WO2019099426A1 - Nucléoprotéine ciblant un inhibiteur du virus de la grippe - Google Patents

Nucléoprotéine ciblant un inhibiteur du virus de la grippe Download PDF

Info

Publication number
WO2019099426A1
WO2019099426A1 PCT/US2018/060877 US2018060877W WO2019099426A1 WO 2019099426 A1 WO2019099426 A1 WO 2019099426A1 US 2018060877 W US2018060877 W US 2018060877W WO 2019099426 A1 WO2019099426 A1 WO 2019099426A1
Authority
WO
WIPO (PCT)
Prior art keywords
alkyl
optionally substituted
deuterium
alkoxy
group
Prior art date
Application number
PCT/US2018/060877
Other languages
English (en)
Inventor
Megan L. Shaw
Robert Devita
Kris WHITE
Sumit Chanda
Original Assignee
Icahn School Of Medicine At Mount Sinai
Sanford Burnham Prebys Medical Discovery Institute
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Icahn School Of Medicine At Mount Sinai, Sanford Burnham Prebys Medical Discovery Institute filed Critical Icahn School Of Medicine At Mount Sinai
Publication of WO2019099426A1 publication Critical patent/WO2019099426A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • A61P31/16—Antivirals for RNA viruses for influenza or rhinoviruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/13—Amines
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/16—Amides, e.g. hydroxamic acids
    • A61K31/165—Amides, e.g. hydroxamic acids having aromatic rings, e.g. colchicine, atenolol, progabide
    • A61K31/167—Amides, e.g. hydroxamic acids having aromatic rings, e.g. colchicine, atenolol, progabide having the nitrogen of a carboxamide group directly attached to the aromatic ring, e.g. lidocaine, paracetamol
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19—Carboxylic acids, e.g. valproic acid
    • A61K31/195—Carboxylic acids, e.g. valproic acid having an amino group
    • A61K31/196—Carboxylic acids, e.g. valproic acid having an amino group the amino group being directly attached to a ring, e.g. anthranilic acid, mefenamic acid, diclofenac, chlorambucil
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/21—Esters, e.g. nitroglycerine, selenocyanates
    • A61K31/215—Esters, e.g. nitroglycerine, selenocyanates of carboxylic acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/4402—Non condensed pyridines; Hydrogenated derivatives thereof only substituted in position 2, e.g. pheniramine, bisacodyl
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/4406—Non condensed pyridines; Hydrogenated derivatives thereof only substituted in position 3, e.g. zimeldine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/47—Quinolines; Isoquinolines
    • A61K31/4709—Non-condensed quinolines and containing further heterocyclic rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/47—Quinolines; Isoquinolines
    • A61K31/472—Non-condensed isoquinolines, e.g. papaverine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7012—Compounds having a free or esterified carboxyl group attached, directly or through a carbon chain, to a carbon atom of the saccharide radical, e.g. glucuronic acid, neuraminic acid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca

