WO2019088208A1 - Model of human non-alcoholic steatohepatitis - Google Patents

Abstract

A model of human non-alcoholic steatohepatitis which comprises an animal obtained by feeding a chimeric rodent, in which hepatocytes have been partially or totally substituted by human hepatocytes, with an adjusted feed having one or more characteristics selected from among: (a) the content of choline or a salt thereof being 0.01 wt% or less relative to the total amount of the adjusted feed; (b) the content of methionine being 0.5 wt% or less relative to the total amount of the adjusted feed; and (c) the fat content being 25 kcal% or more relative to the total calorie value of proteins, carbohydrates and fats contained in the adjusted feed. This model stably exhibits the symptoms of human non-alcoholic steatohepatitis.

Description

Human non-alcoholic steatohepatitis model

The present invention provides a human non-alcoholic steatohepatitis model obtained by subjecting rodents to a specific treatment, and a method of using a rodent animal subjected to a specific treatment as a human non-alcoholic steatohepatitis model The present invention relates to a method for producing this model, and a method for screening a preventive, ameliorating or therapeutic agent for human non-alcoholic steatohepatitis using this model.

The causes of liver disease include hepatitis virus, alcohol, autoimmunity, primary biliary cholangitis, etc., obesity, diabetes, hypertriglyceridemia, excessive nutrition intake by long-term parenteral nutrition, endocrine disorder, low beta There are known lifestyle habits and lifestyle-related diseases such as lipoproteinemia, starvation and re-replenishment syndromes. In recent years, non-alcoholic fatty liver disease (NAFLD) caused by lifestyle habits has been increasing and becoming a problem. NAFLD includes simple fatty liver where fats are deposited in hepatocytes, and non-alcoholic steatohepatitis (NASH) in which inflammation occurs and fibrosis progresses with hepatic steatosis. Unlike simple fatty liver, NASH progresses to liver cirrhosis and liver cancer, so elucidation of the progress mechanism from simple fatty liver to NASH and accurate discrimination between the two are particularly serious issues.

Research on the mechanism of onset of NASH and research on prevention or treatment of NASH requires an animal model showing NASH symptoms. Conventionally, rats reared on choline and methionine deficient feed are known as animal models of NASH (Non-patent Document 1). However, the decrease in muscle mass causes weight loss, making it difficult to use for continuous observation of NASH symptoms and drug efficacy evaluation.
It is also known that NASH can be induced by rearing rats with a choline deficient methionine-containing feed. However, the effects of species differences are strong, and even when this feed is given to mice, no fibrosis characteristic of NASH is observed (Non-patent Document 1).
In addition, since the livers of these model animals are non-human animal livers, they are not animal models that completely reproduce human NASH, and their metabolic activities in the liver are also non-human animal types. Therefore, it is difficult to say that it is a model suitable for evaluating the efficacy of human NASH.

Here, Patent Document 1 prepares a primary chimeric non-human animal by implanting human hepatocytes into a liver disorder immunodeficient non-human animal to produce a primary chimeric non-human animal, and separates human hepatic cells from the liver of this primary chimeric non-human animal by collagenase perfusion method In the case of chimeric liver nonhuman animals obtained by transplantation into a new liver injury immunodeficient nonhuman animal, macroscopic lipid deposition and swelling of human hepatocytes are observed in human hepatocytes, and it is preferable to surround human hepatocytes. It is disclosed that inflammatory cells centering on neutrophils are accumulated, and a fibrotic image is also observed, exhibiting symptoms of NASH. The passage-transplanted chimeric non-human animal taught by Patent Document 1 is expected to be able to be used as an animal model reproducing human NASH because most of its liver is replaced with human hepatocytes.
However, the NASH symptom of the chimeric non-human animal taught by Patent Document 1 has low reproducibility, and it is difficult to put into practical use as an animal model to be widely used for screening of NASH therapeutic agents and the like. Moreover, in this method, in order to produce NASH by transplanting human hepatocytes, there is also a disadvantage that it is not possible to set a non-NASH group to which human hepatocytes are transplanted, that is, a control group.

International Publication 2008/001614

The present invention provides a rodent animal model that stably exhibits human NASH symptoms, a method for producing this model, a method for using rodents stably presenting human NASH symptoms as a human NASH model, and such a rat. An object of the present invention is to provide a method for screening a human NASH therapeutic agent using rodents.

The present inventors repeated studies to solve the above-mentioned problems, and chimera rodents in which a part or all of the hepatocytes were replaced with human hepatocytes were used with 0.01% by weight of choline or a salt thereof. Hereinafter, by rearing with a compounded feed in which the content of methionine is adjusted to 0.5% by weight or less and the fat content is adjusted to 25 kcal% or more, macroscopic fat deposition in the liver, as shown in the item of the example, We found that there are characteristic lesions in NASH such as fibrosis, infiltration of inflammatory cells, ballooning of hepatocytes (balloon-like swelling), and Mallory body. In particular, Ballooning, Mallory body, etc. are difficult to appear in experimental animals and the like, and are reported to be lesions specific to human NASH (PLoS One. 2014 Dec 23; 9 (12): e115922. Doi: 10.1371 /journal.pone.0115922. eCollection 2014.), it turned out that this rodent animal can be used as a model that reproduces human NASH.

In addition, the present inventor found that feeding human hepatocyte chimeric rodent animals with the above-described adjusted diet does not change the alanine transaminase (ALT) concentration of rodent animals and increases the human ALT1 concentration. The When hepatocytes are damaged, enzymes in the cytoplasm leak out of the cell and enter the blood. Because ALT is most abundant in the liver, ALT activity in blood is an indicator of liver damage. Therefore, it has been found that the above-mentioned adjusted diet can induce liver damage specifically to human hepatocytes without inducing damage to the hepatocytes of recipient animals remaining in human hepatocyte chimeric rodents. Also in this respect, it is understood that the above-mentioned adjusted feed can induce symptoms characteristic of human NASH.

In addition, it was confirmed that NASH symptoms can be reproducibly introduced by breeding human hepatocyte chimera rodents with the above-described adjusted diet. Therefore, it was found that human hepatocyte chimera rodents reared with the above-described adjusted feed can be put to practical use as animal models for research on the pathogenesis of NASH and drug efficacy screening.

In human hepatocyte chimera rodents, human hepatocytes engrafted in the liver function by interaction with rodent cells in other tissues or organs and hepatocytes in rodents remaining in the liver. Do. For this reason, there is a possibility that mouse hepatocytes and human hepatocytes have different sensitivities to various disorders, and it is often difficult to specifically damage human hepatocytes. For example, as shown in the Examples section, inflammation and fibrosis prepared by administering carbon tetrachloride (CCl ₄ ) to normal mice are generally used as a hepatitis or cirrhosis model, but human liver It is difficult to obtain a hepatitis or cirrhosis model due to human hepatocyte injury, since administration of CCl ₄ to cell chimeric mice causes much more damage and necrosis to mouse hepatocytes than human hepatocytes.
Under such circumstances, it was possible to specifically damage human hepatocytes and strongly express human NASH characteristic lesions by giving human hepatocyte chimeric rodents the above-mentioned adjusted diet. It is surprising.

Also, as described in Non-Patent Document 1, there are species differences among rodents in induction of lesions by adjusted diets. Also in this respect, it is surprising that administration of the adjusted diet was able to induce NASH in the livers of human hepatocytes-replaced rodents.

