 15%, 10%, 5%, 1 %, or fewer of the nucleotides of the guide sequence participate in self complementary base pairing when optimally folded. Optimal folding may be determined by any suitable polynucleotide folding algorithm. Some programs are based on calculating the minimal Gibbs free energy. An example of one such algorithm is mFold, as described by Zuker and Stiegler (Nucleic Acids Res. 9 (1981 ), 133-148). Another example folding algorithm is the online Webserver RNAfold, developed at Institute for Theoretical Chemistry at the University of Vienna, using the centroid structure prediction algorithm (see e.g. A.R. Gruber et al., 2008, Cell 106(1 ): 23-24; and PA Carr and GM Church, 2009, Nature Biotechnology 27(12): 1 151 -62).
[0098] As used herein, a“primary cell” refers to a cell which is isolated directly from a living organism’s tissue. In embodiments, the primary cell is a mammalian cell. In
embodiments, the primary cell is a human cell. In embodiments, the primary cell is a mouse cell. In embodiments, the primary cell does not comprise nucleic acid sequence encoding a Cas9 molecule. Without being bound by theory, in embodiments, a primary cell is a cell which has limited lifespan and/or duplication potential, and/or does not tolerate stable integration and/or expression of a Cas9 molecule.
[0099] As used herein, a“library” refers to a composition comprising a plurality of members of the library. In embodiments, the member of the library is nucleic acid sequence encoding an encoded gRNA molecule. In embodiments, the library is a vector library. In embodiments, the library is random. In other embodiments, the library is rationally designed. In other embodiments, the library comprises a combination of random and rationally designed members. In embodiments, the members of the library include a means for identifying a particular member of the library (e.g., a tag or code). DETAILED DESCRIPTION
Methods of Inducing Genetic Modifications in a Cell
[00100] The present disclosure relates to methods for introducing a genetic modification in a cell using the CRISPR/Cas9 gene editing system, without the need for generating a stable cell line expressing a Cas9 protein. Generating a stable cell line expressing Cas9 is not necessarily possible or desired for all cells, such as human or mouse primary cells, and cells can accumulate mutations and lose homogeneity during expansion from a single cell. Instead, the present disclosure relates to introduction of a ribonuclear protein complex (RNP) comprising a Cas9 molecule and a precomplexed RNA or an apo-Cas9 molecule with ssDNA into a cell, coupled with delivery of one or more nucleic acid sequences encoding one or more encoded gRNA molecules comprising a targeting domain, which introduces a genetic modification at or near an encoded target sequence in the cell.
[00101 ] Therefore, some embodiments of the present disclosure provide methods of inducing one or more genetic modifications in a cell using an RNP comprising a Cas9 molecule and a precomplexed RNA or an apo-Cas9 molecule with ssDNA, and one or more nucleic acid sequences encoding one or more encoded gRNA molecules, each of said one or more encoded gRNA molecules comprising a targeting domain. In some embodiments, the methods disclosed herein comprise: a) introducing into said cell an RNP comprising a Cas9 molecule and a precomplexed RNA or an apo-Cas9 molecule with ssDNA; and b) introducing into said cell one or more nucleic acid sequences encoding one or more encoded gRNA molecules, each of said one or more encoded gRNA molecules comprising a targeting domain. In some embodiments, introducing into said cell an RNP or an apo-Cas9 molecule with ssDNA precedes introducing into said cell one or more nucleic acid sequences. In some embodiments, introducing into said cell one or more nucleic acid sequences precedes introducing into said cell an RNP or an apo-Cas9 molecule with ssDNA. In some embodiments, introducing into said cell an RNP or an apo-Cas9 molecule with ssDNA and introducing into said cell one or more nucleic acid sequences are performed simultaneously, e.g., by a single electroporation step.
[00102] As used herein, a“precomplexed RNA” refers to one or more RNA molecules that are bound to a Cas9 molecule. In embodiments, the precomplexed RNA is a gRNA molecule, e.g., as described herein, or any nucleic acid that has the same secondary structure as a gRNA. In embodiments, the precomplexed RNA is a dgRNA. In embodiments, the precomplexed RNA is an sgRNA. In embodiments, the precomplexed RNA is a portion of a gRNA molecule that binds to Cas9, e.g., is a tracr. [00103] In embodiments, the precomplexed RNA is a gRNA molecule comprising a targeting domain. In embodiments, the targeting domain does not have a target sequence (e.g., a fully complementary target sequence) in the genome of the cell to which it is introduced. In other embodiments, the targeting domain does have a target sequence (e.g., a fully complementary target sequence) in the genome of the cell to which it is introduced. In some embodiments, the target sequence is located in a target gene, e.g., the coding sequence of the target gene, the promoter of the target gene, the non-coding region of the target gene, etc. Non-limiting examples of target genes include: an oncogene, a tumor suppressor gene, a gene encoding a tumor antigen, a gene encoding a transmembrane receptor, a gene encoding a checkpoint protein, a gene encoding an immunostimulatory protein, a gene encoding a cytokine, a gene encoding a growth factor, a disease gene, etc. In some embodiments, the target gene is selected from the group consisting of beta-2-macroglobulin (B2M), CD33, CD45, and PD-1 . In some embodiments, the target sequence is located in a non-coding region of the genome, for example, non-coding RNAs, regulatory regions, repetitive DNA, etc.
[00104] As a non-limiting example, the precomplexed RNA molecule and Cas9 molecule can be formulated (in one or more compositions), directly delivered or administered to a cell in which a genetic modification event is desired. In some embodiments, the
precomplexed RNA is mixed with the Cas9 molecule to form an RNP prior to introduction of the RNP into the cell, e.g., by electroporation. This may contain RNA bound to Cas9 as well as unbound RNA. In some embodiments, the methods disclosed herein comprise introducing ssDNA with an apo-Cas9 molecule into the cell. In some embodiments, the ssDNA is introduced into the cell in a single step with the introduction of the apo-Cas9. In some embodiments, the ssDNA is mixed with the apo-Cas9 prior to instruction into the cell, e.g., by electroporation.
[00105] In embodiments, the RNP or an apo-Cas9 molecule with ssDNA can be delivered into cells, e.g., described herein, by any art-known method, e.g., electroporation. In some embodiments, delivery of the RNP or an apo-Cas9 molecule with ssDNA may result in a high % (e.g., >50%, >60%, >70%, >80%, >85%, >90%, >95%, >98%, or >99%) of the target cells containing the RNP or Cas9. In some embodiments, e.g., for a modifier screen where the precomplexed RNP creates a specific knockout of the target gene, and without being bound by theory, it can be preferable to use a precomplexed RNA molecule and Cas9 molecule which result in high % editing at the target sequence (e.g., >50%, >60%, >70%, >80%, >85%, >90%, >95%, >98%, or >99%) in the target cell, e.g., described herein, even when the concentration of RNP delivered to the cell is reduced. Again, without being bound by theory, delivering a reduced or low concentration of RNP comprising a precomplexed RNA molecule that produces a high % editing at the target sequence in the target cell (including at the low RNP
concentration), can be beneficial because it may reduce the frequency and number of off-target editing events. In one aspect, where a low or reduced concentration of RNP is to be used, the following procedure can be used to generate the RNP:
1 . Provide the Cas9 molecule and the tracr in solution at a high concentration (e.g., a
concentration higher than the final RNP concentration to be delivered to the cell), and allow the two components to equilibrate;
2. Provide the crRNA molecule, and allow the components to equilibrate (thereby forming a high-concentration solution of the RNP);
3. Dilute the RNP solution to the desired concentration;
4. Deliver said RNP at said desired concentration to the target cells, e.g., by
electroporation.
[00106] The above procedure may be modified for use with sgRNA molecules by omitting step 2, above, and in step 1 , providing the Cas9 molecule and the sgRNA molecule in solution at high concentration, and allowing the components to equilibrate. The above procedure may be modified by annealing crRNA and tracr first, and then adding the Cas9 molecule. In embodiments, the Cas9 molecule and each gRNA component are provided in solution at a 1 :1 ratio (Cas9:gRNA), e.g., a 1 :1 molar ratio of Cas9:gRNA molecule. Cas9 molecule and each gRNA component are provided in solution at a 1 :2 ratio (Cas9:gRNA), e.g., a 1 :2 molar ratio of Cas9:gRNA molecule. Cas9 molecule and each gRNA component are provided in solution at a 1 :3 ratio (Cas9:gRNA), e.g., a 1 :3 molar ratio of Cas9:gRNA molecule. Cas9 molecule and each gRNA component are provided in solution at a 1 :4 ratio (Cas9:gRNA), e.g., a 1 :4 molar ratio of Cas9:gRNA molecule. Cas9 molecule and each gRNA component are provided in solution at a 1 :5 ratio (Cas9:gRNA), e.g., a 1 :5 molar ratio of Cas9:gRNA molecule. Cas9 molecule and each gRNA component are provided in solution at a 1 :6 ratio (Cas9:gRNA), e.g., a 1 :6 molar ratio of Cas9:gRNA molecule. Where dgRNA molecules are used, the ratio, e.g., molar ratio, is 1 :1 :1 (Cas9:tracr:crRNA). Where dgRNA molecules are used, the ratio, e.g., molar ratio, is 1 :2:2 (Cas9:tracr:crRNA). Where dgRNA molecules are used, the ratio, e.g., molar ratio, is 1 :3:3 (Cas9:tracr:crRNA). Where dgRNA molecules are used, the ratio, e.g., molar ratio, is 1 :4:4 (Cas9:tracr:crRNA). Where dgRNA molecules are used, the ratio, e.g., molar ratio, is 1 :5:5 (Cas9:tracr:crRNA). Where dgRNA molecules are used, the ratio, e.g., molar ratio, is 1 :6:6 (Cas9:tracr:crRNA). Where dgRNA molecules are used, the ratio, e.g., molar ratio, is 1 :1 :2 (Cas9:tracr:crRNA). Where dgRNA molecules are used, the ratio, e.g., molar ratio, is 1 :2:4 (Cas9:tracr:crRNA). Where dgRNA molecules are used, the ratio, e.g., molar ratio, is 1 :3:6 (Cas9:tracr:crRNA). Where dgRNA molecules are used, the ratio, e.g., molar ratio, is 1 :4:8 (Cas9:tracr:crRNA). Where dgRNA molecules are used, the ratio, e.g., molar ratio, is 1 :5:10 (Cas9:tracr:crRNA). Where dgRNA molecules are used, the ratio, e.g., molar ratio, is 1 :6:12 (Cas9:tracr:crRNA). In embodiments, the RNP is formed at a
concentration of 20uM or higher, e.g., a concentration from about 20uM to about 50 uM. In embodiments, the RNP is formed at a concentration of 10 uM or higher, e.g., a concentration from about 10 uM to about 30 uM. In embodiments, the RNP is diluted to a final concentration of 10uM or less (e.g., a concentration from about 0.01 uM to about 10uM) in a solution comprising the target cell (e.g., described herein) for delivery to said target cell. In
embodiments, the RNP is diluted to a final concentration of 3uM or less (e.g., a concentration from about 0.01 uM to about 3uM) in a solution comprising the target cell (e.g., described herein) for delivery to said target cell. In embodiments, the RNP is diluted to a final concentration of 1 uM or less (e.g., a concentration from about 0.01 uM to about 1 uM) in a solution comprising the target cell (e.g., described herein) for delivery to said target cell. In embodiments, the RNP is diluted to a final concentration of 0.3uM or less (e.g., a concentration from about 0.01 uM to about 0.3uM) in a solution comprising the target cell (e.g., described herein) for delivery to said target cell. In embodiments, the RNP is provided at a final concentration of about 3uM in a solution comprising the target cell (e.g., described herein) for delivery to said target cell. In embodiments, the RNP is provided at a final concentration of about 1 uM in a solution comprising the target cell (e.g., described herein) for delivery to said target cell. In embodiments, the RNP is provided at a final concentration of about 0.3uM in a solution comprising the target cell (e.g., described herein) for delivery to said target cell. In embodiments, the RNP is provided at a final concentration of about 0.1 uM in a solution comprising the target cell (e.g., described herein) for delivery to said target cell. In
embodiments, the RNP is provided at a final concentration of about 0.05uM in a solution comprising the target cell (e.g., described herein) for delivery to said target cell. In
embodiments, the RNP is provided at a final concentration of about 0.03uM in a solution comprising the target cell (e.g., described herein) for delivery to said target cell. In
embodiments, the RNP is provided at a final concentration of about 0.01 uM in a solution comprising the target cell (e.g., described herein) for delivery to said target cell.
[00107] Introduction of the complexes, polypeptides, and nucleic acids of the disclosure into cells can occur by viral or bacteriophage infection, transfection, conjugation, protoplast fusion, lipofection, electroporation, nucleofection, calcium phosphate precipitation, polyethyleneimine (PEI)-mediated transfection, DEAE-dextran mediated transfection, liposome- mediated transfection, particle gun technology, direct micro-injection, nanoparticle-mediated nucleic acid delivery, and the like.
[00108] Introduction of the RNP or apo-Cas9 molecule with ssDNA may be accomplished by, for example, electroporation (e.g., as known in the art) or other method that renders the cell membrane permeable to nucleic acid and/or polypeptide molecules. Additional techniques for rendering the membrane permeable are known in the art and include, for example, cell squeezing (e.g., as described in WO2015/023982 and WO2013/059343, the contents of which are hereby incorporated by reference in their entireties), nanoneedles (e.g., as described in Chiappini et al., Nat. Mat., 14; 532-39, or US2014/0295558, the contents of which are hereby incorporated by reference in their entireties), nanostraws (e.g., as described in Xie, ACS Nano, 7(5); 4351 -58, the contents of which are hereby incorporated by reference in their entireties), gold nanoparticles (e.g., as described in Dykman et al., Acta Naturae. 201 1 Apr-Jun; 3(2): 34-55, the content of which is hereby incorporated by reference in its entirety), lipid nanoparticles (e.g., as described in Naseri et al., Adv Pharm Bull. 2015 Sep; 5(3): 305-313, the content of which is hereby incorporated by reference in its entirety), etc.
[00109] gRNA molecule formats are known in the art. An exemplary gRNA molecule, e.g., dgRNA molecule, of the present invention comprises, e.g., consists of, a first nucleic acid having the sequence:
nnnnnnnnnnnnnnnnnnnnGUUUUAGAGCUAUGCUGUUUUG (SEQ ID NO: 71 ), where the“n”’s refer to the residues of the targeting domain, e.g., as described herein, and may consist of 15-25 nucleotides, e.g., consists of 20 nucleotides;
and a second nucleic acid sequence having the exemplary sequence:
AACUUACCAAGGAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUU GAAAAAGUGGCACCGAGUCGGUGC, optionally with 1 , 2, 3, 4, 5, 6, or 7 (e.g., 4 or 7, e.g., 7) additional U nucleotides at the 3’ end (SEQ ID NO: 72).
[001 10] The second nucleic acid molecule may alternatively consist of a fragment of the sequence above, wherein such fragment is capable of hybridizing to the first nucleic acid. An example of such second nucleic acid molecule is: AACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCA CCGAGUCGGUGC, optionally with 1 , 2, 3, 4, 5, 6, or 7 (e.g., 4 or 7, e.g., 7) additional U nucleotides at the 3’ end (SEQ ID NO: 73).
[001 1 1 ] Another exemplary gRNA molecule, e.g., a sgRNA molecule, of the present invention comprises, e.g., consists of a first nucleic acid having the sequence:
nnnnnnnnnnnnnnnnnnnGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUC CGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (SEQ ID NO: 74), where the“n”’s refer to the residues of the targeting domain, e.g., as described herein, and may consist of 15- 25 nucleotides, e.g., consist of 20 nucleotides, optionally with 1 , 2, 3, 4, 5, 6, or 7 (e.g., 4 or 7, e.g., 4) additional U nucleotides at the 3’ end.
[001 12] In some embodiments, the one or more nucleic acid sequences encoding one or more encoded gRNA molecules is provided as DNA molecules encoding one or more encoded gRNA molecules. The DNA molecules may include a control region, e.g., comprising a promoter, to effect expression. Useful promoters for the encoded gRNAs include H1 , EF- 1 a and U6 promoters. Promoters with similar or dissimilar strengths can be selected to tune the expression of components. In an embodiment, a promoter for an encoded gRNA molecule can be inducible, tissue specific, or cell specific.
[001 13] DNA encoding encoded gRNA molecules can be administered to subjects or delivered into cells by art-known methods or as described herein. For example, gRNA- encoding DNA can be delivered, e.g., by vectors (e.g., viral or non-viral vectors), non-vector based methods (e.g., using naked DNA or DNA complexes), or a combination thereof.
[001 14] In some embodiments, the gRNA-encoding DNA is delivered by a vector (e.g., viral vector/virus, plasmid, minicircle or nanoplasmid). A vector can comprise a sequence that encodes an encoded gRNA molecule.
[001 15] One or more regulatory/control elements, e.g., a promoter, an enhancer, an intron, a polyadenylation signal, a Kozak consensus sequence, internal ribosome entry sites (IRES), a 2A sequence, and a splice acceptor or donor can be included in the vectors. In some embodiments, the promoter is recognized by RNA polymerase II (e.g., a CMV promoter). In other embodiments, the promoter is recognized by RNA polymerase III (e.g., a U6 promoter). In some embodiments, the promoter is a regulated promoter (e.g., inducible promoter). In other embodiments, the promoter is a constitutive promoter. In some embodiments, the promoter is a tissue specific promoter. In some embodiments, the promoter is a viral promoter. In other embodiments, the promoter is a non-viral promoter.
[001 16] In some embodiments, the vector or delivery vehicle is a minicircle. In some embodiments, the vector or delivery vehicle is a nanoplasmid.
[001 17] In some embodiments, the vector or delivery vehicle is a viral vector (e.g., for generation of recombinant viruses). In some embodiments, the virus is a DNA virus (e.g., dsDNA or ssDNA virus). In other embodiments, the virus is an RNA virus (e.g., an ssRNA virus).
[001 18] Exemplary viral vectors/viruses include, e.g., retroviruses, lentiviruses, adenovirus, adeno- associated virus (AAV), vaccinia viruses, poxviruses, and herpes simplex viruses. Viral vector technology is well known in the art and is described, for example, in Sambrook et al., 2012, MOLECULAR CLONING: A LABORATORY MANUAL, volumes 1 -4, Cold Spring Harbor Press, NY), and in other virology and molecular biology manuals.
[001 19] In some embodiments, the virus infects dividing cells. In other
embodiments, the virus infects non-dividing cells. In some embodiments, the virus infects both dividing and non-dividing cells. In some embodiments, the virus can integrate into the host genome. In some embodiments, the virus is engineered to have reduced immunity, e.g., in an animal. In some embodiments, the virus is replication-competent. In other embodiments, the virus is replication- defective, e.g., having one or more coding regions for the genes necessary for additional rounds of virion replication and/or packaging replaced with other genes or deleted. In some embodiments, the virus causes transient expression of the encoded gRNA molecule. In other embodiments, the virus causes long-lasting, e.g., at least 1 week, 2 weeks, 1 month, 2 months, 3 months, 6 months, 9 months, 1 year, 2 years, or permanent expression, of the encoded gRNA molecule. The packaging capacity of the viruses may vary, e.g., from at least about 4 kb to at least about 30 kb, e.g., at least about 5 kb, 10 kb, 15 kb, 20 kb, 25 kb, 30 kb, 35 kb, 40 kb, 45 kb, or 50 kb.
[00120] In some embodiments, the gRNA-encoding DNA is delivered by a recombinant retrovirus. In some embodiments, the retrovirus (e.g., Moloney murine leukemia vims) comprises a reverse transcriptase, e.g., that allows integration into the host genome. In some embodiments, the retrovirus is replication-competent. In other embodiments, the retrovirus is replication-defective, e.g., having one or more coding regions for the genes necessary for additional rounds of virion replication and packaging replaced with other genes, or deleted. [00121 ] In some embodiments, the gRNA-encoding DNA is delivered by a recombinant lentivirus. For example, the lentivirus is replication-defective, e.g., does not comprise one or more genes required for viral replication.
[00122] In some embodiments, the gRNA-encoding DNA is delivered by a recombinant adenovirus. In some embodiments, the adenovirus is engineered to have reduced immunity in human.
[00123] In some embodiments, the gRNA-encoding DNA is delivered by a recombinant adeno-associated virus (AAV). In some embodiments, the AAV can incorporate its genome into that of a host cell, e.g., a target cell as described herein. In some embodiments, the AAV is a self- complementary adeno-associated virus (scAAV), e.g., a scAAV that packages both strands which anneal together to form double stranded DNA. AAV serotypes that may be used in the disclosed methods include, e.g., AAV1 , AAV2, modified AAV2 (e.g., modifications at Y444F, Y500F, Y730F and/or S662V), AAV3, modified AAV3 (e.g., modifications at Y705F, Y73 1 F and/or. T492V), AAV4, AAV5, AAV6, modified AAV6 (e.g., modifications at S663V and/or T492V), AAV8, AAV 8.2, AAV9, AAV rh 10, and pseudotyped AAV, such as AAV2/8, AAV2/5 and AAV2/6 can also be used in the disclosed methods.
[00124] In some embodiments, the gRNA-encoding DNA is delivered by a hybrid virus, e.g., a hybrid of one or more of the viruses described herein.
[00125] A packaging cell may be used to form a virus particle that is capable of infecting a host or target cell. Such a cell includes a 293 cell, which can package adenovirus, and a y2 cell or a PA317 cell, which can package retrovirus. A viral vector used in gene therapy is usually generated by a producer cell line that packages a nucleic acid vector into a viral particle. The vector typically contains the minimal viral sequences required for packaging and subsequent integration into a host or target cell (if applicable), with other viral sequences being replaced by an expression cassette encoding the protein to be expressed. For example, an AAV vector used in gene therapy typically only possesses inverted terminal repeat (ITR) sequences from the AAV genome which are required for packaging and gene expression in the host or target cell. The missing viral functions are supplied in trans by the packaging cell line.
Henceforth, the viral DNA is packaged in a cell line, which contains a helper plasmid encoding the other AAV genes, namely rep and cap, but lacking ITR sequences. The cell line is also infected with adenovirus as a helper. The helper virus promotes replication of the AAV vector and expression of AAV genes from the helper plasmid. The helper plasmid is not packaged in significant amounts due to a lack of ITR sequences. Contamination with adenovirus can be reduced by, e.g., heat treatment to which adenovirus is more sensitive than AAV.
[00126] In an embodiment, the viral vector has the ability of cell type and/or tissue type recognition. For example, the viral vector can be pseudotyped with a different/alternative viral envelope glycoprotein; engineered with a cell type-specific receptor (e.g., genetic modification of the viral envelope glycoproteins to incorporate targeting ligands such as a peptide ligand, a single chain antibody, a growth factor); and/or engineered to have a molecular bridge with dual specificities with one end recognizing a viral glycoprotein and the other end recognizing a moiety of the target cell surface (e.g., ligand-receptor, monoclonal antibody, avidin-biotin and chemical conjugation).