Definitions

  • Influenza viruses are negative-stranded RNA viruses that cause yearly epidemics as well as recurring pandemics, resulting in high numbers of human cases and severe economic burden.
  • pandemic influenza A viruses such as the 1918“Spanish” flu or H5N1
  • pandemic influenza B viruses contribute greatly to the annual recurring epidemics that cause the vast majority of human cases and medical cost.
  • the WHO recommends an annual vaccination against circulating influenza A (FluA) and B (FluB) strains.
  • current vaccines confer incomplete protection against epidemic influenza.
  • This document discloses a novel class of compounds, which exhibit dual antiviral activity against influenza A and B viruses.
  • An aspect of the invention provides a compound of Formula I or a pharmaceutically acceptable salt thereof,
  • L is a bond, O, S, SO, S0 2 , NR 4 , or (CR 5 R 5 ) n XR 4 , wherein n is 1 , 2, or 3.
  • X is O, S, or N.
  • R 1 is H, deuterium, C1-C10 alkyl, C2-C10 alkenyl, aryl or heteroaryl, wherein the Cl -
  • C10 alkyl, aryl or heteroaryl is optionally substituted with one or more R a .
  • R 2 is C1-C10 alkyl, C2-C10 alkenyl, C1 -C6 alkoxy or C1-C6 alkoxy - C1-C10 alkyl, wherein C1-C10 alkyl, C1-C6 alkoxy or C1-C6 alkoxy - C1-C10 alkyl is optionally substituted with one or more R a .
  • R 3 is H, deuterium, C1-C10 alkyl, or aryl, wherein the C1 -C10 alkyl or aryl is optionally substituted with one or more R a .
  • R 3 is H, deuterium, or C1-C4 alkyl.
  • R 4 is each independently H, deuterium, C 1 -C 10 alkyl, or aryl, wherein the C 1 -C 10 alkyl or aryl is optionally substituted with one or more R a .
  • R a is selected from the group consisting of halogen, deuterium, hydroxyl, C 1 -C 10 alkoxy,
  • R b is selected from the group consisting ofhalogen, deuterium, hydroxyl, C1 -C6 alkoxy,
  • C1-C6 alkyl C2-C6 alkenyl, hydroxyl, and C3-C6 cycloalkyl.
  • a and B are each independently selected from the group consisting of H, deuterium, halogen, C1 -C10 alkoxy, C1-C10 alkyl, C3-C6 cycloalkyl, OCHF 2 , OCF3, OCF3, cyano, and carboxamide, wherein the C1-C10 alkoxy, C1-C10 alkyl, or C3-C6 cycloalkyl is optionally substituted with one or more R a .
  • M and N each designate an aryl ring.
  • M and N are each a phenyl ring.
  • the compound is not any of the following:
  • compositions comprising a compound described herein.
  • the composition further includes an additional antiviral agent.
  • Another aspect of this document provides a method of treating at least one of influenza
  • Another aspect of this document provides a method of targeting influenza nucleoprotein by contacting a compound described herein with a cell infected with one or more viral strains, whereby abnormal aggregation or oligomerization of the influenza nucleoprotein inhibits viral replication.
  • the term“pharmaceutical composition” refers to a mixture of a compound disclosed herein with other chemical components, such as diluents or additional carriers.
  • the pharmaceutical composition facilitates administration of the compound to an organism. Multiple techniques of administering a pharmaceutical composition exist in the art including, but not limited to, oral, injection, aerosol, parenteral, and topical administration.
  • pharmaceutically acceptable salts of the compounds disclosed herein are provided.
  • subject encompasses any animal, but preferably a mammal, e.g., human, non- human primate, a dog, a cat, a horse, a cow, or a rodent. More preferably, the subject is a human.
  • carrier refers to a chemical compound that facilitates the incorporation of a compound into cells or tissues.
  • the term“diluent” refers to chemical compounds diluted in water that will dissolve the composition of interest as well as stabilize the biologically active form of the compound. Salts dissolved in buffered solutions are utilized as diluents in the art. One commonly used buffered solution is phosphate buffered saline because it mimics the salt conditions of human blood. Since buffer salts can control the pH of a solution at low concentrations, a buffered diluent rarely modifies the biological activity of a compound.
  • an“excipient” refers to an inert substance that is added to a composition to provide, without limitation, bulk, consistency, stability, binding ability, lubrication, disintegrating ability, etc., to the composition. A“diluent” is a type of excipient.
  • physiologically acceptable or“pharmaceutically acceptable” refers to a carrier or diluent that does not abrogate the biological activity and properties of the compound.
  • therapeutically effective amount refers to an amount of a compound effective to prevent, alleviate or ameliorate symptoms of disease or prolong the survival of the subject being treated. Determination of a therapeutically effective amount is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein.
  • alkyl refers to monovalent saturated alkane radical groups particularly having up to about 18 carbon atoms, more particularly as a lower alkyl, from 1 to 8 carbon atoms and still more particularly, from 1 to 6 carbon atoms.
  • the hydrocarbon chain may be either straight-chained or branched.
  • C1-C10 alkyl refers to alkyl groups having 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 carbon atoms.
  • C1-C6 alkyl refers to alkyl groups having 1 , 2, 3, 4, 5, or 6 carbon atoms.
  • Non-limiting examples include groups such as methyl, ethyl, n-propyl, isopropyl, n-butyl, iso-butyl, tert-butyl, n-hexyl, n-octyl, tert-octyl and the like.
  • cycloalkyl refers to cyclic hydrocarbyl groups having from 3 to about 10 carbon atoms and having a single cyclic ring or multiple condensed rings, including fused and bridged ring systems, which optionally can be substituted with from 1 to 3 alkyl groups.
  • cycloalkyl groups include, by way of example, single ring structures such as cyclopropyl, cyclobutyl, cyclopentyl, cyclooctyl, 1 -methylcyclopropyl, 2-methylcyclopentyl, 2-methylcyclooctyl, and the like, and multiple ring structures such as adamantanyl, and the like.
  • aryl refers to a monovalent aromatic hydrocarbon group derived by the removal of one hydrogen atom from a single carbon atom of a parent aromatic ring system.
  • Typical aryl groups include, but are not limited to, groups derived from aceanthrylene, acephenanthrylene, anthracene, azulene, benzene, fluoranthene, fluorene, hexacene, hexaphene, hexylene, as-indacene, s- indacene, indane, indene, naphthalene, octacene, octaphene, octalene, ovalene, penta-2, 4-diene, pentacene, pentalene, pentaphene, perylene, phenalene, phenanthrene, picene, and the like.
  • an aryl group comprises from 6 to 14 carbon atoms.
  • hetero when used to describe a compound or a group present on a compound means that one or more carbon atoms in the compound or group have been replaced by a nitrogen, oxygen, or sulfur heteroatom. Hetero maybe applied to any of the hydrocarbyl groups described above such as alkyl, e.g. heteroalkyl, cycloheteroalkyl.
  • halogen refers to F, Cl, Br, or I.
  • carboxylate refers to a group of CONRR, wherein each R is independently a C1-C10 alkyl or an aryl.
  • heteroaryl refers to a monovalent heteroaromatic group derived by the removal of one hydrogen atom from a single atom of a parent heteroaromatic ring system.
  • Typical heteroaryl groups include, but are not limited to, groups derived from acridine, carbazole, cinnoline, furan, imidazole, indazole, indole, indoline, indolizine, isobenzofuran, isochromene, isoindole, isoindoline, isoquinoline, isothiazole, isoxazole, naphthyridine, oxadiazole, oxazole, phenanthridine, phenanthroline, phenazine, phthalazine, pteridine, purine, pyran, pyrazine, pyrazole, pyridazine, pyridine, pyrimidine, pyrrole, pyrroli
  • treating refers, in some embodiments, to ameliorating the disease or disorder (i.e., arresting or reducing the development of the disease or at least one of the clinical symptoms thereof). In some embodiments “treating” or “treatment” refers to ameliorating at least one physical parameter, which may not be discernible by the subject. In some embodiments, “treating” or “treatment” refers to modulating the disease or disorder, either physically, (e.g., stabilization of a discernible symptom), physiologically, (e.g., stabilization of a physical parameter), or both.