The present invention has been completed based on the above findings, and provides the following [1] to [14].
[1] A chimeric rodent animal in which part or all of hepatocytes are replaced with human hepatocytes is fed with a modified feed having one or more of the following characteristics (a), (b) and (c): Human non-alcoholic steatohepatitis model, including animals obtained by
(a) The content of choline or its salt is 0.01% by weight or less based on the total amount of the adjusted feed
(b) The content of methionine is 0.5% by weight or less based on the total weight of the adjusted feed
(c) Fat content is 25 kcal% or more based on the total heat of protein, carbohydrate and fat contained in the adjusted feed [2] Chimera rodents are primary chimera rodents or passaged transplants The human non-alcoholic steatohepatitis model according to [1], which is a chimeric rodent.
[3] The human non-alcoholic steatohepatitis model according to [1] or [2], which is bred for at least one week with the adjusted feed.
[4] A chimeric rodent animal in which part or all of hepatocytes are substituted by human hepatocytes is fed with a modified feed having one or more of the following characteristics (a), (b) and (c): Using the resulting animal as a human non-alcoholic steatohepatitis model.
(a) The content of choline or its salt is 0.01% by weight or less based on the total amount of the adjusted feed
(b) The content of methionine is 0.5% by weight or less based on the total weight of the adjusted feed
(c) Fat content is at least 25 kcal% relative to the total heat of protein, carbohydrate and fat contained in the adjusted feed [5] Chimeric rodents are primary chimeric rodents or passaged transplants The method according to [4], which is a chimeric rodent.
[6] The method according to [4] or [5], which is reared for at least 1 week with the adjusted feed.
[7] A chimeric rodent animal in which part or all of hepatocytes are replaced with human hepatocytes is fed with a modified feed having one or more of the following characteristics (a), (b) and (c): A method of producing a human non-alcoholic steatohepatitis model, comprising the steps of:
(a) The content of choline or its salt is 0.01% by weight or less based on the total amount of the adjusted feed
(b) The content of methionine is 0.5% by weight or less based on the total weight of the adjusted feed
(c) Fat content is at least 25 kcal% relative to the total heat of protein, carbohydrate and fat contained in the adjusted feed [8] Chimeric rodents are primary chimera rodents or passaged transplants The method according to [7], which is a chimeric rodent.
[9] The method according to [7] or [8], which is reared for at least 1 week with the adjusted feed.
[10] A chimeric rodent animal in which part or all of hepatocytes are replaced by human hepatocytes is fed with a modified feed having one or more of the following characteristics (a), (b) and (c): Comparing the degree of symptoms of non-alcoholic steatohepatitis before and after administration with the step of administering the test substance to an animal obtained by the method comprising the step, or comparing the chimeric rodent and the test substance with the test substance administered And c. Comparing the degree of symptoms of nonalcoholic steatohepatitis with a chimeric rodent which has not been administered.
(a) The content of choline or its salt is 0.01% by weight or less based on the total amount of the adjusted feed
(b) The content of methionine is 0.5% by weight or less based on the total weight of the adjusted feed
(c) Fat content is 25 kcal% or more with respect to the total heat of protein, carbohydrate and fat contained in the adjusted feed [11] Chimera rodents are primary chimera rodents or passaged transplants The method according to [10], which is a chimeric rodent.
[12] The method according to [10] or [11], wherein the animal is reared for at least one week with the adjusted feed.
[13] A chimeric rodent animal in which part or all of hepatocytes are replaced with human hepatocytes is fed with a modified feed having one or more of the following characteristics (a), (b) and (c): Use of the animal obtained thereby as a human non-alcoholic steatohepatitis model.
(a) The content of choline or its salt is 0.01% by weight or less based on the total amount of the adjusted feed
(b) The content of methionine is 0.5% by weight or less based on the total weight of the adjusted feed
(c) Fat content of 25 kcal% or more based on the total heat of protein, carbohydrate and fat contained in the adjusted feed [14] A passage in which part or all of the hepatocytes are replaced by human hepatocytes Human simple fatty liver model including transplanted chimeric rodents.

The human NASH animal model of the present invention is different from the conventional rodent NASH model because all or part of the liver is replaced with human hepatocytes, and exhibits various symptoms characteristic of human NASH. It is a model that accurately reproduces NASH. The human NASH animal model of the present invention also demonstrates that the transplanted human hepatocytes are specifically damaged, which also exhibits the characteristic lesion of human NASH. Moreover, although the NASH model of a rodent animal having conventional human hepatocytes showed no reproducibility in NASH symptoms, the NASH symptoms in the human NASH animal model of the present invention are reproducible.
Also, human hepatocyte chimera rodents fed a normal diet have simple fatty liver but do not progress to NASH, so the human NASH animal model of the present invention is a human hepatocyte with this simple fatty liver. Chimeric rodents can be used as control animals. The present inventors have found that the primary chimeric rodent animal exhibits symptoms of simple fatty liver, and it is reported in Patent Document 1. However, the passaged chimeric chimeric rodent has simple fatty liver. It is the finding of the present invention to exhibit the symptoms of
Thus, the human NASH animal model of the present invention reproducibly forms a human NASH pathological condition, and in that it can be compared with a control animal, the NASH model using human hepatocyte chimeric rodent animal reported in Patent Document 1 It can be said that it is a better model.
From these facts, the model of the present invention can be suitably used as a pathological model animal that accurately reflects the pathological state of human NASH, for research on the onset mechanism of NASH, screening of a preventive or therapeutic agent thereof, and the like.

It is a graph which shows transition of the blood human albumin concentration at the time of rearing the passage transplant chimera mouse | mouth (human hepatocyte Lot No. BD195) by super-high fat choline deficient methionine reduction diet or a normal diet. It is a graph showing transition of human ALT activity and mouse ALT activity in plasma when passaged transplanted chimeric mice (human hepatocyte Lot No. BD 195) are fed with super-high fat choline deficient methionine reduced diet or normal diet. . Hematoxylin-eosin stained image (40 × magnification) of a liver section after feeding a passage-transplanted chimeric mouse (human hepatocyte Lot No. BD 195) with a superhigh fat choline deficient methionine reduced diet or a normal diet. FIG. 4 is a hematoxylin-eosin stained image (magnification: 400 ×) of a liver section after feeding a passage-transplanted chimeric mouse (human hepatocyte Lot No. BD195) with a superhigh fat choline deficient methionine reduced diet or a normal diet. FIG. 6 is a hematoxylin-eosin stained image (magnification: 400 ×) of a liver section after feeding a passage-transplanted chimeric mouse (human hepatocyte Lot No. IVTJFC) with a superhigh fat choline deficient methionine reduced diet or a normal diet. It is a Sirius red stained image of the liver section after rearing a passage transplant chimera mouse (human hepatocyte Lot No. BD195) by superhigh fat choline deficiency methionine reduction diet or a regular diet. It is a Sirius red stained image of a liver section after rearing a passage transplant chimera mouse (human hepatocyte Lot No. IVTJFC) by superhigh fat choline deficiency methionine reduction diet or a regular diet. The ratio of the fibrotic area calculated from the Sirius red staining image of the liver section after rearing the passage-transplanted chimeric mouse (human hepatocyte Lot No. BD 195) with super high fat choline deficient methionine reduced diet or normal diet is shown. It is a graph. It is an anti-F4 / 80 antibody immunostaining image of a liver section after rearing a passage transplant chimera mouse (human hepatocyte Lot No. BD195) by superhigh fat choline deficiency methionine reduction diet or a regular diet. Macrophage / Kupper calculated from anti-F4 / 80 antibody immunostaining image of liver section after feeding passage-transplanted chimeric mouse (human hepatocyte Lot No. BD 195) with super high fat choline deficient methionine reduced diet or normal diet It is a graph which shows the ratio of a cell positive area. It is the anti- (alpha) SMA antibody immunostaining image of the liver section after rearing | transplanting transplanted chimeric mouse (human hepatocyte Lot No. BD195) by super-high fat choline deficient methionine reduction diet or a normal diet. It is a TUNEL stained image of a liver section after breeding a passaged transplant chimera mouse (human hepatocyte Lot No. BD195) with a super-high fat choline deficient methionine reduced diet or a normal diet. Hematoxylin-eosin stained image (magnification: 400 ×) of a liver section after feeding a primary chimeric mouse (human hepatocyte Lot No. IVTJFC) on a superhigh fat choline deficient methionine reduced diet or a normal diet. It is a Sirius red stained image of a liver section after rearing a primary chimera mouse (human hepatocyte Lot No. IVTJFC) with a superhigh fat choline deficient methionine reduced diet or a normal diet. It is an anti-F4 / 80 antibody immunostaining image of the liver section after rearing a primary chimera mouse (human hepatocyte Lot No. IVTJFC) on superhigh fat choline deficient methionine reducing diet or a normal diet. It is a graph which shows the total ALT activity in a plasma, and a human ALT activity of the CCl ₄ administration group to a human hepatocyte chimera mouse (human hepatocyte Lot No. BD195) or a SCID mouse, or a non-administration group. It is a hematoxylin and eosin stained image of a liver section after administration of CCl ₄ administration to human hepatocyte chimeric mouse (human hepatocyte Lot No. BD195).

(1) Human NASH rodent animal model and method for producing the same The method for producing a human non-alcoholic steatohepatitis (NASH) model of the present invention is a chimera antibody in which part or all of the hepatocytes are replaced with human hepatocytes. A group consisting of (a) 0.01% by weight or less of choline or a salt thereof, 0.5% by weight or less of a methionine, and (c) a fat content of 25 kcal% or more It is a method including the step of rearing on a conditioned feed having at least one characteristic selected.

Human Hepatocyte Chimera Chimeric Rodent Chimeric Rodent Chiral Rodent Animal The chimeric rodent animal in which part or all of the human hepatocytes are replaced with human hepatocytes can be prepared by transplanting human hepatocytes into an immunodeficient hepatopathic rodent ( Primary chimera animal). In addition, passage-transplanted chimeric rodents transplant human hepatocytes grown in the body of primary chimeric rodents into the above-mentioned immunodeficient hepatopathic rodents and allografts with immunocompromised hepatopathic rodents. It can be obtained by Transplantation of human hepatocytes grown in chimeric rodents can be performed one or more times.

Rodents Rodents include mice, rats such as rats, guinea pigs, squirrels, hamsters and the like, but mice commonly used as experimental animals and rats such as rats are easy to use.
Either male or female may be used, but male is preferred.

Immunodeficiency liver injury Rodent immunodeficiency Hepatic disorder Rodent animals are immunodeficiency that does not show rejection of cells from xenogeneic animals, and the native liver cells of rodents are impaired. It is an animal that receives it. Since the native cells of the animal are damaged, if liver cells are transplanted, the liver function is maintained by the transplanted human hepatocytes, and the animal accurately reflects the intra-individual function of human hepatocytes. Become. In addition, human hepatocytes to be transplanted are easily proliferated.