[00127] In an embodiment, the viral vector achieves cell type specific expression. For example, a tissue-specific promoter can be constructed to restrict expression of the transgene (encoded gRNA) in only the target cell. The specificity of the vector can also be mediated by microRNA- dependent control of transgene expression. In an embodiment, the viral vector has increased efficiency of fusion of the viral vector and a target cell membrane. For example, a fusion protein such as fusion-competent hemagglutin (HA) can be incorporated to increase viral uptake into cells. In an embodiment, the viral vector has the ability of nuclear localization. For example, a virus that requires the breakdown of the cell wall (during cell division) and therefore will not infect a non-diving cell can be altered to incorporate a nuclear localization peptide in the matrix protein of the virus thereby enabling the transduction of non proliferating cells.
[00128] In some embodiments, the gRNA-encoding DNA is delivered by a non vector based method (e.g., using naked DNA or DNA complexes). For example, the DNA can be delivered, e.g., by organically modified silica or silicate (Ormosil), electroporation, gene gun, sonoporation, magnetofection, lipid-mediated transfection, dendrimers, inorganic nanoparticles, calcium phosphates, or a combination thereof.
[00129] In some embodiments, the gRNA-encoding DNA is delivered by a combination of a vector and a non-vector based method. For example, a virosome comprises a liposome combined with an inactivated virus (e.g., HIV or influenza virus), which can result in more efficient gene transfer, e.g., in a respiratory epithelial cell than either a viral or a liposomal method alone. [00130] The vector may also contain a ribosome binding site for translation initiation and a transcription terminator. The expression vector may also include appropriate sequences for amplifying expression. The expression vector may also include nucleotide sequences encoding non-native tags (e.g., histidine tag, hemagglutinin tag, green fluorescent protein, etc.) that are fused to the site-directed polypeptide, thus resulting in a fusion protein. In some embodiments, a promoter is an inducible promoter (e.g., heat shock promoter, tetracycline-regulated promoter, steroid-regulated promoter, metal-regulated promoter, estrogen receptor-regulated promoter, etc.). In some embodiments, a promoter is a constitutive promoter (e.g., CMV promoter, UBC promoter). In some embodiments, the promoter is a spatially restricted and/or temporally restricted promoter (e.g., a tissue specific promoter, a cell type specific promoter, etc.).
[00131 ] In an embodiment, the delivery vehicle is a non-viral vector. In an embodiment, the non-viral vector is an inorganic nanoparticle (e.g., attached to the payload to the surface of the nanoparticle). Exemplary inorganic nanoparticles include, e.g., magnetic nanoparticles (e.g., Fe Ivln02), or silica. The outer surface of the nanoparticle can be conjugated with a positively charged polymer (e.g., polyethylenimine, polylysine, polyserine) which allows for attachment (e.g., conjugation or entrapment) of payload. In an embodiment, the non-viral vector is an organic nanoparticle (e.g., entrapment of the payload inside the nanoparticle). Exemplary organic nanoparticles include, e.g., SNALP liposomes that contain cationic lipids together with neutral helper lipids which are coated with polyethylene glycol (PEG) and protamine and nucleic acid complex coated with lipid coating.
[00132] Exemplary lipids and/or polymers for transfer of CRISPR systems or nucleic acid, e.g., vectors, encoding CRISPR systems or components thereof include, for example, those described in WO201 1/076807, WO2014/136086, W02005/060697,
WO2014/14021 1 , WO2012/031046, WO2013/103467, WO2013/006825, WO2012/006378, WO2015/095340, and WO2015/095346, the contents of each of the foregoing are hereby incorporated by reference in their entirety. In an embodiment, the vehicle has targeting modifications to increase target cell update of nanoparticles and liposomes, e.g., cell specific antigens, monoclonal antibodies, single chain antibodies, aptamers, polymers, sugars, and cell penetrating peptides. In an embodiment, the vehicle uses fusogenic and endosome- destabilizing peptides/polymers. In an embodiment, the vehicle undergoes acid-triggered conformational changes (e.g., to accelerate endosomal escape of the cargo). In an
embodiment, a stimuli-cleavable polymer is used, e.g., for release in a cellular compartment. For example, disulfide-based cationic polymers that are cleaved in the reducing cellular environment can be used.
[00133] In an embodiment, the delivery vehicle is a biological non-viral delivery vehicle. In an embodiment, the vehicle is an attenuated bacterium (e.g., naturally or artificially engineered to be invasive but attenuated to prevent pathogenesis and expressing the transgene (e.g., Listeria monocytogenes, certain Salmonella strains, Bifidobacterium longum, and modified Escherichia coli), bacteria having nutritional and tissue-specific tropism to target specific tissues, bacteria having modified surface proteins to alter target tissue specificity). In an embodiment, the vehicle is a genetically modified bacteriophage (e.g., engineered phages having large packaging capacity, less immunogenic, containing mammalian plasmid maintenance sequences and having incorporated targeting ligands). In an embodiment, the vehicle is a mammalian virus-like particle. For example, modified viral particles can be generated (e.g., by purification of the "empty" particles followed by ex vivo assembly of the virus with the desired cargo). The vehicle can also be engineered to incorporate targeting ligands to alter target tissue specificity.
In an embodiment, the vehicle is a biological liposome. For example, the biological liposome is a phospholipid-based particle derived from human cells (e.g., erythrocyte ghosts, which are red blood cells broken down into spherical structures derived from the subject (e.g., tissue targeting can be achieved by attachment of various tissue or cell-specific ligands), or secretory exosomes - subject (i.e., patient) derived membrane-bound nanovesicle (30 - 100 nm) of endocytic origin (e.g., can be produced from various cell types and can therefore be taken up by cells without the need of for targeting ligands).
[00134] Without being bound by theory, the presently disclosed methods can achieve higher efficiency of introducing the Cas9 molecule into a cell and/or generating a genetic modification at the target sequence of one or more encoded gRNA molecules than other known methods, for example, methods of inducing one or more encoded gRNA molecules into a cell using a Cas9 molecule without a precomplexed RNA or associated ssDNA. For example, the methods disclosed herein can introduce the Cas9 molecule into a cell at an efficiency of at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or more.
[00135] In some embodiments, the methods disclosed herein introduces a genetic modification to an encoded target gene in the cell. A“genetic modification” as used herein refers to an alteration of a target sequence, e.g., an indel; an alteration of the epigenetic modification of the target sequence, e.g., methylation; an alteration of the transcription of the target sequence, e.g., inhibition/enhancement of promoter activity, etc. In some embodiments, the genetic modification results in reduced or increased expression of the encoded target gene and/or the encoded target gene product. In some embodiments, the encoded target gene is modified at an efficiency that is at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or more. As used herein,“modified at an efficiency” means the percentage of cells in a population of cells containing an encoded gRNA that comprises a genetic modification, e.g., an indel, at or near the target sequences of the encoded target gene, as measured by NGS, e.g., with at least 1 ,000, 10,000, 100,000, 1 ,000,000 sequence reads. In some embodiments, the expression level of the encoded target gene is reduced or increased by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or more. As used herein,“expression level” means the average, median or combined expression level of the encoded target gene of all cells containing an encoded gRNA, as measured by RT-PCR, RNA-seq, RASL-seq, FACS, etc.
[00136] In some embodiments, the methods disclosed herein introduces a genetic modification to the target sequence of a target gene in the cell. In some embodiments, the genetic modification results in reduced or increased expression of the target gene and/or the target gene product. In some embodiments, the target gene is modified at an efficiency that is at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or more. In some embodiments, the methods disclosed herein introduces a genetic modification to the encoded target gene and the target gene in the same cell. In some embodiments, the expression level of the target gene is reduced or increased by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or more.
Cells
[00137] It will be appreciated that the presently disclosed methods are valuable for introducing a genetic modification using the CRISPR/Cas9 gene editing system into cells that have limited proliferative capacity, cells that have low transfection/transduction efficiency, and/or cells that are rapidly differentiating, such as primary human cells, stem cells, etc. For example, the presently disclosed methods are valuable for introducing a genetic modification using the CRISPR/Cas9 gene editing system into stem cells such as embryonic stem cells, hematopoietic stem cells, mesenchymal stem cells, neural stem cells, epithelial stem cells, endothelial stem cells, skin stem cells, induced pluripotent stem (iPS) cells, etc. In some embodiments, the presently disclosed methods are valuable for introducing a genetic modification using the CRISPR/Cas9 gene editing system into a tumor cell, a lymphocyte, a macrophage, a monocyte, a dendritic cell, an erythrocyte, an adipocyte, a neuron, an astrocyte, a myocyte, an epithelial cell, an endothelial cell, a beta cell, a keratinocyte, etc. Exemplary tumor cells include, but are not limited to, tumor cells from lung cancer, lung adenocarcinoma, lung squamous cell carcinoma, acute myeloid leukemia, basal cell (skin) carcinoma, bladder cancer, breast cancer, carcinoid cancer, chronic lymphocytic leukemia, colorectal cancer, lymphoma, diffuse large B-cell lymphoma, endometrial cancer, esophageal cancer, esophageal adenocarcinoma, glioblastoma multiforme, glioma, head and neck cancer, kidney cell cancer, medulloblastoma, melanoma, multiple myeloma, nasopharyngeal cancer, neuroblastoma, ovarian cancer; prostate cancer, rhabdoid tumor, thyroid cancer, urinary bladder cancer, etc.
[00138] As used herein, a“primary cell” refers to a cell which is isolated directly from a living organism’s tissue. In embodiments, the primary cell is a mammalian cell. In embodiments, the primary cell is a human cell. In embodiments, the primary cell does not comprise nucleic acid sequence encoding a Cas9 molecule. Without being bound by theory, in embodiments, a primary cell is a cell which has limited lifespan and/or duplication potential, and/or does not tolerate stable integration and/or expression of a Cas9 molecule.
[00139] It will be appreciated that the presently disclosed methods are valuable for introducing a genetic modification using the CRISPR/Cas9 gene editing system into cells without the need to first establish and/or characterize stable Cas9 expressing subclones, into cells where the stable Cas9 expression is not desired because it would be immunogenic when transplanted in vivo, e.g., screening in syngeneic tumor models, or cells that silence Cas9. Exemplary cell lines that can be used with the presently disclosed methods include , but are not limited to, C8161 , CCRF-CEM, MOLT, mlMCD-3, NHDF, HeLa-S3, Huh1 , Huh4, Huh7,
HUVEC, HASMC, HEKn, HEKa, MiaPaCell, Panel , PC-3, TF1 , CTLL-2, C1 R, Rat6, CV1 , RPTE, A10, T24, J82, A375, ARH-77, Calul , SW480, SW620, SKOV3, SK-UT, CaCo2,
P388D1 , SEM-K2, WEHI-231 , HB56, TIB55, Jurkat, J45.01 , LRMB, Bcl-1 , BC-3, IC21 , DLD2, Raw264.7, NRK, NRK-52E, MRC5, MEF, Hep G2, HeLa B, HeLa T4, COS, COS-1 , COS-6, COS-M6A, BS-C-1 monkey kidney epithelial, BALB/3T3 mouse embryo fibroblast, 3T3 Swiss, 3T3-L1 , 132-d5 human fetal fibroblasts; 10.1 mouse fibroblasts, 293-T, 3T3, 721 , 9L, A2780, A2780ADR, A2780cis, A172, A20, A253, A431 , A-549, ALC, B16, B35, BCP-1 cells, BEAS-2B, bEnd.3, BHK-21 , BR 293, BxPC3, C3H-10T1 /2, C6/36, Cal-27, CHO, CHO-7, CHO-IR, CHO- K1 , CHO-K2, CHO-T, CHO Dhfr
Figure imgf000050_0001
COS-7, COV-434, CML T1 , CMT, CT26, D17, DH82, DU145, DuCaP, EL4, EM2, EM3,
EMT6/AR1 , EMT6/AR10.0, FM3, H1299, H69, HB54, HB55, HCA2, HEK-293, HeLa,
Hepa1 c1 c7, HL-60, HMEC, HT-29, HUES 62, JY cells, K562 cells, KBM-7, Ku812, KCL22,
KG1 , KY01 , LNCap, Ma-Mel 1 -48, MC-38, MCF-7, MCF-10A, MDA-MB-231 , MDA-MB-468, MDA-MB-435, MDCK II, MDCK II, MOR/0.2R, MONO-MAC 6, MTD-1 A, MyEnd, NCI-H69/CPR, NCI-H69/LX10, NCI-H69/LX20, NCI-H69/LX4, NIH-3T3, NALM-1 , NW-145, OPCN/OPCT cell lines, Peer, PNT-1 A/PNT 2, RenCa, RIN-SF, RMA/RMAS, Saos-2 cells, Sf-9, SkBr3, T2, T-47D, T84, THP1 cell line, U373, U87, U937, VCaP, Vero cells, WM39, WT-49, X63, YAC-1 , YAR, and transgenic varieties thereof. Cell lines are available from a variety of sources known to those with skill in the art (see, e.g., the American Type Culture Collection (ATCC) (Manassus, Va.)). In some embodiments, a cell transfected with one or more vectors described herein is used to establish a new cell line comprising one or more vector-derived sequences. In some
embodiments, a cell transiently transfected with the components of a CRISPR system as described herein (such as by transient transfection of one or more vectors, or transfection with RNA), and modified through the activity of a CRISPR complex, is used to establish a new cell line comprising cells containing the modification but lacking any other exogenous sequence. In some embodiments, cells transiently or non-transiently transfected with one or more vectors described herein, or cell lines derived from such cells are used in assessing one or more test compounds.
[00140] Stem cells (also referred to as progenitor cells herein), such as erythroid or hematopoietic progenitor cells, are capable of both proliferation and giving rise to more progenitor cells, these in turn having the ability to generate a large number of mother cells that can in turn give rise to differentiated or differentiable daughter cells. The daughter cells themselves can be induced to proliferate and produce progeny that subsequently differentiate into one or more mature cell types, while also retaining one or more cells with parental developmental potential. The term "stem cell" refers then, to a cell with the capacity or potential, under particular circumstances, to differentiate to a more specialized or differentiated phenotype, and which retains the capacity, under certain circumstances, to proliferate without substantially differentiating. In one embodiment, the term progenitor or stem cell refers to a generalized mother cell whose descendants (progeny) specialize, often in different directions, by differentiation, e.g., by acquiring completely individual characters, as occurs in progressive diversification of embryonic cells and tissues. Cellular differentiation is a complex process typically occurring through many cell divisions. A differentiated cell may derive from a multipotent cell which itself is derived from a multipotent cell, and so on. While each of these multipotent cells may be considered stem cells, the range of cell types each can give rise to may vary considerably. Some differentiated cells also have the capacity to give rise to cells of greater developmental potential. Such capacity may be natural or may be induced artificially upon treatment with various factors. In many biological instances, stem cells are also
"multipotent" because they can produce progeny of more than one distinct cell type, but this is not required for "stem-ness."
[00141 ] Self-renewal is another important aspect of the stem cell, as used in this document. In theory, self-renewal can occur by either of two major mechanisms. Stem cells may divide asymmetrically, with one daughter retaining the stem state and the other daughter expressing some distinct other specific function and phenotype.
[00142] Alternatively, some of the stem cells in a population can divide symmetrically into two stems, thus maintaining some stem cells in the population as a whole, while other cells in the population give rise to differentiated progeny only. Generally, "progenitor cells" have a cellular phenotype that is more primitive (i.e., is at an earlier step along a developmental pathway or progression than is a fully differentiated cell). Often, progenitor cells also have significant or very high proliferative potential. Progenitor cells can give rise to multiple distinct differentiated cell types or to a single differentiated cell type, depending on the developmental pathway and on the environment in which the cells develop and differentiate.
[00143] In the context of cell ontogeny, the adjective "differentiated," or
"differentiating" is a relative term. A "differentiated cell" is a cell that has progressed further down the developmental pathway than the cell to which it is being compared. Thus, stem cells can differentiate to lineage-restricted precursor cells (such as a hematopoietic progenitor cell), which in turn can differentiate into other types of precursor cells further down the pathway (such as an erythrocyte precursor), and then to an end-stage differentiated cell, such as an erythrocyte, which plays a characteristic role in a certain tissue type, and may or may not retain the capacity to proliferate further.
[00144] "Hematopoietic progenitor cell" as the term is used herein, refers to cells of a stem cell lineage that give rise to all the blood cell types including the erythroid
(erythrocytes or red blood cells (RBCs)), myeloid (monocytes and macrophages, neutrophils, basophils, eosinophils, megakaryocytes / platelets, and dendritic cells), and lymphoid (T-cells, B-cells, NK-cells), multi-potent progenitor cells that give rise to multiple blood cell types, or lineage-committed progenitor cells that are committed to a specific lineage. [00145] A "cell of the erythroid lineage" indicates that the cell being contacted is a cell that undergoes erythropoiesis such that upon final differentiation it forms an erythrocyte or red blood cell. Such cells originate from bone marrow hematopoietic progenitor cells. Upon exposure to specific growth factors and other components of the hematopoietic
microenvironment, hematopoietic progenitor cells can mature through a series of intermediate differentiation cellular types, all intermediates of the erythroid lineage, into RBCs. Thus, cells of the "erythroid lineage," as the term is used herein, comprise hematopoietic progenitor cells, rubriblasts, prorubricytes, erythroblasts, metarubricytes, reticulocytes, and erythrocytes.
[00146] In some embodiments, the hematopoietic progenitor cell has at least one of the cell surface marker characteristic of hematopoietic progenitor cells: CD34+, CD59+, Thyl/CD90+, CD381 lo/-, and C-kit/CD1 17+. In some embodiments, the hematopoietic progenitor are CD34+.
[00147] In some embodiments, the hematopoietic progenitor cell is a peripheral blood stem cell obtained from the patient after the patient has been treated with granulocyte colony stimulating factor (optionally in combination with Plerixaflor). In illustrative embodiments, CD34+ cells are enriched using CliniMACS® Cell Selection System (Miltenyi Biotec). In some embodiments, CD34+ cells are weakly stimulated in serum-free medium (e.g., StemSpan SFEM (Stemcell Technologies)) with cytokines (e.g., SCF, rhTPO, rhFLT3, IL6, etc.) before genome editing. In some embodiments, addition of SR1 and dmPGE2 and/or other factors is
contemplated to improve long-term engraftment. In some embodiments, CD34+ cells are cord blood CD34+ cells or bone marrow CD34+ cells.
[00148] In some embodiments, the hematopoietic progenitor cells of the erythroid lineage have the cell surface marker characteristic of the erythroid lineage: such as CD71 and CD235a.
[00149] In some embodiments, the cells described herein are induced pluripotent stem cells (iPSCs). To generate iPSCs cells, a somatic cell can be obtained from a subject, reprogrammed to an induced pluripotent stem cell, and then re-differentiated into a
hematopoietic progenitor cell. The use of iPSCs negates the need for cells obtained from an embryonic source. Thus, in one embodiment, the stem cells used in the disclosed methods are not embryonic stem cells. [00150] Although differentiation is generally irreversible under physiological contexts, several methods have been recently developed to reprogram somatic cells to iPSCs. Exemplary methods are known to those of skill in the art and are described briefly herein below.
[00151 ] As used herein, the term "reprogramming" refers to a process that alters or reverses the differentiation state of a differentiated cell (e.g., a somatic cell). Stated another way, reprogramming refers to a process of driving the differentiation of a cell backwards to a more undifferentiated or more primitive type of cell. It should be noted that placing many primary cells in culture can lead to some loss of fully differentiated characteristics. Thus, simply culturing such cells included in the term differentiated cells does not render these cells non-differentiated cells (e.g., undifferentiated cells) or pluripotent cells. The transition of a differentiated cell to pluripotency requires a reprogramming stimulus beyond the stimuli that lead to partial loss of differentiated character in culture. Reprogrammed cells also have the characteristic of the capacity of extended passaging without loss of growth potential, relative to primary cell parents, which generally have capacity for only a limited number of divisions in culture.
[00152] The cell to be reprogrammed can be either partially or terminally differentiated prior to reprogramming. In some embodiments, reprogramming encompasses complete reversion of the differentiation state of a differentiated cell (e.g., a somatic cell) to a pluripotent state or a multipotent state. In some embodiments, reprogramming encompasses complete or partial reversion of the differentiation state of a differentiated cell (e.g., a somatic cell) to an undifferentiated cell (e.g., an embryonic-like cell).
[00153] Reprogramming can result in expression of particular genes by the cells, the expression of which further contributes to reprogramming. In certain embodiments described herein, reprogramming of a differentiated cell (e.g., a somatic cell) causes the differentiated cell to assume an undifferentiated state (e.g., is an undifferentiated cell). The resulting cells are referred to as "reprogrammed cells," or "induced pluripotent stem cells (iPSCs or iPS cells)."
[00154] Reprogramming can involve alteration, e.g., reversal, of at least some of the heritable patterns of nucleic acid modification (e.g., methylation), chromatin condensation, epigenetic changes, genomic imprinting, etc., that occur during cellular differentiation.
Reprogramming is distinct from simply maintaining the existing undifferentiated state of a cell that is already pluripotent or maintaining the existing less than fully differentiated state of a cell that is already a multipotent cell (e.g., a hematopoietic stem cell). Reprogramming is also distinct from promoting the self- renewal or proliferation of cells that are already pluripotent or multipotent, although the compositions and methods described herein can also be of use for such purposes, in some embodiments.
