WO2019086646A1 - Feline leukemia virus vaccine - Google Patents
Feline leukemia virus vaccine Download PDFInfo
- Publication number
- WO2019086646A1 WO2019086646A1 PCT/EP2018/080094 EP2018080094W WO2019086646A1 WO 2019086646 A1 WO2019086646 A1 WO 2019086646A1 EP 2018080094 W EP2018080094 W EP 2018080094W WO 2019086646 A1 WO2019086646 A1 WO 2019086646A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- feline
- felv
- virus
- vaccine
- antigen
- Prior art date
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
- A61K39/21—Retroviridae, e.g. equine infectious anemia virus
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/525—Virus
- A61K2039/5256—Virus expressing foreign proteins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/525—Virus
- A61K2039/5258—Virus-like particles
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/545—Medicinal preparations containing antigens or antibodies characterised by the dose, timing or administration schedule
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/55—Medicinal preparations containing antigens or antibodies characterised by the host/recipient, e.g. newborn with maternal antibodies
- A61K2039/552—Veterinary vaccine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/70—Multivalent vaccine
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/13011—Gammaretrovirus, e.g. murine leukeamia virus
- C12N2740/13034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/13011—Gammaretrovirus, e.g. murine leukeamia virus
- C12N2740/13071—Demonstrated in vivo effect
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
- C12N2770/00011—Details
- C12N2770/36011—Togaviridae
- C12N2770/36111—Alphavirus, e.g. Sindbis virus, VEE, EEE, WEE, Semliki
- C12N2770/36141—Use of virus, viral particle or viral elements as a vector
- C12N2770/36143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
Definitions
- the present invention relates to new vaccines for feline leukemia virus.
- Feline leukemia virus is a retrovirus that infects domestic cats, resulting in significant morbidity and mortality worldwide. Though predominantly transmitted through saliva, FeLV also has been reported to spread through contact with body fluids [Pacitti et al., Vet Rec 1 18:381-384 (1986)
- the clinical signs in cats observed during FeLV infections include: cytoproliferative disorders (lymphoid or myeloid tumors), cytosuppressive disorders (infectious diseases associated with immunosuppression, anemia, myelosuppression), inflammatory disorders, neurological disorders, abortions, and enteritis [Hoover et al., J Am Vet Med Assoc 199:1287-1297 (1991 ); Levy and Crawford, Textbook of Veterinary Internal Medicine, 6th ed (Ettinger SJ, Feldman EC, eds.) WB Saunders, Philadelphia, PA.
- the RNA genome of FeLV encodes only three genes: (i) an ENV gene, which encodes the envelope glycoprotein, (ii) a GAG gene, which encodes the major structural components of the virus, and (iii) a POL gene, which encodes the RNA polymerase [Thomsen et ai, Journal of General Wro/ogy 73:1819-1824 (1992)].
- the FeLV envelope (ENV) gene encodes a gp85 precursor protein which is proteolytically processed by one or more cellular enzymes to yield the major envelope glycoprotein gp70 and the associated transmembrane protein p15E
- the transmembrane protein p15E contains a sequence conserved among gammaretroviruses with immunosuppressive properties [Mathes et al., Nature 274:687-689 (1978)]. Recently, The European Medicines Agency's
- CVMP Committee for Medicinal Products for Veterinary Use
- a vaccine comprising a recombinant p45 FeLV-envelope antigen derived from the gp70 surface glycoprotein of the FeLV subgroup A that is expressed in Escherichia coli as active substance.
- the FeLV envelope glycoprotein is the target of FeLV-specific cytotoxic T cell responses, as well as neutralizing antibodies and accordingly, one of the major immunogens of FeLV [Flynn et al., J. Virol. 76(5): 2306-2315 (2002)].
- Assays for antigenemia include p27 enzyme-linked immunosorbent assay (ELISA), virus isolation, and immunofluorescence assays [Hoover et al., J Am Vet Med Assoc 199:1287-1297 (1991 ); Rojko and Kociba, J Am Vet Med Assoc 199:1305-1310 (1991 )]. Such tests remain helpful in clinical applications, as well as for determining whether the clinical disease is a result of an actively circulating virus.