The immunodeficient liver disorder animal can be produced by subjecting the same individual to a liver injury induction treatment and an immunodeficiency induction treatment. Treatment for inducing liver injury includes administration of liver injury inducers such as carbon tetrachloride, yellow phosphorus, D-galactosamine, 2-acetylaminofluorene, pyrrolidine alkaloid, irradiation, surgical partial resection of liver, etc. It can be mentioned. The immunodeficiency inducing treatment includes administration of an immunosuppressant and thymectomy.

In addition, an immunodeficient liver disorder animal can also be prepared by subjecting a genetically immunodeficient animal to a liver injury inducing treatment. As genetic immunodeficiency animals, animals with severe combined immunodeficiency (SCID: severe combined immunodeficiency) showing T cell line dysfunction, animals with loss of T cell function due to hereditary thymus defect, RAG2 gene known Examples include animals that have been knocked out by gene targeting (Science, 244: 1288 1292, 1989) or genome editing techniques. Specifically, SCID mice, RAG2 knockout mice, IL2Rgc / Rag2 knockout mice, NOD mice, NOG mice, nude mice, nude rats, immunodeficient rats obtained by implanting SCID mouse bone marrow into X-irradiated nude rats (Japanese Patent Application Laid-Open No. 2007-228962, Transplantation. 60 (7): 740-7, 1995) and the like.

In addition, an immunodeficient liver disorder animal can also be prepared by subjecting a genetically liver disordered animal to an immunodeficiency inducing treatment. As a genetically liver-injured animal, a known transgenic method (Proc. Natl. Acad.) Is used using a liver injury-inducing protein gene linked under the control of a liver cell-specifically expressed protein enhancer and / or promoter. Sci. USA 77; 7380-7384 (1980)). In such an animal, the liver injury-inducing protein is expressed specifically in the liver, and thus has liver injury. Proteins specifically expressed in the liver include serum albumin, cholinesterase, Hageman factor and the like. Liver injury-inducing proteins include urokinase plasminogen activator (uPA), tissue plasminogen activator (tPA) and the like. Alternatively, an animal having genetic liver disorder can be obtained by knocking out a gene responsible for liver function such as the fumaryl acetoacetate hydrolase gene. Alternatively, liver damage can be caused by administering ganciclovir to a mouse into which a thymidine kinase gene has been introduced under the albumin enhancer promoter.

Furthermore, an immunodeficient liver disorder animal can also be produced by crossing a genetically immunodeficient animal with a genetic liver disorder animal of the same species.
As a genetically immunocompromised liver disorder animal, an animal whose liver injury gene and immunodeficiency gene are homozygous or heterozygous can be used, respectively.

Human hepatocytes used for transplantation can be isolated from human liver tissue by a conventional method such as collagenase perfusion. For example, by using human hepatocytes of children under 14 years of age, high rates of substitution by human hepatocytes are achieved. In addition, if proliferating hepatocytes having active proliferative ability in vivo are used, human hepatocyte population that can rapidly proliferate in the recipient rodent body and can exert normal liver function can be obtained in a short time. It can be formed. Examples of such proliferating human hepatocytes include human small hepatocytes invented by the present inventors (JP-A-8-112092 etc.) and the like. In addition, human hepatic cells obtained from hepatic progenitor cells such as Clip cells, and pluripotent stem cells such as iPS cells and ES cells can also be used.

Human hepatocytes can be transplanted into the liver via the spleen of an immunocompromised liver injury animal. It can also be transplanted directly from the portal vein. The number of human hepatocytes to be transplanted can be about 1 to 2 million.
The sex of the immunodeficient liver injury animal is not particularly limited. Also, the age of the immunodeficient liver-damaged animal at the time of transplantation is not particularly limited, but when human hepatocytes are transplanted when the mouse is low age, human hepatocytes can be more actively proliferated as the mouse grows. From the point of view, it is preferable to use an animal of about 6 weeks of age immediately after birth.
The animal after transplantation may be bred by a conventional method. For example, by rearing for about 3 to 30 weeks after transplantation, a primary chimeric animal in which part or all of the hepatocytes are replaced with human hepatocytes can be obtained.

Next, a method for producing a passaged chimeric animal will be described. Human hepatocytes grown in a chimeric animal can be recovered, for example, by collagenase treatment of a liver tissue of the chimeric animal. The cytotoxicity of collagenase is higher for rodent hepatocytes than for human hepatocytes, so by adjusting the collagenase treatment time, the hepatocytes of chimeric animals are damaged, and almost only human hepatocytes are isolated. can do.
In the recovered hepatocytes, in addition to human hepatocytes grown in the chimera animal body, non-hepatic parenchymal cells and hepatocytes of recipient animals are also contained in small amounts. Therefore, the recovered hepatocytes may be used as they are for transplantation, but the purity of human hepatocytes can also be increased using a monoclonal antibody that specifically recognizes human hepatocytes or recipient animal hepatocytes.
Transplantation and expansion of human hepatocytes isolated from primary chimeric animals to the liver of rodents are the same as in the production of primary chimeric animals.

In the present invention, both primary chimeric rodents and passage-transplanted chimeric rodents can be used. Passage-transplanted chimeric rodents may be transplanted one time or may be transplanted two or more times. For example, chimeric rodents transplanted two to four times can be used. In any case, human NASH symptoms can be sufficiently introduced by rearing on adjusted diets.

Adjusted Feed When the adjusted feed used in the present invention is one in which the amount of choline or its salt is reduced, the amount of choline or its salt added is 0.01 relative to the total amount of the adjusted feed (that is, the final concentration is 0.01). % By weight or less is preferable, 0.001% by weight or less is more preferable, and it is most preferable that no choline or a salt thereof is blended or substantially not blended. Thereby, NASH symptoms can be sufficiently induced. In addition, there is no hindrance to growth even if it does not mix choline or its salt.
The compounding amount of choline or its salt mentioned here is the addition amount of choline or its salt to feed. Although the raw material in the feed for rearing rodents may originally contain a trace amount of choline or its salt, its content is usually negligible.
Choline has the following formula (1)

It is a quaternary ammonium cation shown by
Choline salts include, but are not limited to, chlorides, hydroxides, phosphates, monohydrogen phosphates, dihydrogen phosphates, carbonates, hydrogen carbonates, inorganic salts such as sulfates; tartaric acid Typical examples are salts, hydrogen tartrate (bitartrate), citrate, acetate, oxalate, lactate, malate, malate, fumarate, malonate, organic salts such as succinate Organic salts can be mentioned. In a controlled feed, choline is usually present as a salt.

When the adjusted feed used in the present invention has a reduced methionine content, the methionine content is preferably 0.5% by weight or less, more preferably 0.2% by weight or less, based on the total amount of the adjusted sample (that is, the final concentration is). Is more preferably 0.1% by weight or less. The methionine content can be 0.03% by weight or more, 0.05% by weight or more, or 0.1% by weight or more. Within this range, it is possible to put it into practical use as an experimental animal by inducing a NASH symptom and suppressing a decrease in body weight due to a decrease in muscle mass.
The methionine content here is the amount of methionine added to the feed. Although the raw material in the feed for rearing rodents may naturally contain a trace amount of methionine, its content is usually negligible. Also, methionine constituting the peptide is not included in the methionine blending amount referred to herein.

When the adjusted feed used in the present invention has an increased fat content, the fat content is 25 kcal% or more based on the total heat quantity (100 kcal%) of protein, carbohydrate and fat in the feed It is preferable to set it as 40 kcal% or more, especially 50 kcal% or more, and more preferably 60 kcal% or more. Thereby, NASH symptoms can be sufficiently induced. The fat content is 120 kcal% or less, particularly 90 kcal% or less, 70 kcal% or less, 60 kcal% or less based on the total heat quantity (100 kcal%) of protein, carbohydrate and fat in feed. It can be done. Within this range, it can be practically used as an experimental animal while inducing NASH symptoms.

In addition, when the adjusted feed used in the present invention is one in which the fat content is increased, the fat content is 10% by weight or more, particularly 20% by weight or more, and particularly 30% by weight, with respect to the total amount of the adjusted feed. As described above, the content is preferably 35% by weight or more. Thereby, NASH symptoms can be sufficiently induced. In addition, the fat content can be 70% by weight or less, in particular 60% by weight or less, and in particular 50% by weight or less, based on the total amount of the adjusted feed. Within this range, it can be practically used as an experimental animal while inducing NASH symptoms.

In the present invention, the "fat" in the adjusted feed includes any of vegetable fats, animal fats, and mineral fats.
Examples of vegetable oils include, but are not limited to, corn oil, soybean oil, sesame oil, rapeseed oil, rice oil, soy sauce, soy sauce, safflower oil, coconut oil, cotton seed oil, sunflower oil, sesame oil, sesame oil, linseed oil, olive oil, peanut oil Almond oil, avocado oil, hazelnut oil, walnut oil, grape seed oil, cocoa butter, peanut butter and the like. Animal fats and oils include soy sauce, soy sauce, liver oil, horse oil, pork fat, beef tallow, horse fat, milk fat, and their hardened fats and oils.

