WO2019088658A1 - Dual-targeting antibody targeting scf and galectin-1 and use thereof - Google Patents

Abstract

The present invention relates to a dual-targeting antibody targeting stem cell factor (SCF) and galectin-1 and a composition for preventing or treating angiogenesis-related diseases comprising the same. The present invention provides a dual-targeting antibody derived from a human monoclonal antibody which can effectively inhibit angiogenesis by simultaneously neutralizing SCF and galectin-1 involved in angiogenesis, and a pharmaceutical composition for preventing or treating angiogenesis-related diseases comprising the antibody. The dual-targeting antibody according to the present invention can effectively prevent or treat angiogenesis-related diseases by simultaneously neutralizing two targets involved in angiogenesis wherein the angiogenesis-related diseases cause hemorrhaging by blood vessels changing due to abnormal angiogenesis and thus increasing the permeability thereof.

Description

Dual target antibodies targeting SCF and galectin-1 and uses thereof

The present invention relates to a dual target antibody targeting SCF (Stem Cell Factor) and galectin-1 (Galectin-1) and a composition for preventing or treating angiogenesis-related diseases comprising the same.

SCF (stem cell factor) is known to be a factor deeply involved in the differentiation of blood cells, sperm, and melanocytes. It is mainly produced in fibroblast and endothelial cells and is known to promote angiogenesis by increasing expression and secretion in hypoxia state. In addition, galectin-1 binds to VEGF (Vascular Endothelial Growth Factor) receptor, a typical protein that is secreted in hypoxia and regulates angiogenesis, to induce angiogenesis As a factor, it is known that even if VEGF is inhibited, blood vessels are induced by galectin-1, a new ligand.

Angiogenesis refers to the generation of new microvessels from existing blood vessels that are already present by the vasogenic factor in the body. When cells grow to a certain extent, they secrete substances that stimulate angiogenesis, and when secreted too much, secrete substances that inhibit it. Feedback is used to maintain the balance of blood vessel production.

Most of the adult blood vessels are almost non-dividing, and normal angiogenesis is extremely rare. Abnormal angiogenesis changes the blood vessels and increases the permeability, causing diseases that cause bleeding. Examples include age-related macular degeneration, diabetic retinopathy, choroidal neovascularization, glaucoma retinitis igmentosa, retinopathy od prematurity, glaucoma diseases such as glaucoma, corneal dystrophy, retinoschisis, rheumatoid arthritis, psoriasis, metastasis, and delayed wound healing occur.

Particularly, the angiogenesis in the cornea of the above-mentioned diseases inhibits the transparency of the eyeball, resulting in loss of visual acuity. In the retinal neovascularization, abnormal blood vessels are generated, resulting in exudation of blood, To induce blindness through. Therefore, it is desirable that the angiogenesis in the eye is not a desirable phenomenon, but it is desirable to be suppressed as much as possible. Thus, diseases caused by abnormal angiogenesis can increase the therapeutic effect of the disease only by inhibiting the angiogenesis.

For this reason, studies on the treatment of angiogenesis-related diseases using an angiogenesis inhibitor have been conducted, and many angiogenic factors such as growth, migration, differentiation and capillary formation of vascular endothelial cells, Neonatal inhibitors were found. Angiogenesis inhibitors are activated against the activity of angiogenic factors required for angiogenesis. Naturally occurring angiogenesis inhibitors in the body are less toxic and can be used to inhibit pathological angiogenesis, and many related drugs are under development.

As a result of intensive efforts to find a therapeutic agent for angiogenesis-related diseases, the present inventors have found that SCF (stem cell factor) and galectin-1 promote angiogenesis, whereas inhibiting the expression of SCF and galectin- The present inventors have completed the present invention by producing a double target antibody capable of simultaneously neutralizing SCF and galectin-1.

It is an object of the present invention to provide a dual target antibody that specifically binds to SCF (Stem Cell Factor) and galectin-1.

It is another object of the present invention to provide a DNA encoding a double-target antibody that specifically binds to SCF and galectin-1.

It is still another object of the present invention to provide a pharmaceutical composition for preventing or treating angiogenesis-related diseases comprising a double-target antibody that specifically binds to SCF and galectin-1.

It is still another object of the present invention to provide a method for treating SCF and Galectin-1 comprising administering to a subject in need thereof a double-target antibody specifically binding to SCF and Galectin-1; And a method for preventing or treating angiogenesis-related diseases.

It is still another object of the present invention to provide a composition for simultaneous detection of SCF and galectin-1 comprising a double-target antibody that specifically binds to SCF and galectin-1.

In order to achieve the above object, the present invention provides a light chain CDR1 comprising an amino acid sequence of SEQ ID NO: 1, a light chain CDR2 represented by an amino acid sequence of SEQ ID NO: 2, and a light chain CDR3 represented by an amino acid sequence of SEQ ID NO: 3 Light chain variable region; And a heavy chain variable region comprising the heavy chain CDR1 represented by the amino acid sequence of SEQ ID NO: 4, the heavy chain CDR2 represented by the amino acid sequence of SEQ ID NO: 5, and the heavy chain CDR3 represented by the amino acid sequence of SEQ ID NO: 6. (Stem Cell Factor) and galectin-1 (Galectin-1).

The present invention also provides a method for producing a light chain CDR1 comprising the light chain CDR1 represented by SEQ ID NO: 1, the light chain CDR2 represented by SEQ ID NO: 2, and the light chain CDR3 represented by SEQ ID NO: 3 by the nucleotide sequence of SEQ ID NO: 10, SEQ ID NO: 11 and SEQ ID NO: DNA encoding a light chain variable region comprising; And a heavy chain variable region comprising the nucleotide sequence of SEQ ID NO: 13, SEQ ID NO: 14 and SEQ ID NO: 15, which respectively encode the heavy chain CDR1 of SEQ ID NO: 4, the heavy chain CDR2 of SEQ ID NO: 5 and the heavy chain CDR3 of SEQ ID NO: DNA coding region; A DNA encoding a double-target antibody that specifically binds to SCF and galectin-1.

The present invention also provides a vector comprising the DNA and a cell transformed with the vector.

The present invention also provides a pharmaceutical composition for preventing or treating an angiogenesis-related disease comprising a double-target antibody that specifically binds to SCF and galectin-1.

The present invention also relates to a method for screening for a compound that specifically binds to SCF and galectin-1 to a subject in need thereof; And a method for preventing or treating an angiogenesis-related disease.

The present invention also provides a composition for simultaneous detection of SCF and galectin-1 comprising a double-target antibody specifically binding to SCF and galectin-1.

The present invention relates to a method for preventing or treating an angiogenesis-related disease comprising a human monoclonal antibody derived from a human monoclonal antibody, which is capable of effectively inhibiting neovascularization by simultaneously neutralizing SCF and galectin-1 involved in angiogenesis, A pharmaceutical composition is provided. The dual target antibody according to the present invention can simultaneously prevent or treat an angiogenesis-related disease that causes hemorrhage because blood vessels are changed due to abnormal angiogenesis by simultaneously neutralizing two targets involved in angiogenesis.

FIG. 1 shows a total of 9 monoclonal antibodies 3C6, 3A2, 3C3, 3A4, 3E7, 3C8, 3C4, 3F7 and 3F3 selected by enzyme immunoassay.