- ELISA enzyme-linked immunosorbent assay
- RP alphavirus-derived replicon RNA particles
- VEE Venezuelan equine encephalitis virus
- SIN Sindbis
- SFV Semliki Forest virus
- RP vaccines deliver propagation-defective alphavirus RNA replicons into host cells and result in the expression of the desired antigenic transgene(s) in vivo [Pushko et al., Virology 239(2):389-401 (1997)]. RPs have an attractive safety and efficacy profile when compared to some traditional vaccine formulations [Vander Veen, et al. Anim Health Res Rev. 13(1 ):1 -9. (2012) ]. The RP platform has been used to encode pathogenic antigens and is the basis for several USDA-licensed vaccines for swine and poultry.
- the present invention provides vectors that encode one or more feline leukemia virus (FeLV) antigens.
- Such vectors can be used in immunogenic compositions comprising these vectors.
- the immunogenic compositions of the present invention may be used in vaccines.
- a vaccine protects the vaccinated subject ⁇ e.g., mammal) against FeLV.
- the vaccinated subject is a feline.
- the vaccinated subject is a domestic cat.
- the present invention further provides combination vaccines for eliciting protective immunity against FeLV and other diseases, e.g., other feline infectious diseases. Methods of making and using the immunogenic compositions and vaccines of the present invention are also provided.
- the vector is an alphavirus RNA replicon particle that encodes one or more antigens that originate from a feline pathogen.
- the feline pathogen is FeLV.
- the feline pathogen is FeLV.
- the alphavirus RNA replicon particles encode a FeLV glycoprotein (gp85). In related embodiments, the alphavirus RNA replicon particles encode an antigenic fragment of gp85. In a particular embodiment of this type, the antigenic fragment of gp85 is the FeLV glycoprotein gp70. In certain related embodiments, the antigenic fragment of gp85 is the FeLV glycoprotein gp45. In still more particular embodiments, the alphavirus RNA replicon particle is a Venezuelan Equine Encephalitis (VEE) alphavirus RNA replicon particle. In yet more specific embodiments the VEE alphavirus RNA replicon particle is a TC-83 VEE alphavirus RNA replicon particle.
- VEE Venezuelan Equine Encephalitis
- the alphavirus RNA replicon particle is a Sindbis (SIN) alphavirus RNA replicon particle. In still other embodiments, the alphavirus RNA replicon particle is a Semliki Forest virus (SFV) alphavirus RNA replicon particle.
- a naked DNA vector comprises a nucleic acid construct that encodes one or more antigens that originate from a feline pathogen. In particular embodiments of this type, the naked DNA vectors comprise a nucleic acid construct that encodes a FeLV gp85, or antigenic fragment thereof. In certain embodiments an alphavirus RNA replicon particle of the present invention encodes one or more FeLV antigens or antigenic fragments thereof.
- the alphavirus RNA replicon particles encode two to four FeLV antigens or antigenic fragments thereof.
- immunogenic compositions comprise alphavirus RNA replicon particles that encode one or more FeLV antigens or antigenic fragments thereof.
- the immunogenic compositions comprise alphavirus RNA replicon particles encodes two to four FeLV antigens or antigenic fragments thereof.
- the alphavirus RNA replicon particles encode an FeLV glycoprotein (gp85) or an antigenic fragment thereof.
- the antigenic fragment of gp85 is the FeLV glycoprotein gp70.
- the antigenic fragment of gp85 is the FeLV glycoprotein gp45.
- the immunogenic composition comprises
- the immunogenic composition comprises two or more sets of alphavirus RNA replicon particles.
- one set of alphavirus RNA replicon particles encodes a particular antigen, whereas the other set of alphavirus RNA replicon particles encodes a second antigen.
- the first set of alphavirus RNA replicon particles encode the FeLV antigen or an antigenic fragment thereof
- the second set of alphavirus RNA replicon particles encode a feline calicivirus (FCV) antigen or an antigenic fragment thereof.
- FCV antigen originates from a virulent systemic feline calicivirus (VS-FCV) isolate.
- FCV antigen originates from a classical (F9-like) feline calicivirus isolate.
- the second set of alphavirus RNA replicon particles encode two FCV antigens, one of which originates from a virulent systemic feline calicivirus isolate, whereas the other originates from a classical (F9- like) feline calicivirus isolate.
- the immunogenic composition comprises one set of alphavirus RNA replicon particles that encode a first antigen, another set of alphavirus RNA replicon particles that encode a second antigen, and a third set of alphavirus RNA replicon particles that encode a third antigen.
- the first set of alphavirus RNA replicon particles encode the FeLV antigen or an antigenic fragment thereof
- the second set of alphavirus RNA replicon particles encode a feline calicivirus (FCV) antigen which originates from a virulent systemic feline calicivirus or an antigenic fragment thereof
- the third set of alphavirus RNA replicon particles encode a feline calicivirus (FCV) antigen which originates from a classical (F9-like) feline calicivirus or an antigenic fragment thereof.