[00155] The specific approach or method used to generate pluripotent stem cells from somatic cells is not critical to the claimed invention. Thus, any method that reprograms a somatic cell to the pluripotent phenotype would be appropriate for use in the methods described herein.
[00156] Reprogramming methodologies for generating pluripotent cells using defined combinations of transcription factors have been described. Mouse somatic cells can be converted to ES cell-like cells with expanded developmental potential by the direct transduction of Oct4, Sox2, Klf4, and c-Myc; see, e.g., Takahashi and Yamanaka, Cell 726(4): 663-76 (2006). iPSCs resemble ES cells as they restore the pluripotency- associated transcriptional circuitry and much of the epigenetic landscape. In addition, mouse iPSCs satisfy all the standard assays for pluripotency: specifically, in vitro differentiation into cell types of the three germ layers, teratoma formation, contribution to chimeras, germline transmission [see, e.g., Maherali and Hochedlinger, Cell Stem Cell. 3(6):595-605 (2008)], and tetraploid
complementation.
[00157] Human iPSCs can be obtained using similar transduction methods, and the transcription factor trio, OCT4, SOX2, and NANOG, has been established as the core set of transcription factors that govern pluripotency; see, e.g., Budniatzky and Gepstein, Stem Cells Transl Med. 3(4):448-57 (2014); Barrett et al., Stem Cells Trans Med 3:1 -6 sctm.2014-0121 (2014); Focosi et al., Blood Cancer Journal 4: e21 1 (2014); and references cited therein. The production of iPSCs can be achieved by the introduction of nucleic acid sequences encoding stem cell-associated genes into an adult, somatic cell, historically using viral vectors.
[00158] iPSCs can be generated or derived from terminally differentiated somatic cells, as well as from adult stem cells, or somatic stem cells. That is, a non-pluripotent progenitor cell can be rendered pluripotent or multipotent by reprogramming. In such instances, it may not be necessary to include as many reprogramming factors as required to reprogram a terminally differentiated cell. Further, reprogramming can be induced by the non-viral introduction of reprogramming factors, e.g., by introducing the proteins themselves, or by introducing nucleic acids that encode the reprogramming factors, or by introducing messenger RNAs that upon translation produce the reprogramming factors (see e.g., Warren et al., Cell Stem Cell, 7(5):618-30 (2010). Reprogramming can be achieved by introducing a combination of nucleic acids encoding stem cell-associated genes including, for example Oct-4 (also known as Oct- 3/4 or Pouf51 ), Soxl, Sox2, Sox3, Sox 15, Sox 18, NANOG, Klfl, Klf2, Klf4, Klf5,
NR5A2, c-Myc, 1 -Myc, n-Myc, Rem2, Tert, and LIN28. In one embodiment, reprogramming using the methods and compositions described herein can further comprise introducing one or more of Oct-3/4, a member of the Sox family, a member of the Klf family, and a member of the Myc family to a somatic cell. In one embodiment, the methods and compositions described herein further comprise introducing one or more of each of Oct 4, Sox2, Nanog, c-MYC and Klf4 for reprogramming. As noted above, the exact method used for reprogramming is not necessarily critical to the methods and compositions described herein. However, where cells differentiated from the reprogrammed cells are to be used in, e.g., human therapy, in one embodiment the reprogramming is not effected by a method that alters the genome. Thus, in such embodiments, reprogramming is achieved, e.g., without the use of viral or plasmid vectors.
[00159] The efficiency of reprogramming (i.e., the number of reprogrammed cells) derived from a population of starting cells can be enhanced by the addition of various small molecules as shown by Shi et al., Cell-Stem Cell 2:525-528 (2008); Huangfu et al, Nature Biotechnology 26(7) :795-797 (2008) and Marson et al., Cell-Stem Cell 3: 132-135 (2008). Thus, an agent or combination of agents that enhance the efficiency or rate of induced pluripotent stem cell production can be used in the production of patient-specific or disease-specific iPSCs. Some non-limiting examples of agents that enhance reprogramming efficiency include soluble Wnt, Wnt conditioned media, BIX- 01294 (a G9a histone methyltransferase), PD0325901 (a MEK inhibitor), DNA methyltransferase inhibitors, histone deacetylase (HDAC) inhibitors, valproic acid, 5'- azacytidine, dexamethasone, suberoylanilide, hydroxamic acid (SAHA), vitamin C, and trichostatin (TSA), among others.
[00160] Other non-limiting examples of reprogramming enhancing agents include: Suberoylanilide Hydroxamic Acid (SAHA (e.g., MK0683, vorinostat) and other hydroxamic acids), BML-210, Depudecin (e.g., (-)-Depudecin), HC Toxin, Nullscript (4- (l,3-Dioxo-IH,3H- benzo[de]isoquinolin-2-yl)-N-hydroxybutanamide), Phenylbutyrate (e.g., sodium phenylbutyrate) and Valproic Acid ((VP A) and other short chain fatty acids), Scriptaid, Suramin Sodium, Trichostatin A (TSA), APHA Compound 8, Apicidin, Sodium Butyrate, pivaloyloxymethyl butyrate (Pivanex, AN-9), Trapoxin B, Chlamydocin, Depsipeptide (also known as FR901228 or FK228), benzamides (e.g., CI-994 (e.g., N-acetyl dinaline) and MS-27-275), MGCD0103, NVP- LAQ-824, CBHA (m-carboxycinnaminic acid bishydroxamic acid), JNJ16241 199, Tubacin, A- 161906, proxamide, oxamflatin, 3-CI-UCHA (e.g., 6-(3-chlorophenylureido)caproic hydroxamic acid), AOE (2-amino-8-oxo-9, 10-epoxydecanoic acid), CHAP31 and CHAP 50. Other reprogramming enhancing agents include, for example, dominant negative forms of the HDACs (e.g., catalytically inactive forms), siRNA inhibitors of the HDACs, and antibodies that specifically bind to the HDACs. Such inhibitors are available, e.g., from BIOMOL International, Fukasawa, Merck Biosciences, Novartis, Gloucester Pharmaceuticals, Titan Pharmaceuticals, MethylGene, and Sigma Aldrich.
Methods of Screening gRNA in a Population of Cells
[00161 ] Some embodiments disclosed herein provides methods of screening one or more encoded gRNA molecules in a population of cells for a property to identify an encoded gRNA molecule, wherein the methods use an RNP comprising a Cas9 molecule and a precomplexed RNA or an apo-Cas9 complexed with a ssDNA and a library of nucleic acid sequences encoding one or more encoded gRNA molecules, each of said one or more encoded gRNA molecules comprising a targeting domain.
[00162] In some embodiments, the methods disclosed herein comprise: a) introducing into said population of cells an RNP comprising a Cas9 molecule and a
precomplexed RNA or an apo-Cas9 molecule with a ssDNA; b) introducing into said population of cells a library of nucleic acid sequences encoding one or more encoded gRNA molecules, each of said one or more encoded gRNA molecules comprising a targeting domain; c) assaying a cell of the population of cells for a property; and d) identifying the encoded gRNA molecule introduced into said cell. In some embodiments, introducing into said population of cells an RNP or an apo-Cas9 molecule with a ssDNA precedes introducing into said population of cells a library of nucleic acid sequences. In some embodiments, introducing into said population of cells a library of nucleic acid sequences precedes introducing into said population of cells an RNP or an apo-Cas9 molecule with a ssDNA. In some embodiments, introducing into said population of cells an RNP or an apo-Cas9 molecule with a ssDNA and introducing into said population of cells a library of nucleic acid sequences are performed simultaneously.
[00163] In some embodiments, the population of cells may include a reporter gene. A "reporter gene" encodes proteins that are readily detectable due to their biochemical characteristics, such as enzymatic activity or chemifluorescent features, e.g., fluorescent proteins, or confer resistance to a selection agent. Exemplary fluorescent proteins include, but are not limited to, green fluorescence protein (GFP), EGFP, red fluorescence protein (RFP), blue fluorescence protein (EBFP), cyan fluorescence protein (ECFP), yellow fluorescence protein (YFP), and derivatives or variants thereof. One specific example of such a reporter is green fluorescent protein. Fluorescence generated from this protein can be detected with various commercially-available fluorescent detection systems. Other reporters can be detected by staining. The reporter can also be an enzyme that generates a detectable signal when contacted with an appropriate substrate. The reporter can be an enzyme that catalyzes the formation of a detectable product. Suitable enzymes include, but are not limited to, proteases, nucleases, lipases, phosphatases and hydrolases. The reporter can encode an enzyme whose substrates are substantially impermeable to eukaryotic plasma membranes, thus making it possible to tightly control signal formation. Specific examples of suitable reporter genes that encode enzymes include, but are not limited to, CAT (chloramphenicol acetyl transferase; Alton and Vapnek (1979) Nature 282: 864-869); luciferase (lux); b-galactosidase; LacZ; b. - glucuronidase; aminoglycoside 3'-phosphotransferase, APT 3' II; puromycin Af-acetyl- transferase (PAG); and alkaline phosphatase (Toh, et al. (1980) Eur. J. Biochem. 182: 231 -238; and Hall et al. (1983) J. Mol. Appl. Gen. 2: 101 ), each of which are incorporated by reference herein in its entirety. Other suitable reporters include those that encode for a particular epitope that can be detected with a labeled antibody that specifically recognizes the epitope.
[00164] In some embodiments, the reporter gene may be used for analyzing the effect of the encoded gRNA molecules in a defined region. Such regions include for example a regulatory region in the vicinity of a coding region. For example, a coding sequence for a reporter gene may be inserted into the genome (e.g., in place of the native coding sequence) and its expression or the functional activity of its gene product may be used as the readout. In some instances, the coding sequence of a reporter gene is fused to the native coding sequence, and the readout is the mRNA or protein expression of the resultant fusion protein or the functional activity of the fusion protein. The method can be used to screen and identify sequences involved in cellular processes, including for example gene expression, cell division, cell metabolism, etc. The method can be used to identify mutations that result in loss of function or gain of function, or decrease or increase of transcription. The method may be used to identify the effect of one or more encoded gRNA molecules simultaneously. The method may be used to identify the effect of one or more encoded gRNA molecules in two or more genes, including two or more regulatory regions, two or more coding sequences, or some combination thereof.
Pooled Screen
[00165] It will be appreciated that the methods disclosed herein are suitable for pooled screens, i.e., without compartmentalization of the population of cells or the encoded gRNA molecules. Instead, the population of cells is introduced with the library of nucleic acid sequences encoding one or more gRNA molecules, and an RNP comprising a Cas9 molecule and a precomplexed RNA or an apo-Cas9 molecule with a ssDNA, without separating individual cells. Methods of conducting pooled screens using CRISPR have been disclosed in the literature, e.g., Joung et al., Nat Protoc. 2017 Apr;12(4):828-863; Jaitin et al., Cell. 2016 Dec 15;167(7) :1883-1896; Cross et al, Sci Rep. 2016 Aug 22;6:31782; Munoz et al.,
Cancer Discov. 2016 Aug;6(8):900-13; Marceau et al, Nature. 2016 Jul 7;535(7610):159-63; DeJesus et al., Elite. 2016 Jun 28;5. pii: e17290; Hong et al., Nat Commun. 2016 Jun
22;7:1 1987; Braun et al., Proc Natl Acad Sci U S A. 2016 Jul 5;1 13(27):E3892-900; Miles et al., FEBS J. 2016 Sep;283(17):3170-80; Wang et al., J Biol Chem. 2016 Jul 15;291 (29):15256-66; Parnas et al., Cell. 2015 Jul 30;162(3):675-86; Wang et al., Science. 2014 Jan 3;343(6166):80- 4, the contents of which are hereby incorporated by reference in their entireties.
[00166] Without being bound by theory, because of the higher efficiency of introducing the Cas9 molecule as an RNP or with ssDNA into a cell than other known methods, for example, methods of inducing one or more encoded gRNA molecules into a cell using a Cas9 molecule without a precomplexed RNA or ssDNA, the methods disclosed herein eliminate the need for using individual gRNA formed RNPs, hence eliminate the need for
compartmentalization. The pooled screening methods disclosed herein also eliminate the need for co-introduction of Cas9 and gRNA in a lentiviral vector as described in, e.g., Shalem et al., Science 343:84-87 (2014), which is limited by the size of the lentiviral vector.
[00167] In some embodiments, a selection agent is used to remove cells that have not been introduced with a nucleic acid sequence encoding an encoded gRNA molecule. Exemplary selection agents include, but are not limited to, G418 (Geneticin), puromycin, etc. In some embodiments, flow cytometry is used to remove cells that have not been introduced with a nucleic acid sequence encoding an encoded gRNA molecule, for example, by removing cells that do not express a selection marker, e.g., a fluorescent protein.
[00168] The population of cells can be a single cell type, a mixture of cell types.
In some embodiments, the population of cells can be a biological sample, such as a blood sample, a biopsy, a tissue, a tumor sample, an organ, etc. In some embodiments, the population of cells contains at least 1 x 103 cells, at least 1 x 104 cells, at least 1 x 105 cells, at least 1 x 106 cells, at least 1 x 107 cells, at least 1 x 108 cells, at least 1 x 109 cells, at least 1 x 1010 cells, or more.
[00169] In embodiments where the methods are used for a pooled screen of a phenotype resulting from enhanced expression of a target gene, the methods may further comprise introducing a nucleic acid encoding one or more transcription activation factors, such as VP64, p65, HSF1 , etc., or one or more transcription activation domains, such as p300 histone acetyltransferase domain, etc. In some embodiments, the nucleic acids comprise a vector.
[00170] In some embodiments, the Cas9 may be a catalytically inactive Cas9 (dCas9). In some embodiments, the dCas9 may be fused directly or recruit activation and repression domains, such as VP64 and KRAB, respectively. In some embodiments, the dCas9 may be fused to a cytidine deaminase domain, such as an apolipoprotein B mRNA-editing complex 1 (APOBEC1 ) deaminase domain or an E. coli TadA variant deaminase domain, as described in WO2017070632 and Gaudelli et al., Nature 551 , 464^71 (23 November 2017), the contents of which are hereby incorporated by reference in their entireties.
Library of Nucleic Acid Sequences
[00171 ] As used herein, a“library” refers to a composition comprising a plurality of members of the library. In embodiments, the member of the library is nucleic acid sequence encoding an encoded gRNA molecule. In embodiments, the library is a vector library. In embodiments, the library is random. In other embodiments, the library is rationally designed. In other embodiments, the library comprises a combination of random and rationally designed members. In embodiments, the members of the library include a means for identifying a particular member of the library (e.g., a tag or code).
[00172] The library of nucleic acid sequences disclosed herein can encode one or more gRNA molecules. For example, the library of nucleic acid sequences can encode at least 10, at least 100, at least 1 ,000, at least 10,000, at least 100,000, at least 1 ,000,000, or more gRNA molecules. In some embodiments, the encoded gRNA molecules may each comprise a targeting domain. In some embodiments, the targeting domain of the encoded gRNA molecules specifically binds to a target sequence of an encoded target gene. In some embodiments, the targeting domain of the encoded gRNA molecules specifically binds to a promoter region, an exon, an intron, or a combination thereof, of an encoded target gene. In some embodiments, more than one encoded gRNA molecules may specifically binds to an encoded target gene. For example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, or more encoded gRNA molecules may specifically binds to an encoded target gene. In some embodiments, the library of nucleic acid sequences can encode gRNA molecules that target a whole genome, such as a human genome. In some embodiments, the library of nucleic acid sequences can encode gRNA molecules comprising MS2 binding loops to recruit two different activation domains, p65 and HSF1 . Genome-wide gRNA libraries have been described in Shalem et al., Science 343:84-87 (2014); Kolke-Yusa et al., Nature Biotech. 32:267-273 (2014); Gilbert et al., Cell 159:647-661 (2014); Konermann et al., Nature 517:583-588 (2015), the contents of which are incorporated herein by reference in their entireties. In some embodiments, the library may be a barcoded gRNA library as described in Wong et al., Proc Natl Acad Sci U S A. 2016 Mar 1 ;1 13(9):2544-9, the content of which is hereby incorporated by reference in its entirety.
[00173] In some embodiments, the library of nucleic acids comprises a vector. As used herein, a "vector" is a tool that allows or facilitates the transfer of an entity from one environment to another. It is a replicon, such as a plasmid, phage, or cosmid, into which another DNA segment may be inserted so as to bring about the replication of the inserted segment. Generally, a vector is capable of replication when associated with the proper control elements.
In general, the term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. Vectors include, but are not limited to, nucleic acid molecules that are single-stranded, double- stranded, or partially double-stranded; nucleic acid molecules that comprise one or more free ends, no free ends (e.g. circular); nucleic acid molecules that comprise DNA, RNA, or both; and other varieties of polynucleotides known in the art. One type of vector is a "plasmid," which refers to a circular double stranded DNA loop into which additional DNA segments can be inserted, such as by standard molecular cloning techniques. Another type of vector is a viral vector, wherein virally-derived DNA or RNA sequences are present in the vector for packaging into a virus (e.g., lentiviruses, retroviruses, replication defective retroviruses, adenoviruses, replication defective adenoviruses, and adeno- associated viruses (AAVs)). Viral vectors also include polynucleotides carried by a virus for transfection into a host cell. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g. bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Moreover, certain vectors are capable of directing the expression of genes to which they are operatively- linked. Such vectors are referred to herein as "expression vectors." Common expression vectors of utility in recombinant DNA techniques are often in the form of plasmids.
[00174] Recombinant expression vectors can comprise a nucleic acid of the invention in a form suitable for expression of the nucleic acid in a host cell, which means that the recombinant expression vectors include one or more regulatory elements, which may be selected on the basis of the host cells to be used for expression, that is operatively-linked to the nucleic acid sequence to be expressed. Within a recombinant expression vector, "operably linked" is intended to mean that the nucleotide sequence of interest is linked to the regulatory element(s) in a manner that allows for expression of the nucleotide sequence (e.g. in an in vitro transcription/translation system or in a host cell when the vector is introduced into the host cell). With regards to recombination and cloning methods, mention is made of U.S. patent application 10/815,730, published September 2, 2004 as US 2004-0171 156 Al , the contents of which are herein incorporated by reference in their entireties.
[00175] The vectors can include a selection marker gene, e.g., that encodes puromycin /V-acetyl-transferase (PAC), aminoglycoside 3'-phosphotransferase II (APT 3' II), or a fluorescent protein. Exemplary fluorescent proteins include, but are not limited to, green fluorescence protein (GFP), EGFP, red fluorescence protein (RFP), blue fluorescence protein (EBFP), cyan fluorescence protein (ECFP), yellow fluorescence protein (YFP), and derivatives or variants thereof. In some embodiments, the marker gene may encode a luciferase.
[00176] The vector(s) can include the regulatory element(s), e.g., promoter(s).
The vector(s) can comprise Cas, and/or a single, but possibly also can comprise at least 3 or 8 or 16 or 32 or 48 or 50 RNA(s) (e.g., sgRNAs), such as 1 -2, 1 -3, 1 -4 1 -5, 3-6, 3-7, 3-8, 3-9, 3- 10, 3-8, 3-16, 3-30, 3-32, 3-48, 3-50 RNA(s) (e.g., sgRNAs). In a single vector there can be a promoter for each RNA (e.g., sgRNA), advantageously when there are up to about 16 RNA(s) (e.g., sgRNAs); and, when a single vector provides for more than 16 RNA(s) (e.g., sgRNAs), one or more promoter(s) can drive expression of more than one of the RNA(s) (e.g., sgRNAs), e.g., when there are 32 RNA(s) (e.g., sgRNAs), each promoter can drive expression of two RNA(s) (e.g., sgRNAs), and when there are 48 RNA(s) (e.g., sgRNAs), each promoter can drive expression of three RNA(s) (e.g., sgRNAs). By simple arithmetic and well established cloning protocols and the teachings in this disclosure one skilled in the art can readily practice the invention as to the RNA(s) (e.g., sgRNA(s) for a suitable exemplary vector such as AAV, and a suitable promoter such as the U6 promoter, e.g., U6-sgRNAs. For example, the packaging limit of AAV is -4.7 kb. The length of a single U6-sgRNA (plus restriction sites for cloning) is 361 bp. Therefore, the skilled person can readily fit about 12-16, e.g., 13 U6-sgRNA cassettes in a single vector. This can be assembled by any suitable means, such as a golden gate strategy used for TALE assembly (http://www.genome-engineering.org/taleffectors/). The skilled person can also use a tandem guide strategy to increase the number of U6-sgRNAs by approximately 1 .5 times, e.g., to increase from 12-16, e.g., 13 to approximately 18-24, e.g., about 19 U6- sgRNAs. Therefore, one skilled in the art can readily reach approximately 18-24, e.g., about 19 promoter-RNAs, e.g., U6- sgRNAs in a single vector, e.g., an AAV vector. A further means for increasing the number of promoters and RNAs, e.g., sgRNA(s) in a vector is to use a single promoter (e.g., U6) to express an array of RNAs, e.g., sgRNAs separated by cleavable sequences. And an even further means for increasing the number of promoter-RNAs, e.g., sgRNAs in a vector, is to express an array of promoter-RNAs, e.g., sgRNAs separated by cleavable sequences in the intron of a coding sequence or gene; and, in this instance it is advantageous to use a polymerase II promoter, which can have increased expression and enable the transcription of long RNA in a tissue specific manner (see, e.g.,
http://nar.oxfordjournals.Org/content/34/7/e53.short,
http://www.nature.com/mt/journal/vl6/n9/abs/mt2008144a.html). In an advantageous
embodiment, AAV may package U6 tandem sgRNA targeting up to about 50 genes.
Accordingly, from the knowledge in the art and the teachings in this disclosure the skilled person can readily make and use vector(s), e.g., a single vector, expressing multiple RNAs or guides or sgRNAs under the control or operatively or functionally linked to one or more promoters— especially as to the numbers of RNAs or guides or sgRNAs discussed herein, without any undue experimentation.