  • treating refers to delaying the onset of the disease or disorder, or even preventing the same.“Prophylactic treatment” is to be construed as any mode of treatment that is used to prevent progression of the disease or is used for precautionary purpose for persons at risk of developing the condition. [0039]
  • This document discloses a novel class of compounds which exhibit dual antiviral activity against influenza A and B viruses.
  • An aspect of the invention provides a compound of Formula I or a pharmaceutically acceptable salt thereof,
  • L is a bond, O, S, SO, S0 2 , NR 4 , or (CR 5 R 5 ) n XR 4 , wherein n is 1 , 2, or 3.
  • X is O, S, or N.
  • R 1 is H, deuterium, C1-C10 alkyl, C2-C10 alkenyl, aryl or heteroaryl, wherein the Cl -
  • C10 alkyl, aryl or heteroaryl is optionally substituted with one or more R a .
  • R 2 is C1-C10 alkyl, C2-C10 alkenyl, C1 -C6 alkoxy or C1-C6 alkoxy - C1-C10 alkyl, wherein C1-C10 alkyl, C1-C6 alkoxy or C1-C6 alkoxy - C1-C10 alkyl is optionally substituted with one or more R a .
  • R 2 is C(R C ) 3 , and each R c is independently selected from the group consisting of C1-C6 alkoxy, C1-C6 alkyl, C2-C10 alkenyl, and C3-C6 cycloalkyl, wherein C1-C6 alkoxy, C1 -C6 alkyl, and C3-C6 cycloalkyl are each optionally substituted with one or more atoms selected from halogen and deuterium.
  • R 2 include tert-butyl, isoprenyl, 2- ethyl-2-propyl, prenyl, and 2-methoxy-2-propyl.
  • a tertiary carbon of R 2 is attached to ring M.
  • substituents containing a tertiary carbon include tert- butyl, isoprenyl, and 2-methoxy-2 -propyl, each of which can be further substituted with another group.
  • R 3 is H, deuterium, C1-C10 alkyl, or aryl, wherein the C1 -C10 alkyl or aryl is optionally substituted with one or more R a .
  • R 3 is H, deuterium, or C1-C4 alkyl.
  • R 4 is each independently H, deuterium, C1-C10 alkyl, or aryl, wherein the C1-C10 alkyl or aryl is optionally substituted with one or more R a .
  • R a is selected from the group consisting of halogen, deuterium, hydroxyl, C 1 -C 10 alkoxy,
  • R b is selected from the group consisting of halogen, deuterium, hydroxyl, Cl -C6 alkoxy,
  • C1-C6 alkyl C2-C6 alkenyl, hydroxyl, and C3-C6 cycloalkyl.
  • an R a substituted with one or more R b is in the form of C(R b )3, wherein each R b is independently selected from the group consisting C1-C6 alkoxy, C1-C6 alkyl, C2- C6 alkenyl, and C3-C6 cycloalkyl.
  • the C1-C6 alkoxy, C1-C6 alkyl, C2-C6 alkenyl, and C3-C6 cycloalkyl are each optionally substituted with one or more halogen.
  • Non-limiting examples of C(R b )3 include tert-butyl, isoprenyl, 2-ethyl-2 -propyl, prenyl, and 2-methoxy-2 -propyl.
  • a and B are each independently selected from the group consisting of H, deuterium, halogen, C1 -C10 alkoxy, C1-C10 alkyl, C3-C6 cycloalkyl, OCHF 2 , OCF3, OCF3, cyano, and carboxamide, wherein the C1-C10 alkoxy, C1-C10 alkyl, or C3-C6 cycloalkyl is optionally substituted with one or more R a .
  • M and N each designate an aryl ring.
  • M and N are each a phenyl ring.
  • a halogen atom can be F, Cl, Br, or I.
  • the compound of Formula I is not any of the following:
  • R 1 is of Formula I is aryl or heterocyclyl selected from the group consisting of naphthyridine, indolyl, pyrazolyl, benzodioxaolyl, pyridyl, furopyridinyl, isoindolyl, pyridooxazinyl, imidazolyl, pyrrolyl, pyrrolopyridinyl, thiophenyl, isoxazolyl, pyrimidinyl, quinoxalinyl, quinazolinyl, quinolinyl, isoquinolinyl, phenyl, indazolyl, [l ,2,4]triazolo[l,5-a]pyridine, l,2,3,4-tetrahydroisoquinoline, 1 ,3-benzodioxole, 1 -benzothiophene, lH-indazole, lH-pyr
  • aryl or heteroaryl can be attached to L at any position of the ring.
  • pyridyl as herein used includes wherein the pyridyl ring can be substituted with any group described herein.
  • L is a bond and the compound is represented by Formula I-A:
  • R 1 is C1-C10 alkyl, C2-C10 alkenyl, aryl or heteroaryl, wherein the C1-C10 alkyl, aryl or heteroaryl is optionally substituted with one or more R a .
  • R 1 is C(R b )3, wherein each R b is independently selected from the group consisting Cl -C6 alkoxy, Cl -C6 alkyl, C2-C6 alkenyl, and C3-C6 cycloalkyl.
  • the C1-C6 alkoxy, C1-C6 alkyl, C2-C6 alkenyl, and C3-C6 cycloalkyl are each optionally substituted with one or more halogen.
  • Non-limiting examples of C(R b )3 include tert-butyl, isoprenyl, 2-ethyl-2 -propyl, prenyl, and 2-methoxy-2 -propyl.
  • L is O, S, or SO.
  • R 1 is aryl or heterocyclyl selected from the group consisting of naphthyridine, indolyl, pyrazolyl, benzodioxaolyl, pyridyl, furopyridinyl, isoindolyl, pyridooxazinyl, imidazolyl, pyrrolyl, pyrrolopyridinyl, thiophenyl, isoxazolyl, pyrimidinyl, quinoxalinyl, quinazolinyl, quinolinyl, isoquinolinyl, phenyl, oxazole, and quinazoline, any of which is optionally substituted with 1 to 3 groups of R a .
  • L is NR 4
  • R 4 is H, deuterium, or C1 -C10 alkyl.
  • R 4 is H or deuterium
  • R 3 is H or deuterium.
  • R 1 is aryl or heterocyclyl selected from the group consisting of pyrazolyl, pyridyl, imidazolyl, pyrrolyl, thiophenyl, isoxazolyl, pyrimidinyl, phenyl, or oxazole, any of which is optionally substituted with 1 to 3 groups of R a .
  • R 1 is pyridyl optionally substituted R a selected from the group consisting of CF3, OH, halogen, alkyl, substituted alkyl, CN, carboxamide, C0 2 H, OR d , and NR d R d , wherein R d is C1-C10 alkyl.
  • R a is F, CF3, methyl, ethyl, methoxy, or ethoxy.
  • L is (CR 5 R 5 ) n XR 4 .
  • the compound is represented by Formula I-
  • R 4 is H, deuterium, or C1-C4 alkyl, and each R 5 is independently H or deuterium.
  • R 1 is aryl or heterocyclyl selected from the group consisting of pyrazolyl, pyridyl, imidazolyl, pyrrolyl, thiophenyl, isoxazolyl, pyrimidinyl, phenyl, or oxazole, any of which is optionally substituted with 1 to 3 groups ofR a .
  • R 1 is phenyl, pyridyl, or pyrimidyl, each of which optionally substituted with C(R b )3, and each R b is independently selected from the group consisting C1-C6 alkoxy, C1-C6 alkyl, and C3-C6 cycloalkyl, wherein said C1-C6 alkoxy, C1 -C6 alkyl, and C3-C6 cycloalkyl are each optionally substituted with one or more atoms selected from halogen and deuterium.
  • C(R b )3 is tert-butyl group.
  • the compound is represented by Formula I-C:
  • R 4 is H, deuterium, or C1-C4 alkyl.
  • R 1 is aryl or heterocyclyl selected from the group consisting of pyrazolyl, pyridyl, imidazolyl, pyrrolyl, thiophenyl, isoxazolyl, pyrimidinyl, phenyl, or oxazole, any of which is optionally substituted with 1 to 3 groups of R a .
  • R 1 is phenyl, pyridyl, or pyrimidyl, each of which optionally substituted with C(R b )3, and each R b is independently selected from the group consisting C 1 -C6 alkoxy, C1-C6 alkyl, and C3-C6 cycloalkyl, wherein said C1-C6 alkoxy, C1-C6 alkyl, and C3-C6 cycloalkyl are each optionally substituted with one or more halogen.
  • C(R b ) 3 is tert-butyl group.
  • Exemplary compounds of Formula I include the following:
  • compositions containing a therapeutically effective amount of the above described compound and a pharmaceutically acceptable carrier.
  • the pharmaceutical composition can futher include one or more additional antiviral agents.
  • additional agent include oseltamivir, zanamivir, peramivir, amantadine, and rimantadine.
  • the pharmaceutical composition may also contain one or more physiologically acceptable surface active agents, additional carriers, diluents, excipients, smoothing agents, suspension agents, film forming substances, and coating assistants, or a combination thereof; and a composition disclosed herein.
  • Acceptable additional carriers or diluents for therapeutic use are well known in the pharmaceutical art, and are described, for example, in Remington’s Pharmaceutical Sciences, l8th Ed., Mack Publishing Co., Easton, PA (1990), which is incorporated herein by reference in its entirety.
  • Preservatives, stabilizers, dyes, sweeteners, fragrances, flavoring agents, and the like may be provided in the pharmaceutical composition.
  • sodium benzoate, ascorbic acid and esters of p- hydroxybenzoic acid may be added as preservatives.
  • antioxidants and suspending agents may be used.