The adjusted feed used in the present invention has a content of (a) choline or a salt thereof of 0.01% by weight or less, a content of (b) methionine of 0.5% by weight or less, and (c) a fat content of 25 kcal% or more It has only to have one or two or more characteristics. Specifically, (a), (b), (c), (a) and (b), (a) and (c), (b) and (c), and (a) and (b) Any of (c) may be used. Among them, the combination of (a), (b) and (c) is preferable.

The adjusted feed used in the present invention contains nutrients such as proteins, carbohydrates, minerals, vitamins and the like which are usually contained in animal feed as long as the above (a), (b) and / or (c) are satisfied. Can.

The chimeric rodents are administered the adjusted diet at a human hepatocyte substitution rate of at least 30%, particularly at least 50%, and more preferably at least 70% for both primary chimera animals and passaged transplant chimera animals. It is preferable to start doing. In addition, it may be possible to start administration of the adjusted diet in a state where the human hepatocyte replacement rate has reached 80% or more, or 90% or more, or all hepatocytes of rodents have been replaced with human hepatocytes. .
Human hepatocyte replacement rate can be obtained, for example, by preparing a liver section of a chimeric animal and staining (for example, hematoxylin-eosin staining) to measure the area ratio of human hepatocytes, or for an antibody specific for human hepatocytes (for example, Immunostaining can be carried out using cytokeratin 8/18 antibody or STEM121 antibody) to determine the human hepatocyte area ratio (human cytokeratin 8/18 or STEM121 positive area ratio). By extracting liver sections of chimeric animals from all seven lobes of the liver and calculating the average value of the area ratio of human hepatocytes, it is possible to accurately grasp the human hepatocyte replacement rate. Since the human hepatocyte replacement rate of the outer right lobe slice is highly correlated with the average value of the human hepatocyte replacement rate of all 7 lobe sections, the human hepatocyte replacement rate can also be determined using the outer right lobe slice .
The human hepatocyte replacement rate can also be estimated by measuring the concentration of human albumin in the blood of a chimeric animal and fitting it to a previously prepared calibration curve.

When rearing chimeric rodents with a controlled feed, the adjusted feed may be freely fed or forcibly fed.
In addition, the administration period of the adjusted feed can be 1 week or more, 2 weeks or more, 3 weeks or more, or 4 weeks or more. In addition, it can be 40 weeks or less, 30 weeks or less, 20 weeks or less, or 10 weeks or less. Within this range, NASH symptoms can be sufficiently induced.

Non-alcoholic steatohepatitis (NASH)
As described above, human hepatocyte chimeric rodent animals exhibiting human NASH symptoms are obtained, and this animal can be used as a human NASH model (human NASH rodent animal model).
Human NASH is one of fat-accumulating liver diseases other than human alcoholic liver disease (non-alcoholic fatty liver disease (NAFLD)), but at least lipid droplet deposition, inflammatory cell infiltration, and fibrosis in the liver. Refers to a disease that exhibits the symptoms of

Although deposition of fat droplets on the liver may be observed as little as possible, it is preferable that the area ratio of fat droplets observed by staining a liver section (for example, Oil Red O staining) is 5% or more, 33% Is more preferably more than 66%. The NAFLD activity score (NAS score) (Hepatology. 2005 Jun; 41 (6): 1313-21) specified by the Nonalcoholic Steatohepatitis Clinical Research Network is “1” when the area ratio of fat droplets is 5% or more and 33% or less. It is "2" when it is more than 33% and not more than 66%, and "3" when it is more than 66%.

Inflammatory cell infiltration in the liver may be observed as little as possible, but when a liver section is stained (eg, hematoxylin and eosin staining, Masson's trichrome staining), an inflammatory lesion per × 200 magnification field in the liver leaflet It is preferable that 1 or more be recognized, It is more preferable to be recognized 2 or more, It is more preferable to be recognized 4 or more. In the above NAS score, “1” when there are 1 or more and less than 2 inflammatory lesions per × 200 magnification field of liver lobule, “2” when 2 or more and 4 or less, “3” when more than 4 is there.

Although any fibrosis of the liver may be observed, when liver sections are stained (eg, Sirius red stain, Masson trichrome stain), it is observed around the sinusoid and at the center of the liver lobule, or around the portal vein. Is preferred (NAS score Fibrosis stage "1"), and even more preferably observed both around the sinusoid and around the portal vein (NAS score Fibrosis stage "2"), that crosslinkable fibrosis is observed It is even more preferable (NAS score Fibrosis stage "3"), and even more preferable that cirrhosis is observed (NAS score Fibrosis stage "4").

In addition to the above lesions, iron deposition and hepatocyte apoptosis may also be observed in the liver of chimeric rodents exhibiting NASH symptoms obtained by the above method. Iron deposition can be confirmed, for example, by iron staining of liver sections or hematoxylin and eosin staining. Apoptosis of hepatocytes is confirmed as apoptotic bodies, for example, in hematoxylin and eosin staining. In addition, DNA fragments generated by apoptosis can also be confirmed by detection by TUNEL (TdT-mediated dUTP end labeling) method or immunostaining of activated Caspase 3.

In addition, oxidative stress is considered to be one of the causes of progression of symptoms from nonalcoholic fatty liver disease (NAFLD) to NASH. CYP2E1 and 4-hydroxy-2-nonenal (4-HNE) are known as proteins that cause oxidative stress. CYP2E1 is an enzyme that generates free radicals, and 4-HNE is a lipid peroxidase. In the liver of chimeric rodents exhibiting NASH symptoms, expression or enhanced expression of proteins that cause oxidative stress such as CYP2E1 and 4-HNE can be observed. The expression of CYP2E1 and 4-HNE can be confirmed by immunostaining of liver sections using human CYP2E1 and human 4-HNE antibodies, respectively.

In addition, in the liver of chimeric rodents exhibiting NASH symptoms, characteristic lesions can be observed in human NASH such as Ballooning (balloon-like swelling) of hepatocytes and Mallory body. The ballooning of the hepatocytes and the mallory body can be confirmed by staining the liver section (for example, hematoxylin and eosin staining, azanmaloli staining, masson trichrome staining). The NAS score is "1" when there are a small number of ballooning degeneration of hepatocytes in the liver and "2" when there are many.

Furthermore, in blood, plasma or serum, an improvement in human alanine transaminase (ALT) activity abundant in the liver can be observed. ALT catalyzes the transfer reaction between the α-keto group of α-ketoglutaric acid and the amino group of L-alanine to form pyruvate and glutamic acid, which are coupled to this reaction to form lactate dehydrogenase (LDH) Since nicotinamide adenine dinucleotide reduced form (NADH) is converted to β-nicotinamide adenine dinucleotide oxidized form (NAD), ALT activity can be determined by measuring the rate of decrease of NADH using absorbance as an index. .
Measurement of the ALT activity value can not distinguish between ALT derived from mouse hepatocytes and ALT derived from human hepatocytes, but in addition to the measurement of ALT activity values, if human ALT1 concentration is measured by ELISA etc., it occupies in ALT The ratio of ALT derived from human hepatocytes can be grasped.

(2) Screening method of agent for preventing, treating or ameliorating human NASH The method for screening agent for preventing, treating or ameliorating human NASH of the present invention is a test substance in the human NASH rodent animal model of the present invention described above And comparing the degree of NASH symptoms before and after administration of the test substance, or comparing the degree of NASH symptoms between a group to which the test substance is administered and a non-administration group.

The comparison of the degree of NASH symptoms before and after administration of the test substance may be performed for any of the above-mentioned symptoms observed in human NASH. That is, in the liver, deposition of lipid droplets, inflammatory cell infiltration, fibrosis, iron deposition, hepatocyte apoptosis, expression of proteins that cause oxidative stress, hepatocytes ballooning, malory body, ALT activity It is also good. Above all, it is preferable to perform deposition of lipid droplets, inflammatory cell infiltration, and / or fibrosis. In addition to one or more of lipid droplet deposition, inflammatory cell infiltration, and fibrosis, iron deposition, hepatocyte apoptosis, expression of proteins leading to oxidative stress, hepatocyte ball ballooning, malory body, and ALT activity 1 By comparing the above, it is possible to perform screening with higher accuracy.
If these symptoms are alleviated or ameliorated, the test substance can be determined to be effective for treatment or amelioration of human NASH. If any NASH symptom is significantly alleviated or ameliorated, the test substance can be determined to be effective for treatment or improvement of human NASH, but 1.3 times or more, 1.5 times or more, or 2 times or more Can be used as an indicator. In addition, since an agent effective for treating or ameliorating a disease is generally also effective for preventing the disease, such a test agent can be determined to be effective for preventing human NASH.

