WO2019101116A1

WO2019101116A1 - Uses of dna tetrahedron for preparing drug for promoting neural repair

Info

Publication number: WO2019101116A1
Application number: PCT/CN2018/116847
Authority: WO
Inventors: 林云锋; 马文娟; 蔡潇潇; 邵晓茹; 谢雪萍
Original assignee: 四川大学
Priority date: 2017-11-22
Filing date: 2018-11-22
Publication date: 2019-05-31
Also published as: CN109806275A; CN109806275B

Abstract

Provided are uses of a DNA tetrahedron for preparing a drug for promoting neural repair. Said tetrahedron is assembled into a tetrahedral structure by means of a four single-stranded DNA using complementary base pairing, wherein each rib has a double-stranded DNA structure. Also provided is a drug for promoting neural repair using DNA tetrahedron as an active substance.

Description

Use of DNA tetrahedron in the preparation of nerve prosthetic drugs

Technical field

The invention relates to the field of nerve repair, and in particular to the use of DNA tetrahedrons in the preparation of nerve prosthetic drugs.

Background technique

At present, neurological diseases, such as neurodegenerative diseases and nerve damage, are difficult problems in the medical field. Because the self-repair and renewal of nerve cells is difficult, the treatment of neural stem cells (NSCs) has become more and more concerned. Although there are still some technical problems to be solved in the clinical application of neural stem cell therapy, the most important thing at present is whether the implanted cells can proliferate, differentiate and migrate.

Some researchers have found that some drug molecules (such as prostaglandin E2, tenuigenin, etc.) can enhance the proliferation and differentiation of NSC, but its biocompatibility and utilization are not high, there are limitations in the treatment of nervous system diseases. .

DNA tetrahedrons (TDNs) are a new type of DNA nanomaterials that currently have extensive research and potential applications in the biomedical field. TDNs are DNA nanomaterials with three-dimensional structure formed by self-assembly of four single-stranded DNA single strands under specific conditions, and the base sequences of four single-stranded DNAs strictly follow the principle of "base complementary pairing", and thus accurate, Cleverly designed. The synthesis method of TDNs is simple, the yield is high, and the tolerance to specific or non-specific nucleases is better than that of ordinary linear DNA, and it has good biocompatibility, biosafety and biodegradability.

At present, TDNs have appeared in some research as a drug carrier, but its application in nerve repair has yet to be developed.

Summary of the invention

The present invention aims to provide a new drug that promotes nerve repair.

In order to solve this technical problem, the present invention provides the use of a DNA tetrahedron for the preparation of a medicament, which is a drug for promoting nerve repair.

In the aforementioned use, the DNA tetrahedron is assembled into a tetrahedral structure by base-pair complementary pairing of four single-stranded DNAs; each of the ribs of the tetrahedron is a double-stranded DNA structure.

In the above application, the DNA tetrahedron is prepared by heating an aqueous solution containing the four single-stranded DNAs at equal concentrations, so that the hydrogen bonds between the bases are completely broken, maintaining for 5 to 20 minutes, and then rapidly cooling to 0 to 0. 10 ° C, maintained for at least 15 min; the aqueous solution also contained 10 mM Tris-HCl, 50 mM MgCl 2 ; the pH of the aqueous solution before heating was 8.

In the above application, the maintenance time after heating is 10 minutes, the specific temperature of the temperature reduction is 4 ° C, and the retention time after the temperature reduction is 20 minutes.

In the aforementioned use, the sequences of the four single-stranded DNAs are shown in SEQ ID NOS. 1 to 4, respectively.

In the aforementioned use, the drug is a drug that promotes proliferation, differentiation and/or migration of neural stem cells.

Further, the drug is a drug that activates the Wnt/β-Catenin pathway.

Further, the drug is a drug that inhibits the Notch signaling pathway.

Further, the drug is a drug that activates the RHOA/ROCK2 signaling pathway.

The present invention also provides a drug for promoting nerve repair, which is prepared by using the DNA tetrahedron according to any one of claims 1 to 9 as an active material, together with a pharmaceutically acceptable adjuvant or auxiliary component.

The invention has the following beneficial effects:

The TDNs of the present invention can be ingested in large amounts by mouse neural stem cells, and their uptake rate is much higher than that of single-stranded DNA.

The TDNs of the invention can significantly increase the proliferation, differentiation and migration of mouse neural stem cells, and has a good nerve repairing ability.

Since the TDNs of the present invention are composed of nucleic acids, their metabolism is not toxic to cells and has good biocompatibility.

The TDNs of the present invention can be prepared as a drug for promoting nerve repair.