  • alcohols, esters, sulfated aliphatic alcohols, and the like may be used as surface active agents; sucrose, glucose, lactose, starch, microcrystalline cellulose, crystallized cellulose, mannitol, light anhydrous silicate, magnesium aluminate, magnesium metasilicate aluminate, synthetic aluminum silicate, calcium carbonate, sodium acid carbonate, calcium hydrogen phosphate, calcium carboxymethyl cellulose, and the like may be used as excipients; magnesium stearate, talc, hardened oil and the like maybe used as smoothing agents; coconut oil, olive oil, sesame oil, peanut oil, soya may be used as suspension agents or lubricants; cellulose acetate phthalate as a derivative of a carbohydrate such as cellulose or sugar, or methyl
  • a dosage form includes those forms in which the compound is administered per se.
  • a dosage form may include a pharmaceutical composition.
  • the dosage form may comprise a sufficient amount of the compound to treat a viral infection as part of a particular administration protocol, as would be understood by those of skill in the art. Techniques for formulation and administration of the compounds of the instant application may be found in“Remington’s Pharmaceutical Sciences,” Mack Publishing Co., Easton, PA, 18th edition, 1990.
  • Suitable routes of administration may, for example, include oral, rectal, transmucosal, topical, or intestinal administration; parenteral delivery, including intramuscular, subcutaneous, intravenous, intramedullary injections, as well as intrathecal, direct intraventricular, intraperitoneal, intranasal, or intraocular injections.
  • parenteral delivery including intramuscular, subcutaneous, intravenous, intramedullary injections, as well as intrathecal, direct intraventricular, intraperitoneal, intranasal, or intraocular injections.
  • the compound can also be administered in sustained or controlled release dosage forms, including depot injections, osmotic pumps, pills, transdermal (including electrotransport) patches, and the like, for prolonged and/or timed, pulsed administration at a predetermined rate.
  • compositions may be manufactured in a manner that is itself known, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or tabletting processes.
  • compositions may be formulated in any conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries which facilitate processing of the active compounds into preparations which can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen. Any of the well-known techniques, diluents, carriers, and excipients may be used as suitable and as understood in the art; e.g., in Remington’s Pharmaceutical Sciences, above.
  • Injectables can be prepared in conventional forms, either as liquid solutions or suspensions, solid forms suitable for solution or suspension in liquid prior to injection, or as emulsions.
  • Suitable excipients are, for example, water, saline, dextrose, mannitol, lactose, lecithin, albumin, sodium glutamate, cysteine hydrochloride, and the like.
  • the injectable pharmaceutical compositions may contain minor amounts of nontoxic auxiliary substances, such as wetting agents, pH buffering agents, and the like.
  • Physiologically compatible buffers include, but are not limited to, Hanks’s solution, Ringer’s solution, or physiological saline buffer. If desired, absorption enhancing preparations may be utilized.
  • penetrants appropriate to the barrier to be permeated may be used in the formulation.
  • compositions for parenteral administration include aqueous solutions of the active compounds in water-soluble form.
  • suspensions of the active compounds may be prepared as appropriate oily injection suspensions.
  • Aqueous injection suspensions may contain substances, which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran.
  • the suspension may also contain suitable stabilizers or agents that increase the solubility of the compounds to allow for the preparation of highly concentrated solutions.
  • Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative.
  • compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
  • the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.
  • the composition can be formulated readily by combining the compositions of interest with pharmaceutically acceptable carriers well known in the art.
  • Such carriers which may be used in addition to the cationic polymeric carrier, enable the compositions to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions and the like, for oral ingestion by a patient to be treated.
  • Pharmaceutical preparations for oral use can be obtained by combining the active compound with solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores.
  • Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carboxymethylcellulose, and/or polyvinylpyrrolidone (PVP), e.g., Povidone.
  • disintegrating agents maybe added, such as the cross-linked polyvinylpyrrolidone (e.g. Crospovidone), agar, or alginic acid or a salt thereof such as sodium alginate.
  • Dragee cores are provided with suitable coatings.
  • concentrated sugar solutions may be used, which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures.
  • Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.
  • compositions which can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol.
  • the push-fit capsules can contain the active ingredients in admixture with filler such as lactose, binders such as starches, and/or lubricants such as talc or magnesium stearate and, optionally, stabilizers.
  • the active compounds maybe dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols.
  • stabilizers may be added. All formulations for oral administration should be in dosages suitable for such administration.
  • compositions may take the form of tablets or lozenges formulated in a conventional manner. Administration to the buccal mucosa and sublingually are contemplated.
  • the composition can be conveniently delivered in the form of an aerosol spray presentation from pressurized packs or a nebulizer, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
  • a suitable propellant e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
  • a suitable propellant e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
  • a suitable propellant e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
  • compositions may also be formulated in rectal compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter or other glycerides.
  • rectal compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter or other glycerides.
  • Another aspect of this disclosure provides a method of treating or managing influenza A or B viral infection, or preventing, treating or managing a pathological state resulting from influenza A or B viral infection in a subject comprising administering to the subject in need a therapeutically effective amount of a compound of Formula I.
  • Specific embodiments of the compound of Formula I are as described above. In some embodiemnts, the method applies to the treatment of both influenza A and B viral infection.
  • influenza nucleoprotein is a critical factor in many stages of the viral life cycle.
  • NP protein coats the viral genomic RNA to form ribonucleoproteins (RNPs) and is involved in transportation of RNPs to the nucleus, viral transcription and replication, and virion assembly. Therefore, NP is localized within the cytoplasm during viral entry, the nucleus during viral replication and finally in the cytoplasm again during egress.
  • RNPs ribonucleoproteins
  • the mode of action lies in promoting abnormal oligomerization of influenza virus nucleoprotein (NP) leading to NP aggregation, which in turn causes inhibition of viral replication.
  • NP influenza virus nucleoprotein
  • the compound of Formula I or the pharmaceutical composition is administered upon the detection of a sympton of influenza A and / or B viral infections. In some embodiments, the compound of Formula I or the pharmaceutical composition is administered in about 1, 2, 3, 4, 5, 8 , 10, 12, or 24 hours after the detection of the symptoms.
  • the method further includes administering a second antiviral agent.
  • a second antiviral agent includes oseltamivir, nucleozin, oseltamivir, zanamivir, peramivir, amantadine, and rimantadine.
  • the second antiviral agent can be administered sequentially or simultaneously with the compound of Formula I or a composition thereof.
  • Methods for treating viral infections may include administering a therapeutically effective amount of the therapeutic compounds as described herein. Treating a viral infection may also include prophylactically administering the therapeutic compounds to prevent infection or the spread of an infection in a subject at imminent risk of infection, such as a subject receiving or about to undergo surgery, an immunocompromised subject, or subject otherwise at risk of an infection if the compound was not administered.