- compositions comprise multiple sets ⁇ e.g., 2-10) of alphavirus RNA replicon particles, in which the first set of alphavirus RNA replicon particles encode the FeLV antigen or an antigenic fragment thereof, the one or more other sets of alphavirus RNA replicon particles can encode one or more non-FeLV antigens.
- the non-FeLV antigen is a protein antigen that originates from feline herpesvirus (FHV).
- the non-FeLV antigen is a protein antigen that originates from feline calicivirus (FCV).
- FCV feline herpesvirus
- the non-FeLV antigen is a protein antigen that originates from feline pneumovirus (FPN). In still other embodiments, the non-FeLV antigen is a protein antigen that originates from feline parvovirus (FPV). In yet other embodiments, the non-FeLV antigen is a protein antigen that originates from feline infectious peritonitis virus (FIPV). In still other embodiments, the non-FeLV antigen is a protein antigen that originates from feline immunodeficiency virus. In still other embodiments, the non-FeLV antigen is a protein antigen that originates from borna disease virus (BDV).
- FPN feline pneumovirus
- FPV feline parvovirus
- FEPV feline infectious peritonitis virus
- the non-FeLV antigen is a protein antigen that originates from feline immunodeficiency virus. In still other embodiments, the non-FeLV antigen is a protein antigen that originates from borna disease
- the non-FeLV antigen is a protein antigen that originates from feline influenza virus. In still other embodiments, the non-FeLV antigen is a protein antigen that originates from feline panleukopenia virus (FPLV). In yet other embodiments the non-FeLV antigen is a protein antigen that originates from feline coronavirus (FCoV). In still other embodiments the non-FeLV antigen is a protein antigen that originates from feline rhinotracheitis virus (FVR). In yet other embodiments the non-FeLV antigen is a protein antigen that originates from feline influenza virus. In still other embodiments, the non-FeLV antigen is a protein antigen that originates from feline panleukopenia virus (FPLV). In yet other embodiments the non-FeLV antigen is a protein antigen that originates from feline coronavirus (FCoV). In still other embodiments the non-FeLV antigen is a protein antigen that originates from feline rhinotrac
- the present invention also includes all of the nucleic acid constructs of the present invention including synthetic messenger RNA, RNA replicons, as well as all of the alphavirus RNA replicon particles of the present invention, the naked DNA vectors, and the immunogenic compositions and/or vaccines that comprise the nucleic acid constructs ⁇ e.g., synthetic messenger RNA, RNA replicons), the alphavirus RNA replicon particles, and/or the naked DNA vectors of the present invention.
- a nucleic acid construct of the present invention encodes one or more FeLV antigens or antigenic fragments thereof.
- the nucleic acid construct encodes two to four FeLV antigens or antigenic fragments thereof.
- alphavirus RNA replicon particles comprise a nucleic acid construct that encodes one or more FeLV antigens or antigenic fragments thereof.
- alphavirus RNA replicon particles comprise a nucleic acid construct that encodes two to four FeLV antigens or antigenic fragments thereof.
- the immunogenic compositions comprise alphavirus RNA replicon particles that comprise a nucleic acid construct that encodes two to four FeLV antigens or antigenic fragments thereof.
- the alphavirus RNA replicon particles comprise a nucleic acid construct encoding an FeLV glycoprotein (gp85) or an antigenic fragment thereof.
- the antigenic fragment of gp85 is the FeLV glycoprotein gp70.
- the antigenic fragment of gp85 is the FeLV glycoprotein gp45.
- the immunogenic composition comprises alphavirus RNA replicon particles that are Venezuelan Equine Encephalitis (VEE) alphavirus RNA replicon particles.
- VEE alphavirus RNA replicon particles are TC-83 VEE alphavirus RNA replicon particles.
- the immunogenic composition comprises two or more sets of alphavirus RNA replicon particles.
- one set of alphavirus RNA replicon particles comprises a first nucleic acid construct
- the other set of alphavirus RNA replicon particles comprise a second nucleic acid construct.
- the first nucleic acid construct encodes the FeLV antigen or an antigenic fragment thereof
- the second nucleic acid construct encodes a feline calicivirus (FCV) antigen or an antigenic fragment thereof.
- the FCV antigen originates from a virulent systemic feline calicivirus (VS-FCV) isolate.