It is apparent that various other modifications, substitutions and changes can be made in the form of the above-described embodiments of the present invention.

The above content of the present invention will be further described in detail below by way of specific embodiments. However, the scope of the above-mentioned subject matter of the present invention should not be construed as being limited to the following examples. Any technique implemented based on the above description of the present invention is within the scope of the present invention. The present invention will be further described in detail below, but is not intended to limit the scope of the present invention, and in accordance with the above-described basic technical idea of the present invention, Other various modifications, substitutions or changes can be made.

DRAWINGS

Figure 1 is a schematic representation of four single-stranded synthetic TDNs.

Figure 2 is a schematic diagram showing the results of TDNs polyacrylamide gel electrophoresis.

Figure 3 is a schematic illustration of the results of transmission electron microscopy identification.

Figure 4 is a particle size distribution diagram, where a is the particle size distribution of single-stranded DNA and b is the particle size distribution of TDNs.

Fig. 5 is a graph showing the results of identifying the undifferentiated state of mouse neural stem cells by immunofluorescence technique.

Figure 6 is a graph showing the results of flow cytometry treatment of TDNs uptake by mouse neural stem cells.

Figure 7 is a fluorescent trace of mouse neural stem cells.

Figure 8 is a graphical representation of the results of the effect of TDNs concentration on the proliferation of mouse neural stem cells.

Figure 9 is a graph showing the results of cell cycle changes of mouse neural stem cells under the action of TDNs by flow cytometry.

Figure 10a is a blot of β-catenin, Lef-1 and Cyclin-D in mouse neural stem cells under the action of TDNs.

Figure 10b is a bar graph showing the relative intensities of β-catenin, Lef-1 and Cyclin-D protein blots in mouse neural stem cells under the action of TDNs.

Figure 10c is a bar graph showing the relative gene expression levels of β-catenin, Lef-1 and Cyclin-D in mouse neural stem cells under the action of TDNs.

Figure 11a is a Western blot of β-III-Tubulin in mouse neural stem cells under the action of TDNs.

Figure 11b is a bar graph showing the relative intensity of β-III-Tubulin western blot signal in mouse neural stem cells under the action of TDNs.

Figure 11c is a bar graph showing the relative expression levels of β-III-Tubulin gene in mouse neural stem cells under the action of TDNs.

Figure 12a is a blot of the Notch signaling pathway-associated protein in mouse neural stem cells under the action of TDNs.

Figure 12b is a bar graph showing the relative strength of the Notch signaling pathway-related Western blot signal in mouse neural stem cells under the action of TDNs.

Figure 12c is a graph showing the relative expression of the Notch signaling pathway-related genes in mouse neural stem cells under the action of TDNs.

Figure 13 is an immunofluorescence map of β-III-Tubulin protein 1 day after TDNs treatment.

Figure 14 is an immunofluorescence map of β-III-Tubulin protein after 7 days of TDNs treatment.

Figure 15 is a graph showing the results of a mouse neural stem cell scratch test.

Figure 16 is a graph showing the results of a mouse neural stem cell Transwell experiment.

Figure 17a is a diagram showing the RhoA amplified band electrophoresis of mouse neural stem cells under the action of TDNs.

Figure 17b is a graph showing the fold change of RhoA gene expression in mouse neural stem cells under the action of TDNs.

Figure 17c is a relative quantitative diagram of RhoA gene expression in mouse neural stem cells under the action of TDNs.

Figure 17d is a RhoA protein imprinting diagram of mouse neural stem cells under the action of TDNs.

Figure 17e is a bar graph showing the relative strength of RhoA Western blotting signals in mouse neural stem cells under the action of TDNs.

Figure 17f is an immunofluorescence map of RhoA protein in mouse neural stem cells under the action of TDNs.

Figure 17g is a graph showing the intensity of RhoA protein immunofluorescence signal in mouse neural stem cells under the action of TDNs.

Figure 18a is a magnetic resonance diagram of the Rock2 amplified band in mouse neural stem cells under the action of TDNs.

Figure 18b is a graph showing the fold change of Rock2 gene expression in mouse neural stem cells under the action of TDNs.

Figure 18c is a relative quantitative diagram of Rock2 gene expression in mouse neural stem cells under the action of TDNs.

Figure 18d is a map of Rock2 protein in mouse neural stem cells under the action of TDNs.

Figure 18e is a bar graph showing the relative strength of the Rock2 Western blot signal in mouse neural stem cells under the action of TDNs.