[00177] The RNA(s), e.g., sgRNA(s), can be functionally or operatively linked to regulatory element(s) and hence the regulatory element(s) drive expression. The promoter(s) can be constitutive promoter(s) and/or inducible promoter(s) and/or tissue specific promoter(s). The promoter can be selected from the group consisting of RNA polymerases, pol I, pol II, pol III, T7, U6, HI, retroviral Rous sarcoma virus (RSV) LTR promoter, the cytomegalovirus (CMV) promoter, the SV40 promoter, the dihydrofolate reductase promoter, the b-actin promoter, the phosphoglycerol kinase (PGK) promoter, and the EFIa promoter. An advantageous promoter is the promoter U6.
[00178] Aspects of the invention also relate to bicistronic vectors for chimeric RNA and Cas. Bicistronic expression vectors for chimeric RNA and Cas are preferred. In general and particularly in this embodiment Cas is preferably driven by the CBh promoter. The chimeric RNA may preferably be driven by a Pol III promoter, such as a U6 promoter. Ideally the two are combined. The chimeric guide RNA typically consists of a 20bp guide sequence (Ns) and this may be joined to the tracr sequence (running from the first "U" of the lower strand to the end of the transcript). The tracr sequence may be truncated at various positions as indicated. The guide and tracr sequences are separated by the tracr-mate sequence, which may be
GUUUUAGAGCUA (SEQ ID NO: 75). This may be followed by the loop sequence GAAA (SEQ ID NO: 76). Both of these are preferred examples. ChiRNAs are indicated by their "+n" designation, and crRNA refers to a hybrid RNA where guide and tracr sequences are expressed as separate transcripts. Throughout this application, chimeric RNA may also be called single guide, or synthetic guide RNA (sgRNA). The loop is preferably GAAA (SEQ ID NO: 76), but it is not limited to this sequence or indeed to being only 4bp in length. Indeed, preferred loop forming sequences for use in hairpin structures are four nucleotides in length, and most preferably have the sequence GAAA (SEQ ID NO: 76). However, longer or shorter loop sequences may be used, as may alternative sequences. The sequences preferably include a nucleotide triplet (for example, AAA), and an additional nucleotide (for example C or G). Examples of loop forming sequences include CAAA (SEQ ID NO: 77) and AAAG (SEQ ID NO: 78). In practicing any of the methods disclosed herein, a suitable vector can be introduced to a cell or an embryo via one or more methods known in the art, including without limitation, microinjection, electroporation, sonoporation, biolistics, calcium phosphate-mediated transfection, cationic transfection, liposome transfection, dendrimer transfection, heat shock transfection, nucleofection
transfection, magnetofection, lipofection, impalefection, optical transfection, proprietary agent- enhanced uptake of nucleic acids, and delivery via liposomes, immunoliposomes, virosomes, or artificial virions. In some methods, the vector is introduced into an embryo by microinjection.
The vector or vectors may be microinjected into the nucleus or the cytoplasm of the embryo. In some methods, the vector or vectors may be introduced into a cell by nucleofection.
[00179] The term "regulatory element" is intended to include promoters, enhancers, internal ribosomal entry sites (IRES), and other expression control elements (e.g. transcription termination signals, such as polyadenylation signals and poly-U sequences). Such regulatory elements are described, for example, in Goeddel, GENE EXPRESSION
TECHNOLOGY: METHODS IN ENZYMOLOGY 185, Academic Press, San Diego, Calif. (1990). Regulatory elements include those that direct constitutive expression of a nucleotide sequence in many types of host cell and those that direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences). A tissue-specific promoter may direct expression primarily in a desired tissue of interest, such as muscle, neuron, bone, skin, blood, specific organs (e.g. liver, pancreas), or particular cell types (e.g. lymphocytes).
Regulatory elements may also direct expression in a temporal-dependent manner, such as in a cell-cycle dependent or developmental stage-dependent manner, which may or may not also be tissue or cell-type specific. In some embodiments, a vector comprises one or more pol III promoter (e.g. 1 , 2, 3, 4, 5, or more pol III promoters), one or more pol II promoters (e.g. 1 , 2, 3, 4, 5, or more pol II promoters), one or more pol I promoters (e.g. 1 , 2, 3, 4, 5, or more pol I promoters), or combinations thereof. Examples of pol III promoters include, but are not limited to, U6 and HI promoters. Examples of pol II promoters include, but are not limited to, the retroviral Rous sarcoma virus (RSV) LTR promoter (optionally with the RSV enhancer), the cytomegalovirus (CMV) promoter (optionally with the CMV enhancer) [see, e.g., Boshart et al, Cell, 41 :521 -530 (1985)], the SV40 promoter, the dihydrofolate reductase promoter, the b-actin promoter, the phosphoglycerol kinase (PGK) promoter, and the EF-1 a promoter. Also encompassed by the term "regulatory element" are enhancer elements, such as WPRE; CMV enhancers; the R-U5' segment in LTR of HTLV-I (Mol. Cell. Biol., Vol. 8(1 ), p. 466-472, 1988); SV40 enhancer; and the intron sequence between exons 2 and 3 of rabbit b-globin (Proc. Natl. Acad. Sci. USA., Vol. 78(3), p. 1527-31 , 1981 ). It will be appreciated by those skilled in the art that the design of the expression vector can depend on such factors as the choice of the host cell to be transformed, the level of expression desired, etc. A vector can be introduced into host cells to thereby produce transcripts, proteins, or peptides, including fusion proteins or peptides, encoded by nucleic acids as described herein (e.g., clustered regularly interspersed short palindromic repeats (CRISPR) transcripts, proteins, enzymes, mutant forms thereof, fusion proteins thereof, etc.). With regards to regulatory sequences, mention is made of U.S. patent application 10/491 ,026, the contents of which are incorporated by reference herein in their entireties. With regards to promoters, mention is made of PCT publication WO 201 1/028929 and U.S. application 12/51 1 ,940, the contents of which are incorporated by reference herein in their entireties.
[00180] Vectors can be designed for expression of CRISPR transcripts (e.g. nucleic acid transcripts, proteins, or enzymes) in prokaryotic or eukaryotic cells. For example, CRISPR transcripts can be expressed in bacterial cells such as Escherichia coli, insect cells (using baculovirus expression vectors), yeast cells, or mammalian cells. Suitable host cells are discussed further in Goeddel, GENE EXPRESSION TECHNOLOGY: METHODS IN ENZYMOLOGY 185, Academic Press, San Diego, Calif. (1990). Alternatively, the recombinant expression vector can be transcribed and translated in vitro, for example using T7 promoter regulatory sequences and T7 polymerase.
[00181 ] Vectors may be introduced and propagated in a prokaryote or prokaryotic cell. In some embodiments, a prokaryote is used to amplify copies of a vector to be introduced into a eukaryotic cell or as an intermediate vector in the production of a vector to be introduced into a eukaryotic cell (e.g. amplifying a plasmid as part of a viral vector packaging system). In some embodiments, a prokaryote is used to amplify copies of a vector and express one or more nucleic acids, such as to provide a source of one or more proteins for delivery to a host cell or host organism. Expression of proteins in prokaryotes is most often carried out in Escherichia coli with vectors containing constitutive or inducible promoters directing the expression of either fusion or non-fusion proteins. Fusion vectors add a number of amino acids to a protein encoded therein, such as to the amino terminus of the recombinant protein. Such fusion vectors may serve one or more purposes, such as: (i) to increase expression of recombinant protein; (ii) to increase the solubility of the recombinant protein; and (iii) to aid in the purification of the recombinant protein by acting as a ligand in affinity purification. Often, in fusion expression vectors, a proteolytic cleavage site is introduced at the junction of the fusion moiety and the recombinant protein to enable separation of the recombinant protein from the fusion moiety subsequent to purification of the fusion protein. Such enzymes, and their cognate recognition sequences, include Factor Xa, thrombin and enterokinase. Example fusion expression vectors include pGEX (Pharmacia Biotech Inc; Smith and Johnson, 1988. Gene 67: 31 -40), pMAL (New England Biolabs, Beverly, Mass.) and pRIT5 (Pharmacia, Piscataway, N.J.) that fuse
glutathione S- transferase (GST), maltose E binding protein, or protein A, respectively, to the target recombinant protein. Examples of suitable inducible non-fusion E. coli expression vectors include pTrc (Amrann et al., (1988) Gene 69:301 -315) and pET I id (Studier et al., GENE EXPRESSION TECHNOLOGY: METHODS IN ENZYMOLOGY 185, Academic Press, San Diego, Calif. (1990) 60-89). In some embodiments, a vector is a yeast expression vector.
Examples of vectors for expression in yeast Saccharomyces cerivisae include pYepSecl (Baldari, et al., 1987. EMBO J. 6: 229-234), pMFa (Kuijan and Herskowitz, 1982. Cell 30: 933- 943), pJRY88 (Schultz et al, 1987. Gene 54: 1 13-123), pYES2 (Invitrogen Corporation, San Diego, Calif), and picZ (InVitrogen Corp, San Diego, Calif.). In some embodiments, a vector drives protein expression in insect cells using baculovirus expression vectors. Baculovirus vectors available for expression of proteins in cultured insect cells (e.g., SF9 cells) include the pAc series (Smith, et al., 1983. Mol. Cell. Biol. 3: 2156-2165) and the pVL series (Lucklow and Summers, 1989. Virology 170: 31 -39).
[00182] In some embodiments, a vector is capable of driving expression of one or more sequences in mammalian cells using a mammalian expression vector. Examples of mammalian expression vectors include pCDM8 (Seed, 1987. Nature 329: 840) and pMT2PC (Kaufman, et al., 1987. EMBO J. 6: 187-195). When used in mammalian cells, the expression vector's control functions are typically provided by one or more regulatory elements. For example, commonly used promoters are derived from polyoma, adenovirus 2, cytomegalovirus, simian virus 40, and others disclosed herein and known in the art. For other suitable expression systems for both prokaryotic and eukaryotic cells see, e.g., Chapters 16 and 17 of Sambrook, et al., MOLECULAR CLONING: A LABORATORY MANUAL. 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989.
[00183] In some embodiments, the recombinant mammalian expression vector is capable of directing expression of the nucleic acid preferentially in a particular cell type (e.g., tissue- specific regulatory elements are used to express the nucleic acid). Tissue-specific regulatory elements are known in the art. Non-limiting examples of suitable tissue-specific promoters include the albumin promoter (liver-specific; Pinkert, et al., 1987. Genes Dev. 1 : 268- 277), lymphoid-specific promoters (Calame and Eaton, 1988. Adv. Immunol. 43: 235-275), in particular promoters of T cell receptors (Winoto and Baltimore, 1989. EMBO J. 8: 729-733) and immunoglobulins (Baneiji, et al., 1983. Cell 33: 729-740; Queen and Baltimore, 1983. Cell 33: 741 -748), neuron-specific promoters (e.g., the neurofilament promoter; Byrne and Ruddle,
1989. Proc. Natl. Acad. Sci. USA 86: 5473-5477), pancreas-specific promoters (Edlund, et al., 1985. Science 230: 912-916), and mammary gland-specific promoters (e.g., milk whey promoter; U.S. Pat. No. 4,873,316 and European Application Publication No. 264,166).
Developmental^- regulated promoters are also encompassed, e.g., the murine hox promoters (Kessel and Gruss, 1990. Science 249: 374-379) and the a-fetoprotein promoter (Campes and Tilghman, 1989. Genes Dev. 3: 537-546). With regards to these prokaryotic and eukaryotic vectors, mention is made of U.S. Patent 6,750,059, the contents of which are incorporated by reference herein in their entireties. Other embodiments of the invention may relate to the use of viral vectors, with regards to which mention is made of U.S. Patent application 13/092,085, the contents of which are incorporated by reference herein in their entireties. Tissue-specific regulatory elements are known in the art and in this regard, mention is made of U.S. Patent 7,776,321 , the contents of which are incorporated by reference herein in their entireties. In some embodiments, a regulatory element is operably linked to one or more elements of a CRISPR system so as to drive expression of the one or more elements of
the CRISPR system. In general, CRISPRs (Clustered Regularly Interspaced Short Palindromic Repeats), also known as SPIDRs (SPacer Interspersed Direct Repeats), constitute a family of DNA loci that are usually specific to a particular bacterial species. The CRISPR locus comprises a distinct class of interspersed short sequence repeats (SSRs) that were recognized in E. coli (Ishino et al., J. Bacteriol., 169:5429-5433 [1987]; and Nakata et al., J. Bacteriol., 171 :3553- 3556 [1989]), and associated genes. Similar interspersed SSRs have been identified in
Haloferax mediterranei, Streptococcus pyogenes, Anabaena, and Mycobacterium tuberculosis (See, Groenen et al., Mol. Microbiol., 10:1057-1065 [1993]; Hoe et al., Emerg. Infect. Dis., 5:254-263 [1999]; Masepohl et al., Biochim. Biophys. Acta 1307:26-30 [1996]; and Mojica et al., Mol. Microbiol., 17:85-93 [1995]). The CRISPR loci typically differ from other SSRs by the structure of the repeats, which have been termed short regularly spaced repeats (SRSRs) (Janssen et al., OMICS J. Integ. Biol., 6:23-33 [2002]; and Mojica et al., Mol. Microbiol., 36:244- 246 [2000]). In general, the repeats are short elements that occur in clusters that are regularly spaced by unique intervening sequences with a substantially constant length (Mojica et al., [2000], supra). Although the repeat sequences are highly conserved between strains, the number of interspersed repeats and the sequences of the spacer regions typically differ from strain to strain (van Embden et al, J. Bacteriol., 182:2393-2401 [2000]). CRISPR loci have been identified in more than 40 prokaryotes (See e.g., Jansen et al., Mol. Microbiol., 43:1565-1575 [2002]; and Mojica et al., [2005]) including, but not limited to Aeropyrum, Pyrobaculum, Sulfolobus, Archaeoglobus, Halocarcula, Methanobacterium, Methanococcus, Methanosarcina, Methanopyrus, Pyrococcus, Picrophilus, Thermoplasma, Corynebacterium, Mycobacterium, Streptomyces, Aquifex, Porphyromonas, Chlorobium, Thermus, Bacillus, Listeria,
Staphylococcus, Clostridium, Thermoanaerobacter, Mycoplasma, Fusobacterium, Azarcus, Chromobacterium, Neisseria, Nitrosomonas, Desulfovibrio, Geobacter, Myxococcus,
Campylobacter, Wolinella, Acinetobacter, Erwinia, Escherichia, Legionella, Methylococcus, Pasteurella, Photobacterium, Salmonella, Xanthomonas, Yersinia, Treponema, and
Thermotoga. In some embodiments, one or more vectors driving expression of one or more elements of a CRISPR system (such as the Cas and or the RNA guiding the Cas to a genomic target locus in a eukaryotic cell as referred to herein elsewhere) are introduced into a host cell such that expression of the elements of the CRISPR system direct formation of
a CRISPR complex at one or more target sites. For example, a Cas enzyme, a guide sequence linked to a tracr-mate sequence, and a tracr sequence could each be operably linked to separate regulatory elements on separate vectors. Alternatively, two or more of the elements expressed from the same or different regulatory elements, may be combined in a single vector, with one or more additional Vectors providing any components of the CRISPR system not included in the first vector. CRISPR system elements that are combined in a single vector may be arranged in any suitable orientation, such as one element located 5' with respect to
("upstream" of) or 3' with respect to ("downstream" of) a second element. The coding sequence of one element may be located on the same or opposite strand of the coding sequence of a second element, and oriented in the same or opposite direction. In some embodiments, a single promoter drives expression of a transcript encoding a Cas and one or more of the guide sequence, tracr mate sequence (optionally operably linked to the guide sequence), and a tracr sequence embedded within one or more intron sequences (e.g. each in a different intron, two or more in at least one intron, or all in a single intron). In some embodiments, the Cas, guide sequence, tracr mate sequence, and tracr sequence are operably linked to and expressed from the same promoter. Delivery vehicles, vectors, particles, nanoparticles, formulations and components thereof for expression of one or more elements of a CRISPR system are as used in the foregoing documents, such as WO 2014/093622 (PCT/US2013/074667). In some embodiments, a vector comprises one or more insertion sites, such as a restriction
endonuclease recognition sequence (also referred to as a "cloning site"). In some embodiments, one or more insertion sites (e.g. about or more than about 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, or more insertion sites) are located upstream and/or downstream of one or more sequence elements of one or more vectors. In some embodiments, a vector comprises an insertion site upstream of a tracr mate sequence, and optionally downstream of a regulatory element operably linked to the tracr mate sequence, such that following insertion of a guide sequence into the insertion site and upon expression the guide sequence directs sequence-specific binding of a CRISPR complex to a target sequence in a eukaryotic cell. In some embodiments, a vector comprises two or more insertion sites, each insertion site being located between two tracr mate sequences so as to allow insertion of a guide sequence at each site. In such an arrangement, the two or more guide sequences may comprise two or more copies of a single guide sequence, two or more different guide sequences, or combinations of these. When multiple different guide sequences are used, a single expression construct may be used to target CRISPR activity to multiple different, corresponding target sequences within a cell. For example, a single vector may comprise about or more than about 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, or more guide sequences. In some embodiments, about or more than about 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, or more such guide-sequence-containing vectors may be provided, and optionally delivered to a cell. In some embodiments, a vector comprises a regulatory element operably linked to an enzyme coding sequence encoding a Cas protein. Cas protein or Cas mRNA or CRISPR guide RNA or RNA(s) can be delivered separately; and advantageously at least one of these is delivered via a particle complex. Cas mRNA can be delivered prior to the guide RNA to give time for Cas to be expressed. Cas mRNA might be administered 1 -12 hours (preferably around 2-6 hours) prior to the administration of guide RNA. Alternatively, Cas mRNA and guide RNA can be administered together. Advantageously, a second booster dose of guide RNA can be administered 1 -12 hours (preferably around 2-6 hours) after the initial administration of Cas mRNA + guide RNA. Additional administrations of Cas mRNA and/or guide RNA might be useful to achieve the most efficient levels of genome modification. [00184] In some embodiments, the library of nucleic acids is introduced to the population of cells to achieve a low multiplicity of infection (MOI) such that most cells receive a single vector. For example, the library of nucleic acids is introduced to the population of cells to achieve an MOI of less than 1 .
Assaying for a Property
[00185] A variety of properties can be assessed by assaying the population of cells after the introduction of the library of nucleic acid sequences encoding one or more encoded gRNA molecules, such as cell survival, cell death, cell growth, cell differentiation, cell activation, gene expression (single gene expression, e.g., fetal haemoglobin, multiple gene expression, reporter gene expression, etc.), a phenotypic change, or a combination thereof. In some embodiments, the population of cells may be assessed for a modification, e.g., a reduction or an enhancement, of a phenotype resulting from introducing the precomplexed gRNA. It will be appreciated that the assays can be used to assess any phenotypic change that affect cell growth or that are selectable by cell sorting using intracellular or cell surface markers (e.g., FACS). For example, the population of cells may be labelled by an antibody that specifically binds to a cell surface marker or an epitope encoded by a reporter gene. Exemplary cell surface markers include, but are not limited to, CD44, CD133, CD24, CD90, CD271 , CD49f, CD13, CXCR4, CD48, CD150, CD244, CD34, CD38, SCA-1 , Thy1 .1 , C-kit, lin, CD135, CD1 1 b, CD31 , CD1 17, CD45, CD4, CD8, CD15, CD24, CD1 14, CD182, CD14, CD1 1 a, CD91 , CD16, CD3, CD25, FAXP3, CD19, CD20, CD22, CD61 , CD56, CD30, etc. In some embodiments, the population of cells may be stained for an intracellular marker, e.g., intracellular Zn2+, etc. In some embodiments, the population of cells may be sorted by the expression of a reporter protein as disclosed herein. In some embodiments, the assaying a cell of the population of cells for a property comprises comparing the level of the reporter gene product in the cell to a reference level. In some embodiments, the assaying a cell of the population of cells for a property comprises growing the population of cells in the presence of a selection agent.
Exemplary selection agents include, but are not limited to, G418 (Geneticin), puromycin, etc. In some embodiments, assaying a cell of the population of cells for a property may comprise analyzing the expression level of one or more reporter genes in the cell. In some embodiments, the cell is identified as having the property if the difference in the level of the reporter gene product of the cell compared to the reference level has a Z-score of less than -3 or greater than 3. [00186] In some embodiments, assaying a cell of the population of cells for a property may comprise analyzing the expression level of one or more genes in the cell.
Techniques for single-cell gene expression analysis are known in the art, for example, CRISP- seq, Perturb-seq (Jaitin DA, Weiner A, Yofe I, Lara-Astiaso D, Keren-Shaul H, David E, et al. Dissecting Immune Circuits by Linking CRISPR-Pooled Screens with Single-Cell RNA-Seq.
Cell. 2016;167(7) :1883-96. e15; Dixit A, Parnas O, Li B, Chen J, Fulco CP, Jerby-Arnon L, et al. Perturb-Seq: Dissecting Molecular Circuits with Scalable Single-Cell RNA Profiling of Pooled Genetic Screens. Cell. 2016;167(7):1853-66. e17; Adamson B, Norman TM, Jost M, Cho MY, Nunez JK, Chen Y, et al. A Multiplexed Single-Cell CRISPR Screening Platform Enables Systematic Dissection of the Unfolded Protein Response. Cell. 2016;167(7) :1867-82. e21 , the contents of which are hereby incorporated by reference in their entireties), etc.
[00187] In some embodiments, the population of cells can be grown for a period of time in vitro, ex vivo or in vivo. For example, the population of cells, after the introduction of the library of nucleic acid sequences encoding one or more encoded gRNA molecules, can be grown in vitro, ex vivo or in vivo for a length that is, is about, is less than, is more than, 1 hr, 2 hr, 3 hr, 4 hr, 5 hr, 6 hr, 12 hr, 18 hr, 1 d, 2 d, 3 d, 4 d, 5 d, 6 d, 7 d, 8 d, 9 d, 10 d, 1 1 d, 12 d, 13 d, 14 d, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 2 months, 3 months, 4 months, 5 months, 6 months, or a range between any two of the above values.