- the FCV antigen originates from a classical (F9-like) feline calicivirus isolate.
- the second nucleic acid construct encodes two FCV antigens, one of which originates from a virulent systemic feline calicivirus isolate, whereas the other originates from a classical (F9-like) feline calicivirus isolate.
- the immunogenic composition comprises one set of alphavirus RNA replicon particles that comprise a first nucleic acid construct, another set of alphavirus RNA replicon particles that comprise a second nucleic acid construct, and a third set of alphavirus RNA replicon particles that comprise a third nucleic acid construct.
- the first nucleic acid construct encodes the FeLV antigen or an antigenic fragment thereof
- the second nucleic acid construct encodes a feline calicivirus (FCV) antigen which originates from a virulent systemic feline calicivirus or an antigenic fragment thereof
- the third nucleic acid construct encodes a feline calicivirus (FCV) antigen which originates from a classical (F9-like) feline calicivirus or an antigenic fragment thereof.
- the immunogenic composition comprises one set of alphavirus RNA replicon particles that comprise a first nucleic acid construct, another set of alphavirus RNA replicon particles that comprise a second nucleic acid construct, a third set of alphavirus RNA replicon particles that comprise a third nucleic acid construct, and a fourth set of alphavirus RNA replicon particles that comprise a fourth nucleic acid construct.
- the immunogenic composition comprises one set of alphavirus RNA replicon particles that comprise a first nucleic acid construct, another set of alphavirus RNA replicon particles that comprise a second nucleic acid construct, a third set of alphavirus RNA replicon particles that comprise a third nucleic acid construct, and a fourth set of alphavirus RNA replicon particles that comprise a fourth nucleic acid construct.
- the immunogenic composition comprises one set of alphavirus RNA replicon particles that comprise a first nucleic acid construct, another set of alphavirus RNA
- immunogenic composition comprises a set of alphavirus RNA replicon particles that comprise a first nucleic acid construct, another set of alphavirus RNA replicon particles that comprise a second nucleic acid construct, a third set of alphavirus RNA replicon particles that comprise a third nucleic acid construct, a fourth set of alphavirus RNA replicon particles that comprise a fourth nucleic acid construct ,and a fifth set of alphavirus RNA replicon particles that comprise a fifth nucleic acid construct.
- the nucleotide sequences of the first nucleic acid construct, the second nucleic acid construct, third nucleic acid construct, the fourth nucleic acid construct, and the fifth nucleic acid construct are all different.
- an immunogenic composition of the present invention can contain alphavirus RNA replicon particles that comprise a nucleic acid construct that encodes at least one non-FeLV antigen for eliciting protective immunity to a non- FeLV pathogen.
- the non-FeLV antigen is a protein antigen that originates from feline herpesvirus (FHV).
- the non-FeLV antigen is a protein antigen that originates from feline calicivirus (FCV).
- the non-FeLV antigen is a protein antigen that originates from feline pneumovirus (FPN).
- the non-FeLV antigen is a protein antigen that originates from feline parvovirus (FPV). In yet other embodiments, the non-FeLV antigen is a protein antigen that originates from feline infectious peritonitis virus (FIPV). In still other embodiments, the non-FeLV antigen is a protein antigen that originates from feline immunodeficiency virus. In still other embodiments, the non-FeLV antigen is a protein antigen that originates from borna disease virus (BDV). In yet other embodiments, the non-FeLV antigen is a protein antigen that originates from feline influenza virus.
- FFPV feline parvovirus
- FFPV feline infectious peritonitis virus
- BDV borna disease virus
- the non-FeLV antigen is a protein antigen that originates from feline influenza virus.
- the non-FeLV antigen is a protein antigen that originates from feline panleukopenia virus (FPLV). In yet other embodiments the non-FeLV antigen is a protein antigen that originates from feline coronavirus (FCoV). In still other embodiments the non- FeLV antigen is a protein antigen that originates from feline rhinotracheitis virus (FVR). In still other embodiments the non-FeLV antigen is a protein antigen that originates from Chlamydophila felis.
- FPLV feline panleukopenia virus
- FCoV feline coronavirus
- FVR feline rhinotracheitis virus
- the non-FeLV antigen is a protein antigen that originates from Chlamydophila felis.
- the present invention further provides combination immunogenic compositions and/or vaccines (multivalent vaccines) that include alphavirus RNA replicon particles that encode an antigen or antigenic fragment thereof originating from FeLV together with one or more modified live ⁇ e.g., attenuated) or killed feline pathogens.