FIG. 2 is a graph showing inhibition of tube formation of vascular endothelial cells of HUVEC (vascular endothelial cells) by treating all 9 monoclonal antibodies of the present invention.

Fig. 3 is a graph showing the result of electrophoresis of the light chain domain DNA in the 3C4 antibody variable region amplified by PCR on 1% agarose gel.

FIG. 4 is a graph showing the results of electrophoresis of the heavy chain domain DNA among 3C4 antibody variable regions amplified by PCR on 1% agarose gel. FIG.

Fig. 5 is a diagram showing the base sequence, amino acid sequence and CDR region thereof of the 3C4 antibody light chain region.

6 is a diagram showing the base sequence, amino acid sequence and CDR region thereof of the 3C4 antibody heavy chain region.

FIG. 7 is a graph showing the results of SDS-PAGE analysis after separation and purification of human 3C4 antibody expressed in animal cell lines.

FIG. 8 is a graph showing the results of SPR (surface plasmon resonance) for confirming the SCF binding ability of a human 3C4 antibody according to the present invention.

FIG. 9 is a graph showing the ability of the human 3C4 antibody according to the present invention to inhibit the tube formation of vascular endothelial cells (HUVEC).

10 is a graph showing the results of c-kit phosphorylation inhibition assay of the human 3C4 antibody according to the present invention.

11 is a graph showing the results of protein microarray analysis using a human 3C4 antibody according to the present invention.

FIG. 12 is a diagram showing the result of isolation and purification after human galectin-1 gene was overexpressed in E. coli.

13 is a graph showing the results of SPR (surface plasmon resonance) for confirming galectin-1 binding ability of human 3C4 antibody according to the present invention.

FIG. 14 is a graph showing the ability of the human 3C4 antibody according to the present invention to inhibit the formation of vascular endothelial cells. FIG.

FIG. 15 is a graph showing the ability of human 3C4 antibody according to the present invention to inhibit cell proliferation by galectin-1 (A) and SCF (B).

FIG. 16 is a graph showing the ability of each antibody to inhibit the tube formation of vascular endothelial cells in order to compare the neutralization ability of a human 3C4 antibody and a commercially available SCF antibody according to the present invention.

Hereinafter, the present invention will be described in detail.

Terms not otherwise defined herein have meanings as commonly used in the art to which the present invention belongs.

The present inventors first produced a double-target antibody capable of preventing or treating the above-mentioned diseases by inhibiting angiogenesis in angiogenesis-related diseases.

In the case of the double target antibody, since two signals can be simultaneously suppressed or amplified, it can be more effective than suppressing / amplifying one signal. As compared with the case of processing each signal with each signal inhibitor, It is capable of low dose administration and has the advantage of suppressing / amplifying two signals at the same time and space.

In the present invention, the dual target antibody may be a "polyclonal" or "monoclonal" antibody, but a monoclonal antibody is more preferable. A monoclonal antibody refers to an antibody obtained from a substantially homogeneous population of antibodies, i.e., the individual antibodies that make up this population are identical except for possible naturally occurring mutations that may be present in minor amounts. Monoclonal antibodies are highly specific for single antigenic sites. Moreover, contrary to polyclonal antibodies comprising different antibodies to different epitopes, each monoclonal antibody is directed against a single epitope on the antigen. Monoclonal should not be construed to mean that it is necessary to generate antibodies in any particular way. For example, monoclonal antibodies useful in the present invention can be prepared by hybridoma methods as described in Kohler et al., Nature, 256: 495 (1975), or by recombinant DNA methods [see US Patent No. 4,816,567] can do. In addition, monoclonal antibodies have been described, for example, in Clackson et al., Nature, 352: 624-628 (1991); Marks et al., J. Mol. Biol., 222: 581-597 (1991).

In one aspect, the present invention provides a double-target antibody specifically binding to SCF (Stem Cell Factor) and galectin-1, comprising a light chain CDR1 represented by the amino acid sequence of SEQ ID NO: 1, A light chain variable region comprising a light chain CDR2 represented by an amino acid sequence and a light chain CDR3 represented by an amino acid sequence represented by SEQ ID NO: 3; And a heavy chain variable region comprising the heavy chain CDR1 represented by the amino acid sequence of SEQ ID NO: 4, the heavy chain CDR2 represented by the amino acid sequence of SEQ ID NO: 5, and the heavy chain CDR3 represented by the amino acid sequence of SEQ ID NO: To provide the target antibody.

As used herein, the term " antibody " includes the complete antibody form as well as antigen-binding fragments of the antibody molecule.

A complete antibody is a structure having two full-length light chains and two full-length heavy chains, each light chain linked by a disulfide bond with a heavy chain. The heavy chain constant region has gamma (gamma), mu (mu), alpha (alpha), delta (delta) and epsilon (epsilon) types and subclasses gamma 1 (gamma 1), gamma 2 ), Gamma 4 (gamma 4), alpha 1 (alpha 1) and alpha 2 (alpha 2). The constant region of the light chain has the kappa and lambda types (Cellular and Molecular Immunology, Wonsiewicz, MJ, Ed., Chapter 45, pp. 41-50, WB Saunders Co. Philadelphia, PA (1991); Nisonoff, A., Introduction to Molecular Immunology, 2nd Ed., Chapter 4, pp. 45-65, Sinauer Associates, Inc., Sunderland, MA (1984)).

As used herein, the term " antigen binding fragment " refers to a fragment having an antigen binding function and includes Fab, F (ab ') 2, F (ab') ₂ and Fv. Fabs in the antibody fragment have one antigen-binding site in a structure having a variable region of a light chain and a heavy chain, a constant region of a light chain, and a first constant region (C _H1 ) of a heavy chain. Fab 'differs from Fab in that it has a hinge region that contains at least one cysteine residue at the C-terminus of the heavy chain C _H1 domain. The F (ab ') ₂ antibody is produced in which the cysteine residue of the hinge region of the Fab' forms a disulfide bond. Fv is the smallest antibody fragment that has only the variable region of the heavy chain and the variable region of the light chain. The two-chain Fv is a non-covalent linkage between the heavy chain variable region and the light chain variable region. Is generally linked to the variable region of the heavy chain and the variable region of the short chain through a peptide linker in a covalent bond or directly connected at the C-terminal to form a dimer-like structure like the double-chain Fv. Such an antibody fragment can be obtained using a protein hydrolyzing enzyme (for example, a Fab can be obtained by restriction of the whole antibody to papain, and F (ab ') ₂ fragment can be obtained by cleavage with pepsin), or Can be produced through recombinant DNA technology.

In the present invention, the antibody is in the form of a Fab or a complete antibody form. In addition, the heavy chain constant region may be selected from any one of gamma (gamma), mu (mu), alpha (alpha), delta (delta) or epsilon (epsilon). The light chain constant region may be kappa or lambda form, and according to one embodiment of the present invention is kappa type.

As used herein, the term " heavy chain " refers to a variable region domain V _H comprising an amino acid sequence having a sufficient variable region sequence to confer specificity to an antigen, and a variable region domain V _H comprising three constant region domains C _H1 , C _H2 and C _H3 Quot; means both the heavy chain and the fragment thereof. The term " light chain " is used herein to refer to both the full length light chain comprising a variable region domain V _L comprising an amino acid sequence having a sufficient variable region sequence for imparting specificity to an antigen and the constant region domain C _L , it means.