[00188] In some embodiments, the population of cells can be subjected to a variety of treatments or conditions such as an anti-tumor agent, an anti-inflammatory agent, an immunomodulatory, a growth factor, a cytokine, a differentiation factor, an antibacterial agent, a physical shock, a tumorigenesis agent, etc. In particular embodiments corticosteroid anti inflammatory agents may be used to treat the population of cells. Corticosteroids for use may be selected from any of methylprednisolone, hydrocortisone, prednisone, budenisonide, mesalamine, and dexamethasone. In particular embodiments immunomodulator selected from any of 6-mercaptopurine, azathioprine, cyclosporine A, tacrolimus, and methotrexate. In particular embodiments an immunomodulator is selected from an anti-TNF agent (e.g., infliximab, adalimumab, certolizumab, golimumab), natalizumab, and vedolizumab. Exemplary antibacterial agents include without limitation sulfonamides (e.g., sulfanilamide, sulfadiazine, sulfamethoxazole, sulfisoxazole, sulfacetamide), trimethoprim, quinolones (e.g., nalidixic acid, cinoxacin, norfloxacin, ciprofloxacin, ofloxacin, sparfloxacin, fleroxacin, perloxacin, levofloxacin, garenoxacin and gemifloxacin), methenamine, nitrofurantoin, penicillins (e.g., penicillin G, penicillin V, methicilin oxacillin, cloxacillin, dicloxacillin, nafcilin, ampicillin, amoxicillin, carbenicillin, ticarcillin, mezlocillin, and piperacillin), cephalosporins (e.g., cefazolin, cephalexin, cefadroxil, cefoxitin, cefaclor, cefprozil, cefuroxime, cefuroxime acetil, loracarbef, cefotetan, ceforanide, cefotaxime, cefpodoxime proxetil, cefibuten, cefdinir, cefditoren pivorxil, ceftizoxime, ceftriaxone, cefoperazone, ceftazidime, and cefepine), carbapenems (e.g., imipenem, aztreonam), and aminoglycosides (e.g., neomycin, kanamycin, streptomycin, gentamicin, toramycin, netilmicin, and amikacin).
[00189] In some embodiments, an anti-tumor agent is selected from tyrosine kinase inhibitors, including but not limited to, EGFR inhibitors, Her2 inhibitors, Her3 inhibitors, IGFR inhibitors, and Met inhibitors. For example, tyrosine kinase inhibitors include but are not limited to, Erlotinib hydrochloride (Tarceva®); Linifanib (N-[4-(3-amino-1 H-indazol-4-yl)phenyl]- N'-(2-fluoro-5-methylphenyl)urea, also known as ABT 869, available from Genentech); Sunitinib malate (Sutent®); Bosutinib (4-[(2,4-dichloro-5-methoxyphenyl)amino]-6-methoxy-7-[3-(4- methylpiperazin-1 -yl)propoxy]quinoline-3-carbonitrile, also known as SKI-606, and described in US Patent No. 6,780,996); Dasatinib (Sprycel®); Pazopanib (Votrient®) ; Sorafenib
(Nexavar®); Zactima (ZD6474); nilotinib (Tasigna®); Regorafenib (Stivarga®) and Imatinib or Imatinib mesylate (Gilvec® and Gleevec®). Epidermal growth factor receptor (EGFR) inhibitors include but are not limited to, Erlotinib hydrochloride (Tarceva®), Gefitnib (Iressa®); N-[4-[(3- Chloro-4-fluorophenyl)amino]-7-[[(3"S")-tetrahydro-3-furanyl]oxy]-6-quinazolinyl]- 4(dimethylamino)-2-butenamide, Tovok®); Vandetanib (Caprelsa®); Lapatinib (Tykerb®); (3R,4R)-4-Amino-1 -((4-((3-methoxyphenyl)amino)pyrrolo[2,1 -f][1 ,2,4]triazin-5- yl)methyl)piperidin-3-ol (BMS690514) ; Canertinib dihydrochloride (CI-1033); 6-[4-[(4-Ethyl-1 - piperazinyl)methyl]phenyl]-N-[(1 R)-1 -phenylethyl]- 7H-Pyrrolo[2,3-d]pyrimidin-4-amine (AEE788, CAS 497839-62-0) ; Mubritinib (TAK165); Pelitinib (EKB569); Afatinib (BIBW2992); Neratinib (HKI-272); N-[4-[[1 -[(3-Fluorophenyl)methyl]-1 H-indazol-5-yl]amino]-5-methylpyrrolo[2,1 - f][1 ,2,4]triazin-6-yl]-carbamic acid, (3S)-3-morpholinylmethyl ester (BMS599626) ; N-(3,4- Dichloro-2-fluorophenyl)-6-methoxy-7-[[(3aa,5 ,6aa)-octahydro-2-methylcyclopenta[c]pyrrol-5- yl]methoxy]- 4-quinazolinamine (XL647, CAS 781613-23-8); and 4-[4-[[(1 R)-1 - Phenylethyl]amino]-7H-pyrrolo[2,3-d]pyrimidin-6-yl]-phenol (PKI166, CAS 187724-61 -4). EGFR antibodies include but are not limited to, Cetuximab (Erbitux®); Panitumumab (Vectibix®);
Matuzumab (EMD-72000); Nimotuzumab (hR3); Zalutumumab; TheraCIM h-R3; MDX0447 (CAS 339151 -96-1 ); and ch806 (mAb-806, CAS 946414-09-1 ). Human Epidermal Growth Factor Receptor 2 (HER2 receptor) (also known as Neu, ErbB-2, CD340, or p185) inhibitors include but are not limited to, Trastuzumab (Herceptin®); Pertuzumab (Omnitarg®); Neratinib (HKI-272, (2E)-N-[4-[[3-chloro-4-[(pyridin-2-yl)methoxy]phenyl]amino]-3-cyano-7-ethoxyquinolin- 6-yl]-4-(dimethylamino)but-2-enamide, and described PCT Publication No. WO 05/028443); Lapatinib or Lapatinib ditosylate (Tykerb®); (3R,4R)-4-amino-1 -((4-((3- methoxyphenyl)amino)pyrrolo[2,1 -f][1 ,2,4]triazin-5-yl)methyl)piperidin-3-ol (BMS690514); (2E)- N-[4-[(3-Chloro-4-fluorophenyl)amino]-7-[[(3S)-tetrahydro-3-furanyl]oxy]-6-quinazolinyl]-4- (dimethylamino)-2-butenamide (BIBW-2992, CAS 850140-72-6); N-[4-[[1 -[(3- Fluorophenyl)methyl]-1 H-indazol-5-yl]amino]-5-methylpyrrolo[2,1 -f][1 ,2,4]triazin-6-yl]-carbamic acid, (3S)-3-morpholinylmethyl ester (BMS 599626, CAS 714971 -09-2); Canertinib
dihydrochloride (PD183805 or CI-1033); and N-(3,4-Dichloro-2-fluorophenyl)-6-methoxy-7- [[(3aa,5 ,6aa)-octahydro-2-methylcyclopenta[c]pyrrol-5-yl]methoxy]- 4-quinazolinamine (XL647, CAS 781613-23-8). HER3 inhibitors include but are not limited to, LJM716, MM-121 , AMG-888, RG71 16, REGN-1400, AV-203, MP-RM-1 , MM-1 1 1 , and ME HD-7945 A. MET inhibitors include but are not limited to, Cabozantinib (XL184, CAS 849217-68-1 ); Foretinib (GSK1363089, formerly XL880, CAS 849217-64-7); Tivantinib (ARQ197, CAS 1000873-98-2); 1 -(2-Hydroxy-2- methylpropyl)-N-(5-(7-methoxyquinolin-4-yloxy)pyridin-2-yl)-5-methyl-3-oxo-2-phenyl-2,3- dihydro-1 H-pyrazole-4-carboxamide (AMG 458); Cryzotinib (Xalkori®, PF-02341066); (3Z)-5- (2,3-Dihydro-1 H-indol-1 -ylsulfonyl)-3-({3,5-dimethyl-4-[(4-methylpiperazin-1 -yl)carbonyl]-1 H- pyrrol-2-yl}methylene)-1 ,3-dihydro-2H-indol-2-one (SU1 1271 ); (3Z)-N-(3-Chlorophenyl)-3-({3,5- dimethyl-4-[(4-methylpiperazin-1 -yl)carbonyl]-1 H-pyrrol-2-yl}methylene)-N-methyl-2-oxoindoline- 5-sulfonamide (SU1 1274); (3Z)-N-(3-Chlorophenyl)-3-{[3,5-dimethyl-4-(3-morpholin-4-ylpropyl)- 1 H-pyrrol-2-yl]methylene}-N-methyl-2-oxoindoline-5-sulfonamide (SU1 1606); 6-[Difluoro[6-(1 - methyl-1 H-pyrazol-4-yl)-1 ,2,4-triazolo[4,3-b]pyridazin-3-yl]methyl]-quinoline (JNJ38877605, CAS 943540-75-8); 2-[4-[1 -(Quinolin-6-ylmethyl)-1 H-[1 ,2,3]triazolo[4,5-b]pyrazin-6-yl]-1 H-pyrazol-1 - yl]ethanol (PF04217903, CAS 956905-27-4); N-((2R)-1 ,4-Dioxan-2-ylmethyl)-N-methyl-N'-[3-(1 - methyl-1 H-pyrazol-4-yl)-5-oxo-5H-benzo[4,5]cyclohepta[1 ,2-b]pyridin-7-yl]sulfamide (MK2461 , CAS 917879-39-1 ) ; 6-[[6-(1 -Methyl-1 H-pyrazol-4-yl)-1 ,2,4-triazolo[4,3-b]pyridazin-3-yl]thio]- quinoline (SGX523, CAS 1022150-57-7); and (3Z)-5-[[(2,6-Dichlorophenyl)methyl]sulfonyl]-3- [[3,5-dimethyl-4-[[(2R)-2-(1 -pyrrolidinylmethyl)-1 -pyrrolidinyl]carbonyl]-1 H-pyrrol-2-yl]methylene]- 1 ,3-dihydro-2H-indol-2-one (PHA665752, CAS 477575-56-7). IGF1 R inhibitors include but are not limited to, BMS-754807, XL-228, OSI-906, GSK0904529A, A-928605, AXL1717, KW-2450, MK0646, AMG479, IMCA12, MEDI-573, and BI836845. See e.g., Yee, JNCI, 104; 975 (2012) for review.
[00190] In some embodiments, an anti-tumor agent is selected from FGF downstream signaling pathway inhibitors, including but not limited to, MEK inhibitors, Braf inhibitors, PI3K/Akt inhibitors, SHP2 inhibitors, and also mTor inhibitors. For example, mitogen- activated protein kinase (MEK) inhibitors include but are not limited to, XL-518 (also known as GDC-0973, Cas No. 1029872-29-4, available from ACC Corp.); 2-[(2-Chloro-4- iodophenyl)amino]-N-(cyclopropylmethoxy)-3,4-difluoro-benzamide (also known as CI-1040 or PD184352 and described in PCT Publication No. W02000035436); N-[(2R)-2,3- Dihydroxypropoxy]-3,4-difluoro-2-[(2-fluoro-4-iodophenyl)amino]- benzamide (also known as PD0325901 and described in PCT Publication No. W02002006213); 2,3-Bis[amino[(2- aminophenyl)thio]methylene]-butanedinitrile (also known as U0126 and described in US Patent No. 2,779,780); N-[3,4-Difluoro-2-[(2-fluoro-4-iodophenyl)amino]-6-methoxyphenyl]-1 -[(2R)-2,3- dihydroxypropyl]- cyclopropanesulfonamide (also known as RDEA1 19 or BAY869766 and described in PCT Publication No. W0200701401 1 ); (3S,4R,5Z,8S,9S,1 1 E)-14-(Ethylamino)- 8,9,16-trihydroxy-3,4-dimethyl-3,4,9, 19-tetrahydro-1 H-2-benzoxacyclotetradecine-1 ,7(8H)- dione] (also known as E6201 and described in PCT Publication No. W02003076424); 2’-Amino- 3’-methoxyflavone (also known as PD98059 available from Biaffin GmbH & Co., KG, Germany); Vemurafenib (PLX-4032, CAS 918504-65-1 ); (R)-3-(2,3-Dihydroxypropyl)-6-fluoro-5-(2-fluoro-4- iodophenylamino)-8-methylpyrido[2,3-d]pyrimidine-4,7(3H,8H)-dione (TAK-733, CAS 1035555- 63-5); Pimasertib (AS-703026, CAS 1204531 -26-9); and Trametinib dimethyl sulfoxide (GSK- 1 120212, CAS 1204531 -25-80). Phosphoinositide 3-kinase (PI3K) inhibitors include but are not limited to, 4-[2-(1 H-lndazol-4-yl)-6-[[4-(methylsulfonyl)piperazin-1 -yl]methyl]thieno[3,2- d]pyrimidin-4-yl]morpholine (also known as GDC 0941 and described in PCT Publication Nos. WO 09/036082 and WO 09/055730); 2-Methyl-2-[4-[3-methyl-2-oxo-8-(quinolin-3-yl)-2,3- dihydroimidazo[4,5-c]quinolin-1 -yl]phenyl]propionitrile (also known as BEZ 235 or NVP-BEZ 235, and described in PCT Publication No. WO 06/122806); 4-(trifluoromethyl)-5-(2,6- dimorpholinopyrimidin-4-yl)pyridin-2-amine (also known as BKM120 or NVP-BKM120, and described in PCT Publication No. W02007/084786); Tozasertib (VX680 or MK-0457, CAS 639089-54-6); (5Z)-5-[[4-(4-Pyridinyl)-6-quinolinyl]methylene]-2,4-thiazolidinedione
(GSK1059615, CAS 958852-01 -2); (1 E,4S,4aR,5R,6aS,9aR)-5-(Acetyloxy)-1 -[(di-2- propenylamino)methylene]-4,4a,5,6,6a,8,9,9a-octahydro-1 1 -hydroxy-4-(methoxymethyl)-4a,6a- dimethyl-cyclopenta[5,6]naphtho[1 ,2-c]pyran-2,7,10(1 H)-trione (PX866, CAS 502632-66-8); and 8-Phenyl-2-(morpholin-4-yl)-chromen-4-one (LY294002, CAS 154447-36-6). mTor inhibitors include but are not limited to, Temsirolimus (Torisel®); Ridaforolimus (formally known as deferolimus, (1 R,2R,4S)-4-[(2R)-2 [(1 R.9S.12S,15R,16E,18R,19R.21 R,
23S,24E,26E,28Z,30S,32S,35R)-1 ,18-dihydroxy-19,30-dimethoxy-15,17,21 ,23, 29,35- hexamethyl-2,3,10,14,20-pentaoxo-1 1 ,36-dioxa-4-azatricyclo[30.3.1 .04,9] hexatriaconta- 16,24,26,28-tetraen-12-yl]propyl]-2-methoxycyclohexyl dimethylphosphinate, also known as AP23573 and MK8669, and described in PCT Publication No. WO 03/064383); Everolimus (Afinitor® or RAD001 ); Rapamycin (AY22989, Sirolimus®); Simapimod (CAS 164301 -51 -3); (5-{2,4-Bis[(3S)-3-methylmorpholin-4-yl]pyrido[2,3-d]pyrimidin-7-yl}-2-methoxyphenyl)methanol (AZD8055); 2-Amino-8-[trans-4-(2-hydroxyethoxy)cyclohexyl]-6-(6-methoxy-3-pyridinyl)-4- methyl-pyrido[2,3-d]pyrimidin-7(8H)-one (PF04691502, CAS 1013101 -36-4); and N2-[1 ,4- dioxo-4-[[4-(4-oxo-8-phenyl-4H-1 -benzopyran-2-yl)morpholinium-4-yl]methoxy]butyl]-L- arginylglycyl-L-a-aspartylL-serine-, inner salt (SF1 126, CAS 936487-67-1 ).
[00191 ] In some embodiments, an anti-tumor agent is selected from pro- apoptotics, including but not limited to, IAP inhibitors, Bcl2 inhibitors, MCI1 inhibitors, Trail agents, Chk inhibitors. For examples, IAP inhibitors include but are not limited to, NVP-LCL161 , GDC-0917, AEG-35156, AT406, and TL3271 1 . Other examples of IAP inhibitors include but are not limited to those disclosed in W004/005284, WO 04/007529, W005/097791 , WO 05/069894, WO 05/069888, WO 05/094818, US2006/0014700, US2006/0025347, WO 06/069063, WO 06/0101 18, WO 06/017295, and WO08/134679. BCL-2 inhibitors include but are not limited to, 4-[4-[[2-(4-Chlorophenyl)-5,5-dimethyl-1 -cyclohexen-1 -yl]methyl]-1 -piperazinyl]-N-[[4-[[(1 R)-3-(4- morpholinyl)-1 -[(phenylthio)methyl]propyl]amino]-3-
[(trifluoromethyl)sulfonyl]phenyl]sulfonyl]benzamide (also known as ABT-263 and described in PCT Publication No. WO 09/155386); Tetrocarcin A; Antimycin; Gossypol ((-)BL-193);
Obatoclax; Ethyl-2-amino-6-cyclopentyl-4-(1 -cyano-2-ethoxy-2-oxoethyl)-4Hchromone-3- carboxylate (HA14 - 1 ); Oblimersen (G3139, Genasense®); Bak BH3 peptide; (-)-Gossypol acetic acid (AT-101 ); 4-[4-[(4'-Chloro[1 ,1 '-biphenyl]-2-yl)methyl]-1 -piperazinyl]-N-[[4-[[(1 R)-3- (dimethylamino)-1 -[(phenylthio)methyl]propyl]amino]-3-nitrophenyl]sulfonyl]-benzamide (ABT- 737, CAS 852808-04-9); and Navitoclax (ABT-263, CAS 923564-51 -6). Proapoptotic receptor agonists (PARAs) including DR4 (TRAILR1 ) and DR5 (TRAILR2), including but are not limited to, Dulanermin (AMG-951 , RhApo2L/TRAIL); Mapatumumab (HRS-ETR1 , CAS 658052-09-6); Lexatumumab (HGS-ETR2, CAS 845816-02-6); Apomab (Apomab®); Conatumumab
(AMG655, CAS 896731 -82-1 ); and Tigatuzumab (CS1008, CAS 946415-34-5, available from Daiichi Sankyo). Checkpoint Kinase (CHK) inhibitors include but are not limited to, 7- Hydroxystaurosporine (UCN-01 ); 6-Bromo-3-(1 -methyl-1 H-pyrazol-4-yl)-5-(3R)-3-piperidinyl- pyrazolo[1 ,5-a]pyrimidin-7-amine (SCH900776, CAS 891494-63-6) ; 5-(3-Fluorophenyl)-3- ureidothiophene-2-carboxylic acid N-[(S)-piperidin-3-yl]amide (AZD7762, CAS 860352-01 -8); 4- [((3S)-1 -Azabicyclo[2.2.2]oct-3-yl)amino]-3-(1 H-benzimidazol-2-yl)-6-chloroquinolin-2(1 H)-one (CHIR 124, CAS 405168-58-3); 7-Aminodactinomycin (7-AAD), Isogranulatimide,
debromohymenialdisine; N-[5-Bromo-4-methyl-2-[(2S)-2-morpholinylmethoxy]-phenyl]-N'-(5- methyl-2-pyrazinyl)urea (LY2603618, CAS 91 1222-45-2); Sulforaphane (CAS 4478-93-7, 4- Methylsulfinylbutyl isothiocyanate); 9,10,1 1 ,12-Tetrahydro- 9,12-epoxy-1 H-diindolo[1 ,2,3- fg:3',2',1 '-kl]pyrrolo[3,4-i][1 ,6]benzodiazocine-1 ,3(2H)-dione (SB-218078, CAS 135897-06-2); and TAT-S216A (Sha et al., Mol. Cancer. Ther 2007; 6(1 ):147-153), and CBP501 .
[00192] In some embodiments, an anti-tumor agent is selected from FGFR inhibitors. For example, FGFR inhibitors include but are not limited to, Brivanib alaninate (BMS- 582664, (S)-((R)-1 -(4-(4-Fluoro-2-methyl-1 H-indol-5-yloxy)-5-methylpyrrolo[2,1 -f][1 ,2,4]triazin-6- yloxy)propan-2-yl)2-aminopropanoate); Vargatef (BIBF1 120, CAS 928326-83-4); Dovitinib dilactic acid (TKI258, CAS 852433-84-2); 3-(2,6-Dichloro-3,5-dimethoxy-phenyl)-1 -{6-[4-(4- ethyl-piperazin-1 -yl)-phenylamino]-pyrimidin-4-yl}-1 -methyl-urea (BGJ398, CAS 87251 1 -34-7); Danusertib (PHA-739358); and (PD173074, CAS 219580-1 1 -7). In a specific aspect, the present disclosure provides a method of treating cancer by administering to a subject in need thereof an antibody drug conjugate in combination with an FGFR2 inhibitor, such as 3-(2,6- dichloro-3,5-dimethoxyphenyl)-1 -(6((4-(4-ethylpiperazin-1 -yl)phenyl)amino)pyrimidin-4-yl)-1 - methylurea (also known as BGJ-398); or 4-amino-5-fluoro-3-(5-(4-methylpiperazin1 -yl)-1 H- benzo[d]imidazole-2-yl)quinolin-2(1 H)-one (also known as dovitinib or TKI-258). AZD4547 (Gavine et al., 2012, Cancer Research 72, 2045-56, N-[5-[2-(3,5-Dimethoxyphenyl)ethyl]-2H- pyrazol-3-yl]-4-(3R,5S)-diemthylpiperazin-1 -yl)benzamide), Ponatinib (AP24534; Gozgit et al., 2012, Mol Cancer Ther., 1 1 ; 690-99; 3-[2-(imidazo[1 ,2-b]pyridazin-3-yl)ethynyl]-4-methyl-N-{4- [(4-methylpiperazin-1 - yl)methyl]-3-(trifluoromethyl)phenyl}benzamide, CAS 943319-70-8).
[00193] In some embodiments, an anti-tumor agent is selected from antagonists of an immune checkpoint molecule chosen from one or more of PD-1 , PD-L1 , PD-L2, TIM3, CTLA-4, LAG-3, CEACAM-1 , CEACAM-5, VISTA, BTLA, TIGIT, LAIR1 , CD160, 2B4 or TGFR.
In one embodiment, the immune checkpoint molecule antagonist is an anti-PD-1 inhibitor, wherein the anti-PD-1 antibody is chosen from Nivolumab, Pembrolizumab or Pidilizumab. In some embodiments, the anti-PD-1 antibody molecule is Nivolumab. Alternative names for Nivolumab include MDX- 1 106, MDX-1 106-04, ONO-4538, or BMS-936558. In some embodiments, the anti-PD- 1 antibody is Nivolumab (CAS Registry Number: 946414-94-4). Nivolumab is a fully human lgG4 monoclonal antibody which specifically blocks PD1 .
Nivolumab (clone 5C4) and other human monoclonal antibodies that specifically bind to PD1 are disclosed in US 8,008,449 and W02006/121 168. In some embodiments, the anti-PD-1 antibody molecule is Pembrolizumab. Pembrolizumab (also referred to as Lambrolizumab, MK- 3475, MK03475, SCH-900475 or KEYTRUDA®; Merck) is a humanized lgG4 monoclonal antibody that binds to PD-1 . Pembrolizumab and other humanized anti-PD-1 antibodies are disclosed in Hamid, O. et al. (2013) New England Journal of Medicine 369 (2): 134-44, US 8,354,509 and W02009/1 14335. In some embodiments, the anti-PD-1 antibody molecule is Pidilizumab. Pidilizumab (CT-01 1 ; Cure Tech) is a humanized lgG1 k monoclonal antibody that binds to PD1 . Pidilizumab and other humanized anti-PD-1 monoclonal antibodies are disclosed in W02009/10161 1 . Other anti-PD1 antibody molecules include AMP 514 (Amplimmune) and, e.g., anti-PD1 antibodies disclosed in US 8,609,089, US 2010/028330, and/or US
2012/01 14649 and US2016/0108123. In some embodiments, the anti-tumor agent is the anti- Tim3 antibody disclosed in US2015/0218274. In other embodiments, the anti-tumor agent is the anti-PD-L1 antibody disclosed in US2016/0108123, Durvalumab® (MEDI4736), Atezolizumab® (MPDL3280A) or Avelumab®.
[00194] In some embodiments, the population of cells, after the introduction of the library of nucleic acid sequences encoding one or more encoded gRNA molecules, can be co cultured with other cells, such as tumor cells, lymphocytes, dendritic cells, astrocytes, etc.
[00195] In some embodiments, the population of cells, e.g., tumor cells, after the introduction of the library of nucleic acid sequences encoding one or more encoded gRNA molecules, can be transferred into an in vivo environment, such as a mouse. In some embodiments, the mouse may have a compromised immune system, e.g., a NOD scid gamma (NSG) mouse, a NOG (NOD/Shi-scid/IL-2RYnuN) mouse, a nude mouse, etc. In some
embodiments, the mouse may have a humanized immune system, e.g., a humanized NSG mouse.
[00196] In some embodiments, the methods disclosed herein are used for in vivo screening of a genome-wide gRNA library for targets involved in tumor growth or metastasis. In vivo CRISPR screening for targets regulating tumor growth and metastasis is described in PCT Patent Pub. No. WO2016108926, the content of which is incorporated herein by reference in its entirety. For example, a population of tumor cells may be transferred into a mouse by, e.g., subcutaneous transplant, intravenous injection, etc. Tumor cells at the site of
transplant/injection and/or tumor cells at metastatic site(s) may be collected and assessed as disclosed herein.
Identifying gRNA Molecules
[00197] The gRNA molecule(s) introduced into a cell having the property, such as cell survival, cell death, cell growth, cell differentiation, cell activation, gene expression (single gene expression, e.g., fetal haemoglobin, or multiple gene expression), or a combination thereof or subjected to a treatment or condition for a first length of time can be identified by genetic analysis of the cell having the property or subjected to a treatment or condition for a first length of time. In some embodiments, genetic analysis may comprise sequencing, e.g., next-gen sequencing (NGS), hybridization, PCR, etc. In some embodiments, genetic analysis may comprise comparing the gRNA molecule(s) in the cell having the property with the gRNA molecule(s) in the cell not having the property, and/or the encoded gRNA molecules introduced into the population of cells. In some embodiments, genetic analysis may comprise comparing the gRNA molecule(s) in the cells that have been subjected to a treatment or condition for different lengths of time. For example, the level of the gRNA molecule(s) in a cell having the property or subjected to a treatment or condition for a first length of time can be compared to a reference level of the gRNA molecule(s), e.g., the level of the gRNA molecule(s) in the cell not having the property or subjected to a treatment or condition for a second length of time, and/or the encoded gRNA molecules introduced into the population of cells. In some embodiments, a gRNA is identified when its level in the cell having the property or subjected to a treatment or condition for a first length of time is significantly higher or lower than the reference level, e.g., by counting the number of sequencing reads of a gRNA through NGS. For example, a gRNA is identified if the level of the encoded gRNA molecule in a cell having the property or subjected to a treatment or condition for a first length of time is at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, at least 200%, higher or lower than the reference level. In some embodiments, a gRNA is identified if the difference in the level of the encoded gRNA molecule in a cell having the property or subjected to a treatment or condition for a first length of time compared to the reference level has a Z- score of less than -5, less than -4, less than -3, less than -2, greater than 2, greater than 3, greater than 4, or greater than 5. In some embodiments, the methods disclosed herein provide identifying a target gene that is modified in a cell having the property or subjected to a treatment or condition for a first length of time. For example, a target gene may be identified when at least 1 , at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10 gRNA molecules having a target sequence located in the target gene is identified in the cell having the property or subjected to a treatment or condition for a first length of time.
[00198] In some embodiments, genetic analysis may comprise single cell RNA- sequencing (CRISP-seq, Perturb-seq (Jaitin DA, Weiner A, Yofe I, Lara-Astiaso D, Keren-Shaul H, David E, et al. Dissecting Immune Circuits by Linking CRISPR-Pooled Screens with Single- Cell RNA-Seq. Cell. 2016;167(7):1883-96.e15; Dixit A, Parnas O, Li B, Chen J, Fulco CP, Jerby-Arnon L, et al. Perturb-Seq: Dissecting Molecular Circuits with Scalable Single-Cell RNA Profiling of Pooled Genetic Screens. Cell. 201 6;1 67(7) :1 853-66. e1 7; Adamson B, Norman TM, Jost M, Cho MY, Nunez JK, Chen Y, et al. A Multiplexed Single-Cell CRISPR Screening Platform Enables Systematic Dissection of the Unfolded Protein Response. Cell.
201 6;1 67(7) :1 867-82. e21 , the contents of which are hereby incorporated by reference in their entireties)).
[001 99] Tools for analyzing pooled screens using CRISPR are known in the art, for example, HiTSelect (Diaz et al, Nucleic Acids Res. 201 5 Feb 1 8;43(3) :e1 6), MAGeCK (Li, W. et al. MAGeCK enables robust identification of essential genes from genome-scale CR!SPR/Cas9 knockout screens. Genome Biol 15, 554 (2014)), STARZ (Doench, J.G. et al. Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR- Cas9. Nat. Biotechnoi. 34, 184-191 (2016), the contents of which are hereby incorporated by reference in their entireties), etc.
EXAMPLES
[00200] CRISPR-Cas9 screening enables genome-wide interrogation of gene function. Achieving the high and uniform Cas9 expression desirable for screening currently requires engineering stable and clonal Cas9-expressing cells, an approach that is not applicable in human primary cells. Guide Swap enables genome-scale pooled CRISPR-Cas9 screening in human primary cells by exploiting the unexpected finding that editing by lentivirally-delivered, targeted gRNAs occurs efficiently when Cas9 is delivered complexed with non-targeting gRNA. We validated Guide Swap in depletion and enrichment screens in CD4+ T cells. Next, we implemented Guide Swap in a model of ex vivo hematopoiesis, identifying known and novel regulators of CD34+ hematopoietic stem and progenitor cell (HSPC) expansion. We anticipate that this platform will be broadly applicable to other challenging cell types to enable discovery in previously inaccessible, but biologically relevant human primary cell systems.
EXAMPLE 1 : General Methods
Synthetic and lentiviral gRNA
[00201 ] Split gRNA for RNP complexes were from Integrated DNA Technologies (Alt-R CRISPR-Cas9 crRNA and tracrRNA) unless otherwise noted. CD33_A single guide RNA (GG AACCAGT AACCAT G AACT GTTTT AG AGCT AG AAAT AGC AAGTT AAAAT AAGGCT AGT CC GTT AT CAACTT G AAAAAGTGGCACCG AGT CGGT GCTTTT (SEQ ID NO: 1 )) was synthesized by Trilink. [00202] The design and construction of the human genome-wide sgRNA library targeting 18,360 protein-coding genes has been previously described (DeJesus R, et al., eLife. 2016;5:e17290). Individual sgRNA-encoding sequences were cloned into pNGx-LV-g003 lentiviral plasmid using the Bbsl site.
[00203] Individual gRNA target sequences were as follows: non-targeting sequences were from the GeCKO v2 library. CD33-targeting sequences were from Doench JG, et al., Nat Biotech. 2014;32(12):1262-7.
Table 1. gRNA target sequences
Figure imgf000079_0001
Figure imgf000080_0001