Figure 18f is a diagram showing the immunofluorescence of Rock2 protein in mouse neural stem cells under the action of TDNs.

Figure 18g is a graph showing the intensity of Rock2 protein immunofluorescence signal in mouse neural stem cells under the action of TDNs.

Figure 19a is a diagram showing the electrophoresis of vinculin amplification bands in mouse neural stem cells under the action of TDNs.

Figure 19b is a graph showing the fold change of vinculin gene expression in mouse neural stem cells under the action of TDNs.

Figure 19c is a relative quantitative diagram of vinculin gene expression in mouse neural stem cells under the action of TDNs.

Figure 19d is a picogram of the vinculin protein in mouse neural stem cells under the action of TDNs.

Figure 19e is a bar graph showing the relative strength of the vinculin protein imprinting signal in mouse neural stem cells under the action of TDNs.

Figure 19f is an immunofluorescence map of vinculin protein in mouse neural stem cells under the action of TDNs.

Figure 19g is a graph showing the immunofluorescence signal intensity of vinculin protein in mouse neural stem cells under the action of TDNs.

Detailed ways

Example Synthesis of TDNs

Synthetic

The four DNA single strands (S1, S2, S3, S4) were dissolved in the TM buffer solution at the same final concentration, wherein the solute of the TM buffer solution was Tris-HCl and MgCl2, and their concentrations were 10 mM and 50 mM, respectively. The pH of the solution was adjusted to 8.0. Then, the mixture was vortexed, mixed, centrifuged, and placed in a PCR machine. The temperature was rapidly raised to 95 ° C for 10 to 15 minutes, and then cooled to 4 ° C for 20 minutes. That is, a tetrahedral structure as shown in FIG. 1 is synthesized.

The sequence of the DNA single strand is shown in Table 1.

Table 1 Sequence of single strands of TDNs

名称name	SEQ ID NO.SEQ ID NO.	序列(5’→3’)Sequence (5'→3')
S1 S1	11	atttatcacccgccatagtagacgtatcaccaggcagttgagacgaacattcctaagtctgaa Atttatcacccgccatagtagacgtatcaccaggcagttgagacgaacattcctaagtctgaa

S2S2	22	acatgcgagggtccaataccgacgattacagcttgctacacgattcagacttaggaatgttcg Acatgcgagggtccaataccgacgattacagcttgctacacgattcagacttaggaatgttcg

S3S3	33	actactatggcgggtgataaaacgtgtagcaagctgtaatcgacgggaagagcatgcccatcc Actactatggcgggtgataaaacgtgtagcaagctgtaatcgacgggaagagcatgcccatcc

S4S4	44	acggtattggaccctcgcatgactcaactgcctggtgatacgaggatgggcatgctcttcccgAcggtattggaccctcgcatgactcaactgcctggtgatacgaggatgggcatgctcttcccg

2. Identification

2.1 gel electrophoresis

a, preparation of polyacrylamide gel: 40 wt% acrylamide solution, 10 × TAE, 10 wt% ammonium sulfate solution, distilled water, tetramethylethylenediamine according to the volume of 1-2:1:1:1:1 The mixture is made into a polyacrylamide gel.

b. Loading and electrophoresis: Mix 1ul of 6×loading buffer with 5ul of sample and marker, and then add them to the corresponding electrophoresis tank. Electrophoresis was carried out for 1 hour in an ice bath under a constant pressure of 100V.

c. GelRed staining and exposure: The polyacrylamide gel was placed in a mixed liquid solution in which GelRed and distilled water were mixed at a ratio of 1:50, protected from light and shaken for 15 to 25 minutes. exposure.

Results: As shown in Figure 2, lanes 1-8 are Marker, 1-S1, 2-S2, 3-S3, 4-S4, 5-S1+S2, 6-S1+S2+S3, 7-S1+ S2+S3+S4 (7-TDNs). As can be seen from the figure, the sizes of the ss DNA single strands S1, S2, S3, and S4 are about 60 bp, 50 bp, 50 bp, and 50 bp, respectively, and the size of the TDNs prepared by the present invention is about 210 bp.

2.2 Transmission electron microscope

Take an appropriate amount of sample liquid on a metal sheet, irradiate it for 5 to 10 minutes in the infrared to dry it, and test it on the machine.

Results: As shown in Fig. 3, the shape of TDNs was approximately triangular in shape under transmission electron microscopy, and the particle size ranged from 10 to 15 nM. The circle is labeled as a polymer.

2.3 dynamic light scattering

Take appropriate amount of ssDNA and TDNs solution and place them in a dynamic light scattering detector for detection.