As used herein, the term " CDR (complementarity determining region) " refers to the amino acid sequence of the hypervariable region of the immunoglobulin heavy chain and light chain (Kabat et al., Sequences of Proteins of Immunological Interest, 4th Ed. US Department of Health and Human Services, National Institutes of Health (1987)). The heavy and light chains each contain three CDRs (heavy chain (CDR _H1 , CDR _H2 and CDR _H3 ) and light chains (CDR _L1 , CDR _L2 and CDR _L3 )). The CDR is an annular region involved in the recognition of an antigen, which is an important site in which the antibody provides an important contact moiety in binding to an antigen or epitope, and thus the specificity of the antibody to the antigen is determined as the sequence of the site changes .

In the present invention, the term " framework region (FR) " means a constituent element constituting a variable region of the antibody, and means a region located between the CDRs and serving to support the CDR ring structure do.

In the present invention, " dual target antibody specifically binding to SCF and galectin-1 " may be used interchangeably with " anti-SCF antibody " or " dual target antibody ".

In the present invention, the antibody may comprise a light chain variable region represented by the amino acid sequence of SEQ ID NO: 7 or a heavy chain variable region represented by the amino acid sequence of SEQ ID NO: 8.

In addition, in the present invention, the antibody may be characterized by being represented by the amino acid sequence of SEQ ID NO: 9.

The double-target antibody or antigen-binding fragment thereof of the present invention may include variants of the amino acid sequence set forth in the Sequence Listing attached to SCF and galectin-1 in a specific manner. For example, the amino acid sequence of an antibody may be altered to improve the binding affinity and / or other biological properties of the antibody. Such modifications include, for example, deletion, insertion and / or substitution of the amino acid sequence residues of the antibody.

Such amino acid variations are made based on the relative similarity of the amino acid side chain substituents, such as hydrophobicity, hydrophilicity, charge, size, and the like. By analysis of the size, shape and type of amino acid side chain substituents, arginine, lysine and histidine are both positively charged residues; Alanine, glycine and serine have similar sizes; Phenylalanine, tryptophan and tyrosine have a similar shape. Thus, based on these considerations, arginine, lysine and histidine; Alanine, glycine and serine; And phenylalanine, tryptophan and tyrosine are biologically functional equivalents.

In introducing mutations, the hydropathic index of amino acids can be considered. Each amino acid is assigned a hydrophobic index according to its hydrophobicity and charge: isoruicin (+4.5); Valine (+4.2); Leucine (+3.8); Phenylalanine (+2.8); Cysteine / cysteine (+2.5); Methionine (+1.9); Alanine (+1.8); Glycine (-0.4); Threonine (-0.7); Serine (-0.8); Tryptophan (-0.9); Tyrosine (-1.3); Proline (-1.6); Histidine (-3.2); Glutamate (-3.5); Glutamine (-3.5); Aspartate (-3.5); Asparagine (-3.5); Lysine (-3.9); And arginine (-4.5).

The hydrophobic amino acid index is very important in imparting the interactive biological function of proteins. It is known that substitution with an amino acid having a similar hydrophobicity index can retain similar biological activities. When the mutation is introduced with reference to the hydrophobic index, substitution is made between amino acids showing preferably a hydrophobic index difference of within ± 2, more preferably within ± 1, even more preferably within ± 0.5.

On the other hand, it is also well known that substitution between amino acids with similar hydrophilicity values leads to proteins with homogeneous biological activity, and the following hydrophilicity values are assigned to each amino acid residue: arginine (+3.0) ; Lysine (+3.0); Aspartate (+3.0 + -1); Glutamate (+3.0 + -1); Serine (+0.3); Asparagine (+0.2); Glutamine (+0.2); Glycine (0); Threonine (-0.4); Proline (-0.5 ± 1); Alanine (-0.5); Histidine (-0.5); Cysteine (-1.0); Methionine (-1.3); Valine (-1.5); Leucine (-1.8); Isoru Isin (-1.8); Tyrosine (-2.3); Phenylalanine (-2.5); Tryptophan (-3.4).

When a mutation is introduced with reference to the hydrophilicity value, the amino acid is substituted preferably within ± 2, more preferably within ± 1, even more preferably within ± 0.5.

In addition, amino acid exchanges in proteins that do not globally alter the activity of the molecule are known in the art (H. Neurath, R. L. Hill, The Proteins, Academic Press, New York, 1979). The most commonly occurring exchanges involve amino acid residues Ala / Ser, Val / Ile, Asp / Glu, Thr / Ser, Ala / Gly, Ala / Thr, Ser / Asn, Ala / Val, Ser / Gly, Thy / Pro, Lys / Arg, Asp / Asn, Leu / Ile, Leu / Val, Ala / Glu and Asp / Gly.

In addition, in the present invention, the double target antibody specifically binding to the SCF and galectin-1 of the present invention may be characterized by including a human IgG1-derived constant region. According to one embodiment of the present invention, the present invention provides a 3C4 antibody which is a dual target antibody which further comprises a human IgG1-derived constant region in the light chain variable region and the heavy chain variable region.

The double target antibody of the present invention is preferably a " humanized antibody ". By humanized antibody is meant an antibody consisting of an amino acid sequence derived from a human germline, some or all, by altering the sequence of the antibody bearing the non-human complementarity determining region (CDR). More preferably, the antibody of the invention may be a " human antibody ". In the present invention, the term " human antibody " broadly refers to antibodies comprising variable regions (CDRs and FRs) derived from human immunoglobulins, and to a lesser extent human immunoglobulins Quot; means an antibody comprising a derived variable region and a constant region. The human antibody may be in the form of a whole antibody as well as a functional fragment of an antibody molecule. Human antibodies can be prepared using a variety of techniques known in the art.

Since all the components of the human antibody are derived from humans, the immunization reaction is less likely to occur than the conventional humanized antibody or mouse antibody, and thus there is an advantage that an undesired immune response does not occur when administered to a human. And can be very useful as an antibody for therapeutic use.

For purposes of the present invention, the human antibody can be regarded as a dual target antibody that specifically binds to the SCF and galectin-1 of the invention, wherein the human antibody specifically binds to SCF and galectin- And galectin-1-induced neovascularization, but the present invention is not particularly limited thereto.

In addition, the human antibody may be glycosylated and / or pegylated to enhance the residence time in a living body.

The term " glycosylation " of the present invention means a processing method in which a glycosyl group is transferred to a protein. The glycation is carried out by a glycosyltransferase in which a glycosyl group is bonded to a serine, threonine, asparagine or hydrosilicon residue of a target protein. The glycated protein can be used not only as a constituent material of a living tissue, It also plays an important role in cell recognition on the surface. Therefore, in the present invention, the effect of the human antibody can be improved by changing the pattern of glycation or glycation of the human antibody.

The term " PEGylation " of the present invention means a processing method for improving the blood residence time of the human antibody by introducing polyethylene glycol into the human antibody (Anna M. Wu, et al., Nature Biotechnology, Drug Discovery, 5: 147-159, 2006; Alain Beck, et al., Immunology, 10: 345-352, 2010). Specifically, by pegylating the polymer nanoparticles with polyethylene glycol, the hydrophilicity of the surface of the nanoparticles is increased, and the immune function including macrophages in the human body, which predominates and extinguishes pathogens, waste materials, Rapid dissolution in the body through a so-called stealth effect that prevents recognition from the body can be prevented. Therefore, the blood retention time of the human antibody can be improved by the pegylation. The pegylation used in the present invention can be formed by a method of forming an amide group by bonding of a carboxyl group of hyaluronic acid and an amine group of polyethylene glycol. However, it is not limited thereto and pegylation can be carried out in various ways. The polyethylene glycol to be used is not particularly limited, but preferably has a molecular weight of 100-1,000 and has a linear or branched structure.