  • compositions or pharmaceutical compositions described herein maybe administered to the subject by any suitable means.
  • methods of administration include, among others, (a) administration though oral pathways, which administration includes administration in capsule, tablet, granule, spray, syrup, or other such forms; (b) administration through non-oral pathways such as rectal, vaginal, intraurethral, intraocular, intranasal, or intraauricular, which administration includes administration as an aqueous suspension, an oily preparation or the like or as a drip, spray, suppository, salve, ointment or the like; (c) administration via injection, subcutaneously, intraperitoneally, intravenously, intramuscularly, intradermally, intraorbitally, intracap sularly, intraspinally, intrastemally, or the like, including infusion pump delivery; as well as (d) administration topically; as deemed appropriate by those of skill in the art for bringing the active compound into contact with living tissue.
  • compositions suitable for administration include compositions where the active ingredients are contained in an amount effective to achieve its intended purpose.
  • a therapeutically effective amount of a compound is an amount effective to treat a viral infection, for example, in a mammalian subject (e.g. , a human).
  • the therapeutically effective amount of the compounds disclosed herein required as a dose will depend on the route of administration, the type of animal, including human, being treated, and the physical characteristics of the specific animal under consideration. The do se can be tailored to achieve a desired effect, but will depend on such factors as weight, diet, concurrent medication and other factors which those skilled in the medical arts will recognize.
  • a therapeutically effective amount means an amount of compound effective to prevent, alleviate or ameliorate symptoms of disease or prolong the survival of the subject being treated. Determination of a therapeutically effective amount is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein.
  • the useful in vivo dosage to be administered and the particular mode of administration will vary depending upon the age, weight and mammalian species treated, the particular compounds employed, and the specific use for which these compounds are employed.
  • the determination of effective dosage levels can be accomplished by one skilled in the art using routine pharmacological methods. Typically, human clinical applications of products are commenced at lower dosage levels, with dosage level being increased until the desired effect is achieved. Alternatively, acceptable in vitro studies can be used to establish useful doses and routes of administration of the compositions identified by the present methods using established pharmacological methods.
  • dosages may range broadly, depending upon the desired effects and the therapeutic indication. Typically, dosages may be about 10 microgram/kg to about 100 mg/kg body weight, preferably about 100 microgram/kg to about 10 mg/kg body weight. Alternatively dosages may be based and calculated upon the surface area of the patient, as understood by those of skill in the art.
  • the exact formulation, route of administration and dosage for the pharmaceutical compositions can be chosen by the individual physician in view of the patient’s condition, (see e.g. , Fingl et al. 1975, in“The Pharmacological Basis of Therapeutics”, which is hereby incorporated herein by reference in its entirety, with particular reference to Ch. 1 , p. 1).
  • the dose range of the composition administered to the patient can be from about 0.5 to about 1000 mg/kg of the patient’s body weight.
  • the dosage may be a single one or a series of two or more given in the course of one or more days, as is needed by the patient.
  • human dosages for compounds have been established for at least some conditions, those same dosages, or dosages that are about 0.1% to about 500%, more preferably about 25% to about 250% of the established human dosage may be used.
  • a suitable human dosage can be inferred from ED50 or ID50 values, or other appropriate values derived from in vitro or in vivo studies, as qualified by toxicity studies and efficacy studies in animals.
  • the attending physician would know how to and when to terminate, interrupt, or adjust administration due to toxicity or organ dysfunctions. Conversely, the attending physician would also know to adjust treatment to higher levels if the clinical response were not adequate (precluding toxicity).
  • the magnitude of an administrated dose in the management of the disorder of interest will vary with the severity of the condition to be treated and to the route of administration. The severity of the condition may, for example, be evaluated, in part, by standard prognostic evaluation methods. Further, the dose and perhaps dose frequency will also vary according to the age, body weight, and response of the individual patient. A program comparable to that discussed above may be used in veterinary medicine.
  • the daily dosage regimen for an adult human patient maybe, for example, an oral dose of about 0.1 mg to 2000 mg of the active ingredient, preferably about 1 mg to about 500 mg, e.g. 5 to 200 mg.
  • an intravenous, subcutaneous, or intramuscular dose of the active ingredient of about 0.01 mg to about 100 mg, preferably about 0.1 mg to about 60 mg, e.g. about 1 to about 40 mg is used.
  • dosages may be calculated as the free acid.
  • the composition is administered 1 to 4 times per day.
  • compositions may be administered by continuous intravenous infusion, preferably at a dose of up to about 1000 mg per day.
  • a dose of up to about 1000 mg per day it maybe necessary to administer the compounds disclosed herein in amounts that exceed, or even far exceed, the above-stated, preferred dosage range in order to effectively and aggressively treat particularly aggressive diseases or infections.
  • the compounds will be administered for a period of continuous therapy, for example for a week or more, or for months or years.
  • Dosage amount and interval may be adjusted individually to provide plasma levels of the active moiety, which are sufficient to maintain the antibiotic effects, or minimal effective concentration (MEC).
  • MEC minimal effective concentration
  • the MEC will vary for each compound but can be estimated from in vitro data. Dosages necessary to achieve the MEC will depend on individual characteristics and route of administration. However, HPLC assays or bioassays can be used to determine plasma concentrations.
  • Dosage intervals can also be determined using MEC value.
  • Compositions should be administered using a regimen, which maintains plasma levels above the MEC for 10-90% of the time, preferably between 30-90% and most preferably between 50-90%.
  • the effective local concentration of the drug may not be related to plasma concentration.
  • the amount of composition administered may be dependent on the subject being treated, on the subject’s weight, the severity of the infection, the manner of administration and the judgment of the prescribing physician.
  • compositions disclosed herein can be evaluated for efficacy and toxicity using known methods.
  • the toxicology of the compound may be established by determining in vitro toxicity towards a cell line, such as a mammalian, and preferably human, cell line. The results of such studies are often predictive of toxicity in animals, such as mammals, or more specifically, humans.
  • the toxicity of particular compounds in an animal model such as mice, rats, rabbits, or monkeys, may be determined using known methods.
  • the efficacy of a particular compound may be established using several recognized methods, such as in vitro methods, animal models, or human clinical trials. Recognized in vitro models exist for nearly every class of condition.
  • acceptable animal models maybe used to establish efficacy of chemicals to treat such conditions.
  • the skilled artisan can be guided by the state of the art to choose an appropriate model, dose, and route of administration, and regime.
  • human clinical trials can also be used to determine the efficacy of a compound in humans.