Results: As shown in Figure 4-a, the particle size of ssDNA was approximately 48.255 nm. As shown in Figure 4-b, the particle size of TDNs is about 16.801 nm.

In order to prove that TDNs do contribute to nerve repair, the following will further illustrate by way of experimental examples, the mouse neural stem cells used in the experimental examples are all NE-4C cells.

Experimental Example 1 Identification of neural stem cells

Identification of mouse neural stem cells by immunofluorescence technique, including the following steps at one time:

A. The cell suspension was inoculated into a confocal dish and placed in an incubator for 24 hours. The medium containing DMEM + 10% serum + 1% double antibody was aspirated, and washed three times with PBS for 5 minutes each time;

B, 4% paraformaldehyde fixed for 25 minutes, the paraformaldehyde was aspirated, washed three times with PBS for 5 minutes each time;

C, 0.5% Triton-100 treatment for 20-25 minutes, aspirate Triton-100, wash 3 times with PBS for 5 minutes each time;

D, sheep serum treatment for 1 hour, the sheep serum was aspirated, washed three times with PBS for 5 minutes each time;

E, primary antibody (anti-nestin antibody) treatment, 4 ° C, overnight. On the next day, the temperature was rewarmed at 37 ° C for 0.5 hours, and the primary antibody was recovered and washed three times with PBS for 5 minutes each time. Fluorescent secondary antibody treatment, protected from light, 37 ° C, 1 hour, the secondary antibody was aspirated, washed three times with PBS for 5 minutes each time;

E, ghost pen cyclic peptide treatment, protected from light, 10-30 minutes, aspirate phalloidin, washed 3 times in PBS, 5 minutes each time;

F, DAPI treatment, protected from light, 10 minutes, aspirate DAPI, wash 3 times with PBS for 5 minutes each time. 10% glycerol seal, protected from light, stored at 4 ° C. Check on the machine.

The test results are shown in Fig. 5. The mouse neural stem cells showed positive for nestin antibody, indicating that the cells were still in an undifferentiated state and could be used for subsequent experiments.

The "cells" referred to in the following experimental examples are all mouse neural stem cells of the same undifferentiated state in Experimental Example 1.

Experimental Example 2 Neural stem cell uptake experiment

Being able to be ingested by cells is a prerequisite for most drugs to be therapeutic. This experimental example measures the ability of neural stem cells to uptake TDNs.

(1) Flow cytometry

a. Inoculate the cell suspension in a 6-well plate, first pre-culture in the incubator for 24 hours (37 ° C, 5% (v / v) CO2); then reduce the serum concentration in the medium from 10% to 6%, Incubate for 6 hours (37 ° C, 5% (v / v) CO2); then reduce the serum concentration in the medium from 6% to 0, and continue to incubate for 1 hour in the incubator (37 ° C, 5% (v /v)CO2).

b. The negative control group did not do any treatment. The positive control group was supplemented with Cyn-modified single-stranded DNA S1 at a concentration of 250 nM. The experimental group was supplemented with Cyn-modified TDNs at a concentration of 250 nM and cultured in an incubator for 12 hours (37 ° C, 5%). (v/v)CO2).

c. Collect the cells, centrifuge at 1000r/min for 5min, resuspend in PBS, repeat three times, and check on the machine.

Results: As shown in Figures 6-a and 6-b, neural stem cells uptake TNDs significantly more than ssDNA uptake. (Please explain Figure 6-a)

The above experiments prove that TNDs can be well taken up by mouse neural stem cells.

(2) Fluorescent tracer technology

a. Inoculate a mouse neural stem cell suspension in a confocal dish, pre-culture in the incubator for 24 hours (37 ° C, 5% (v / v) CO2); then reduce the serum concentration in the medium from 10% to 6%, continue to incubate for 6 hours in the incubator (37 ° C, 5% (v / v) CO2); then reduce the serum concentration in the medium from 6% to 0, continue to incubate in the incubator for 1 hour (37 ° C, 5% (v/v) CO2).

b. The control group was added with Cy5 modified S1 at a concentration of 250 nM, and the experimental group was added with Cyn-modified TDNs at a concentration of 250 nM, and cultured in an incubator for 12 hours (37 ° C, 5% (v/v) CO 2 ).

c, aspirate the medium, wash it three times with PBS for 5 minutes each time; then fix it with 4wt% paraformaldehyde for 25 minutes, aspirate paraformaldehyde, wash it three times with PBS for 5 minutes each time; Peptide treatment, avoiding light for 10 to 30 minutes, aspirating phalloidin, washing three times with PBS for 5 minutes each time; then treating with DAPI, avoiding light for 10 minutes, aspirating DAPI, and washing three times with PBS for 5 minutes each time. Then, seal it with 10wt% glycerin, protect it from light, store it at 4°C, and check it on the machine.