- the immunogenic compositions comprise a modified live or killed Chlamydophila felis combined with alphavirus RNA replicon particles that encode an antigen or antigenic fragment thereof originating from FeLV.
- the immunogenic compositions comprise a modified live or killed feline rhinotracheitis Virus (FVR) combined with alphavirus RNA replicon particles that encode an antigen or antigenic fragment thereof originating from FeLV.
- FVR feline rhinotracheitis Virus
- the immunogenic compositions comprise a modified live or killed feline calicivirus (FCV) combined with alphavirus RNA replicon particles that encode an antigen or antigenic fragment thereof originating from FeLV.
- the immunogenic compositions comprise a modified live or killed feline panleukopenia virus (FPL) combined with alphavirus RNA replicon particles that encode an antigen or antigenic fragment thereof originating from FeLV.
- the immunogenic compositions comprise a modified live or killed Chlamydophila felis, a modified live or killed FVR, a modified live or killed FCV, a modified live or killed FPL, and alphavirus RNA replicon particles that encode an antigen or antigenic fragment thereof originating from FeLV.
- the feline antigen of the FeLV is the FeLV viral
- vaccines comprise an
- the FeLV antigen is the FeLV glycoprotein (gp85).
- the FeLV glycoprotein gp85 comprises an amino acid sequence comprising 95% identity or more with the amino acid sequence of SEQ ID NO: 2.
- the FeLV glycoprotein (gp85) comprises the amino acid sequence of SEQ ID NO: 2.
- the FeLV glycoprotein (gp85) is encoded by the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 10.
- the FeLV glycoprotein gp70 comprises an amino acid sequence comprising 95% identity or more with the amino acid sequence of SEQ ID NO: 4.
- the FeLV glycoprotein (gp85) comprises the amino acid sequence of SEQ ID NO: 4.
- the FeLV glycoprotein (gp70) is encoded by the nucleotide sequence of SEQ ID NO: 3 or SEQ ID NO: 1 1 .
- the present invention further comprises vaccines and multivalent vaccines comprising the immunogenic compositions of the present invention.
- the vaccines are nonadjuvanted vaccine.
- the vaccine aids in the prevention of disease due to FeLV.
- antibodies are induced in a feline subject when the feline is immunized with the vaccine.
- the present invention also provides methods of immunizing a feline against a feline pathogen, e.g., FeLV, comprising administering to the feline an immunologically effective amount of a vaccine or multivalent of the present invention.
- the vaccine is administered via intramuscular injection.
- the vaccine is administered via subcutaneous injection.
- the vaccine is administered via intravenous injection.
- the vaccine is administered via intradermal injection.
- the vaccine is administered via oral administration.
- the vaccine is administered via intranasal administration.
- the feline is a domestic cat.
- the vaccines and multivalent vaccines of the present invention can be administered as a primer vaccine and/or as a booster vaccine.
- a primer vaccine and/or as a booster vaccine.
- a vaccine of the present invention is administered as a one shot vaccine (one dose), without requiring subsequent administrations.
- the primer vaccine and the booster vaccine can be administered by the identical route.
- the primer vaccine and the booster vaccine are both administered by subcutaneous injection.
- the administration of the primer vaccine can be performed by one route and the booster vaccine by another route.
- the primer vaccine can be administered by subcutaneous injection and the booster vaccine can be administered orally.
- the invention further provides for a method of immunizing a feline against FeLV comprising injecting the feline with an immunologically effective amount of the above described inventive vaccines.
- the vaccines can include from about 1 x 10 4 to about 1 x 10 10 RPs or higher, for example.
- the vaccines can include from about 1 x 10 5 to about 1 x 10 9 RPs.
- the vaccines can include from about 1 x 10 6 to about 1 x 10 8 RPs.
- the feline is a domestic cat.
- the vaccines of the present invention are administered in 0.05 ml_ to 3 ml_ doses.
- the dose administered is 0.1 ml_ to 2 ml_s.
- the dose administered is 0.2 ml_ to 1 .5 ml_s.
- the dose administered is 0.3 to 1 .0 ml_s.
- the dose administered is 0.4 ml_ to 0.8 ml_s.
- the dose administered is 0.5 ml_ to 1 .5 ml_s.
- the present invention provides an improved, safe nonadjuvanted FeLV vaccine.
- the vaccines of the present invention do not induce feline injection-site sarcomas, yet still provide protection to the vaccinates from the debilitating disease state caused by FeLV infection as efficaciously as an inactivated whole-virus adjuvanted vaccine.