The test substance is not particularly limited, and includes low molecular weight compounds, amino acids, nucleic acids, lipids, saccharides, extracts of natural products and the like.
The administration route of the test substance is not particularly limited, and oral administration, intraperitoneal administration, intravenous administration, intraarterial administration, subcutaneous administration, intramuscular administration, transdermal administration and the like can be mentioned.
The dose of the test substance and the administration schedule such as the number of times of administration can be determined for each test substance so that the presence or absence of the effect can be determined.
After administration of the test substance, for example, 1 to 8 weeks later, the degree of NASH symptoms can be confirmed and compared with the degree of NASH symptoms in the non-administration group. Alternatively, the degree of NASH symptoms can be compared before and after administration of the test substance.

Hereinafter, the present invention will be described in more detail by way of examples, but the present invention is not limited thereto.
(1) Preparation of primary human hepatocyte chimera mouse
Preparation of Immunocompromised Hepatic Injured Mice uPA-Tg (+ / +) / SCID (+ / +) mice used as recipient animals were bred by Phoenix Bio Inc. This mouse was produced by the following method.

First, uPA-Tg mice (hemizygote, +/-) were prepared by the method described in Examples 1 and 2 of JP-A-2013-230093.
The uPA gene was extracted from mouse liver by AGPC method (acid-guanidinium-isothiocyanate-phenol-chloroform) and was dissolved in RNase-free water. Sequence of uPA gene registered in the published database using the total RNA obtained above (uPA gene specific primer (antisense sequence from 1341 bases to 1360 bases in length prepared from Accession No. NM008873) and Reverse transcription with LongRange Reverse Transcriptase (manufactured by Qiagen) is carried out at 25 ° C. for 10 minutes, then at 42 ° C. for 90 minutes, and reverse transcriptase inactivation treatment is carried out at 85 ° C. for 5 minutes. The mRNA was digested by treatment with Invitrogen) for 20 minutes at 37 ° C. to digest only cDNA, and PCR was performed using the synthesized cDNA as a template for PCR reaction. The enzyme used was Phusion DNA polymerase (Fynnzymes), and PCR primers (sense sequences of bases 39 to 61) were prepared from the uPA gene sequence (Accession number: NM008873). The fragment to be amplified has nucleotides 39-13 in the PCR reaction The obtained DNA fragment was introduced into an expression plasmid having a mouse albumin promoter / enhancer described later to construct “malb uPAInt2”, which is downstream of the mouse albumin enhancer / promoter. The second exon of rabbit β globin, the intron, the third exon, the ORF part of mouse uPA, and the polyA signal in the third exon of rabbit β globin are combined.

The plasmid "malb uPAInt2" was introduced into ES cells obtained from 129SvEv mice by electroporation, and then selective culture was performed with G418. The obtained G418 resistant colonies were assayed for ES cells into which a gene had been introduced by PCR as follows.

25-30 μg of vector for homologous recombination (uPA) was linearized by digestion with restriction enzyme and purified. This DNA is suspended in an electroporation buffer (20 mM HEPES pH 7.0, 137 mM NaCl, 5 mM KCl, 6 mM D-glucose, 0.7 mM Na ₂ HPO ₄ ) containing 3 × 10 ⁶ mouse ES cells. It became cloudy, and gene transfer was performed under the conditions of Field Strength 185 V / cm, Capacitance 500 μF. Twenty-four hours after the introduction, selective culture was performed with a final concentration of 200 μg / mL of G418 (Geniticin) (SIGMA G-9516). For culture of ES cells, Dulbecco's modified Eagle's medium (DMEM) (Gibco / BRL 11965-084) culture solution contains 15% fetal bovine serum (Hyclone SH30071) and 2 mM L-glutamine (Gibco) / BRL 25030-081), final concentration 100 μM each non-essential amino acid (Gibco / BRL 11140-050), final concentration 10 mM HEPES (Gibco / BRL 15630-080), final concentration 100 U each / mL penicillin / streptomycin (Gibco / BRL 15140-122), final concentration 100 μM β-mercaptoethanol (SIGMA M-7522), and final concentration 1000 U / mL ESGRO (LIF) (Gibco / BRL) What added 13275-029) was used (it is hereafter described as ES culture medium).

Moreover, as a feeder cell for ES cells, MEF (Mouse Embryonic Fibroblast) cells isolated from E14.5 embryos are used, and the culture solution is DMEM (Gibco / BRL 11965-084), and the final concentration is 10%. Fetal bovine serum (Hyclone SH30071), final concentration 2 mM L-glutamine (Gibco / BRL 25030-081), final concentration 100 μM each non-essential amino acid (Gibco / BRL 11140-050) final concentration Used each to which 100 U / mL penicillin / streptomycin (Gibco / BRL 15140-122) was added (hereinafter referred to as MEF medium). MEF cells cultured to confluency in 150 cm ² flasks are detached with trypsin / EDTA (0.05% / 1 mM, Gibco / BRL 25300-047), 4 10 cm dishes, 2 24-well plates, The solution was replated at optimal concentrations in ^two 6-well plates, six 25 cm ² flasks, and two 75 cm ² flasks.

Genotype analysis ES cells were prepared as follows.
From the fifth day after gene transfer, emerging G418 resistant colonies were passaged to a 24-well plate as follows. Specifically, transfer G418 resistant colonies to a 96-well microplate containing 150 μL of trypsin / EDTA solution using Pipetman (Gillson), treat for 20 minutes in a 37 ° C incubator, and then pipet with Pipetman. It was a single cell. The cell suspension was transferred to a 24-well plate and culture was continued. Two days later, cells on a 24-well plate were split into two for cryopreservation and DNA extraction. That is, 500 μL of trypsin / EDTA was added to the cells, treated in an incubator at 37 ° C. for 20 minutes, and 500 μL of ES medium was added and gently pipetted into a single cell by pipetman. Thereafter, half of the cell suspension was transferred to a 24-well plate containing 1 mL of ES medium, and 1 mL of ES medium was also added to the original 24-well plate. After two more days, the medium of one 24-well plate was removed, and fetal bovine serum at a final concentration of 10% and dimethylsulfoxide (DMSO) at a final concentration of 10% were added to ES medium (Sigma D-5879) After 1 mL of freezing medium was added and sealed, it was stored frozen at -70 ° C.

The assay of transgenic ES cells was performed by PCR as follows. That is, the medium was removed from each well of a 24-well plate in which cells were grown to confluence, washed with PBS and then 250 μL of lysis buffer (1% SDS, 20 mM EDTA, 20 mM Tris pH 7.5) and proteinase K 5 μL of (20 mg / mL) was added, shaken well, and dissolved by heating at 52 ° C. DNA was extracted from the dissolved sample by phenol / chloroform extraction and used as a template DNA for PCR.

uPA transgenic ES cells were selected by the following procedure.
The PCR primers used were set in rabbit beta globin. The sequence is the sense primer: GGGCGGGCGTACCGCATCTGAGAACTTCAGGGTGAG (SEQ ID NO: 1), antisense primer: GGGCGGCGGACTACAATTCTTTGCTAAATGATGAGA (SEQ ID NO: 2). The reaction was carried out according to the attached method of AmpliTaqGold (ABI). After activating the enzyme for 9 minutes at 95 ° C., the reaction was repeated 40 times at 94 ° C. for 30 seconds (denaturation), 63 ° C. for 30 seconds (annealing), and 72 ° C. for 1 minute (extension). After completion, the reaction solution was electrophoresed on a 2% agarose gel to confirm the PCR product.

Clones for which gene transfer was confirmed by PCR analysis were thawed by warming the cryopreserved 96-well plate to 37 ° C., and passaged to a 24-well plate. After culturing this 24-well plate at 37 ° C. for 24 hours, the medium was changed to remove DMSO and liquid paraffin. When each clone reached 75-90% confluence, it was passaged from 24 well to 6 well plate. Furthermore, when two wells were obtained which had grown to 75-90% confluency in a six-well plate, one well was cryopreserved, and the remaining one well was used for injection into blastocysts and DNA extraction. .

Cryopreservation was performed as follows. That is, cells are rinsed twice with PBS, 0.5 mL of Trypsin is added, incubated at 37 ° C. for 15 to 20 minutes, trypsinized, and then 0.5 mL of ES cell culture medium is added, and 35 to 40 times Petting was performed to completely dissociate the ES cell mass. The cell suspension was transferred to a 15 mL centrifuge tube, and the wells were further washed with 1 mL of ES cell medium and collected in the tube. The tube was centrifuged at 1,000 rpm for 7 minutes, the medium was removed and resuspended in 0.25 mL ES cell medium and 0.25 mL of 2 × freezing medium was added. The contents of the wells were transferred to cryogenic vials, frozen at -80 ° C and stored in liquid nitrogen.

Cells for injection into blastocysts and DNA extraction were used to dissociate the ES cell mass completely, and then one-fourth of the cells were used for injection into blastocysts, and one third of the remaining cells, And two thirds were each passaged to gelatin coated 60 mm dishes. The former extracted genomic DNA for PCR analysis when the cells grew to confluency, and the latter cells were divided into three and frozen when grown to confluence.