RESULTS: As shown in Figures 7-a and 7-b, ssDNA was less taken up by neural stem cells; neural stem cells took more uptake of TDNs, and most of the TDNs that entered the cells accumulated in the cytoplasm of the cells and entered the nucleus less. .

It indicates that TDNs can be well taken up by neural stem cells.

Experimental Example 3 TDNs promote proliferation and detection of mouse neural stem cells

1.CCK-8 detection proliferation

(1) Inoculate a cell suspension (100 μl/well) in a 96-well plate, place the plate in an incubator for 24 hours (37 ° C, 5% CO ₂ ), and then mix the components with DMEM + 10% serum. The serum concentration in the +1% double-antibody medium was reduced from 10% to 6%, cultured in the incubator for 6 hours (37 ° C, 5% CO ₂ ), and then the serum concentration in the medium was reduced from 6% to 0, cultured in an incubator for 1 hour (37 ° C, 5% CO ₂ ).

(2) The cultured cell suspension was divided into a control group and an experimental group, and TDNs were added to the experimental group, and an equal amount of PBS was added to the control group, followed by incubation in an incubator for 24 hours (37 ° C, 5% CO _{2 ).} ).

(3) Add CCK-8 solution (10μl/well) to the experimental group and the control group, then incubate in the incubator for 1~4h (37°C, 5% CO ₂ ), and then measure the absorbance of each well at 450nm. The result is shown in Figure 8.

As shown in Fig. 8, when the concentration of TDNs was 62.5 nM, 125 nM, and 250 nM, the proliferation process of mouse neural stem cells in the experimental group was promoted to a certain extent by TDNs, and 250 nM was the most. Good concentration indicates that TDNs have the effect of promoting the proliferation of mouse neural stem cells.

2, using flow cytometry to detect cell proliferation

(1) Inoculate the cell suspension in a 25 ml culture flask, place the culture flask in an incubator for 24 hours (37 ° C, 5% CO ₂ ), and then divide the component into DMEM + 10% serum + 1% double antibody. The serum concentration in the medium was reduced from 10% to 6%, cultured in the incubator for 6 hours (37 ° C, 5% CO ₂ ), then the serum concentration in the medium was reduced from 6% to 0, in the incubator The medium was cultured for 1 hour (37 ° C, 5% CO ₂ ).

(3) The control cells and the experimental group cells were separately digested with 0.25% trypsin, placed in a 15 ml centrifuge tube (2000 rpm, 5 minutes), the supernatant was discarded, washed with PBS, centrifuged (2000 rpm, 5 minutes), and then added with ice. 500 μl of ethanol was fixed, and the cells were fixed at 4 ° C overnight. The next day, PBS was added to centrifuge, the supernatant was discarded, washed with PBS, centrifuged, and the supernatant was discarded. Then, 100 μl of RNase was added, and a 37 ° C water bath was added for 30 minutes. 400 μl of PI was added and mixed. Protected from light at 4 ° C for 30 minutes. The cells were transferred to a flow tube, detected by the machine, and analyzed by data. The results are shown in Fig. 9.

As shown in Fig. 9, compared with the control group, the number of cells in the S phase (DNA synthesis phase) in the experimental group was significantly increased, indicating that TDNs changed the cell cycle of the neural stem cells and promoted its proliferation.

In summary, TDNs can promote the proliferation of neural stem cells.

Experimental Example 4 Detection of Wnt/β-catenin signaling pathway related gene expression

The Wnt/β-catenin signaling pathway is an important pathway for cell cycle regulation, and its activation can significantly promote stem cell proliferation. This experiment was to detect the expression of Wnt/β-catenin signaling pathway-related genes in NSCs treated with TDNs.

Sample processing

(1) Inoculate a cell suspension (100 μl/well) in a 6-well plate, place the plate in an incubator for 24 hours (37 ° C, 5% CO ₂ ), and then mix the components with DMEM + 10% serum. The serum concentration in the +1% double-antibody medium was reduced from 10% to 6%, cultured in the incubator for 6 hours (37 ° C, 5% CO ₂ ), and then the serum concentration in the medium was reduced from 6% to 0, cultured in an incubator for 1 hour (37 ° C, 5% CO ₂ ).