The saccharification and / or pegylation may be modified by known methods in the art so long as the function of the antibody of the present invention is maintained. The human antibody of the present invention may be modified by various saccharification and / Or mutant human antibodies in which the pegylation pattern is modified.

The present invention also provides a method for producing a light chain CDR1 comprising the light chain CDR1 represented by SEQ ID NO: 1, the light chain CDR2 represented by SEQ ID NO: 2, and the light chain CDR3 represented by SEQ ID NO: 3 by the nucleotide sequence of SEQ ID NO: 10, SEQ ID NO: 11 and SEQ ID NO: DNA encoding a light chain variable region comprising; And a heavy chain variable region comprising the nucleotide sequence of SEQ ID NO: 13, SEQ ID NO: 14 and SEQ ID NO: 15, which respectively encode the heavy chain CDR1 of SEQ ID NO: 4, the heavy chain CDR2 of SEQ ID NO: 5 and the heavy chain CDR3 of SEQ ID NO: DNA coding region; A DNA encoding a double-target antibody that specifically binds to SCF and galectin-1.

In the present invention, the DNA encoding the light chain variable region may be characterized by being represented by SEQ ID NO: 16.

In addition, in the present invention, the DNA encoding the heavy chain variable region may be characterized by being represented by SEQ ID NO: 17.

In addition, in the present invention, the DNA encoding the double-target antibody may be characterized by being represented by SEQ ID NO: 18.

Considering the mutation having the above-mentioned biological equivalent activity, the antibody of the present invention or the nucleic acid molecule encoding the same is interpreted as including a sequence showing substantial identity with the sequence described in the sequence listing. The above substantial identity is obtained by aligning the sequence of the present invention with any other sequence as much as possible and analyzing the aligned sequence using algorithms commonly used in the art, Homology, more preferably 70% homology, even more preferably 80% homology, and most preferably 90% homology. Alignment methods for sequence comparison are known in the art.

As used herein, the term " nucleic acid molecule " is meant to encompass both DNA (gDNA and cDNA) and RNA molecules. Nucleotides that are basic building blocks in nucleic acid molecules include not only natural nucleotides, analogue). The nucleic acid molecule sequences encoding the heavy chain variable region and the light chain variable region of the present invention may be modified. Such modifications include addition, deletion or non-conservative substitution or conservative substitution of nucleotides.

Nucleic acid molecules of the invention that encode the dual target antibodies of the invention are also contemplated to include nucleotide sequences that exhibit substantial identity to the nucleotide sequences described above. The above substantial identity can be determined by aligning the nucleotide sequence of the present invention with any other sequence as much as possible and analyzing the aligned sequence using algorithms commonly used in the art to obtain 80% Or 95% homology with the nucleotide sequence of SEQ ID NO: 1.

The present invention also provides a vector comprising the DNA and a cell transformed with the vector.

As used herein, the term " vector " refers to a plasmid vector as a means for expressing a gene of interest in a host cell; Cosmeptide vector; And viral vectors such as bacteriophage vectors, adenovirus vectors, retroviral vectors, and adeno-associated viral vectors.

The DNA encoding the dual target antibody in the vector of the present invention may be operatively linked to a promoter.

As used herein, the term " operably linked " means a functional linkage between a nucleic acid expression control sequence (e.g., an array of promoter or transcription factor binding sites) and another nucleic acid sequence, Thereby controlling the transcription and / or translation of the different nucleic acid sequences.

The recombinant vector system of the present invention can be constructed through various methods known in the art and can typically be constructed as a vector for cloning or as a vector for expression. In addition, the vector of the present invention can be constructed by using prokaryotic cells or eukaryotic cells as hosts.

On the other hand, the expression vector of the present invention may include an antibiotic resistance gene commonly used in the art as a selection marker, and the antibiotic resistance gene may be selected from the group consisting of ampicillin, gentamycin, carbenicillin, chloramphenicol, streptomycin, kanamycin Neotymine, neomycin, and tetracycline.

Further, in the present invention, the cells may be bacteria or animal cells.

The cells transformed with the above-mentioned vector are host cells capable of continuously cloning and expressing the vector of the present invention stably, and any host cell known in the art can be used. For example, suitable eukaryotic host cells of the vector may be selected from the group consisting of monkey kidney cells (COS7), NSO cells, SP2 / 0, Chinese hamster ovary (CHO) cells, W138, baby hamster kidney cells, MDCK, myeloma cell lines, HuT 78 cells and HEK-293 cells, preferably CHO cells, but are not limited thereto.

The present invention also provides a pharmaceutical composition for preventing or treating an angiogenesis-related disease comprising a double-target antibody that specifically binds to SCF and galectin-1 of the present invention.

Since the pharmaceutical composition of the present invention uses the above-mentioned double-target antibody or antigen-binding fragment thereof of the present invention as an active ingredient, the content common to both of them is that, in order to avoid the excessive complexity of the present specification by the repeating substance, .

In the present invention, the angiogenesis-related disease refers to a disease caused by the formation of blood vessels. The angiogenesis-related diseases of the present invention are useful as medicaments for treating or preventing angiogenesis-related diseases, rheumatoid arthritis, psoriasis, cancer, metastasis, delayed wound healing, chronic inflammation, Atherosclerosis, stenosis, vascular malformation, vascular access dysfunction in patients with hemodialysis, transplant arteriopathy, vasculitis, DiGeorge syndrome, hereditary hemorrhagic telangiectasia, cavernous malformation, keloid scar, pyogenic granuloma, blister, Kaposi < RTI ID = 0.0 > sarcoma Kaposi's sarcoma, proliferative vitreoretinopathy, primary pulmonary hypertension, asthma, nasal polyps, inflammation Inflammatory bowel disease, Inflammatory Bowel Disease, periodontal disease, ascites, peritoneal adhesion, endometriosis, uterine bleeding, ovarian cyst, ovarian stimulation syndrome Osteoporosis, ovarian hyperstimulation syndrome, synovitis, osteomyelitis, osteophyma, sepsis, infectious disease and autoimmune disease, But it is not necessarily limited thereto.

In the present invention, the intraocular-vessel-related diseases include macular degeneration, age-related macular degeneration, diabetic retinopathy, choroidal neovascularization, glaucoma Retinopathy of prematurity, glaucoma, corneal dystrophy, and retinoschisis, and preferably retinopathy of prematurity, retinopathy of prematurity, retinopathy of prematurity, retinopathy of prematurity, retinopathy of prematurity, retinopathy of prematurity, Lt; / RTI >

As demonstrated in the following examples, the dual target antibodies of the present invention can inhibit angiogenesis of vascular endothelial cells, and are effective for the prevention or treatment of angiogenesis-related diseases.

The pharmaceutically acceptable carriers to be contained in the pharmaceutical composition of the present invention are those conventionally used in the present invention and include lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, But are not limited to, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrups, methylcellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. It is not. The pharmaceutical composition of the present invention may further contain a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, a preservative, etc., in addition to the above components. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington ' s Pharmaceutical Sciences (19th ed., 1995).