Using ES cells carrying the uPA gene, chimeric mice were prepared as follows.
With respect to ES cell clones for which gene transfer was confirmed, chimeric embryos were prepared using blastocysts of C57BL / 6J strain mice as host embryos, and they were transplanted to the horns of pseudopregnant mice to obtain offspring. Harvesting of host embryos was performed on day 3 of gestation by perfusing the oviduct and uterus with Whitten's medium supplemented with 100 μM trypsin / EDTA. Eight-cell stage embryos or morula were cultured in Whitten's medium for 24 hours, and the obtained blastocysts were used for injection. The ES cells used for injection were dispersed by TE treatment on the second or third day after passaging, and allowed to stand at 4 ° C. until being subjected to microscopic operation. As a pipette for injection of ES cells, glass capillary tubing (inner diameter about 20 μm) manufactured by Sutter was used. As a pipette for holding embryos, a micro glass tube (NARISHIGE) with an outer diameter of 1 mm is thinly drawn using a microelectrode maker (P-97 / IVF, manufactured by Sutter), and then the outer diameter is obtained using a microforge (De Fonburun) It was cut at a portion of 50 to 100 μm and further processed to a bore diameter of 10 to 20 μm. The injection pipette and the holding pipette were connected to a micromanipulator (Leica) to which a piezo system (Primetec PAMS-CT150) was connected. As a chamber used for micromanipulation, a slide glass with a cover glass attached with beeswax is used, and two drops of Hepes-buffered Whitten's medium containing about 10 μL of 0.3% BSA are placed thereon. The top was covered with mineral oil (Sigma). One drop contains about 100 ES cells, the other contains about 20 expanded blastocysts, and about 15 ES cells are injected per embryo. All microscopic manipulations were performed under an inverted microscope. Manipulated embryos were transferred to the uterine horn of an ICR-based recipient female on day 2 of pseudopregnancy. The recipient females who did not take off their offspring even after the scheduled delivery date were subjected to cesarean section and were fostered by foster parents. As a result of injecting 45 clones of ES cells into blastocysts of C57BL / 6J strain mice, male chimeric mice were obtained in 39 clones.

The uPA-Tg mice (hemizygote, +/-) thus obtained are backcrossed twice to SCID-bg mice, and mice having the uPA-Tg (+/-) SCID (+ / +) genotype are selected. Obtained. Sperm were collected from males of the mice and returned to the post-mortem after unfertilized eggs and in vitro fertilization of SCID mice (homozygote, + / +). Among the born offspring mice, mice containing a Tg gene were selected, and by natural mating, mice uPA-Tg (+/-) / SCID (+ / +) having both traits were obtained. The discrimination between uPA-Tg (+/-) and uPA-Tg (-/-) was carried out by genomic PCR using a sequence specific for the transgene as a primer.
Forward primer
5'-GGGCGGGCGGTACGCATCCTGGAGAACTTCAGGGTGAG-3 '(SEQ ID NO: 3)
Reverse primer
5'-GGGCGGCGGTACCAATTCTTTGCCAAATGATGAGA-3 '(SEQ ID NO: 4)
Also, discrimination between SCID (+ / +), SCID (+/−) and SCID (− / −) was performed by the PCR-RFLP method.

Next, the obtained uPA-Tg (+/-) / SCID (+ / +) are crossed, and uPA-Tg (+ / +) / SCID (+ / +) and uPA-Tg (+/-) / SCID (+ / +) was obtained. The discrimination between uPA-Tg (+ / +) and uPA-Tg (+/-) was performed by Southern blotting. The tails of 8-10 day-old mice were cut about 5 mm, solubilized with SDS, proteinase K solution, and phenol and chloroform extraction were performed to remove contaminating protein components. After contaminating RNA was degraded using DNase-free RNase A, high molecular weight genomic DNA was precipitated by isopropanol precipitation. The above genomic DNA was washed with 70% ethanol, allowed to air dry, and then redissolved in TE. The genomic DNA extracted from the sample, the genomic DNA of positive and negative controls, and 5 μg each were completely digested with EcoR1, and the resulting DNA fragments were separated by agarose electrophoresis and transferred to a nylon membrane. A DNA fragment suitable for Southern hybridization probe was purified from uPA cDNA probe / TA using restriction enzyme EcoR1 (379 bp). The above DNA fragment was [32P] labeled by the random prime method. The DNA fragment transferred to the nylon membrane was hybridized with the RI labeled uPA cDNA probe. The nonspecifically bound probe was removed by washing, and the radioactive signal derived from the foreign gene introduced into the candidate individual of the mAlb-uPA-Int2 Tg mouse was detected by exposure to X-ray film. Genotype of mAlb-uPA-Int2 Tg mouse individual by detecting specific signal of 1.5 kb from wild type locus and specific signal of 0.4 kb (wt: 1.5 kb) from mutant type locus Was judged.
uPA-Tg (+ / +) / SCID (+ / +) mice and SCID / cb-17 mice (Nihon Charles River) are multiplied to obtain uPA-Tg (+/-) / SCID (+ / +) mice The uPA-Tg (+ / +) / SCID (+ / +) mice were used for primary transplantation, and uPA-Tg (+/-) / SCID (+ / +) mice were used as host mice for passage.

As human hepatocyte-transplanted human hepatocytes, hepatocytes purchased from BD Gentest (Lot No. BD 195, girl, 2 years old) and hepatocytes purchased from BioIVT (Lot No. IVTJFC, boy, 1 year old) I used each. These frozen hepatocytes are referred to as “Chise Tateno, Yasumi Yoshizane, Naomi Saito, Miho Kataoka, Rie Utoh, Chihiro Yamasaki, Asato Tachibana, Yoshinori Soeno, Kinji Asahina, Hiroshi Hino, Toshimasa Asahara, Tsuyoshi Yokoi, Toshinori Furukawa, Katsuyoshi Yoshizato: Am J Pathol 165: 901-912, 2004 "was used by melting according to the method described in" Completely humanized liver in mice shows human-type metabolic responses to drugs.

Three to five week-old uPA-Tg (+ / +) / SCID (+ / +) mice are anesthetized with isoflurane, and an incision of about 5 mm in the left flank is made and 10.0 × 10 ⁵ human hepatocytes are obtained from the splenic head. After injection, the spleen was returned to the abdominal cavity and sutured.
After transplantation, the animals were reared for about 100 days by free intake of tap water supplemented with common feed CRF-1 (Oriental Yeast Co., Ltd.) and sodium hypochlorite solution 0.0125%.

It is known that SCID / c.b-17 mice used for cross-linking do not have T cells or B cells but have NK cells. Therefore, an antibody that inhibits NK activity was intraperitoneally administered the day before transplantation so that the transplanted human hepatocytes were not attacked by mouse NK cells.

The percent replacement of human hepatocytes in the livers of the resulting primary chimeric mice was 90-95%. This substitution rate was determined by measuring human albumin concentration in mouse blood. That is, blood is collected from the tail vein of a chimeric mouse, and 2 μl of collected blood is added to 200 μL of LX-Buffer, and human albumin in the blood of mouse is obtained by using an automatic analyzer JEOL BM 6050 (Nippon Denshi) by immunoturbidimetry. The concentration was measured. The human albumin concentration was applied to a calibration curve prepared in advance to estimate the human hepatocyte replacement rate. The standard curve is used to prepare a frozen section of the chimera mouse liver and to perform immunostaining using human hepatocyte-specific cytokeratin 8/18 antibody (ICN Pharmaceuticals, Inc.). An 18 positive area was determined between human hepatocyte substitution rate and human albumin concentration in chimera mouse blood.

(2) Preparation of Passaged Transplanted Human Hepatocyte Chimera Mouse The liver tissue of a primary chimera mouse was treated with collagenase to recover cells rich in human hepatocytes. Three to five weeks old uPA-Tg (+/−) / SCID (+ / +) mice were transplanted with 1 × 10 ⁶ hepatocytes isolated from primary chimeric mice from the spleen. The transplantation method is the same as human hepatocyte transplantation into primary chimeric mice.
After transplantation, CRF-1 (Oriental Yeast Co., Ltd.), and sodium hypochlorite solution 0.0125% -added tap water was added for about 100 days by free intake of tap water.
The percent replacement of human hepatocytes in the livers of the resulting passaged chimeric mice was 90-97%.

(3) Induction of NASH symptoms by administration of adjusted diet
(3-1) Transplanted human hepatocyte chimera mouse
Human albumin concentration in blood / ALT activity in serum As described above, when hepatocytes are damaged, enzymes in the cytoplasm leak out of the cell and enter the blood. Since ALT is most abundant in the liver, elevated ALT activity in the blood is an indicator of liver damage. In addition, albumin is produced in the liver and is present in the blood, so when the liver is damaged, the concentration of albumin in the blood decreases. Therefore, a decrease in albumin concentration in blood is an indicator of liver damage.