(2) culturing the cell suspension obtained in the step (1) with a medium containing DMEM+1% double antibody, dividing the cell suspension into a control group and an experimental group, and simultaneously changing the medium at the same time; TDNs at a concentration of 250 nM were added to the group, while an equal amount of PBS was added to the control group.

2. Protein detection

After 24 hours of treatment in the experimental group, the whole protein of the experimental group and the control group were extracted, and three proteins on the Wnt/β-catenin signaling pathway related to the neural stem cell proliferation process were detected by Western blot: β-catenin, Lef-1 and Cyclin-D.

The brief detection procedure is as follows: filling→loading→electrophoresis→transfer membrane→blocking liquid shaking for 1 hour→primary antibody 4°C overnight→recovering primary antibody→TBST washing 3 times (5-10 minutes each time)→secondary antibody incubation 1 Hours → Discard secondary antibody, TBST wash 3 times (5-10 minutes each time) → Exposure.

As shown in Fig. 10a and Fig. 10b, the content of β-catenin, Lef-1 and Cyclin-D protein in mouse neural stem cells treated with TDNs was significantly higher than that in the control group.

3. Gene expression detection

After 24 hours of treatment in the experimental group, the RNA of the experimental group and the control group were extracted, and the cDNA was obtained by the reverse transcription kit, and then the fluorescent method was used to detect the Wnt/β-catenin signaling pathway related to the neural stem cell proliferation process by fluorescent quantitative PCR. Genes: β-catenin, Lef-1 and Cyclin-D.

As shown in Figure 10c, the expression levels of β-catenin, Lef-1 and Cyclin-D genes were significantly higher in the control group of mouse neural stem cells TDRs than in the control group.

This experimental example shows that TDNs promote the proliferation of neural stem cells by up-regulating the expression of three genes on the Wnt/β-catenin signaling pathway.

Experimental Example 5 Detection of β-III-Tubulin and Notch Signaling Pathway Related Gene Expression

The β-III-Tubulin protein is a neuronal marker, and when the neural stem cells differentiate into neurons, the expression of β-III-Tubulin is up-regulated. The Notch signaling pathway plays an important role in the development of the nervous system, which manifests itself as an inhibitory state during adult neural stem cell differentiation. In this study, the expression of β-III-Tubulin and Notch signaling pathway-related genes was examined to demonstrate the role of TDNs in promoting differentiation of NSCs.

Sample processing

2. Protein detection

After treatment in the experimental group for 1 day, 3 days and 7 days, the whole protein of the experimental group and the control group were extracted, and the proteins related to neural stem cell differentiation were detected by Western blot: β-III-Tubulin, Notch-1, Hes-1. And Hes-5.

As shown in Figures 11a, 11b, 12a and 12b, the expression levels of the marker protein (β-III-Tubulin) of neural stem cell differentiation in the experimental group were higher than those in the control group, and compared with the control group, the differentiation in the experimental group was correlated. The expression levels of Notch-1, Hes-1 and Hes-5 were decreased in the three proteins of Notch signaling pathway, indicating that TDNs can promote the differentiation and maturation of mouse neural stem cells.

3. Gene expression detection

After 1 day, 3 days and 7 days of treatment in the experimental group, the RNA of the experimental group and the control group were extracted, the cDNA was obtained by the reverse transcription kit, and the protein related to neural stem cell differentiation was detected by fluorescent quantitative PCR using the dye method: β- III-Tubulin, Notch-1, Hes-1 and Hes-5.

As shown in Figures 11c and 12c, compared with the control group, the expression level of the differentiation-related gene (β-III-Tubulin) in the experimental group was higher, and the differentiation-related Notch signal in the experimental group was compared with the control group. The three proteins in the pathway are Notch-1, Hes-1, Hes-5, and the corresponding expressions of the genes Notch-1, Hes-1 and Hes-5 are decreased, indicating that TDNs can promote mouse neural stem cells. The differentiation is mature, and its differentiation is related to the inhibition of the Notch pathway.

4. Immunofluorescence technology

(1) The sample was processed in accordance with the method of Section 1 of this Experimental Example, and only the 6-well plate was replaced with a confocal small dish.