Figure imgf000081_0001
Note: the sequences in bold were cloned into the lentiviral vector with an additional 5' G
[00204] Scrambled RNA:
AUGUGAGUCGCAAAUAAGGCUGGUACCGCUGUGCAU (SEQ ID NO: 36) was purchased from Integrated DNA Technologies.
Primary blood cell isolation
[00205] CD34+ cells were isolated from G-CSF-mobilized peripheral blood
(Hemacare and ANCells) using CliniMACS CD34 microbeads (Miltenyi Biotec). Cord blood CD34+ cells were purchased from ANCells (CB005F) and Lonza (2C-101 ). Human primary CD4+ T cells were isolated from peripheral blood (ANCells) using CliniMACS CD4 microbeads (Miltenyi Biotec) following the manufacturer’s protocol. Commercial suppliers (ANCells, Lonza and Hemacare) obtained human tissue samples in line with ethical regulations under informed consent through an IRB approved donor program. ANCells utilized Alpha Independent Review Board. Hemacare utilized Quorum IRB. ANCells and Lonza also obtained samples from outside sources with documented IRB compliance. Lot numbers can be found in the Life Sciences Reporting Summary.
Cell culture
[00206] HEK293T cells were cultured in DMEM medium (HyClone) supplemented with 10% FBS (Omega Scientific), 10mM HEPES (Hyclone), 1 mM sodium pyruvate (Hyclone),
1 x MEM NEAA and 1 % Penicillin/Streptomycin/Glutamine (PSG). HEK293T were passaged every 2-3 days. CD34+ HSPC were cultured in StemSpan SFEM (Stemcell Technologies) with 50ng/mL SCF (Life Technologies PHC21 13), TPO (R&D Systems 288-TP), Flt3 ligand (Life Technologies PHC9413), IL6 (Life Technologies PHC0063) and 1 x antibiotic antimycotic (Gibco). T cells were cultured in RPMI-1640 supplemented with 10% FBS, 5mM HEPES, 1 % PSG, 1 x MEM NEAA and 1 mM sodium pyruvate with 20U/mL IL-2 (R&D Systems), 1 x BME (Gibco / Thermo Fisher)) and Dynabeads Human T-Activator CD3/28 (Gibco / Thermo Fisher) at a 1 :1 cell to bead ratio. CT26 cells were cultured in RPMI-1640 medium (HyClone)
supplemented with 10% FBS. Cells were maintained at 0.12-1 .2 x 10® cells/mL by passage every other day (trypsinization). All cells were grown in a humidified 37°C incubator with 5%
C02.
Lentiviral production [00207] Lentivirus was produced by co-transfecting the lentiviral vector with pCMV-dR8.91 and pCMV-VSV-G packaging plasmids into HEK239T cells using Lipofectamine 3000 (Life Technologies). Media was changed 12 hours post-transfection, and virus-containing supernatant was collected 48 hours post-transfection. Viral supernatant was passed through a 0.45 mM filter (Millipore SLHV033RS) and then concentrated using Amicon Ultra-15 Centrifugal Filter Units with Ultracel-100 membrane (Millipore UFC910024). Viral titers were measured by FACS in HEK293T cells and were typically -1 x109.
Cas9 expression and purification
[00208] A freshly transformed BL21 (DE3)Star (Novagen) colony containing the pET28-Cas9 construct was isolated. This colony was used to inoculate 25 mL LB Luria
(Teknova) supplemented with kanamycin (25 pg/mL). The culture was grown at 270 RPM and 37°C for approximately 16 hours. This culture was used to seed, at 1 :100 (v/v), two 2.5 L Ultra Yield flasks (Thomson) containing 1 L each of room temperature Terrific Broth Complete (Teknova) supplemented with kanamycin (25 pg/mL). The cultures were grown at 37°C and 270 RPM while monitoring the OD(600 nm). Thirty minutes prior to reaching OD(600 nm) of 1 .0, the incubator temperature was decreased to 18°C. At OD(600 nm) of 1 .0, protein expression was induced with Isopropyl b-D-l -thiogalactopyranoside (IPTG, Calbiochem) to a final concentration of 0.2 mM. The cells were harvested and the pellets stored at -20 °C after 18 hours of induction.
[00209] Cells from 2 L of expression cultures were lysed in 500 ml buffer containing 20 mM Tris (pH 8.0), 500 mM NaCI, 10% glycerol, 1 mM Tris-(2-Carboxyl ethyl) phosphine (TCEP, Doe & Ingalls), and 10 Protease Inhibitor Complete tablets (Roche
Diagnostics). The lysate was disrupted by sonication on ice for 2 mins in 100 ml volumes at 70% power, with 1 second sonicate, 2 seconds rest cycles. Supernatant was separated by centrifuging at 15,000 rpm for 30 min. at 4°C (Sorvall RC 6+ centrifuge) before being applied to a HisTrapp FF 5 ml column (GE Healthcare Life Science Corporation) and eluted with buffer containing 20 mM Tris (pH 8.0), 500 mM NaCI, 300 mM imidazole, and 1 mM TCEP. Protein was buffer exchanged to Side A buffer (20 mM Tris (pH 8.0), 150 mM NaCI, 0.5 mM TCEP) before being loaded to a Resource S column (GE Healthcare Life Science Corporation), and eluted with Side B buffer (20 mM Tris (pH 8.0), 500 mM NaCI, 0.5 mM TCEP) using a gradient from 100% Side A buffer to 100% Side B buffer in 15 column volumes. The final protein was purified by gel filtration chromatography with a HiLoad 16/600 Supdex 200 prep grade column (GE Healthcare Life Science Corporation) in 20 mM HEPES (pH 7.5), 150mM KCI, 1 % Sucrose,
1 mM TCEP. All the above column purifications were done using an AKTA Pure fast protein liquid chromatography (FPLC) system (GE Healthcare Life Science Corporation). Purified protein was filtered through Mustang E membrane (Pall Corporation) to reduce residual endotoxin.
[00210] The protein sequence encoding N- and C-terminally tagged S. Pyogenes Cas9 is as below (SEQ ID NO: 37):
MAPKKKRKVD KKYSIGLDIG TNSVGWAVIT DEYKVPSKKF KVLGNTDRHS IKKNLIGALL FDSGETAEAT RLKRTARRRY TRRKNRICYL QEIFSNEMAK VDDSFFHRLE ESFLVEEDKK HERHPIFGNI VDEVAYHEKY PTIYHLRKKL VDSTDKADLR LIYLALAHMI KFRGHFLIEG DLNPDNSDVD KLFIQLVQTY NQLFEENPIN ASGVDAKAIL SARLSKSRRL ENLIAQLPGE KKNGLFGNLI ALSLGLTPNF KSNFDLAEDA KLQLSKDTYD DDLDNLLAQI GDQYADLFLA AKNLSDAILL SDILRVNTEI TKAPLSASMI KRYDEHHQDL TLLKALVRQQ LPEKYKEIFF DQSKNGYAGY IDGGASQEEF YKFIKPILEK MDGTEELLVK LNREDLLRKQ RTFDNGSIPH QIHLGELHAI LRRQEDFYPF LKDNREKIEK ILTFRIPYYV GPLARGNSRF AWMTRKSEET ITPWNFEEVV DKGASAQSFI ERMTNFDKNL PNEKVLPKHS LLYEYFTVYN ELTKVKYVTE GMRKPAFLSG EQKKAIVDLL FKTNRKVTVK QLKEDYFKKI ECFDSVEISG VEDRFNASLG TYHDLLKIIK DKDFLDNEEN EDILEDIVLT LTLFEDREMI EERLKTYAHL FDDKVMKQLK RRRYTGWGRL SRKLINGIRD KQSGKTILDF LKSDGFANRN FMQLIHDDSL TFKEDIQKAQ VSGQGDSLHE HIANLAGSPA IKKGILQTVK VVDELVKVMG RHKPENIVIE MARENQTTQK GQKNSRERMK RIEEGIKELG SQILKEHPVE NTQLQNEKLY LYYLQNGRDM YVDQELDINR LSDYDVDHIV PQSFLKDDSI DNKVLTRSDK NRGKSDNVPS EEVVKKMKNY WRQLLNAKLI TQRKFDNLTK AERGGLSELD KAGFIKRQLV ETRQITKHVA QILDSRMNTK YDENDKLIRE VKVITLKSKL VSDFRKDFQF YKVREINNYH HAHDAYLNAV VGTALIKKYP KLESEFVYGD YKVYDVRKMI AKSEQEIGKA TAKYFFYSNI MNFFKTEITL ANGEIRKRPL IETNGETGEI VWDKGRDFAT VRKVLSMPQV NIVKKTEVQT GGFSKESILP KRNSDKLIAR KKDWDPKKYG GFDSPTVAYS VLVVAKVEKG KSKKLKSVKE LLGITIMERS SFEKNPIDFL EAKGYKEVKK DLIIKLPKYS LFELENGRKR MLASAGELQK GNELALPSKY VNFLYLASHY EKLKGSPEDN EQKQLFVEQH KHYLDEIIEQ ISEFSKRVIL ADANLDKVLS AYNKHRDKPI REQAENIIHL FTLTNLGAPA AFKYFDTTID RKRYTSTKEV LDATLIHQSI TGLYETRIDL SQLGGDSRAD PKKKRKVHHH HHH
RNP formation
[0021 1 ] All pre-complexed gRNAs were split and synthetic unless otherwise noted. crRNA and tracrRNA were resuspended to 100mM stock solutions in 10mM Tris, pH 7.5. Unless otherwise noted, the following quantities were used. Per 25 mI_ electroporation reaction, 3 mV crRNA (2.25 mI_) and 3 mI_ tracrRNA (1 .25 mI_) were heated separately at 95 °C for 2 minutes They were then removed from heat and cooled to room temperature on the bench top. After cooling, 6 pg Cas9 protein and 0.5 pl_ of CCE buffer (100 mM HEPES, 500 mM KCI, 25 mM MgCI2, 0.25% glycerol, 10 mM DTT) was added to the tracrRNA and incubated at 37°C for 5 minutes. The crRNA was then added to the tracrRNA/Cas9 mixture, bringing the total reaction volume to 5 mI_, and incubated at 37°C for 5 minutes to form the RNP.
[00212] For RNP formation with the CD33 synthetic single gRNA, 6 pg Cas9 protein was mixed with 6 pg sgRNA and incubated at 37°C for 5 minutes.
CRISPR-Cas9 editing in human primary CD34+ HSPC and CD4+ T cells
[00213] Lentiviral transduction: For human primary CD34+ HSPC, Falcon 96 Well flat bottom non-treated cell culture plates (Corning 351 172) were coated with 50pg/mL retronectin in PBS overnight at 4°C. The following day, the wells were blocked with 1 % BSA in PBS for 30 minutes at room temperature and then washed once with PBS. Concentrated lentivirus (70pL/well) was pre-bound to the retronectin-coated plate by spinning the plate at 2000xg for 2 hours. CD34+ cells were added (up to 1 .5x105 cells/well) after removing the concentrated virus, and the plate was briefly centrifuged for 1 minute at 280xg prior to return to incubation. For CD4+ T cells, cells were thawed, washed and resuspended in complete culture media including IL-2, BME and CD3/28 beads to a final concentration of 200K cells per ml_. 4pl of 1 X10L9 vp/mL virus was added per mL and cells were divided over 96 well U-bottom plates with each well containing 250pl. Plates were spun for 1 .5 hrs @ 1200x g at RT.
[00214] Guide Swap: CD34+ HSPC were transduced 48 hours post-thaw with lentiviral gRNA vectors. Mobilized peripheral blood (mPB) CD34+ cells were used unless otherwise noted. CD4+ T cells were transduced the day of thaw. 48 hours post-transduction, the HSPC or T cells (5x104-1 x106/reaction) were washed once with PBS and resuspended in 20 pL of supplemented P3 Primary Cell 4D-Nucleofector Solution (Lonza). The 5 pL of RNP was added to the 20 pL of cells, mixed by pipetting up and down and incubated at room temperature for 5 minutes. After incubation, the cell/RNP mixture was transferred into Nucleocuvettes and electroporated using the P3 Primary Cell 4D-Nucleofector X Kit S (Lonza V4XP-3032), program code CM-137.
[00215] Validation of screening hits: mPB CD34+ HSPC were electroporated with RNPs as above, 48 hours post-thaw using 5x104 cells/reaction. Cell numbers were normalized 96 hours post-electroporation.
[00216] Guide Swap in CT26: CT26 cells were transduced by incubating 1 X 104 cells in 100 pL media with 12.5 pL concentrated lentivirus for 48 hours. Post-infection, stably transduced cells were selected by incubation with puromycin at 18 gg/mL for 48 hours. Delivery of Cas9 RNP complexes to CT26 cells was performed as follows. 1 X 105 cells were harvested and washed once with 1 X D-PBS. Cells were re-suspended in SE Cell Line 4D-Nucleofector® X Kit solution with Supplement (Lonza) and transferred to 16 well-Nucleocuvette™ Strips and electroporated using program DS-120. Cells were re-suspended in pre-warmed media, transferred to 96-well plates and incubated for 48 hours prior to extraction of genomic DNA for TIDE analysis or 96-hours prior to western blot analysis.
Cell surface FACS staining
[00217] Multicolor analysis was performed on an LSRFortessa flow cytometer (Becton Dickinson) using BD FACSDiva and analyzed using FlowJo software. For cell surface FACS staining, cells were pelleted and resuspended in staining media (HBSS1 X (Gibco 14175- 095) supplemented with 2% FBS (HyClone SV30014.03) and 2 mM EDTA (Sigma E7889)) with appropriate antibodies. After 30 minutes incubation at room temperature, cells were washed and resuspended in staining media with 1 ug/mL DAPI for flow cytometry analysis. Antibodies used were as follows: 1 :100 anti CD3-Pacific Blue (Invitrogen MHCD0328), 1 :100 anti CD33- Bv421 (BD Biosciences 565949), 1 :100 anti CD34-APC (BD Biosciences 555824), 1 :100 anti CD34-PE (BD Biosciences 348057), 1 :1000 anti CD41 a-FITC (eBioscience 1 1 -0419-42), 1 :750 anti CD41 a-e450 (eBioscience 48-0419), 1 :100 anti CD45-APC (BD Biosciences 555485),
1 :750 anti CD45RA-PeCy7 (eBioscience 25-0458-42), 1 :250 anti CD71 -Bv71 1 (BD Biosciences 563767), 1 :250 anti CD90-APC (BD Biosciences 559869). Absolute cell counts were obtained using AccuCheck Counting Beads (ThermoFisher Scientific PCB100).
[00218] Lentiviral gRNA-expressing cells were gated using RFP, a fluorescent marker derived from the lentiviral vector.
Cas9 FACS staining
[00219] CD34+ HSPC were thawed, transduced with lentivirus-encoded gRNA and cultured for 3 days in the presence of 750 nM SR1 . Cells were electroporated with 6 pg Cas9 alone, or 6 pg Cas9 pre-complexed to 6 pg of scrambled RNA, crRNA, tracrRNA, crRNA+ tracrRNA or sgRNA. Four hours post-electroporation, the cells were harvested for intracellular Cas9 staining. Cells were pelleted and washed once in PBS. Extracellular Cas9 was removed by incubation with Proteinase K (100 pg/mL in PBS, pH 7.2) for 20 minutes at room
temperature. Prior to fixation, cells were stained with 1 :1000 LIVE/DEAD Fixable Violet Dead Cell Stain (ThermoFisher Scientific L34955). Cells were fixed with cold 1 % paraformaldehyde for 15 minutes on ice, washed, then permeabilized by adding cold methanol dropwise while vortexing, then incubating on ice for 30 minutes. Cell pellets were washed with 1 % BSA in PBS and stained with 1 :250 rabbit anti Cas9 (Takara 632607) in 1 % BSA in PBS for 1 hour at room temperature, followed by 1 :1000 goat anti rabbit IgG AlexaFluor 488 (ThermoFisher A-1 1034) for 45 minutes at room temperature. Post-staining, cells were resuspended in 0.1 % BSA in PBS for FACS. FACS data were acquired on an LSRFortessa flow cytometer (Becton Dickinson) using BD FACSDiva and analyzed using FlowJo software.
T cell Pooled Screen
[00220] The pool of gRNAs consisted of 12,996 elements targeting 2585 genes at 5 gRNAs per gene with 73 controls. 10 gRNAs each for CD4, CD45 and CXCR4 were spiked in at a plasmid concentration equal to 1 /13,000th of the total pool.
[00221 ] For each replicate, CD4+ T cells were thawed, washed and resuspended in complete culture media (RPMI-1640 supplemented with 10% FBS, 5mM HEPES, 1 % PSG,
1 x MEM NEAA (HyClone) and 1 mM sodium pyruvate (HyClone)) with 20U/mL IL-2 (R&D Systems) and 1 x BME (Gibco / Thermo Fisher)), Dynabeads Human T-Activator CD3/28 (Gibco / Thermo Fisher) at a 1 :1 cell to bead ratio. Final concentration was 200K cells per ml_.
[00222] 4mI of 1 X10L9 vp/mL virus was added per mL and cells were divided over 96 well U-bottom plates with each well containing 250mI. In total, 16.25 million cells were transduced equaling -1250 cells/guide. Plates were spun for 1 .5 hrs @ 1200x g at RT.
Transduction rate was -65%.
[00223] Two days post-transduction, half of the transduced cells (-15x106) were washed, pelleted and frozen at -80SC for subsequent gDNA isolation. The nt_A RNP was formed by heating 45mI_ nt_A crRNA with 45mI_ tracrRNA at 95SC for 5 min, cooling to RT, then adding 300pg of Cas9 for a total volume of 140mI_. The remaining cells were electroporated with this nt_A RNP using the P3 Primary Cell 4D-Nucleofector X Kit L (Lonza V4XP-3024), program code CM-137 at a density of 5x106 cells/1 10 mI_ electroporation volume (65 mI_ cells
resuspended in supplemented buffer P3 plus 45 mI_ nt_A RNP). After electroporation, cells were returned to reserved media and redistributed over 96 well plates. Two days later cells were pooled and diluted 1 :4 in fresh complete culture media. Cells were transferred to T75 flasks which were incubated upright.
[00224] After another 3 days of culture, the cells were pelleted, resuspended in staining media with 1 :100 anti CD4-APC (BD Biosciences 555349), CXCR4-APC/Cy7
(Biolegend 306528), CD45 (eBioscience 48-0459-42) and incubated at room temperature for 1 hour. Cells were then pelleted, resuspended in staining media with PI. Four populations were sorted (live RFP+CD4+CD45+CXCR4+), (live RFP+CD4-), (live RFP+CD45-), (live RFP+CXCR4-). Sorting was done on a FACS Aria cell sorter (Becton Dickinson). Purity was confirmed by post-sort purity check.
[00225] Genomic DNA was isolated using the Quick-gDNA miniprep kit (Zymo Research D3025) following the manufacturer’s protocol. Sequencing libraries were generated by PCR-amplifying the lentiviral vector backbone sequence from genomic DNA. For pre- nucleofection and (live RFP+CD4+CD45+CXCR4+) populations, a total of 13 x 2 pg PCR reactions were performed. For low yield negative populations the entire eluate was added to a single PCR reaction. PCR was performed in a volume of 50mI_ containing 1 x Q5 Reaction buffer, 200 mM dNTPs, 0.5 mM forward primer, 0.5 mM reverse primer, 2pg or total gDNA and 0.02 U/pL Q5 polymerase (NEB). The following cycling parameters were used: 1 x 95 °C for 5 min; 30x 95 °C for 15s, 60 °C for 15s, 72°C for 30s; 1 x 72^ for 5 min.
[00226] The PCR products were purified using DNA Clean & Concentrator-5 columns (Zymo Research D4013) following the manufacturer’s recommendations, normalized, pooled and sequenced with a MiSeq (lllumina). sgRNA libraries were sequenced 1 x50base reads. Sequencing was performed following the manufacturer’s recommendations using custom sequencing primers. Raw sequencing reads were aligned to the appropriate library using BWA (Doench JG, Hartenian E, Graham DB, Tothova Z, Hegde M, Smith I, et al. Rational design of highly active sgRNAs for CRISPR-Cas9-mediated gene inactivation. Nat Biotech.
2014;32(12):1262-7).
[00227] Library and sequencing primers (vector construction as previously described (DeJesus R, et al., eLife. 2016;5:e17290)):
Table 2. Primer sequences
Figure imgf000087_0001
HSPC Pooled Screen
[00228] The genome-scale screen of 13,243 gene targets was divided into 5 pools of plasmids, each encoding 13,000 gRNAs with the positive control gRNA AHR 8 spiked in. The protocol below is per pool of 13,000 gRNA. [00229] Cord blood CD34+ cells were thawed, washed with I xHBSS and resuspended in complete culture media (StemSpan SFEM (Stemcell Technologies) with 50ng/ml_ SCF, TPO, Flt3 ligand, IL6 and 1 x antibiotic antimycotic) with 750 nM SR1 . Two days post-thaw, 3.9 x106 cells were pelleted, washed with PBS, resuspended in complete culture media and transduced with the lentiviral pool equaling -300 cells/gRNA. Two days post transduction, the transduced cells (~15x106) were electroporated with non-targeting nt_A RNP using the P3 Primary Cell 4D-Nucleofector X Kit S (Lonza V4XP-3032), program code CM-137 at a density of 1 x106 cells/25 pL electroporation volume (20 mI_ cells resuspended in
supplemented P3 plus 5 mI_ nt_A non-targeting RNP). After electroporation, the cells were seeded in complete culture media and cultured for 10-1 1 days, expanding the culture as needed to keep the cell density < 1 x106 cells/mL.
[00230] After 10-1 1 days of culture, the cells were pelleted, resuspended in staining media with 1 :100 anti CD34-APC (BD Biosciences 555824) and incubated at room temperature for 1 hour. Cells were then pelleted, resuspended in staining media with DAPI and live RFP+ CD34+ and RFP+ CD34- cells were sorted on a FACS Aria cell sorter (Becton Dickinson). Purity was confirmed by post-sort purity check.
[00231 ] Genomic DNA was isolated using the DNeasy Blood and Tissue Kit (Qiagen 69504) following the manufacturer’s protocol. Sequencing libraries were generated by PCR-amplifying the lentiviral vector backbone sequence from genomic DNA. For each sample (RFP+ CD34+ and RFP+ CD34-), a total of 15 x 2 pg PCR reactions were performed. PCR reactions were performed in a volume of 50mI_ containing 1 x Q5 Reaction buffer, 200 mM dNTPs, 0.5 mM forward primer, 0.5 mM reverse primer, 2 pg gDNA and 0.02 U/pL Q5 polymerase (NEB). The following cycling parameters were used: 1 x 95 °C for 1 min; 28x 95 °C for 15s, 65 °C for 15s, 72°C for 30s; 1 x 72 °C for 5 min. The PCR products were purified and sequenced as above with a HiSeq 1000 (lllumina).
Screening Data Analysis.
[00232] Correlation between reads per million of the two technical replicates in the T cell screen was assessed by calculating the Pearson correlation coefficient using Spotfire.
[00233] RSA analysis (Konig R, et al., Nature Methods. 2007;4:847) was run as described in Li W, et al., Genome biology. 2014;15(12):554. Briefly, read counts within samples were mean normalized, and used to calculate guide scores as (normalized read count in Day 6 sample)/(normalized read count in Day 0). Scores were calculated separately for each replicate, then averaged before being used as the input for the most recent version of RSA (v1 .8) using default parameters. For the enrichment experiments the following parameters were used: -r (reverse picking), -u 1 .0e8 (upper bound of fold enrichment) , -1 (the lower bound of fold enrichment). As“1” is a placeholder for insignificant p-values (p=1 .0), we replaced logP=1 entries with logP=0. Gene Ontology analysis was performed using Metascape (Tripathi S, et al., Cell host & microbe. 2015;18(6) :723-35) (www.metascape.org).
[00234] For the 2nd best guide ranking, sequence reads were converted to reads per million (RPM) and then converted to a Log2 scale. The absolute difference between conditions was derived for each gRNA and the values were ranked by the mean RPM values. Since variance was strongly related to mean RPM overall, a sliding standard deviation value was derived using a window of 250 absolute difference values surrounding each gRNA ranked by the mean RPM values. The change in RPM values was then normalized by dividing by the sliding standard deviation score in each case (“normalized score”). The absolute normalized score was then used to rank the guides. For the T cell screen, the 2nd best guide depleted in the Day 6 CD4+CD45+CXCR4+ population, or enriched in the surface receptor negative population was selected. For the HSPC screen, the 2nd best guide was selected where the direction of the 1 st and 2nd best natural normalized scores was the same (i.e. both down or both up in CD34 POS vs CD34 NEG).
Cas9/ssDNA in CT26
[00235] Mobilized peripheral blood CD34+ HSPC were transduced 48 hours post thaw with lentiviral guide vectors. 48 hours post-transduction, the cells (5x1 04-1 x1 06/reaction) were washed once with PBS and resuspended in 20mI_ of supplemented P3 Primary Cell 4D- Nucleofector Solution (Lonza). Per reaction, 6pg of Cas9 was mixed with ssDNA and incubated at room temperature for 5 minutes. The Cas9/ssDNA mixture was then added to the 20mI_ of cells for a final concentration of 4mM ssDNA. The cell/Cas9/ssDNA mixture was transferred into Nucleocuvettes and electroporated using the P3 Primary Cell 4D-Nucleofector X Kit S (Lonza V4XP-3032), program code CM-137. CT26 cells were transduced by incubating 1 X 1 04 cells in 100 pL media with 1 2.5 pL concentrated lentivirus for 48 hours. Post-infection, stably transduced cells were selected by incubation with puromycin 1 8 pg/mL for 48 hours. Delivery of Cas9/ssDNA was as above, except CT26 cells were resuspended in SE Cell line solution and electroporated using program code DS-1 20. Two ssDNA sequences were used with Cas9: ssDNA (GFP) :
AT G AGT AAAGG AG AAG AACTTTT CACT GG AGTT GT CCCAATT CTT GTT G AATT AG ATGGCG A TGTT A AT GG G C A AAA ATT CTCTGTCAGTGGAGAGGGTG (SEQ ID NO: 79) ; and ssDNA (IDT): IDT Cas9 electroporation enhancer (cat# 1075916).
Tracking of Indels by Decomposition (TIDE)
[00236] Editing efficiency was determined by TIDE analysis (Brinkman EK, et al.,
Nucleic acids research. 2014;42(22):e168-e). Briefly, genomic DNA was extracted at indicated times post-electroporation using 1 x 104 cells/pL QuickExtract™ DNA Extraction Solution (Epicentre). Genomic regions containing CRISPR-targeted sites were PCR amplified using Q5® High-Fidelity DNA Polymerase (New England BioLabs, Inc), purified by QIAquick PCR
Purification Kit (Qiagen) or ZR-96 DNA Clean & Concentrator™-5 (Zymo Research) and sequenced by Sanger sequencing. Primer sequences are included in Table 3.
Table 3. gDNA PCR/sequencing primers (all 5’-3’)
Figure imgf000090_0001
Targeted NGS analysis of CRISPR-Cas9 edited loci
[00237] PCR amplicons were purified using 1 8x Agencourt AmpureXP beads
(Beckman Coulter) following the manufacturer’s recommendations. Amplicons were quantified using the Quant-iT PicoGreen dsDNA assay (Life Technologies) following the manufacturer’s recommendations. Illumina sequencing libraries were generated using the Nextera DNA Library Prep Kit (Illumina) following the manufacturer’s recommendations with the following changes. Tagmentation was performed in a final volume of 5 pi using 5 ng of purified PCR product, 0.15 pi of Nextera tagment enzyme and tagmentation buffer previously described by Wang Q, et al., Nature protocols. 2013;8(10):2022-32. Tagmented amplicons were then PCR amplified in a final volume of 50 mI using a final concentration of 0.2 mM dNTP (Life Technologies), 0.2 mM lllumina index PCR primers (Integrated DNA Technologies), 1 x Phusion DNA polymerase buffer (New England Biolabs) and 1 U of Phusion DNA polymerase (New England Biolabs). PCR cycling conditions used were as follows: 72 SC for 3 min, 98 SC for 2 min and 15 cycles of 98 SC for 10 sec, 63 SC for 30 sec, and 72 SC for 3 min. Sequencing libraries were then purified using 1 0x Agencourt AmpureXP beads (Beckman Coulter) following the manufacture’s recommendations. Sequencing libraries were quantified using the Quant-iT PicoGreen dsDNA assay (Life