The pharmaceutical composition of the present invention may be administered parenterally and may be administered, for example, by intravenous infusion, subcutaneous injection, muscle injection, intraperitoneal injection, topical administration, intranasal administration, intrapulmonary administration and rectal administration.

The appropriate dosage of the pharmaceutical composition of the present invention varies depending on factors such as the formulation method, the administration method, the age, body weight, sex, pathological condition, food, administration time, administration route, excretion rate and responsiveness of the patient, Usually, a skilled physician can readily determine and prescribe dosages effective for the desired treatment or prophylaxis. For example, the daily dosage of the pharmaceutical composition of the present invention may be 0.0001-100 mg / kg. As used herein, the term "pharmaceutically effective amount" means an amount sufficient to prevent or treat an angiogenesis-related disorder.

The pharmaceutical composition of the present invention may be formulated into a unit dosage form by using a pharmaceutically acceptable carrier and / or excipient according to a method which can be easily carried out by those having ordinary skill in the art to which the present invention belongs. Or by intrusion into a multi-dose container. The formulations may be in the form of solutions, suspensions or emulsions in oils or aqueous media, or in the form of excipients, powders, suppositories, powders, granules, tablets or capsules, and may additionally contain dispersing or stabilizing agents.

In addition, the pharmaceutical composition of the present invention can be used in combination with or in combination with other therapeutic agents targeting VEGF, and thus there may be synergistic effects such as more effective inhibition of abnormal angiogenesis. The therapeutic agent targeting VEGF may be, but is not limited to, eilea, Aafibercept or lucentis (Ranibizumab).

The present invention also relates to a method for the treatment of SCF and galectin-1 comprising administering to a subject in need thereof a double-target antibody specifically binding to SCF and galectin-1 according to the present invention; And a method for preventing or treating an angiogenesis-related disease.

The subject is preferably a mammal, including a human, and is a patient in need of treatment for an angiogenesis-related disease, a patient undergoing treatment for angiogenesis-related diseases, a patient suffering from an angiogenesis-related disease, And patients who underwent surgical procedures for the treatment of angiogenesis-related diseases may also be included. By administering the pharmaceutical composition according to the present invention to an individual, angiogenesis-related diseases can be alleviated or treated.

As used herein, the term " alleviation " refers to any action that alleviates or benefits an angiogenesis-related disorder by administration of a pharmaceutical composition in accordance with the present invention. The pharmaceutical composition of the present invention is administered in a pharmaceutically effective amount.

As used herein, the term " administering " refers to introducing a pharmaceutical composition of the present invention to a subject by any suitable method, and the administration route may be administered through various routes of oral or parenteral administration, .

 In addition, the pharmaceutical composition for preventing or treating angiogenesis-related diseases comprising a double-target antibody specifically binding to SCF and galectin-1 according to the present invention can be used as a medicament for the treatment of other angiogenesis- And can be simultaneously / sequentially processed. Such administration may be single or multiple administrations. It is important to take into account all of the above factors and to administer the amount in which the maximum effect can be obtained in a minimal amount without adverse effect, and can be easily determined by those skilled in the art.

The present invention also relates to a method for the treatment of SCF and galectin-1 comprising administering to a subject in need thereof a double-target antibody specifically binding to SCF and galectin-1 according to the present invention; A method for inhibiting angiogenesis.

Specifically, the method relates to a method of inhibiting SCF and galectin-1-induced angiogenesis by simultaneously neutralizing galectin-1 as well as SCF. This method inhibits c-kit phosphorylation by SCF and inhibits phosphorylation of AKT and ERK, the down-stream signaling pathways, resulting in the tube formation of SCF and galectin-1-induced vascular endothelial cells It can be a method of effectively suppressing the effect.

The present invention also provides a composition for simultaneous detection of SCF and galectin-1 comprising dual target antibodies specifically binding to SCF and galectin-1 according to the present invention, and a kit comprising said composition.

The detection composition and kit of the present invention include the double-target antibody or antigen-binding fragment thereof of the present invention described above, and it is possible to simultaneously detect the binding specifically to SCF and galectin-1.

Since the detection composition and kit of the present invention include an antibody, they can be basically prepared for various immunoassays or immunostaining. The immunoassay or immunostaining can be carried out by radioimmunoassay, radioimmunoprecipitation, immunoprecipitation, enzyme-linked immunosorbent assay (ELISA), capture-ELISA, inhibition or competition assay, sandwich assay, flow cytometry, But are not limited to, immunoaffinity purification.

Samples that can be applied to the detection composition and kit of the present invention include, but are not limited to, cell, tissue or tissue-derived extract, lysate or purified water, blood, plasma, serum, lymph or ascites.

Hereinafter, preferred embodiments of the present invention will be described in detail to facilitate understanding of the present invention. However, the following examples are for illustrative purposes only and are not intended to limit the scope of the invention.

Example  One. SCF  And Galectin -1 Target  Production of double target antibody-producing cell line

1-1. Immunization of mice

The emulsion was prepared by mixing 50 ug of the recombinant SCF (Stem Cell Factor) protein (cat # 7466-SC) purchased from R & D systems with the same volume of Freund's Adjuvant (Sigma, USA) standard). The emulsion was injected into the abdominal cavity of 4 humanized NSG mice prepared by 7-week-old female human CD34 + cell injection. Then, each mouse was injected with 50 占 퐂 of antigen into a total volume of 500 占 퐇 to induce antibody production. After one week and two weeks thereafter, an emulsion mixed with an incomplete Prunts Ajvant (Sigma, USA) and an antigen, respectively, was injected into the abdominal cavity of the mice.

1-2. Identification and screening of antibody-producing cells

Blood was collected from the eye of the immunized mouse through the above method and placed in a 1.5 ml microcentrifuge tube and centrifuged at 13,000 rpm for 10 minutes. Serum was separated and stored at -20 ° C until experiments to confirm antibody formation were performed. Enzyme immunoassay using an antigen protein was performed to confirm whether or not an antibody had been generated. Then, three days before the cell fusion, an emulsion prepared by mixing incomplete Pronto Ajvant (Sigma, USA) and an antigen was injected into the abdominal cavity of a mouse.

1-3. Hybrid  Produce

After confirming antibody production, mice were sacrificed to isolate spleen cells and fused with myeloma cells P3X63Ag8.653 (ATCC CRL-1580) to prepare hybridomas.

First, P3X63Ag8.653 cells of the mice were cultured in a culture plate using RPMI1640 medium supplemented with 10% fetal bovine serum. For cell fusion, P3X63Ag8.653 cells were washed twice with serum-free RPMI1640 medium (Hyclone, USA) and adjusted to a concentration of 1 × 10 ⁷ cells. Mice were sacrificed by cervical dislocation and the spleens were collected and then placed in a mesh vessel (Sigma, USA) to separate the cells. After preparing a suspension of splenocytes, the suspension was washed with centrifugation. The spleen cell solution was exposed to Tris-NH ₄ Cl (Tris 20.6 g / L, NH ₄ Cl 8.3 g / L) to lyse red blood cells. The completely separated antibody-producing cells were centrifuged at 400 xg for 5 minutes, washed twice in serum-free medium and resuspended in 10 ml medium. Lymphocytes were counted using a hemocytometer and 1 x 10 ⁸ of lymphocytes were mixed with 1 x 10 (10: 1) of P3X63Ag 8.653 cells in serum-free medium. The centrifugation was carried out at 400 xg for 5 minutes. Then, 1 ml of 50% (M / V) polyethylene glycol 1500 (Sigma, USA) warmed at 37 ° C) was slowly added for 1 minute and mixed.