(2) After 1 day and 7 days of TDNs treatment, the culture medium of the experimental group and the control group were aspirated, and washed three times with PBS for 5 minutes each time. After fixing with 4% paraformaldehyde for 25 minutes, the paraformaldehyde was aspirated, washed three times with PBS for 5 minutes, treated with 0.5% Triton-100 for 20-25 minutes, and then washed with Triton-100 and washed with PBS three times. 5 minutes each time. The sheep serum was treated for 1 hour, and the sheep serum was aspirated, and washed three times with PBS for 5 minutes each time. Monoclonal anti-beta-III-Tubulin antibody treatment, 4 ° C, overnight. On the next day, the temperature was rewarmed at 37 ° C for 0.5 hours, and the primary antibody was recovered and washed three times with PBS for 5 minutes each time. Fluorescent secondary antibody treatment, protected from light, 37 ° C, 1 hour, the secondary antibody was aspirated, washed three times with PBS for 5 minutes each time. DAPI treatment, protected from light, 10 minutes, aspirate DAPI, wash 3 times with PBS for 5 minutes each time. 10% glycerol seal, protected from light, stored at 4 ° C. Check on the machine.

Results: As shown in Figures 13 and 14, after 1 day and 7 days, the fluorescence intensity (β-III-Tubulin) was higher in the experimental group than in the control group, and the morphology of the cells was closer to the neurons.

In conclusion, TDNs promote the differentiation of neural stem cells by inhibiting the Notch signaling pathway.

Example 6 TDNs promote migration of mouse neural stem cells

Scratch test

a. Inoculate a mouse neural stem cell suspension in a 6-well plate, first pre-culture the plate in an incubator for 24 hours (37 ° C, 5% (v/v) CO 2 ); then the serum concentration in the medium is 10 % decreased to 6%, continued to incubate for 6 hours in the incubator (37 ° C, 5% (v / v) CO2); then the serum concentration in the medium was reduced from 6% to 0, and continued to incubate for 1 hour in the incubator ( 37 ° C, 5% (v/v) CO 2 ); then a single layer of cells was scratched along the line using a sterile tip in the plate and washed three times with PBS.

b. The control group did not add TDNs. The experimental group was added TDNs of the corresponding concentration and cultured in an incubator (37 ° C, 5% (v/v) CO 2 ). Photographs were taken under light microscope at 0, 12, and 24 hours, respectively, and scratch changes were recorded.

c. Results: As shown in Fig. 15, compared with the control group, TDNs significantly promoted the horizontal migration of mouse neural stem cells.

2.Transwell experiment

a. Transwell (0.8 μm pore size) chamber was placed in a 6-well plate, and the mouse neural stem cell suspension was inoculated in the chamber. The culture plate was pre-incubated in the incubator for 24 hours (37 ° C, 5% (v/v). ) CO2); then reduce the serum concentration in the medium from 10% to 6%, continue to culture for 6 hours in the incubator (37 ° C, 5% (v / v) CO2); then the serum concentration in the medium 6% was reduced to 0 and incubation was continued for 1 hour in the incubator (37 ° C, 5% (v/v) CO 2 ).

b. The control group was not added with TDNs. The experimental group was added with TDNs at a concentration of 250 nM and cultured in an incubator for 12 hours (37 ° C, 5% (v/v) CO 2 ).

c, aspirate the medium, wash it three times with PBS for 5 minutes each time; then fix it with 4wt% paraformaldehyde for 25 minutes, then remove paraformaldehyde, wash it three times with PBS for 5 minutes each time; then treat with DAPI In the dark for 10 minutes, DAPI was removed, washed three times with PBS for 5 minutes each time; protected from light, stored at 4 ° C, and tested on the machine.

d. Results: As shown in Fig. 16, compared with the control group, the cells passing through the Transwell chamber in the experimental group were significantly increased, that is, TDNs promoted the vertical migration of the neural stem cells.

The scratch test and the Transwell experiment demonstrated that the TDNs of the present invention do have a good promoting effect on the lateral and longitudinal migration of mouse neural stem cells.

Example 7 Detection of RHOA/ROCK2 Signaling Pathway Related Proteins

Sample processing

(1) Inoculate a mouse neural stem cell suspension in a 6-well plate, first pre-culture the plate in an incubator for 24 hours (37 ° C, 5% (v/v) CO 2 ); then the serum concentration in the medium is 10% down to 6%, continue to culture for 6 hours in the incubator (37 ° C, 5% (v / v) CO2); then reduce the serum concentration in the medium from 6% to 0, continue to incubate for 1 hour in the incubator (37 ° C, 5% (v / v) CO2).

(2) TDNs were not added to the control group, and TDNs at a concentration of 250 nM were added to the experimental group and cultured in an incubator.

2. Fluorescence quantitative PCR detection

After 24 hours of TDNs treatment, total RNA was extracted from the experimental group and the control group. After reverse transcription, the fluorescent quantitative PCR reaction was performed to detect the expression of RhoA, Rock2 and Vinculin.