  • compositions may, if desired, be presented in a pack or dispenser device which may contain one or more unit dosage forms containing the active ingredient.
  • the pack may for example comprise metal or plastic foil, such as a blister pack.
  • the pack or dispenser device may be accompanied by instructions for administration.
  • the pack or dispenser may also be accompanied with a notice associated with the container in form prescribed by a governmental agency regulating the manufacture, use, or sale of pharmaceuticals, which notice is reflective of approval by the agency of the form of the dmg for human or veterinary administration.
  • Such notice for example, may be the labeling approved by the U.S. Food and Dmg Administration for prescription dmgs, or the approved product insert.
  • Compositions comprising a compound formulated in a compatible pharmaceutical carrier may also be prepared, placed in an appropriate container, and labeled for treatment of an indicated condition.
  • substantially pure material in the pharmaceutical industry, it is standard practice to provide substantially pure material when formulating pharmaceutical compositions. Therefore, in some embodiments, “substantially pure” refers to the amount of purity required for formulating pharmaceuticals, which may include, for example, a small amount of other material that will not affect the suitability for pharmaceutical use. In some embodiments, the substantially pure compound contains at least about 96% of the compound by weight, such as at least about 97%, 98%, 99%, or 100% of the compound.
  • a related aspect provides a method of targeting influenza virus nucleoprotein by contacting a compound of Formula I with a cell infected with one or more viral strains, whereby abnormal aggregation or oligomerization of the influenza virus nucleoprotein inhibits viral replication.
  • Specific embodiments of the compound of Formula I are as described above.
  • the one or more viral strains are influenza A and influenza B.
  • the compound is contacted with the cell within 2, 4, 6, 8, 10, 15, 20, 24, 30, or 48 hours after the cell is infected with a viral strain.
  • Multiplicities are denoted accordingly: s (singlet), d (doublet), dd (doublet of doublets), ddd (doublet of doublet of doublets), dt (doublet of triplets), tt (triplet of triplets), dq (doublet of quartets), t (triplet), q (quartet), p (pentet), m (multiplet).
  • High resolution mass spectra (LCMS) were obtained using an Agilent 1200 Series Rapid Resolution LC/MS. The chromatography was performed by using Teledyne ISCO RediSep normal phase (40-60 microns) silica Gel disposable flash columns using a Teledyne ISCO Combiflash Rf purification system.
  • Preparative reversed phase chromatography was carried out by using a Gilson 271 liquid handler coupled to a UV-visl59 Gilson detector, Gilson 322 pump and with a Luna lOpm Cl8(2) 100A AXIA Packed column 100 x 21.2 mm.
  • Mobile phase linear gradient from 5%-90% CH3CN in H2O (0.1% formic acid), at flow rate of 20 mL/min.
  • N,N'-(l,4-phenylene)bis(4-(tert-butyl)benzamide) (SI): Prepared from general procedure (A) from 1 ,4-diamino-benzene (0.07g, 1 equiv.), triethylamine (3.0 equiv.) and 4-(l,l- dimethylethyl)benzoyl chloride (2.2 equiv.). The resulted white suspension was stirred at room temperature for 12 h and then filtered. The white cake was washed with CH2CI2 (10 mL), EtOH (10 mL) and dried under vaccum to give the desired product as white powder 0.2g (72% yield).
  • N,N'-(l,3-phenylene)bis(4-(tert-butyl)benzamide) (S6): Prepared from general procedure (A) from 1,3 -diamino-benzene (0.l0g, 1.0 equiv.), triethylamine (3.0 equiv.) and 4-(l ,l - dimethylethyl)benzoyl chloride (2.2 equiv.). Product was purified via flash chromatography (gradient elution from 0% EtOAc in Hexanes to 25% EtOAc in Hexanes) to give product S6 as white powder 0.3g (77% yield).
  • N-(4-acetamidophenyl)-4-(tert-butyl)benzamide (S7): To a solution of N-(4- aminophenyl)-4-(tert-butyl)benzamide (0.094 g, 1.0 equiv.) and pyridine (0.58 g, 7.4 mmol, 20 equiv.) in CH2CI2 (20 mL) was added with acetic anhydride (0.039g, 0.38 mmol, 1.1 equiv.) at 0°C. The resulted white suspension was stirred at room temperature for 12 h before diluted with CH2CI2 (30 mL).
  • MDCK Madin-Darby canine kidney
  • A549 human alveolar epithelial
  • A594 human embryonic kidney 293T (293T) cells
  • ATCC American Type Culture Collection
  • MDCK, A549, and 293T cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) (Gibco, Carlsbad, CA) supplemented with 10% fetal bovine semm (FBS) (HyClone, South Logan, UT), and 1% penicillin-streptomycin (P/S) (Gibco). All cells were grown at 37°C, 5% CO2.
  • DMEM Dulbecco’s modified Eagle’s medium
  • FBS fetal bovine semm
  • P/S penicillin-streptomycin
  • influenza virus plasmid pPoll-NP Y40F was generated by exchanging one nucleotide in the parental plasmid pPoll-NP (16) using the QuickChange site-directed mutagenesis kit (Agilent Technologies, Wilmington, DE) using specific primers (forward: 5’- GATGGAATTGGACGATTCTTCATCCAAATGTGCACCGAAC -3’; reverse: 5’- GTTCGGTGCACATTTGGATGAAGAATCGTCCAATTCCATC -3’) ⁇ Presence of the mutation was confirmed by sequencing (Macrogen, Rockville, MD). The mammalian expression vector pCAGGS containing a chicken b-actin promoter has been previously described. Proper insertion and presence of the mutation was confirmed by sequencing (Macrogen).
  • influenza A/WSN/1933 (H1N1) virus was propagated in MDCK cells for 2 days at 37°C.
  • Influenza A/Califomia/04/ 2009 (H1N1) virus was propagated in MDCK cells for 3 days at 35°C.
  • Influenza viruses A/Puerto Rico/8/l934 (H1N1) (PR8), A/Panama/2007/l999 (H3N2) and A/Vietnam/l203/2004 (H5N1) bearing a mutated polybasic cleavage site in the HA segment (HAlo) were propagated in 10-day old embryonated chicken eggs for 2 days at 37°C.
  • Influenza B/Yamagata/l6/l988 virus was propagated in 8-day old embryonated chicken eggs for 3 days at 33°C. All influenza viruses were titered by standard plaque assay in MDCK cells. Vesicular stomatitis virus was grown and titered by plaque assay in VERO cells. Recombinant influenza viruses were generated using the influenza virus rescue protocol. Briefly, 293T cells were transfected with eight pPoll constructs expressing the PB1 , PB2, PA, NP (or NP Y40F), HA, NA, M, and NS genomic segments as well as pCAGGS expression plasmids encoding the PB 1 , PB2, PA, and NP proteins.
  • MDCK cells Twenty four hours post transfection, MDCK cells were co-cultured with the transfected 293 Ts for an additional 24—48 hours, until cytopathic effects were observed. Newly generated viruses were collected and plaque- purified, and the presence of the mutation was confirmed by sequencing.
  • ATP levels as a function of cell viability, according to manufacturer’s specifications.
  • A549 cells were seeded into 96-well plates (1250 cells/well) and incubated at 37°C, 5% C0 2 for 24 hours. Culture medium was then replaced with 100 uL of fresh medium containing compound (serially diluted), and this was further incubated for 24 hours. Cell viability was measured by adding 50 uL of CellTiterGlo reagent to each well, and the luminescence signal was read using a plate reader (Beckman Coulter, Brea, CA).
  • Viral growth assays in the presence of inhibitors. 100,000 A549 cells were seeded into 24-well plates and incubated for 24 h at 37 °C, 5% C0 2 . Two hours before infection, the medium was replaced with DMEM containing the compound of interest at the indicated concentrations. Compounds were absent during the l-h virus incubation but were present in the DMEM post-infection medium. Infections were performed at a low MOI (0.01-0.1) for 24 or 48 hours, depending on virus used. For infections with influenza viruses, post-infection medium also contained 1 ug/mL TPCK- treated trypsin (sigma- Aldrich, St. Louis, MO). The infected cells were incubated at 37 °C with the exception of influenza B virus-infected cells, which were incubated at 33 °C. Viral titers were determined by standard plaque assay in MDCK cells.
  • the concentration of Sl required for maximum virus inhibition (3 logs), while maintaining enough virus production for subsequent passages was determined (2mM Sl).