The fusion mixture prepared above was diluted with serum-free RPMI 1640 and centrifuged at 400 xg for 3 minutes. Cells were suspended in 35 ml of RPMI 1640 selection medium supplemented with 20% fetal bovine serum and HAT (100 uM hypoxanthine, 0.4 uM aminopterin, 16 uM thymidine). 100ul of the suspension was loaded on a 96-well plate coated with feeder cells (macrophages separated from abdominal cavity using RPMI1640) 1 day ago and cultured at 37 占 폚 and 5% CO ₂ . After 5 days, the HAT medium was replaced every 2-3 days and the cells were cultured for 14 days. After 14 days, RPMI1640 medium supplemented with 20% fetal bovine serum and HT (medium in which 0.4 uM aminopterin was removed from HAT) was replaced and secondary cultured. The supernatant of hybridoma colonies obtained by fusing lymphocytes isolated from SCF-immunized lymph nodes with myeloma cells was used in the subsequent experiments.

1-4. Selection and isolation of antibody-producing fusion cells

The supernatants of the hybridoma colonies prepared in Examples 1-3 were collected and subjected to enzyme immunoassay to confirm the production of antibodies specific to the antigen produced. The culture medium of the fusion cells showing a proper concentration of 4 times or more as compared with the negative control was selected, and the culture was transferred to a 24-well culture plate. In addition, the cells were cultured by limiting dilution so that one cell was contained per well in a 96-well plate, and the culture was recovered. Then, the SCF protein used as an antigen was coated on the 96-well plate at 0.1 ug / well, and enzyme immunoassay was performed. As a result, an optical density (OD value) was measured at a wavelength of 450 nm to finally select fusion cells producing 9 monoclonal antibodies (3C6, 3A2, 3C3, 3A4, 3E7, 3C8, 3C4, 3F7 and 3F3) . This is shown in FIG.

Example  2. Of the dual target antibody SCF Neutralization ability  decision

SCU (50 ng / ml) or SCF (50 ng / ml) + anti-SCF antibody (10 ug / ml) were added to a 12-well plate after the addition of 300 ul of Matriegel (Corning, USA) ml) were mixed with each other, and the tubes were divided into matrigel to observe the tube formation of HUVEC in vitro (n = 10). The results are shown in Fig.

As shown in Fig. 2, it was confirmed that 3C3 and 3C4 antibodies among 9 mAbs effectively inhibited SCF-induced tube formation of HUVEC. From the above results, it was confirmed that the 3C3 and 3C4 antibodies of the present invention can be used for preventing or treating angiogenesis-related diseases by inhibiting angiogenesis.

Example  3. IgG  Sequence analysis of variable region

3-1. CDNA synthesis from fused cells

Total RNA was isolated from 5 X 10 ⁵ clones of 3C4 fusion cells obtained in Examples 1 and 2, and then subjected to reverse transcription using a random primer (bioneer, Korea) and a reverse transcriptase.

3-2. mouse IgG  Variable domain PCR  Amplification

For the cDNA obtained by the reverse transcription reaction, the corresponding regions of the light and heavy chains of the antibody were amplified using variable region specific primers. The primers used are shown in Table 1 below.

Kinds	The sequence (5'-3 ')	SEQ ID NO:
Light chain	CAGCTCCTGGGGCTGCTAATGCTCTGG (forward direction)	19
	CAGTTGCTAACTGTTCCGTGGATG (reverse direction)	20
Heavy chain	ATGGARTTGGGGCTGWGCTGGGTTTT (forward direction)	21
	ACTTTTGAGAGCAGTTCCAGGAGC (Reverse)	22

First, the kappa light chain domain was amplified from cDNA using the primers shown in SEQ ID NOS: 1 and 2. The amplified DNA was confirmed by agarose gel electrophoresis and the results are shown in FIG. In addition, the IgG1 heavy chain domain was amplified from cDNA using the primers shown in SEQ ID NOS: 3 and 4. Similarly, the amplified DNA was confirmed by agarose gel electrophoresis, and the results are shown in FIG.

As shown in Figures 3 and 4, bands were found between the kappa light chain domain (414 bp) and the heavy chain domain (483 bp), confirming the expected size of the PCR product. No PCR products were detected in other PCRs used as negative controls.

Thereafter, the PCR product was developed on an agarose gel, the band was cut, the agarose gel was dissolved at 60 ° C, and DNA was purified using a spin column (Qiagen). The purified DNA was cloned into TOPO-TA vector (Invitrogen), transformed into E. coli DH5a, and colonies were obtained. After culturing the colonies, the plasmid was extracted and PCR was performed again. As a result, 4 plasmids were obtained, Was carried out. The sequences identified through sequencing are shown in Table 2. Sequence analysis showed that the 3C3 clone had the same nucleotide sequence as the 3C4 clone. The base sequence, amino acid sequence and CDR region thereof of the 3C4 antibody are shown in Fig. 5 and Fig.

As shown in Fig. 5, the light chain of 3C4 includes CDR1 (SEQ ID NO: 1), CDR2 (SEQ ID NO: 2) and CDR3 (SEQ ID NO: 3) of the light chain in blue letter order, (SEQ ID NO: 4), CDR2 (SEQ ID NO: 5) and CDR3 (SEQ ID NO: 6) of the heavy chain in order of blue letters.

The light chain amino acid sequence of 3C4 is shown in SEQ ID NO: 7, the heavy chain amino acid sequence is shown in SEQ ID NO: 8, and the entire amino acid sequence of 3C4 is shown in SEQ ID NO: The light chain (SEQ ID NO: 16) and heavy chain (SEQ ID NO: 17) base sequences of 3C4 are shown in Table 2, and the whole nucleotide sequence of 3C4 is shown in SEQ ID NO:

Kinds	The sequence (5'-3 ')	SEQ ID NO:
Light chain	GAT GTT GTG ATG ACT CAG TCT CCA CTC TCC CTG CCC GTC ACC CTT GGA CAG CCG GCC TCC ATC TCC TGC AGG TCT AGT CAA AGC CTC GTA TAC AGT GAT GGA AAC ACC TAC TTG AAT TGG TTT CAG CAG AGG CCA GGC CAA TCT CCA AGG CGC CTA ATT TAT AAG GTT TCT AAC CGG GAC TCT GGG GTC CCA CAG AGA TTC AGC GGC AGT GGG TCA GGC ACT GAT TTC ACA CTG AAA ATC AGC AGG GTG GAG GCT GAG GAT GTT GGG GTT TAT TAC TGC ATG CAA GGT ACA CAC TGG CCT CTT TCG GCG GAG GGA CCA AGG TGG AGA TCA AAC	16
Heavy chain	CAG GTG CAG CTG GTG GAG TCT GGG GGA GGC GTG GTC CAG CCT GGG AGG TCC CTG AGA CTC TCC TGT GTA GCG TCT GGA TTC ACC TTC AGT AGC TAT GGC ATG CAC TGG GTC CGC CAG GCT CCA GGC AAG GGG CTG GAC TGG GTG GCA GTT ATA TGG TAT GAT GGA AGT AAT AAC GAC TAT GCA GAC TCC GTG AAG GGC CGA TTC ACC ATC TCC AGA GAC AAT TCC AAG AAC ACA CTG TAT CTA CAA ATC AAC AGC CTG AGA GCC GAG GAC ACG GCT GTA TAT TAC TGT GCG AGA GGG CAA AAT TAC TAT GGT TTG GGG AGT TAT TTC TTT GAC TAC TGG GGC CAG GGA ACC CTG GTC ACC	17
- Bold and underlined parts are CDR (Complementarity determining region) sequences, which in turn show CDR1, CDR2 and CDR3 sequences.