The passage-transplanted human hepatocyte chimera mouse obtained in the item of “(2) Generation of passage-transplanted human hepatocyte chimera mouse” was treated with a superhigh fat choline deficient methionine reduction diet (A06071302; Research Diets, Inc) or a normal diet. A certain amount of CRF-1 (Oriental Yeast Co., Ltd.) and sodium hypochlorite solution 0.0125% added were fed for 12 or 14 weeks by free intake of tap water. There were 3 animals in each group for 2 weeks feeding and 4 weeks feeding. In the 8-week feeding group, 4 rats were fed with a superhigh fat choline-deficient methionine reduction diet, and 3 rats were fed a normal feed feeding group. In the 12 feeding group and the 14 week feeding group, the superhigh fat choline deficient methionine reduced feed group was 3 and the normal feed group was 3 or 4.
Blood was collected from the tail vein of passaged chimeric mice bred with adjusted diet and regular diet, respectively, before starting the test, 2 weeks, 4 weeks, 8 weeks and 12 weeks, and 2 μl of collected blood was physiological was added to brine 200 [mu] L, latex agglutination turbidimetric immunoassay (LZ test 'Eiken' U-ALB, Eiken Chemical Co., Ltd., Tokyo) using an automatic analyzer ^{BioMajesty TM (JCA-BM6050, JEOL} , Tokyo Blood albumin concentration (mg / ml) was measured.
The results of passaged chimeric mice transplanted with human hepatocyte Lot No. BD195 are shown in FIG. By feeding the adjusted diet, it can be seen that the concentration of human albumin in the blood was significantly reduced, and the functional decline of human hepatocytes was induced.

The super-high fat choline deficient methionine reduced diet (A06071302; Research Diets, Inc) does not contain choline or its salt, but adds L-methionine to a final concentration of 0.1% by weight. Also, the ratio of the heat of fat to the total heat of protein, carbohydrate and fat is 62 kcal%. Also, the fat content is 35.7% by weight based on the total weight of the feed.

In addition, blood was collected from the tail vein of passaged chimeric mice fed with the adjusted diet and the normal diet, respectively, before the start of the test, 2 weeks, 4 weeks, 8 weeks and 12 weeks, and total ALT activity in plasma was obtained. Was measured using Fuji Dry Chem 7000 (Fuji Film) and Fuji Dry Chem Slide GTP / ALT-PIII (Fuji Film), and human ALT1 concentration (ng / mL) was measured using an ELISA kit (human ALT 1 ELISA kit, Phoenix Bio Inc.) It measured using. Furthermore, human ALT activity (U / L) was determined from human ALT1 concentration (ng / mL). Mouse ALT activity was calculated by subtracting human ALT1 activity from total ALT activity.
The time course of the ALT activity of passage-transplanted chimeric mice transplanted with human hepatocyte Lot No. BD195 is shown in FIG. By feeding on the adjusted diet, mouse ALT activity was not increased, but human ALT activity was found to increase after 2 weeks and 4 weeks, and to be in parallel with total ALT activity. It can be seen that liver damage was induced specifically to human hepatocytes by feeding on the adjusted diet.

Lesion of liver tissue The passage-transplanted human hepatocyte chimera mouse obtained in the item of "(2) passage-transplanted human hepatocyte chimera mouse" is a choline-deficient methionine reduced high-fat diet (CDAHFD) (super-high fat fat) Choline deficient methionine weight loss diet · A06071302) (Research Diets, Inc) or CRF-1 (Oriental Yeast Co., Ltd.) which is a regular diet, and free intake of tap water supplemented with 0.0125% sodium hypochlorite solution were raised for 12 weeks.
Two, four, eight, and twelve weeks after the initiation of the test, paraffin sections of the livers of passaged chimeric mice were prepared and hematoxylin-eosin (HE) staining was performed. The histology at a magnification of 40 × is shown in FIG. 3 for passage-transplanted chimeric mice into which human hepatocyte Lot No. BD195 has been transplanted. Fat drops, especially large drops, were significantly increased after 2 weeks and 4 weeks when fed with the adjusted feed, as compared with feeding with the normal feed.

In addition, a histology at a magnification of 400 times after 12 weeks for passage-transplanted chimeric mice into which human hepatocyte Lot No. BD195 has been transplanted is shown in FIG. In addition, a histology at 400 times magnification after 14 weeks for passage-transplanted chimeric mice into which human hepatocyte Lot No. IVTJFC has been transplanted is shown in FIG. In the case of rearing on a controlled diet, inflammatory cell infiltration (arrows) such as macrophages is observed unlike in the case of rearing on regular diet, and Ballooning cells (balloon-like tumors of hepatocytes have a structure like Mallory bodies in the cytoplasm Large) (arrowhead) was observed. It can be seen that chronic administration of the adjusted diet induced lesions characteristic of human NASH.

In addition, paraffin sections of liver 12 weeks after the start of the test for passage-transplanted chimeric mice into which human hepatocyte Lot No. BD195 had been transplanted were prepared and subjected to Sirius red staining. Histograms at 40 × and 400 × magnification are shown in FIG. In addition, for passage-transplanted chimeric mice to which human hepatocyte Lot No. IVTJFC had been transplanted, paraffin sections of the liver 14 weeks after the start of the test were prepared and stained with Sirius red. A 400 × histology is shown in FIG. When reared on a controlled diet, the area of fibrosis (the part stained with red) is larger than in the case of rearing on regular feed, and pericellular or perisinusoidal fibrosis that extends around the central vein or portal vein area is It was observed.
Sirius red positive area (fibrotic area) per total area on Sirius red stained tissue sections for passaged transplanted chimeric mice transplanted with human hepatocyte Lot No. BD195 was calculated. The results are shown in FIG. By feeding on the adjusted diet, it can be seen that the fibrotic portion increases about 1.6 times after 8 weeks and increases about 2.4 times after 12 weeks as compared to feeding on the regular feed .

In addition, for passage-transplanted chimeric mice transplanted with human hepatocyte Lot No. BD 195, paraffin sections of liver 8 weeks and 12 weeks after the start of the test are immunized with anti-F4 / 80 antibody (clone BM8, BMA Biomedicals) Staining was performed. F4 / 80 is one of the antigens expressed in Kupffer cells in the liver, macrophages and the like, and Kupffer cells and macrophages can be stained in brown by immunostaining using an anti-F4 / 80 antibody. The immunostaining image of the anti-F4 / 80 antibody is shown in FIG. In the case of rearing on adjusted diet, it is clear that the portion stained in brown is clearly more than that on rearing on regular feed, and that Kupffer cells and macrophages are increased.

For passage-transplanted chimeric mice transplanted with human hepatocytes Lot No. BD195, 10 sections were randomly determined from tissue sections stained with anti-F4 / 80 antibody on paraffin sections of liver 8 weeks and 12 weeks after the start of the test. Images were taken at a magnification of 100 times, and the ratio of F4 / 80 positive area (Kupffer cell / macrophage positive area) per photographed area was calculated. The results are shown in FIG. By rearing with the adjusted feed, it can be seen that the F4 / 80-positive area is increased about 2.7 times after 8 weeks and about 2.1 times after 12 weeks, as compared with the case of rearing on ordinary feed.

In addition, for passage-transplanted chimeric mice into which human hepatocyte Lot No. BD195 has been transplanted, paraffin sections of the liver at 2 weeks, 4 weeks, 8 weeks and 12 weeks after the initiation of the test were used as anti-α-smooth muscle actin ( Immunostaining was performed using an αSMA) antibody (clone 1A4, Sigma). αSMA is a marker of activated hepatic stellate cells, and activated hepatic stellate cells produce collagen fibers and are considered to play an important role in fibrosis of the liver. Activated stellate cells can be stained brown by immunostaining with an αSMA antibody. The immunostaining image (magnification of 100 times) of the αSMA antibody is shown in FIG. It can be seen from FIG. 11 that in any of the periods reared with the adjusted feed, the αSMA positive region staining brown is clearly increased as compared with the rearing with the normal feed.

In addition, a TUNEL stained image (magnification of 100 times) of a passage-transplanted chimeric mouse into which human hepatocyte Lot No. BD195 has been transplanted is shown in FIG. In addition, paraffin sections of liver 8 weeks and 12 weeks after the start of the test were stained by TUNEL method. The TUNEL method is a staining method that specifically stains cells that have undergone apoptosis. It can be seen from FIG. 12 that, when reared with the adjusted feed, the TUNEL-positive cells stained brown are clearly increased as compared with the rearing with the normal feed. Since apoptosis is an aspect of cell death that is characteristic of NASH, it can be seen that NASH symptoms were induced by feeding on a controlled diet.

(3-2) Primary human hepatocyte chimera mouse The primary human hepatocyte chimera mouse transplanted with human hepatocyte Lot No. IV TJFC obtained in the item “(1) Preparation of primary human hepatocyte chimera mouse” was choline deficient Methionine weight loss high fat feed (CDAHFD) (super high fat choline deficient methionine weight loss feed · A06071302) (Research Diets, Inc) or ordinary feed CRF-1 (Oriental Yeast Co., Ltd.) and sodium hypochlorite solution The rats were bred for 12 weeks with free intake of 0.0125% added tap water.
Twelve weeks after the start of the test, paraffin sections of the livers of primary transplanted chimeric mice were prepared and hematoxylin and eosin (HE) staining was performed. A histology at 400 × magnification is shown in FIG. In the case of rearing on a controlled diet, inflammatory cell infiltration (arrows) such as macrophages is observed unlike in the case of rearing on regular diet, and Ballooning cells (balloon-like tumors of hepatocytes have a structure like Mallory bodies in the cytoplasm Large) (arrowhead) was observed. It can be seen that chronic administration of the adjusted diet induced lesions characteristic of human NASH.