Technologies) following the manufacture’s recommendations and pooled equimolar for sequencing. Sequencing libraries were sequenced with 150 base paired-end reads on a MiSeq sequencer following the manufacture’s recommendations (lllumina). A minimum of a 1000-fold sequencing coverage was generated per amplicon. Reads, generated by the standard MiSeq reporter software (version 2.6.2, lllumina), were aligned to the human genome reference sequence (build GRCh38) using the BWA-MEM aligner (version 0.7.4-r385, (Li H, et al., Bioinformatics (Oxford, England). 2009;25(14):1754-60)) using‘hard-clipping’ to trim 3’ ends of reads of lllumina sequences and low quality bases. Resulting reads were aligned a second time but this time without‘hard-clipping’. Reads were then subjected to variant calling using the VarDict variant caller (Lai Z, et al., Nucleic acids research. 2016;44(1 1 ) :e10) with the allele frequency detection limit set at >=0.0001 . Variants identified were filtered for known variants found in dbSNP (Sherry ST, et al., Nucleic acids research. 2001 ;29(1 ):308-1 1 ). Variants in the edited samples were further filtered to exclude variants identified in the untreated controls, variants with a VarDict strand bias of 2:1 , variants located outside a 10Obp window around the Cas9 cut site, and single nucleotide variants within a 100bp window around the Cas9 cut site.
In vitro cleavage assays
[00238] Templates for in vitro transcription (IVT) of single gRNAs were generated by appending the minimal T7 promoter sequence upstream of sgRNAs by PCR amplification from lentiviral plasmids using the following primers:
Table 4. PCR primers
Figure imgf000091_0001
[00239] This reaction generates the following product: 5’ - G AATT AAT ACG ACT CACT AT AG(N20)GTTT AAG AGCT ATGCTGG AAACAGCAT AGCAAGTTT AAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCT - 3’ (SEQ ID NO: 60). IVT reactions were run for 16 hours at 37°C using 200 ng of purified PCR product and MEGAshortscript™ T7 Transcription Kits (Ambion). IVT sgRNA was purified using
MEGAclear™ Transcription Clean-Up Kit (Ambion) per manufacturer’s procotol and quantified by Nanodrop. Target DNA for cleavage assays were generated by PCR amplification from CT26 gDNA using Smg8 3.1 and Mtap 1 .1 primer sets. For in vitro cleavage, RNP formation was performed as described above but scaled to 300 ng Cas9, 5.625 pmol tracrRNA, and 1 1 .25 pmol crRNA in 2 pL total volume. Cleavage reactions were run in cleavage buffer (20 mM HEPES, 100 mM NaCI, 5 mM MgCI2, 0.1 mM EDTA) containing 100 ng of target DNA with or without IVT sgRNA. Reactions were incubated for 1 hour at 37°C, then 4 pL of 1 mg/mL RNase A was added to each reaction and incubated an additional 15 minutes at 37 °C. Reactions were stopped by adding SDS to a final concentration of 0.1 %. Samples were resolved on 2% TAE- agarose gels and imaged on a ChemiDoc™ MP (Bio-Rad).
Western Blotting
[00240] Cells were lysed using M-PER Mammalian Protein Extraction Reagent (Thermo Fisher) supplemented with Halt™ Protease Inhibitor Cocktail (Thermo Fisher). Lysate concentrations were quantified by Bradford assay using Pierce™ Detergent Compatible Bradford Assay Kit (Thermo Fisher) read on a SpectraMax Plus 384 Microplate Reader (Molecular Devices). Samples were prepared in 1 X XT Sample Buffer (Bio-Rad) with XT reducing agent (Bio-Rad) and run on 4-12% Criterion™ XT Bis-Tris Protein Gels (Bio-Rad) in XT MES Running Buffer (Bio-Rad). Gels were transferred to 0.2 pm Nitrocellulose membranes in 1 X Tris/Glycine buffer with 10% methanol. Blots were blocked in 5% non-fat dairy milk in 1 X Tris-buffered saline with 0.1 % Tween-20 (TBS-T) for one hour before overnight incubation at 4°C with primary antibody diluted in 5% BSA in TBS-T. The following primary antibodies were used: MTAP (Cell Signaling Technology #4158), GAPDH (Cell Signaling Technology #21 18). Blots were developed after incubation with Amersham ECL Donkey Anti-Rabbit IgG HRP-linked whole Ab (GE Healthcare Life Sciences) diluted in 5% milk in TBS-T using Luminata Forte Western HRP Substrate (EMD Millipore). Blots were imaged using ChemiDoc™ MP (Bio-Rad).
EXAMPLE 2: A foundation for CRISPR screening in human primary cells
[00241 ] Plasmid-encoded gRNA is a key feature of a cost-effective genome-wide screening platform, and this constraint formed the foundation of our approach. Guide RNA libraries encoded in plasmids and packaged into lentivirus (herein referred to as lenti vector- encoded gRNA) can be amplified as needed, and due to their genomic integration also enable pooled screening formats. While transduction of HSPC with gRNA-encoding lentiviral vectors was successful, we were unable to achieve efficient and homogeneous transduction with Cas9- encoding vectors, presumably because the larger insert size reduces viral packaging efficiency (Kumar, M., et al., Hum Gene Ther 12, 1893-1905 (2001 )). Thus we delivered lentiviral vectors encoding only the gRNA into HSPC (Fig. 1 A), constraining the multiplicity of infection to minimize multiple integrations that would contribute to noise in a pooled screening context (Fig. 1 B). Coupling with other approaches to deliver Cas9 protein, mRNA or DNA - including lipid transfection, cell penetrating peptide fusion Chariot™, iTOP (D'Astolfo DS, et al., Cell.
2015;161 (3):674-90) and electroporation - resulted in variable efficacy (data not shown).
[00242] The best approach (Cas9 protein electroporation) was insufficient for screening purposes due to poor knockout efficiency as assessed across a range of guides targeting PTPRC (a.k.a. CD45) (Fig. 2A). This limitation was not unique to HSPC, and was also observed in T cells (Fig. 2B) and the murine cancer cell line CT26 (Fig. 2C). However, single gene knockouts in HSPC are often generated by electroporating pre-formed Cas9-gRNA ribonucleoprotein (RNP) complexes (Gundry, M.C. et al., Cell reports 17, 1453-1461 (2016)). This approach can achieve >85% editing in a population, indicating that Cas9 is effectively delivered to HSPC when coupled to a gRNA. Therefore, we reasoned that perhaps the RNP format could be repurposed as solely a delivery vehicle for Cas9. As such, Cas9 would be delivered as a non-targeting RNP but utilize the lenti vector-encoded gRNA to ultimately direct target site editing, challenging the prevailing hypothesis that the Cas9-gRNA association, once formed, is essentially irreversible.
[00243] First, HSPC were transduced with lentiviral vectors encoding gRNA targeting the cell surface protein CD45 and incubated for 48 hours to allow gRNA expression. Next, the cells were electroporated in the presence of Cas9 pre-complexed with non-targeting gRNA, or Cas9 alone for comparison. CD45 knockout was assessed by flow cytometry 4 days later (FIG. 1 A).
[00244] When Cas9 was electroporated pre-complexed to a non-targeting gRNA, we observed more efficient protein knockout of the target of the lenti vector-encoded gRNA. Using three independent lenti vector-encoded gRNAs targeting CD45, electroporation of Cas9 protein alone resulted in 7.5% ± 0.36%, 23.3% ± 2.33% and 61 .5% ± 1 .70% CD45 negative cells. Delivering Cas9 by non-targeting RNP boosted CD45 knockout, resulting in 54.8% ± 1 .27%, 71 .1 % ± 0% and 82.6% ± 0.92% CD45 negative cells, respectively (Fig. 2A). Editing efficiency was further confirmed by next generation sequencing (NGS) (Fig. 1 C). This phenomenon was reproducible in other cell types and species. Delivery of Cas9 by
electroporation of non-targeting RNP enhanced knockout of CD45 in T cells (Fig. 2B) and increased editing efficiency of six gRNAs targeting three different genes in the murine colon cancer cell line CT26 (Fig. 2C and Figs. 1 D-1 F for FACS and Western blot data). Not only did Cas9 delivery by non-targeting RNP outperform equal amounts of uncomplexed Cas9, it was superior to electroporation of up to four times the amount of Cas9 across a range of gRNAs (Fig. 3).
[00245] The targeting sequence of the pre-complexed gRNA did not appear to influence the knockout efficiency of the lenti vector-encoded gRNA target (Fig.
4A). Additionally, pre-complexed gRNA with and without chemical modification (Fig. 4A) and in split gRNA or single gRNA form (Fig. 4B) were all efficient at enabling the approach. Pre- complexed RNP could edit efficiently even in the presence of the lenti vector-encoded gRNA (Fig. 4C).
EXAMPLE 3: Guide RNA binding enhances Cas9 delivery by electroporation
[00246] Given the high binding affinity of the Cas9-gRNA complex (10 pM in vitro)
(Wright AV, et al., Proceedings of the National Academy of Sciences. 2015;1 12(10):2984-9), it was unexpected that inside the cell pre-complexed Cas9 could enable efficient editing with the targeting gRNA encoded in a lenti vector. One possible mechanism is that more unbound Cas9 is delivered into the cell when electroporation occurs in the presence of the pre-complexing reaction. Indeed, we saw a more efficient protein delivery with the gRNA/Cas9 complex than with Cas9 alone (Figs. 5A-5C). As this assay did not discriminate between gRNA-bound and unbound Cas9, we then asked whether unbound Cas9 was present following the pre- complexing reaction. Cas9 was pre-complexed to a gRNA targeting Smg8, in various ratios, then a second gRNA targeting Mtap was added. Functional Cas9-gRNA RNP activity was assessed with an in vitro cleavage assay. At our standard molar ratio of 3:1 gRNA:Cas9 used for pre-complexing, there was complete cleavage of Smg8 target and no detectable cleavage of Mtap target (Fig. 5D). Even in the presence of an 81 -fold molar excess of Mtap gRNA we could not detect functional Cas9-Mtap gRNA complexes (Fig. 5E). This demonstrates that gRNA exchange does not occur in vitro and that the complexing reaction fully saturates functional Cas9 to the detection limit of the assay. Together with the efficient delivery of RNP, however, this suggests an unanticipated exchange for the lenti gRNA in the cell. Hence, we named the approach Guide Swap.
EXAMPLE 4: Guide Swap enables pooled depletion and enrichment screens in T cells
[00247] We next assessed the suitability of Guide Swap for CRISPR pooled screening in human primary cells. As a first step, we titrated the amount of non-targeting RNP. Increasing RNP resulted in increased editing, with 6 pg RNP sufficient to achieve near-maximal editing across four independent gRNAs in HSPC and T cells (Figs. 6A-6B). Using 6 pg RNP, Guide Swap editing occurred quickly in HSPC, reaching near-maximal levels 72 hours post electroporation (Fig. 2D). This is on a timescale consistent with the transient bolus delivery of Cas9 and is particularly advantageous for primary cells, which have a limited life span in culture. To simplify scaling up without significantly impacting the cost for large-scale screening, we tested a range of cell densities for the electroporation step and determined that up to 1 million HSPC per 20 pL volume could be electroporated while maintaining editing efficiency (Fig. 6C). Finally, conventional targeting RNPs are the gold standard for arrayed format editing in HSPC and T cells and provide a useful comparison. While Guide Swap occasionally over- or under-performed relative to targeting RNP, for most gRNAs, Guide Swap and targeting RNP resulted in a similar percentage of cells with phenotypic knockout (Fig. 2E). This indicates that leveraging pre-existing gRNA libraries for a pooled Guide Swap screen should result in suitable target coverage and would be a high-throughout, cost-effective alternative to arrayed format screening.
[00248] To validate the performance of Guide Swap in pooled screening, we conducted a screen in human primary CD4+ T cells and assessed both depletion and enrichment phenotypes (Fig. 7A). Briefly, we transduced activated T cells with a pool of -13,000 gRNAs representing 2,585 genes at approximately 5 gRNAs/gene. In addition to internal library gRNAs targeting CD4, CD45 and CXCR4, we also spiked-in 10 additional gRNAs for each of these genes. After incubating for two days to allow expression of the lenti vector-encoded gRNAs, we removed a fraction of the cells as a Day 0 sample, and electroporated the remaining cells with non-targeting RNP to deliver Cas9. Six days post-nucleofection, the cells were stained and sorted into Day 6 populations that had retained (CD4+CD45+CXCR4+) or lost the surface receptors CD4, CD45 or CXCR4. We isolated genomic DNA and compared encoded gRNA abundance by NGS.
[00249] Deep sequencing analysis (Fig. 8A) revealed strong correlation between replicate screens (Figs. 8B-8C). By applying RSA analysis of sgRNA sequences depleted in the Day 6 CD4+CD45+CXCR4+ compared to Day 0 sample, we identified known essential genes among the top hits including MDM2, WEE1 , EEF2 and TOP2A (Fig. 7B). Of the 68 hits defined by -logRSA>3, -logFC>1 , 50 are previously reported essential genes (Hart, T. et al. Cell 163,
1515-1526 (2015)). An enrichment analysis of the top ranked 100 genes revealed cell cycle phase transition, symbiont process and DNA replication as significantly enriched GO biological processes (Fig. 7C). Components of the IL2R were also significantly depleted (-logRSA>3, - logFC>1 ).
[00250] As anticipated, populations sorted for loss of the cell surface proteins CXCR4 (Fig. 7D), CD4 or CD45 (Figs. 8D-8E) showed enrichment of the relevant gRNAs in both replicates which was reflected in -logRSA values of 40.5, 31 .3 and 21 .7, respectively. RSA analysis also revealed additional genes that regulate surface expression of these proteins. Among these, the highest scoring genes in the CXCR4- population were HIF1 A (-logRSA 9.8), a known regulator of CXCR4 expression, as well as STAT5B (-logRSA 9.2). LCK, which associates with the cytoplasmic tail of CD4, was also enriched in the CD4- population (-logRSA 4.0). Finally, we confirmed that an alternative analysis based on second best scoring gRNA identified an overlapping gene set (essential genes comparison in Fig. 8F).
EXAMPLE 5: Guide Swap screen to elucidate regulators of hematopoiesis
[00251 ] Having established and validated Guide Swap as a method for screening in human primary cells, we next applied Guide Swap to pooled CRISPR-Cas9 screening to identify regulators of ex vivo hematopoiesis, a topic relevant to expansion of cord blood and genetically modified or corrected HSPC. As a first step, Guide Swap was shown to be applicable to multiple donors and HSPC sources. Guide Swap enabled efficient CD33 and CD45 knockout in HSPC isolated from two different mobilized peripheral blood donors and one cord blood donor (Fig. 9A). Within the HSPC compartment, efficient knockout of a lenti vector- encoded gRNA target was also obtained in CD34+CD90+ cells (Fig. 9B, top), a population further enriched in bona fide hematopoietic stem cells (Majeti R, et al., Cell stem cell.
2007;1 (6):635-45). CD45 knockout efficiency in the CD34+CD90+ population was only slightly reduced compared to the CD34+CD90- population (Fig. 9B). Cell recovery post-electroporation with the non-targeting RNP was comparable to mock (Fig. 9C). We also ascertained that the non-targeting gRNA for RNP delivery had no detectable effect on the phenotype of interest, maintaining %CD34+ cells comparable to mock up to 14 days post-electroporation (Fig. 9D).
[00252] Modulators of ex vivo hematopoiesis were identified using the HSPC marker CD34. CD34+ HSPC spontaneously differentiate into cells lacking CD34 in culture, thus enrichment of a given gRNA in the remaining HSPC suggests that the target gene knockout promotes self-renewal. Guide RNA libraries were introduced to cord blood-derived CD34+ HSPC by lentiviral transduction. Two days post-transduction, Cas9 was delivered via non targeting RNP electroporation, and the cells were returned to culture. Ten and eleven days post electroporation, cells were separated into HSPC (CD34+) and differentiated (CD34-) populations by fluorescence-activated cell sorting. We isolated genomic DNA and compared encoded gRNA abundance by NGS.
[00253] As a positive control for our screen we designed a gRNA targeting the aryl hydrocarbon receptor (AHR), inhibition of which by the antagonist StemRegenin 1 (SR1 ) and shRNA knockdown has previously been demonstrated to expand HSPC ex vivo (Boitano AE, et al., Science. 2010;329(5997):1345-8). Guide Swap-mediated AHR knockout expanded phenotypic HSPC to a comparable extent achieved by AHR knockout with a conventional RNP approach, as well as by treatment with 750 nM SR1 (Fig. 10A).
[00254] To identify modulators of ex vivo hematopoiesis at a genome-scale, we screened a library covering 13,243 genes with an average of 5 gRNAs per gene arranged in five pools. We observed in our NGS results (Fig. 1 1 A) that lower gRNA abundance in the pool resulted in higher gRNA variance in the CD34+ and CD34- populations. Therefore, we derived a score for the change in abundance in CD34+ and CD34- populations that takes into account the gRNA abundance. As expected, all positive control gRNAs targeting AHR were significantly enriched (>3 SD) in the CD34+ population (Fig. 10B). We also identified a gRNA targeting CD34 that was significantly depleted (>3 SD) in the CD34+ population, as would be expected (Figs. 10B and 1 1 B). Because of the high level of spontaneous differentiation to CD34 negative cells in our culture conditions, our screen was specifically designed as an HSPC enrichment screen and therefore we focused our follow-up on validating negative regulators of HSPC expansion.
[00255] Among the top ranked gRNAs were those targeting UROS and UROD, which encode two enzymes involved in the biosynthesis of heme (Fig. 10B). We concluded that these were screening artifacts, as knockout of these genes produces cells that fluoresce in the APC channel, which was used to distinguish CD34+ and CD34- cells (Fig. 1 1 C).
[00256] To provide a stringent analysis that adequately accounts for noise in the screen, we selected the second-best gRNA using the absolute value of the normalized score irrespective of the directionality of the effect. Based on this analysis, AHR was the top-ranked gene, followed by a novel regulator of hematopoiesis, ACTR6. The screen also identified RCOR1, previously implicated in murine hematopoiesis (Yao H, et al., Blood. 2014;123(20):3175-84). The highest ranking gRNAs for both ACTR6 and RCOR1 were confirmed to increase the proportion of CD34+ cells compared to mock. At 20 days post electroporation, the percentages of CD34+ cells remaining in culture were 5-fold and 5.6-fold greater in ACTR6 and RCOR1 knockout cultures, respectively, compared to mock (Fig. 10C). We also characterized the effect of the hit gRNAs on additional hematopoietic surface markers including CD90, CD41 a, CD45RA and CD71 (Fig. 12). The CD34 expansion phenotype was observed with three to four independent gRNAs targeting each gene (Fig. 10D), suggesting that the phenotype was indeed due to loss of RCOR1 and ACTR6 expression.
[00257] In the Examples above we detail a novel methodology that enables pooled genome-scale CRISPR-Cas9 screening in human primary T cells and HSPC. In addition to studies of hematopoiesis, the method could be applied to rapidly screen HSPC for the most efficient sites for therapeutic editing, to identify critical regions that regulate gene expression (e.g., fetal hemoglobin) or for identifying splice variants that determine cell fate. In T cells, this approach could be used to enable efficient genome-wide screening to identify new targets for cancer immunotherapies or host factors that control infection by pathogens such as HIV. We anticipate that Guide Swap will enable genome-scale functional screening of coding sequences, splice sites and regulatory regions in a variety of human primary cell types with broad implications in regenerative medicine and applied immunology.
[00258] Additionally, we also assessed Guide Swap in the murine colon cancer cell line CT26, which is frequently used to study and develop cancer immunotherapies. Guide Swap delivery of Cas9 is transient, and this unique characteristic could be leveraged for screening in in vivo mouse models that require immunological tolerance to Cas9, such as syngeneic tumor models. We expect that this approach could be rapidly applied for screening in multiple mouse strains without the time-consuming requirement to engineer Cas9 knock-in mice.
[00259] When applying Guide Swap to a new cell type, two factors must be considered: the suitability of the cell type of interest for lentiviral transduction and
electroporation. While efficient transduction with lentiviral vector containing the gRNA pool was achievable for human primary HSPC and T cells, some cell types with low transduction efficiency may need higher cell input for library coverage. For the electroporation step, we provide optimized electroporation conditions for human primary HSPC, T cells and CT26 using a commonly used electroporator. While not all cell types will maintain viability under these conditions, many manufacturers provide cell-type specific optimized protocols and kits to further maximize viability and editing. While all factors must be carefully weighed, we find that these challenges are common to currently available pooled (transduction) and arrayed
(electroporation) screening methodologies and that Guide Swap enables a critical combination of speed, efficacy and scale not otherwise achievable.
[00260] Our methodology could also potentially be further developed to take advantage of other advances in CRISPR-Cas9 capabilities including catalytically inactive mutants of Cas9 tethered to different functional domains. Fusion to base editing enzymes could be combined with guides tiled across a gene of interest to define structure-function relationship. Additionally, coupling Guide Swap with recently described strategies that combine barcoding perturbations with single cell RNA-sequencing (CRISP-seq, Perturb-seq (Jaitin DA, et al., Cell. 2016;167(7):1883-96. e15; Dixit A, et al., Cell. 2016;167(7):1853-66.e17; Adamson B, et al.,
Cell. 2016;167(7) :1867-82. e21 )) would enable assaying of complex phenotypes at scale in human primary cells. Lastly, Guide Swap could be used to enable modifier screens by pre- complexing Cas9 with a targeted gRNA, instead of a non-targeting gRNA as used in our screens.
[00261 ] Although the Guide Swap methodology was surprising and
counterintuitive, it was also robust and reproducible across multiple guides, gene targets, cell types and species. There remain multiple possible explanations for the mechanism of action of Guide Swap. We cannot eliminate the possibility that a portion of unbound Cas9 remains and is efficient at editing in a cellular context. There may also be other factors at play that facilitate gRNA exchange in the cell. For example, the presence of intracellular factors, high intracellular concentration of the lenti vector-encoded gRNA or post-translational modification of Cas9. In addition to the new biological space that could be explored using this approach, future studies will also investigate the intracellular Cas9-gRNA interaction and the mechanism of action of Guide Swap. Our study creates a roadmap for genome-scale knockout screening in previously inaccessible biological systems, as well as a platform for studies of Cas9 biology and new technology development.
[00262] It is understood that the examples and embodiments described herein are for illustrative purposes and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims. All publications, sequence accession numbers, patents, and patent applications cited herein are hereby incorporated by reference in their entirety for all purposes.