  • A549 cells were infected with WSN at an MOI of 0.01 for 24 hours at 37°C under S20 treatment. The supernatant was then collected and titered by plaque assay. If the recovered Sl treated virus did not show increased viral titer similar to that of the DMSO treated control, the virus was passaged again by same method. Once increased titers in the presence of Sl were detected for two consecutive passages, the viruses were plaque purified. Following plaque purification, all 8 genome segments were sequenced and compared to DMSO treated control virus to detect escape mutations.
  • NP proteins Purified recombinant wild-type WSN NP protein was incubated with S l at 25° C for 30 min. Nuclease-free water was added, up to 10 m ⁇ . After incubation, the samples were mixed with 2.5m1 of 5% Coomassie brilliant blue G-250 and loaded into sample wells of nondenaturing 4-20% gradient Mini-Protean TGX gel (Bio-Rad). Samples were separated by electrophoresis at a constant voltage of 150 V for 60 min at 25° C in a blue native Tris/Glycine buffer system (Coomassie brilliant blue G-250 0.02% Cathode Buffer). Gels were destained with 25% methanol/l0% acetic acid solution and visualized using the Bio-Rad (Hercules, CA) ChemiDoc MP Imaging System.
  • Primer extension of influenza RNA was performed using 5’-end labeled fluorescent primers with either Alexa Fluor 488 for vRNA detection or Alexa Fluor 546 for m/cRNA detection of the PB2 (vRNA: 5’- TGCTAATTGGGCAAGGAGAC -3’ or m/cRNA: 5’- GCCATCATCCATTTCATCCT -3’), NP (vRNA: 5’- TGATGGAAAGTGCAAGACCA -3’ or m/cRNA: 5’- TGATTTCAGTGGCATTCTGG -3’), and NS (vRNA: 5’-
  • A549 cells were pretreated for 2 hours with S 1 , VX-787, or DMSO and infected with the WSN virus for 6 hours (MOI 5) under continued compound treatment. Infected A549 total RNA (100 ug) was added to the fluorescent primer (10 pmol), heated to 90°C (3 min), and cooled on ice.
  • RT Reverse transcription
  • 50U Superscript III Invitrogen
  • cDNA samples were mixed with an equal volume of loading dye solution (Formamide, 5mM EDTA pH 8, 1% bromophenol blue) and heated to 95°C for 3 minutes to stop the reaction.
  • Samples were loaded on a 6% polyacrylamide gel containing 7M Urea in TBE buffer. Gel Fluorescence was detected using the Bio- Rad (Hercules, CA) ChemiDoc MP Imaging System.
  • A/Puerto Rico/8/34 strain expressing GFP from segment 8 PR8-GFP.
  • the concentration of the drugs used was based on their respective 50% inhibitory concentrations (IC50) against PR8-GFP in A549 cells.
  • the assays were performed in 96-well format using a liquid handling robot (Biomek NXP, Beckman) to ensure accuracy.
  • Infected cells were detected through GFP fluorescence, quantified by laser scanning cytometry (Acumen, TTP Labtech). Isobolograms and combination indices were calculated as previous described (30).
  • SI is a Specific Inhibitor of Influenza A Virus.
  • the compound Sl potently inhibited both the reporter virus and wild-type WSN virus (H1N1) in MDCK cells.
  • H1N1 wild-type WSN virus
  • Sl caused a 4 log reduction in viral titers with an IC50 of 20 nM.
  • Cytotoxicity of Sl was tested in A549 cells using the CellTiter-Glo system (Promega) and the compound showed very little toxicity at concentrations as high as 500 uM, yielding a minimum SI of 25,000.
  • Sl causes Aggregation of the NP protein.
  • the importance of the oligomeric state of the influenza virus NP protein has been well defined through previous biochemical and structural studies, and the location of the Sl resistance mutations near to those conferring nucleozin resistance indicated that alteration of the NP-NP interaction at this interface may be the mechanism of S 1 antiviral activity.
  • purified baculo virus-expressed NP was incubated with and without compound for 30 minutes in the presence or absence of purified viral RNA and analyzed by blue native PAGE. In the absence of RNA, the purified NP remains predominately in a monomeric state.
  • the band appears as a doublet because of a slightly truncated form of NP being co-expressed with the full length protein during baculovirus expression. It was observed that both forms of NP are shown to be capable of oligomerizing on RNA and therefore the truncated protein should not affect the experimental outcome.
  • An analog of the published PB2 inhibitor VX-787 was used as a negative control. When treated with Sl or nucleozin in the absence of RNA, the monomeric NP band was lost as compared to controls. For nucleozin, it has been described that NP shifts into an unresolvable higher order complex, and this is likely the case for Sl treatment as well.
  • NP Aggregation by SI causes a Segment Specific Inhibition of Viral Transcription.
  • the nucleoprotein is essential for both viral transcription and replication.
  • Primer extension assays were utilized to analyze mRNA and vRNA production and western blot to detect protein expression from the PB2, NP and NS segments as representatives of long, medium and short segments respectively.
  • Treatment of WT WSN infected A549 cells with nucleozin caused a complete loss of both mRNA, vRNA and viral protein expression from all three segments, regardless of size.
  • Sl inhibition resulted in a segment specific effect.
  • mRNA expression from the PB2 segment was reduced to undetectable levels, although the small amount of PB2 protein indicates that there is a minimal level of mRNA expression.
  • vRNA could not be detected from any segment under Sl treatment, indicating a block in replication.
  • the rY40F-WSN virus was completely resistant to Sl inhibition of transcription and replication, while nucleozin exhibited efficient inhibition of this virus.
  • the loss of global vRNA expression could be explained through two possible mechanisms. First, the loss of protein expression of the polymerase subunits and the nucleoprotein would make RNP formation impossible, which is the functional unit for both transcription and vRNA replication.
  • the accumulation of the NP monomeric pool has previously been shown to be a key molecular trigger in the switch from transcription of mRNA to replication of vRNA in the viral life cycle.
  • the loss of this monomeric NP pool evident in the size exclusion chromatography data could prevent this switch from occurring and thereby block vRNA synthesis from all segments.
  • These two mechanisms are not mutually exclusive, with each likely playing a role in Sl inhibition of influenza virus replication.
  • the observed differential inhibition of mRNA expression by Sl from the three tested segments indicates a possible length-dependent effect of the compound. An explanation for this phenomenon could again be due to the loss of the monomeric NP pool.
  • Sl is a symmetrical bis(4-t-butylphenyl)carboxamide of l,4-diaminobenzene that showed no detectable antiviral activity on the two influenza strains that were screened, and a related symmetrical l,3-benzenediamine analog S6 also showed narrow spectrum activity.
  • S8 demonstrated that it had acquired enhanced broad-spectrum activity with improved calculated physical properties (i.e. lower clogP: 5.95), while maintaining significant potency at non-toxic, albeit somewhat higher concentrations than those of the parent hit Sl against the WSN virus. Most interestingly, S8 also showed activity against influenza B virus as well as oseltamivir- resistant and amantadine-resistant influenza A viruses. However, it did not inhibit a non-influenza virus, VSV. As evidence that S8 was still targeting NP, it was shown that the rWSN-Y40F virus maintained resistance to S8.
  • S8 Synergizes with oseltamivir.
  • the effect of S8 in combination with either nucleozin or oseltamivir was tested.
  • A549 cells were infected with influenza PR8-GFP virus in the presence of the two compounds which were titrated against each other in 3 -fold serial dilutions starting with a concentration above the IC90 of each compound alone. Isobolograms of viral inhibition were generated and based on these data, the combination index for the S8-nucleozin interaction was determined to be 0.79, suggesting an additive to slightly synergistic interaction.
  • Compound S8 exhibits antiviral activities against various influenza viral strains as shown in Table 2.
  • S8 demonstrates potent activites against viruses resistant to oseltamivir or amantadine.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Epidemiology (AREA)
  • Virology (AREA)
  • Molecular Biology (AREA)
  • Emergency Medicine (AREA)
  • Pain & Pain Management (AREA)
  • Pulmonology (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