Example  4. Human Antibody Cloning

The variable domain of the anti-SCF antibody 3C4 (hereinafter 3C4) obtained in Example 3 was grafted to a human Fc amino acid sequence and cloned into a pCHO vector (lifetechnology).

The light chain variable domain was fused within the frame for the human kappa constant region and the heavy chain variable domain was fused within the frame for the human IgG1 constant region. The leader peptide sequence for secretion of the full length IgG1 antibody into the medium was added to the two genes and the gene was synthesized and verified again by sequencing. Three clones were selected for expression testing in CHO cells. Glycerol stocks were prepared for three clones and plasmid DNA without endotoxin was prepared for expression testing in CHO cells.

Example  5. CHO  Isolation and purification of antibodies after transfection into cells

The plasmid DNA obtained in Example 4 was transfected into CHO-S cells. One week before transfection, CHO-S (Invitrogen, 10743-029) was transferred into monolayer cultures in DMEM supplemented serum. One day before transfection, the cells were dispensed and DNA-lipofectamine complexes were prepared for the transfected samples. The cells were incubated overnight at 37 ° C in 5% CO ₂ in the incubator. After incubation for one week with adding the medium once every 2-3 days, the culture was recovered and bound to Protein A / G agarose (company) And washed with PBS. Then, the mixture was eluted with 0.1 M glycine (pH 2.8) and then neutralized with 1 M Tris-HCl (pH 8.0). Again, dialysis was performed with PBS and stored at -70 ° C. The results are shown in Fig.

As shown in FIG. 7, SDS-PAGE showed that a heavy chain of about 50 kDa and a light chain band of about 25 kDa were observed. Thus, it was confirmed that the antibody was correctly synthesized and produced.

Example  6. 3C4  Verification of antibody affinity

SPR (Surface Plasmon Resonance) was performed to accurately confirm the ability of the 3C4 antibody of the present invention to bind to SCF through quantification. After 20 ug of the human antigen SCF protein used for antibody production was fixed on a PEG (Reichert, USA) chip using SR7500DC (Reichert, USA), the anti-SCF antibody of the present invention was added to each concentration (0, 7.8125 nM, 15.625 nM , 31.25 nM, 62.5 nM, 125 nM, 250 nM, 500 nM, 1 uM and 2 uM). The K _D value, which is an affinity for the SCF, was analyzed using the Scrubber2 program, and the result is shown in FIG. The K _D value is the value obtained by dividing the kd value by the ka value.

As shown in FIG. 8, the K _D value was about 18.8 ± 2 × 10 ^-9 M, confirming that the 3C4 antibody of the present invention showed a strong affinity for SCF.

Example  7. 3C4  Antibody SCF  Induced angiogenesis Inhibition  Revalidation

HUVEC was mixed with SCF (50 ng / ml) or SCF (50 ng / ml) + 3C4 antibody (10 ug / ml) and dispensed onto a matrigel. Thereafter, tube formation of HUVEC was observed (n = 10) and the results are shown in Fig.

As shown in Fig. 9, it was confirmed that the 3C4 antibody of the present invention effectively inhibited the tube formation of HUVEC induced by SCF. From the above results, it was confirmed that the 3C4 antibody of the present invention can be used for preventing or treating angiogenesis-related diseases by inhibiting angiogenesis.

Example  8. 3C4  Antibody SCF  Of c-kit phosphorylation inhibition

^Four 6 x 10 cells were cultured for 12 hours, then serum depleted for 4 hours, the 3C4 antibody of the present invention was pretreated for 15 minutes, treated with SCF, and harvested. Western blot analysis revealed that 3C4 antibody effectively inhibited signaling by SCF through c-Kit expression. The results are shown in Fig.

As shown in FIG. 10, the 3C4 antibody of the present invention not only inhibits c-kit phosphorylation by SCF by effectively neutralizing SCF but also affects the down-stream signaling pathway, resulting in phosphorylation of AKT and ERK Respectively.

Example  9. Protein Microarray  Through analysis SCF  And Galectin -1

Protein microarray analysis was performed using a HuProt ^TM v3.1 human proteome microarray (CDI laboratories) protein chip. First, the protein chip was blocked with PBST (pH 7.4) containing 2% BSA and 0.1% Tween 20 at room temperature for 2 hours. 2 ug of biotinylated 3C4 antibody was dissolved in PBST (pH 7.4) containing 2% BSA and 0.1% Tween 20, followed by binding at 4 ° C for 8 hours, followed by washing three times with PBST. 1 ug (18.9 pmol) of Streptavidin-fluorescence (Alexa-Fluor 532 nm) was spiked onto the protein chip, bound at 4 ° C for 1 hour, and then washed three times with PBST. The remaining buffer solution was completely removed and the protein chip was frozen at -20 ° C and scanned with a GenePix4100A microarray laser scanner (Molecular Devices). The results are shown in Fig.

As shown in Fig. 11, it was confirmed that the 3C4 antibody of the present invention shows a high binding force against Galectin-1 (LGALS1) in addition to SCF.

Example  10. 3C4  Antibody Galectin Affinity test for -1

SPR (Surface Plasmon Resonance) was performed to accurately confirm the ability of the 3C4 antibody of the present invention to bind galectin-1 through quantification. First, the human galectin-1 (NP_002296.1) gene was cloned into NdeI / BamHI of pET-3a and overexpressed in E. coli. The gene was separated and purified by ion-exchange chromatography, dialyzed with PBS and stored at -70 ° C. Respectively. Purified samples were used to confirm that the protein was galectin-1 by SDS-PAGE. The results are shown in Fig.

Next, 20 ug of the human antigen galectin-1 protein was immobilized on a PEG (Reichert, USA) chip using SR7500DC (Reichert, USA), and then the 3C4 antibody of the present invention was added to each concentration (0, 23.4375 nM, 46.875 nM, nM, 187.5 nM, 375 nM, 750 nM, 1.5 uM, 3 uM, and 6 uM). The K _D value, which is affinity for Galectin-1, was analyzed using the Scrubber2 program, and the results are shown in FIG.

As shown in FIG. 13, the K _D value was about 46.9 ± 9 × 10 ^-9 M, confirming that the 3C4 antibody of the present invention showed strong affinity for galectin-1 as well as SCF.

Example  11. Galectin -Induced induction of angiogenesis Inhibition  Verification

(5 ug / ml) or galectin-1 (5 ug / ml) + 3C4 antibody (5 ug / ml or 10 ug / ml) was mixed with 300 μl of Matrigel (Corning, USA) And then dispensed onto a matrigel. Thereafter, tube formation of HUVEC was observed (n = 10) and the results are shown in Fig.

As shown in FIG. 14, it was confirmed that the 3C4 antibody of the present invention effectively inhibited the tube formation of HUVEC induced by galectin-1. From the above results, it was confirmed that the 3C4 antibody of the present invention can be used for preventing or treating angiogenesis-related diseases by inhibiting galectin-1-induced angiogenesis as well as SCF as a dual target antibody.