Claims

WHAT IS CLAIMED IS:
1 . A method of inducing one or more genetic modifications in a cell, e.g., in a primary cell, said method comprising:
a) introducing into said cell a ribonuclear protein complex (RNP) comprising a Cas9
molecule and a precomplexed RNA; and
b) introducing into said cell one or more nucleic acid sequences encoding one or more encoded gRNA molecules, each of said one or more encoded gRNA molecules comprising a targeting domain.
2. The method of claim 1 , wherein a genetic modification (e.g., an indel) is introduced at or near an encoded target sequence of said one or more encoded gRNA molecules.
3. The method of claim 1 or 2, wherein the precomplexed RNA comprises a gRNA molecule comprising a targeting domain.
4. The method of claim 3, wherein the precomplexed gRNA molecule is a dual guide RNA (dgRNA) molecule.
5. The method of claim 3, wherein the precomplexed gRNA molecule is a single guide RNA (sgRNA) molecule.
6. The method of any one of claims 3-5, wherein the targeting domain of the precomplexed gRNA molecule specifically binds to a target sequence in the genome of the cell to which it is introduced.
7. The method of any one of claims 3-5, wherein the targeting domain of the precomplexed gRNA molecule does not specifically bind to a target sequence in the genome of the cell to which it is introduced.
8. The method of claim 6, wherein the target sequence is located in a target gene.
9. The method of claim 8, wherein the target gene is selected from the group consisting of beta-2-macroglobulin (B2M), CD33, CD45, PD-1 .
10. The method of any one of claims 1 -9, wherein the targeting domain of each of the one or more encoded gRNA molecules specifically binds to a target sequence of an encoded target gene.
1 1 . The method of any one of claims 1 -10, wherein each of the one or more encoded RNA
molecules is encoded by a vector.
12. The method of claim 1 1 , wherein the vector is selected from the group consisting of a viral vector (e.g., a lentiviral vector, a retroviral vector, etc.), a plasmid, a minicircle, and a nanoplasmid.
13. The method of any one of claims 1 -12, wherein each of the one or more encoded gRNA molecules is a member of a library of encoded gRNA molecules.
14. The method of claim 13, wherein the library of encoded gRNA molecules is a human or mouse genome-wide dgRNA or sgRNA library, preferably an sgRNA library.
15. The method of any one of claims 1 -14, wherein the Cas9 molecule is a Cas9 protein from Streptococcus pyogenes, Streptococcus Aureus, or Streptococcus thermophilus.
16. The method of any one of claims 1 -15, wherein the cell is a primary cell.
17. The method of claim 16, wherein the cell is a human primary cell or a mouse primary cell.
18. The method of claim 16 or 17, wherein the primary cell is a hematopoietic stem cell (HSC), a cancer cell, a lymphocyte, a macrophage, a dendritic cell, an adipocyte, a neuron, or a combination thereof.
19. The method of any one of claims 8-18, wherein the target gene is modified at an efficiency of at least 70%.
20. The method of any one of claims 10-19, wherein one or more of the encoded target gene is modified at an efficiency of at least 50%.
21 . The method of any one of claims 1 -20, further comprising introducing into said cell a ssDNA.
22. The method of claim 21 , wherein the ssDNA is introduced with the RNP.
23. A method of screening one or more encoded gRNA molecules in a population of cells, e.g., a population of primary cells, comprising:
a) introducing into said population of cells a ribonuclear protein complex (RNP) comprising a Cas9 molecule and a precomplexed RNA or an apo-Cas9 molecule with a ssDNA; b) introducing into said population of cells a library of nucleic acid sequences encoding one or more encoded gRNA molecules, each of said one or more encoded gRNA molecules comprising a targeting domain;
c) assaying a cell of the population of cells for a property; and
d) identifying the encoded gRNA molecule introduced into said cell.
24. The method of claim 23, wherein a genetic modification (e.g., an indel) is introduced at or near an encoded target sequence of said one or more encoded gRNA molecules.
25. The method of claim 23 or 24, wherein the property is selected from the group consisting of cell survival, cell death, cell growth, cell differentiation, cell activation, gene expression (single gene expression or multiple gene expression), a phenotypic change, and any combination thereof.
26. The method of any one of claims 23-25, wherein the identifying comprises genetic analysis of the cell having the property.
27. The method of claim 26, wherein the genetic analysis comprises sequencing, hybridization, PCR, or a combination thereof.
28. The method of any one of claims 23-27, wherein the identifying comprises comparing the level of the encoded gRNA molecule to a reference level.
29. The method of claim 28, wherein the encoded gRNA molecule is identified if the difference in the level of the encoded gRNA molecule compared to the reference level has a Z-score of less than -3 or greater than 3.
30. The method of any one of claims 23-29, wherein the identifying comprises calculating an enrichment score of the encoded gRNA molecule.
31 . The method of claim 30, wherein the encoded gRNA molecule is identified if the enrichment score of the encoded gRNA molecule is greater than 2 or less than 0.5.
32. The method of any one of claims 23-31 , wherein the population of cells expresses a reporter gene product.
33. The method of claim 32, wherein the assaying a cell of the population of cells for a property comprises comparing the level of the reporter gene product in the cell to a reference level.
34. The method of claim 33, wherein the cell is identified as having the property if the difference in the level of the reporter gene product of the cell compared to the reference level has a Z- score of less than -3 or greater than 3.
35. The method of any one of claims 23-34, wherein the precomplexed RNA is a gRNA
molecule comprising a targeting domain.
36. The method of claim 35, wherein the precomplexed gRNA molecule is a dual guide RNA (dgRNA) molecule.
37. The method of claim 35, wherein the precomplexed gRNA molecule is a single guide RNA (sgRNA) molecule.
38. The method of any one of claims 35-37, wherein the targeting domain of the precomplexed gRNA molecule specifically binds to a target sequence in the genome of the cell to which it is introduced.
39. The method of any one of claims 35-37, wherein the targeting domain of the precomplexed gRNA molecule does not specifically bind to a target sequence in the genome of the cell to which it is introduced.
40. The method of claim 38, wherein the target sequence is located in a target gene.
41 . The method of claim 40, wherein the target gene is selected from the group consisting of beta-2-macroglobulin (B2M), CD33, CD45, PD-1 .
42. The method of any one of claims 23-41 , wherein the targeting domain of each of the one or more encoded gRNA molecules specifically binds to a target sequence of an encoded target gene.
43. The method of any one of claims 23-42, wherein each nucleic acid sequence encoding one or more encoded gRNA molecules comprises a vector.
44. The method of claim 43, wherein the vector is a lentiviral vector.
45. The method of any one of claims 23-44, wherein the library of encoded gRNA molecules is a human or mouse genome-wide dgRNA or sgRNA library, preferably an sgRNA library.
46. The method of any one of claims 23-45, wherein the Cas9 molecule is a Cas9 protein from Streptococcus pyogenes, Streptococcus Aureus, or Streptococcus thermophilus.
47. The method of any one of claims 23-46, wherein the population of cells is a population of primary cells.
48. The method of claim 47, wherein the population of primary cells is a population of human primary cells or a population of mouse primary cells.
49. The method of claim 47 or 48, wherein the population of primary cells comprises a
hematopoietic stem cell (HSC), a cancer cell, a lymphocyte, a macrophage, a dendritic cell, an adipocyte, a neuron, or a combination thereof.
50. The method of any one of claims 40-49, wherein one or more of the target gene is modified at an efficiency of at least 70%.
51 . The method of any one of claims 42-50, wherein the encoded target gene is modified at an efficiency of at least 50%.
52. The method of any one of claims 23-51 , further comprising introducing into said population of cells a ssDNA.
PCT/IB2018/059313 2017-11-28 2018-11-26 Pooled crispr/cas9 screening in primary cells using guide swap technology WO2019106522A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201762591648P 2017-11-28 2017-11-28
US62/591,648 2017-11-28

Publications (1)

Publication Number Publication Date
WO2019106522A1 true WO2019106522A1 (en) 2019-06-06

Family

ID=64902136

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2018/059313 WO2019106522A1 (en) 2017-11-28 2018-11-26 Pooled crispr/cas9 screening in primary cells using guide swap technology

Country Status (1)

Country Link
WO (1) WO2019106522A1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11345932B2 (en) 2018-05-16 2022-05-31 Synthego Corporation Methods and systems for guide RNA design and use
US11866726B2 (en) 2017-07-14 2024-01-09 Editas Medicine, Inc. Systems and methods for targeted integration and genome editing and detection thereof using integrated priming sites

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015040075A1 (en) * 2013-09-18 2015-03-26 Genome Research Limited Genomic screening methods using rna-guided endonucleases
WO2016123578A1 (en) * 2015-01-30 2016-08-04 The Regents Of The University Of California Protein delivery in primary hematopoietic cells
WO2017115268A1 (en) * 2015-12-28 2017-07-06 Novartis Ag Compositions and methods for the treatment of hemoglobinopathies

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015040075A1 (en) * 2013-09-18 2015-03-26 Genome Research Limited Genomic screening methods using rna-guided endonucleases
WO2016123578A1 (en) * 2015-01-30 2016-08-04 The Regents Of The University Of California Protein delivery in primary hematopoietic cells
WO2017115268A1 (en) * 2015-12-28 2017-07-06 Novartis Ag Compositions and methods for the treatment of hemoglobinopathies

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
ASHLEY M. JACOBI ET AL: "Simplified CRISPR tools for efficient genome editing and streamlined protocols for their delivery into mammalian cells and mouse zygotes", METHODS, vol. 121-122, 27 March 2017 (2017-03-27), NL, pages 16 - 28, XP055560292, ISSN: 1046-2023, DOI: 10.1016/j.ymeth.2017.03.021 *
O. SHALEM ET AL: "Genome-Scale CRISPR-Cas9 Knockout Screening in Human Cells", SCIENCE, vol. 343, no. 6166, 12 December 2013 (2013-12-12), pages 84 - 87, XP055115506, ISSN: 0036-8075, DOI: 10.1126/science.1247005 *
PAMELA Y. TING ET AL: "Guide Swap enables genome-scale pooled CRISPR-Cas9 screening in human primary cells", NATURE METHODS, vol. 15, no. 11, 8 October 2018 (2018-10-08), New York, pages 941 - 946, XP055558398, ISSN: 1548-7091, DOI: 10.1038/s41592-018-0149-1 *
PARNAS OREN ET AL: "A Genome-wide CRISPR Screen in Primary Immune Cells to Dissect Regulatory Networks", CELL, CELL PRESS, AMSTERDAM, NL, vol. 162, no. 3, 16 July 2015 (2015-07-16), pages 675 - 686, XP029248090, ISSN: 0092-8674, DOI: 10.1016/J.CELL.2015.06.059 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11866726B2 (en) 2017-07-14 2024-01-09 Editas Medicine, Inc. Systems and methods for targeted integration and genome editing and detection thereof using integrated priming sites
US11345932B2 (en) 2018-05-16 2022-05-31 Synthego Corporation Methods and systems for guide RNA design and use
US11697827B2 (en) 2018-05-16 2023-07-11 Synthego Corporation Systems and methods for gene modification
US11802296B2 (en) 2018-05-16 2023-10-31 Synthego Corporation Methods and systems for guide RNA design and use

Similar Documents

Publication Publication Date Title
US20230118337A1 (en) Compositions and methods for the treatment of hemoglobinopathies
US20230126434A1 (en) Optimized crispr/cas9 systems and methods for gene editing in stem cells
US20240002843A1 (en) Compositions and methods for the treatment of hemoglobinopathies
JP2023123561A (en) CRISPR/CAS-related methods and compositions for improving transplantation
WO2017070429A1 (en) Methods involving editing polynucleotides that encode t cell receptor
TW202035693A (en) Compositions and methods for immunotherapy
AU2016262521A1 (en) CRISPR/CAS-related methods and compositions for treating HIV infection and AIDS
CN110832075A (en) Compositions and methods for immunooncology
US20210147828A1 (en) Dna damage response signature guided rational design of crispr-based systems and therapies
WO2019106522A1 (en) Pooled crispr/cas9 screening in primary cells using guide swap technology
US20230279394A1 (en) Compositions and methods for the treatment of hemoglobinopathies
Dimitri et al. TET2 regulates early and late transitions in exhausted CD8+ T-cell differentiation and limits CAR T-cell function
WO2022243531A1 (en) Gene therapy for the treatment of severe combined immunodeficiency (scid) related to rag1

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18829467

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18829467

Country of ref document: EP

Kind code of ref document: A1