Moreover, about the primary human hepatocyte chimera mouse which transplanted human hepatocyte Lot No. IVTJFC, the paraffin section of the liver 12 weeks after a test start was produced, and the Sirius red stain was performed. A histology at 400 × is shown in FIG. When reared on a controlled diet, the area of fibrosis (the part stained with red) is larger than in the case of rearing on regular feed, and pericellular or perisinusoidal fibrosis that extends around the central vein or portal vein area is It was observed.

In addition, paraffin sections of the liver 12 weeks after the start of the test for primary human hepatocyte chimeric mice transplanted with human hepatocyte Lot No. IV TJFC were immunostained using anti-F4 / 80 antibody (clone BM8, BMA Biomedicals) The The immunostaining image of the anti-F4 / 80 antibody is shown in FIG. In the case of rearing on adjusted diet, it is clear that the portion stained in brown is clearly more than that on rearing on regular feed, and that Kupffer cells and macrophages are increased.

(4) Carbon tetrachloride (CCl ₄ ) administration test to human hepatocyte chimeric mice It is known that CCl ₄ induces liver damage. The effect of the same dose of CCl ₄ on the liver was compared between passage-transplanted human hepatocyte chimeric mice and normal mice. An increase in ALT activity in plasma was measured as an indicator of liver injury.

Three passage-transplanted human hepatocyte chimera mice transplanted with human hepatocyte Lot No. BD 195 obtained in the item of “(2) Generation of passage-transplanted human hepatocyte chimera mouse” (human hepatocyte substitution rate 75 to 86 %) Orally administered CCl ₄ dissolved in corn oil at a dose of 50 mg / kg. The mice were dosed once / daily for 7 days, and each mouse was dissected the day after the final administration day. In addition, blood was collected from each mouse before, 2 days, 4 days and 8 days after the start of the test, and the total ALT activity in the plasma was determined by Fuji Dry Chem 7000 (Fuji Film) and Fuji Dry Chem Slide GTP / ALT-PIII (Fuji Film) And human ALT1 concentration (ng / mL) was measured using an ELISA kit (human ALT1 ELISA kit, Phoenix Bio Inc.). Furthermore, human ALT activity (U / L) was determined from human ALT1 concentration (ng / mL). In addition, as a control, three passaged human hepatocyte chimeric mice are bred for 8 days without CCl ₄ administration, and after 2, 4, and 8 days, blood is collected, and total ALT activity is measured in the same manner. , Human ALT activity was measured.
Also, three 10-12 week-old male SCID mice were prepared, and in the same manner, oral administration of CCl ₄ , blood collection, and total ALT activity measurement were performed. As a control, three SCID mice were bred for 8 days without CCl ₄ administration, and blood collection and total ALT activity measurement were performed in the same manner after 2, 4, and 8 days.

The change over time in total ALT activity of passage-transplanted chimeric mice and SCID mice is shown in the upper row of FIG. Administration of CCl ₄ significantly increased the total ALT activity in SCID mice, and on the second day all animals became ill and were euthanized. On the other hand, the total ALT activity during the CCl ₄ administration period was about 10 times lower than that of the SCID mice in passaged chimeric mice. As shown in the lower part of FIG. 16, human ALT activity in human hepatocyte chimeric mice was slightly increased in the CCl ₄ administration group. The human ALT activity of human hepatocyte chimeric mice was about one tenth of the total ALT activity. Considering that the human hepatocyte substitution rate of human hepatocyte chimeric mice is as high as 75 to 86%, mouse hepatocytes are much more sensitive to CCl ₄ injury than human hepatocytes. I understand that.

In addition, euthanasia was performed 7 days after CCl ₄ administration of human hepatocyte chimeric mice, and euthanasia was performed in SCID mice because of poor prognosis 2 days after CCl ₄ administration. Paraffin sections of liver were prepared and subjected to HE staining. A histology at 40 × magnification is shown in FIG. In the liver tissue of human hepatocyte chimeric mouse, necrosis of hepatocytes was observed specifically in the mouse region (arrow), and in liver tissue of SCID mice, extensive necrosis of hepatocytes was observed (arrow). This also indicates that CCl ₄ administration is difficult to cause specific damage to human hepatocytes.

(5) Control animals of the model of the present invention As shown on the left of FIG. 3 and FIG. 4, passaged transplant chimera mice reared on a normal diet show pathological condition of simple fatty liver. Also, as shown in this test, passaged chimeric mice do not progress from simple fatty liver to NASH, even when fed with normal diet for a long time. Therefore, passaged chimeric chimeras can be used as a model of human simple fatty liver and can be used as a control animal of the NASH model of the present invention.

The human non-alcoholic steatohepatitis rodent animal model of the present invention accurately reflects human NASH because the liver is replaced with human hepatocytes. Since the NASH symptoms can be obtained stably, it can be suitably used as a model of rodent animals having human hepatocytes for research on the pathogenesis of NASH, screening of agents for preventing, treating or ameliorating NASH, and the like.

Claims (13)

1. A chimeric rodent animal in which part or all of hepatocytes are replaced with human hepatocytes is obtained by feeding the adjusted feed having one or more of the following characteristics (a), (b) and (c): Human non-alcoholic steatohepatitis model, including animal beings.
   (a) The content of choline or its salt is 0.01% by weight or less based on the total amount of the adjusted feed
   (b) The content of methionine is 0.5% by weight or less based on the total weight of the adjusted feed
   (c) The fat content is at least 25 kcal% with respect to the total heat of protein, carbohydrate and fat contained in the adjusted feed
2. The human non-alcoholic steatohepatitis model according to claim 1, wherein the chimeric rodent is a primary chimeric rodent or a passage-transplanted chimeric rodent.
3. The human non-alcoholic steatohepatitis model according to claim 1 or 2, which is bred for at least one week with the adjusted feed.
4. A chimeric rodent animal in which part or all of hepatocytes are replaced with human hepatocytes is obtained by feeding the adjusted feed having one or more of the following characteristics (a), (b) and (c): To use the cultured animal as a human non-alcoholic steatohepatitis model.
   (a) The content of choline or its salt is 0.01% by weight or less based on the total amount of the adjusted feed
   (b) The content of methionine is 0.5% by weight or less based on the total weight of the adjusted feed
   (c) The fat content is at least 25 kcal% with respect to the total heat of protein, carbohydrate and fat contained in the adjusted feed
5. 5. The method according to claim 4, wherein the chimeric rodent is a primary chimeric rodent or a passaged chimeric rodent.
6. The method according to claim 4 or 5, wherein the animal is reared with the adjusted feed for one week or more.
7. Including a step of feeding a chimeric rodent animal in which part or all of the hepatocytes have been replaced with human hepatocytes, with a adjusted feed having one or more of the following characteristics (a), (b), and (c): , A method of producing a human non-alcoholic steatohepatitis model.
   (a) The content of choline or its salt is 0.01% by weight or less based on the total amount of the adjusted feed
   (b) The content of methionine is 0.5% by weight or less based on the total weight of the adjusted feed
   (c) The fat content is at least 25 kcal% with respect to the total heat of protein, carbohydrate and fat contained in the adjusted feed
8. 8. The method according to claim 7, wherein the chimeric rodent is a primary chimeric rodent or a passaged chimeric rodent.
9. The method according to claim 7 or 8, wherein the animal is reared with the adjusted feed for one week or more.
10. Including a step of feeding a chimeric rodent animal in which part or all of the hepatocytes have been replaced with human hepatocytes, with a adjusted feed having one or more of the following characteristics (a), (b), and (c): The test substance is administered to an animal obtained by the method and the degree of symptoms of non-alcoholic steatohepatitis before and after administration are compared, or a chimeric rodent which has received the test substance and the test substance are administered And d) comparing the degree of symptoms of nonalcoholic steatohepatitis with a chimeric rodent, and a method of screening for a therapeutic agent for nonalcoholic steatohepatitis human.
    (a) The content of choline or its salt is 0.01% by weight or less based on the total amount of the adjusted feed
    (b) The content of methionine is 0.5% by weight or less based on the total weight of the adjusted feed
    (c) The fat content is at least 25 kcal% with respect to the total heat of protein, carbohydrate and fat contained in the adjusted feed
11. 11. The method of claim 10, wherein the chimeric rodent is a primary chimeric rodent or a passaged chimeric rodent.
12. The method according to claim 10 or 11, wherein the animal is reared for at least one week with the adjusted feed.
13. A human simple fatty liver model, comprising a passage-transplanted chimeric rodent animal in which part or all of the hepatocytes are replaced with human hepatocytes.

Images