L'invention concerne une nouvelle classe de composé pour le traitement d'une infection par le virus de la grippe A et de la grippe B, ainsi que des compositions et des procédés d'utilisation de celui-ci.
PCT/US2018/060877 2017-11-17 2018-11-14 Nucléoprotéine ciblant un inhibiteur du virus de la grippe WO2019099426A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201762587901P 2017-11-17 2017-11-17
US62/587,901 2017-11-17

Publications (1)

Publication Number Publication Date
WO2019099426A1 true WO2019099426A1 (fr) 2019-05-23

Family

ID=66538807

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2018/060877 WO2019099426A1 (fr) 2017-11-17 2018-11-14 Nucléoprotéine ciblant un inhibiteur du virus de la grippe

Country Status (1)

Country Link
WO (1) WO2019099426A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019233474A1 (fr) * 2018-06-08 2019-12-12 The University Of Hong Kong Composés antiviraux et leurs procédés d'utilisation
EP4054551A4 (fr) * 2019-11-07 2024-03-20 The Board Of Trustees Of The University Of Illinois Inhibiteurs d'entrée virale de la grippe

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5135949A (en) * 1988-09-03 1992-08-04 Boehringer Mannheim Gmbh Pharmaceutical compositions containing phenylamides
US20090163476A1 (en) * 2005-03-03 2009-06-25 Sirtris Pharmaceuticals, Inc. N-Phenyl Benzamide Derivatives as Sirtuin Modulators
US20160115153A1 (en) * 2014-10-24 2016-04-28 Biotherapeutics, Inc. Lanthionine synthetase c-like 2-based therapeutics

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5135949A (en) * 1988-09-03 1992-08-04 Boehringer Mannheim Gmbh Pharmaceutical compositions containing phenylamides
US20090163476A1 (en) * 2005-03-03 2009-06-25 Sirtris Pharmaceuticals, Inc. N-Phenyl Benzamide Derivatives as Sirtuin Modulators
US20160115153A1 (en) * 2014-10-24 2016-04-28 Biotherapeutics, Inc. Lanthionine synthetase c-like 2-based therapeutics

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
DATABASE PUBCHEM 30 March 2007 (2007-03-30), Database accession no. 15998267 *
DATABASE PUBCHEM 8 July 2005 (2005-07-08), Database accession no. 730569 *
HAO ET AL.: "Synthesis and antiviral activity of substituted bisaryl amide compounds as novel influenza virus inhibitors", EUROPEAN JOURNAL OF MEDICINAL CHEMISTRY, vol. 55, 2012, pages 117 - 124, XP055138628, Retrieved from the Internet <URL:https://doi.org/10.1016/j.ejmech.2012.07.008> DOI: doi:10.1016/j.ejmech.2012.07.008 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019233474A1 (fr) * 2018-06-08 2019-12-12 The University Of Hong Kong Composés antiviraux et leurs procédés d'utilisation
EP4054551A4 (fr) * 2019-11-07 2024-03-20 The Board Of Trustees Of The University Of Illinois Inhibiteurs d'entrée virale de la grippe

Similar Documents

Publication Publication Date Title
US9434745B2 (en) 7-oxo-thiazolopyridine carbonic acid derivatives and their use in the treatment, amelioration or prevention of a viral disease
JP6134338B2 (ja) Ｂ型肝炎ウイルス共有結合閉環状ｄｎａ形成の阻害剤およびそれらの使用方法
EP2511273B1 (fr) Inhibiteurs de la réplication virale, leur procédé de préparation et leurs utilisations thérapeutiques
US20160367557A1 (en) Heterocyclic pyrimidine carbonic acid derivatives which are useful in the treatment, amelioration or prevention of a viral disease
KR20150090219A (ko) Hbv 감염에 대항하여 항바이러스 물질로써 기능화된 벤자미드 유도체들
US20130096138A1 (en) Novel thiourea or urea derivative, preparation method thereof, and pharmaceutical composition for preventing or treating aids, containing same as active ingredient
US9688637B2 (en) 3-amidobenzamides and uses thereof for increasing cellular levels of A3G and other A3 family members
US9566254B2 (en) Inhibitors and methods of inhibiting bacterial and viral pathogens
WO2019099426A1 (fr) Nucléoprotéine ciblant un inhibiteur du virus de la grippe
EP2616073A2 (fr) Inhibiteurs d&#39;entrée virale dans des cellules de mammifères
Xu et al. Discovery of novel substituted N-(4-Amino-2-chlorophenyl)-5-chloro-2-hydroxybenzamide analogues as potent human adenovirus inhibitors
US11771694B2 (en) Arylamide compounds for treatment and prevention of viral infections
EP3817815A1 (fr) Modulateurs de nlrp
WO2014012467A1 (fr) Composé diarylaniline ou diarylpyridinamine et son procédé de préparation et son utilisation médicale
JP6923112B2 (ja) フィロウイルスの細胞侵入阻害活性を有するビアリールスルフォンアミド誘導体
CN114890946B (zh) 含有吗啉丙基的[(喹啉-4-基)氨基]苯甲酰胺类化合物及其制备与应用
CN114773267B (zh) [(7-三氟甲基喹啉-4-基)氨基]苯甲酰胺类化合物及其制备与应用
CN112724156A (zh) 一种多环吡啶酮衍生物和药物组合物及其应用
CA3099382A1 (fr) Modulateurs a petites molecules du cmh-1
CN113979936A (zh) 2-芳脲基-n-[3-(4-吗啉基)丙基]烟酰胺类化合物及其应用
CN114057635A (zh) 2-芳脲基-n-[2-(2-甲氧基苯氧基)乙基]烟酰胺类化合物及其应用
US20230105935A1 (en) Antiviral compounds, compositions and methods of use
CN114853670B (zh) 含有酰胺基团的喹啉类化合物及其制备与应用
CN113979935A (zh) 2-芳脲基-n-(4-氟苄基)烟酰胺类化合物及其应用
JP7061394B2 (ja) キノリノン化合物および抗ｒｎａウイルス薬

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18877716

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18877716

Country of ref document: EP

Kind code of ref document: A1