Results: As shown in Figures 9a to 9c, Figures 10a to 10c, and Figures 11a to 11c, in the semi-quantitative PCR and quantitative PCR, three proteins on the RHOA/ROCK2 signaling pathway in the experimental group were migrated compared with the control group. , RhoA, Rock2, and Vinculin, respectively, and the expression levels of the corresponding genes are increased. This indicates that TDNs promote the migration of neural stem cells by activating the RHOA/ROCK2 signaling pathway.

3. Western blot detection

After treated with TDNs for 24 hours, the total protein of the experimental group and the control group were extracted, and RhoA, Rock2 and Vinculin proteins were detected by Western blot.

Results: As shown in Figures 17d to 17e, 18d to 18e, and 19d to 19e, the three proteins on the RHOA/ROCK2 signaling pathway in the experimental group were RhoA, Rock2, and Vinculin, respectively. The amount of expression of its corresponding protein increases. This indicates that TDNs promote the migration of neural stem cells by activating the RHOA/ROCK2 signaling pathway.

4. Immunofluorescence detection

The 6-well plate in the first section of this experimental example was replaced with a confocal small dish for sample processing. After treatment with TDNs for 24 h, the medium was aspirated, washed three times with PBS for 5 minutes each time; after fixing with 4 wt% paraformaldehyde for 25 minutes, paraformaldehyde was aspirated, washed three times with PBS for 5 minutes each time; 0.5% again Triton-100 was treated for 20-25 minutes, and Triton-100 was aspirated, washed three times with PBS for 5 minutes each time; then treated with sheep serum for 1 hour, and the serum was removed by PBS and washed three times for 5 minutes each time. Monoclonal RhoA, Rock2, Vinclilin antibody treatment, 4 ° C, overnight. On the next day, the temperature was rewarmed at 37 ° C for 0.5 hours, and the primary antibody was recovered and washed three times with PBS for 5 minutes each time. Fluorescent secondary antibody treatment, protected from light, 37 ° C, 1 hour, the secondary antibody was aspirated, washed three times with PBS for 5 minutes each time. DAPI treatment, protected from light, 10 minutes, aspirate DAPI, wash 3 times with PBS for 5 minutes each time. 10% glycerol seal, protected from light, stored at 4 ° C, and tested on the machine.

Results: As shown in Figures 17d to 17e, 18d to 18e, and 19d to 19e, the fluorescence intensity (RhoA, Rock2, and Vinculin) of the protein in the experimental group was higher than that of the control group, further indicating that TDNs promote nerves. Stem cell migration is achieved by activating the RHOA/ROCK2 signaling pathway.

The above experiments further demonstrate that TDNs can promote neural stem cell migration.

In summary, the DNA tetrahedron of the present invention is easily taken up by nerve cells, can significantly increase the proliferation, differentiation and migration of mouse neural stem cells, has a good nerve-promoting ability, and has good biocompatibility. The DNA tetrahedron of the present invention can be used for the preparation of a drug for promoting nerve repair.

Claims

Use of a DNA tetrahedron for the preparation of a medicament, characterized in that the medicament is a drug for promoting nerve repair.
The use according to claim 1, wherein the DNA tetrahedron is assembled into a tetrahedral structure by four single-stranded DNAs by base complementary pairing; each of the tetrahedrons is a double-stranded DNA structure.
The use according to claim 1, wherein the DNA tetrahedron is prepared by heating an aqueous solution containing the four single-stranded DNAs at an equal concentration so that hydrogen bonds between the bases are completely broken, maintaining 5 to 20 min, then rapidly cooled to 0-10 ° C for at least 15 min; the aqueous solution also contained 10 mM Tris-HCl, 50 mM MgCl 2 ; the pH of the aqueous solution before heating was 8.
The use according to claim 3, characterized in that the maintenance time after heating is 10 min, the specific temperature of the temperature drop is 4 ° C, and the hold time after the temperature drop is 20 min.
The use according to claim 1, wherein the sequences of the four single-stranded DNAs are shown in SEQ ID NOS.
The use according to claim 1, wherein the drug is a drug that promotes proliferation, differentiation and/or migration of neural stem cells.
The use according to claim 6, wherein the drug is a drug that activates the Wnt/β-Catenin pathway.
The use according to claim 6, wherein the drug is a drug that inhibits the Notch signaling pathway.
The use according to claim 6, wherein the drug is a drug that activates the RHOA/ROCK2 signaling pathway.
A drug for promoting nerve repair, which is prepared by using the DNA tetrahedron according to claims 1 to 9 as an active material, together with a pharmaceutically acceptable adjuvant or auxiliary component.