Example  12. SCF  And galectin -1 cell proliferation Inhibition  Verification

5 X 10 ³ HUVEC cells were plated in 96-well plates and cultured for 12 hours using EGM2 medium. Then, the 3C4 antibody of the present invention was treated to inhibit cell proliferation by SCF and galectin-1 using a Celigo Imaging cytometer (Nexcelom Bioscience) and the number of cells was confirmed by Hoechst staining. The results are shown in Fig.

As shown in Fig. 15, it was confirmed that the proliferation of HUVEC induced by SCF and galectin-1 was inhibited in a concentration-dependent manner upon 3C4 antibody treatment. From the above results, it was once again confirmed that the 3C4 antibody of the present invention effectively inhibited galectin-1-induced angiogenesis as well as SCF.

Comparative Example  1. The present invention 3C4  Antibodies and R & D systems polyclonal  Antibody Neutralization ability  compare

Experiments were conducted to compare the neutralizing ability of the commercially available SCF antibody with the 3C4 antibody of the present invention. 300 [mu] l of Matrigel (Corning, USA) was dispensed into a 12-well plate and allowed to stand for 5 minutes to harden. HUVEC was mixed with SCF (50 ng / ml), SCF (50 ng / ml) + 3C4 antibody or anti-SCF polyclonal antibody of R & D systems (cat #, AF-255-NA) and concentration on matrigel. Thereafter, tube formation of HUVEC was observed (n = 7) and the results are shown in Fig. 16 (* p < 0.05).

As shown in FIG. 16, the 3C4 antibody of the present invention was found to have a significantly higher inhibitory effect on the tube formation of HUVEC induced by SCF than the anti-SCF polyclonal antibody of R & D systems at all concentrations. Through the above comparative example, it was once again confirmed that the use of the 3C4 antibody of the present invention significantly inhibited the angiogenesis of the angiogenesis-related diseases, as compared with the commercially available SCF antibody.

Vascular endothelial growth factor (VEGF) is a major therapeutic target for ocular vascular disease, but about 20% of patients are required to develop new therapeutic agents with no VEGF response. As shown in the above Examples and Comparative Examples, the double target antibody of the present invention specifically binds to SCF (Stem Cell Factor) and galectin-1 and is induced by SCF and galectin-1 In addition to effectively inhibiting angiogenesis, it is anticipated that effective treatment of patients who are unresponsive to existing therapies is possible and that co-administration with existing drugs targeting VEGF can effectively inhibit abnormal angiogenesis .

Although the present invention has been described in terms of the preferred embodiments mentioned above, it is possible to make various modifications and variations without departing from the spirit and scope of the invention. It is also to be understood that the appended claims are intended to cover such modifications and changes as fall within the scope of the invention.

Claims (17)

1. A double-target antibody specifically binding to SCF (Stem Cell Factor) and galectin-1 (Galectin-1)

   A light chain variable region comprising a light chain CDR1 represented by the amino acid sequence of SEQ ID NO: 1, a light chain CDR2 represented by the amino acid sequence of SEQ ID NO: 2, and a light chain CDR3 represented by the amino acid sequence of SEQ ID NO: 3; And a heavy chain variable region comprising the heavy chain CDR1 represented by the amino acid sequence of SEQ ID NO: 4, the heavy chain CDR2 represented by the amino acid sequence of SEQ ID NO: 5, and the heavy chain CDR3 represented by the amino acid sequence of SEQ ID NO: Target antibody.
2. The dual target antibody of claim 1, wherein the antibody comprises a light chain variable region represented by the amino acid sequence of SEQ ID NO: 7 or a heavy chain variable region represented by the amino acid sequence of SEQ ID NO: 8.
3. The dual target antibody of claim 1, wherein said antibody is represented by the amino acid sequence of SEQ ID NO: 9.
4. The dual target antibody of claim 1, wherein the antibody comprises a human IgG1-derived constant region.
5. A light chain variable region comprising the nucleotide sequence of SEQ ID NO: 10, SEQ ID NO: 11 and SEQ ID NO: 12, respectively encoding light chain CDR1, light chain CDR2 of SEQ ID NO: 2 and light chain CDR3 of SEQ ID NO: 3, &Lt; / RTI &gt; And a heavy chain variable region comprising the nucleotide sequence of SEQ ID NO: 13, SEQ ID NO: 14 and SEQ ID NO: 15, which respectively encode the heavy chain CDR1 of SEQ ID NO: 4, the heavy chain CDR2 of SEQ ID NO: 5 and the heavy chain CDR3 of SEQ ID NO: DNA coding region; DNA encoding a double-target antibody that specifically binds to SCF and galectin-1.
6. 6. The double-target antibody-encoding DNA of claim 5, wherein the DNA encoding the light chain variable region is represented by SEQ ID NO: 16.
7. 6. The DNA of claim 5, wherein the DNA encoding the heavy chain variable region is represented by SEQ ID NO: 17.
8. 6. The double-target antibody-encoding DNA of claim 5, wherein the DNA encoding the double-target antibody is represented by SEQ ID NO: 18.
9. 9. A vector comprising the DNA of any one of claims 5 to 8.
10. A cell transformed with the vector of claim 9.
11. 11. The cell of claim 10, wherein the cell is a bacterial or animal cell.
12. A pharmaceutical composition for preventing or treating an angiogenesis-related disease comprising a double-target antibody that specifically binds to SCF and galectin-1 of claim 1.
13. The method according to claim 12, wherein the angiogenesis-related diseases are selected from the group consisting of ocular-related diseases, rheumatoid arthritis, psoriasis, cancer, metastasis, delayed wound healing, (eg, chronic inflammation, atherosclerosis, stenosis, vascular malformation, vascular access dysfunction in patients with hemodialysis, transplant arteriopathy, vasculitis diabetic retinopathy, vasculitis, DiGeorge syndrome, hereditary hemorrhagic telangiectasia, cavernous malformation, keloid scar, pyogenic granuloma, blister disease, Kaposi's sarcoma, proliferative vitreoretinopathy, primary pulmonary hypertension, asthma, nasal polyposis, inflammatory bowel disease, periodontal disease, ascites, peritoneal adhesion, endometriosis, uterine bleeding, ovarian cysts, ovarian cysts, , Ovarian hyperstimulation syndrome, synovitis, osteomyelitis, osteophyma, sepsis, infectious disease, and autoimmune disease. &Lt; / RTI &gt; or a pharmaceutically acceptable salt thereof.
14. 14. The method of claim 13, wherein the ocular-related disease is selected from the group consisting of macular degeneration, age-related macular degeneration, diabetic retinopathy, choroidal neovascularization, Characterized in that it is at least one selected from the group consisting of glaucoma retinitis igmentosa, retinopathy of prematurity, glaucoma, corneal dystrophy and retinoschisis. Or a pharmaceutically acceptable salt thereof.
15. 13. The pharmaceutical composition according to claim 12, wherein the double-target antibody inhibits angiogenesis.
16. Administering a double-target antibody specifically binding to SCF and galectin-1 of claim 1 to a subject in need thereof; Or a pharmaceutically acceptable salt thereof.
17. A composition for simultaneous detection of SCF and galectin-1 comprising dual target antibodies specifically binding to SCF and galectin-1 of claim 1.

Images