- the vaccine compositions of the present invention include an immunologically effective amount of a vector encoding an antigen from one or more strains of feline leukemia virus that aids in eliciting protective immunity in the recipient vaccinated animal.
- the present invention provides new immunologic compositions to improve the reliability of vaccination to aid in the reduction of antigenemia in a feline infected by FeLV and to thereby yield a transient antigenemia and/or lead to the elimination of the infection.
- the vaccines comprise an alphavirus RNA replicon particle (RP) encoding the FeLV viral glycoprotein (gp85).
- the vaccines comprise alphavirus RNA replicon particles (RPs) that comprise the capsid protein and glycoproteins of Venezuelan Equine Encephalitis Virus (VEE) and encode the FeLV viral glycoprotein (gp85) and/or an antigenic fragment thereof ⁇ e.g., gp70 or gp45).
- the vaccines comprise alphavirus RNA replicon particles (RPs) that comprise the capsid protein and glycoproteins of the avirulent TC-83 strain of VEE and encode the FeLV viral glycoprotein (gp85) and/or an antigenic fragment thereof (e.g., gp70 or gp45).
- RPs alphavirus RNA replicon particles
- the vaccines comprise naked DNA vectors that encode the FeLV viral glycoprotein (gp85) and/or an antigenic fragment thereof ⁇ e.g., gp70 or gp45).
- the vaccines of the present invention can be administered to a feline in the absence of an adjuvant and still effectively aid in the protection of the vaccinated feline against FeLV.
- a polypeptide includes reference to one or more of such polypeptides.
- reference to an "alphavirus RNA replicon particle” includes reference to a plurality of such alphavirus RNA replicon particles, unless otherwise indicated.
- a composition containing "approximately” 1 x 10 8 alphavirus RNA replicon particles per milliliter contains from 0.5 x 10 8 to 1 .5 x 10 8 alphavirus RNA replicon particles per milliliter.
- feline refers to any member of the Felidae family. Domestic cats, pure-bred and/or mongrel companion cats, and wild or feral cats are all felines.
- replicon refers to a modified RNA viral genome that lacks one or more elements ⁇ e.g., coding sequences for structural proteins) that if they were present, would enable the successful propagation of the parental virus in cell cultures or animal hosts. In suitable cellular contexts, the replicon will amplify itself and may produce one or more sub-genomic RNA species.
- alphavirus RNA replicon particle is an alphavirus-derived RNA replicon packaged in structural proteins, e.g., the capsid and glycoproteins, which also are derived from an alphavirus, e.g., as described by Pushko et al., [Virology 239(2):389-401 (1997)].
- An RP cannot propagate in cell cultures or animal hosts (without a helper plasmid or analogous component), because the replicon does not encode the alphavirus structural components (e.g., capsid and glycoproteins).
- non-FeLV is used to modify terms such as pathogen, and/or antigen (or immunogen) to signify that the respective pathogen, and/or antigen (or immunogen) is neither an FeLV pathogen nor a FeLV antigen (or immunogen) and that a non-FeLV protein antigen (or immunogen) does not originate from an FeLV.
- oil from is used interchangeably with respect to a given protein antigen and the pathogen or strain of that pathogen that naturally encodes it, and as used herein signify that the unmodified and/or truncated amino acid sequence of that given protein antigen is encoded by that pathogen or strain of that pathogen.
- the coding sequence within a nucleic acid construct of the present invention for a protein antigen originating from a pathogen may have been genetically manipulated so as to result in a modification and/or truncation of the amino acid sequence of the expressed protein antigen relative to the corresponding sequence of that protein antigen in the pathogen or strain of pathogen (including naturally attenuated strains) it originates from.
- “eliciting protective immunity to”, “aids in prevention of disease”, and “aids in the protection” do not require complete protection from any indication of infection.
- “aids in the protection” can mean that the protection is sufficient such that, after challenge, symptoms of the underlying infection are at least reduced, and/or that one or more of the underlying cellular, physiological, or biochemical causes or mechanisms causing the symptoms are reduced and/or eliminated.
- “reduced,” as used in this context, means relative to the state of the infection, including the molecular state of the infection, not just the physiological state of the infection.
- a "vaccine” is a composition that is suitable for application to an animal, e.g., feline (including, in certain embodiments, humans, while in other embodiments being specifically not for humans) comprising one or more antigens typically combined with a pharmaceutically acceptable carrier such as a liquid containing water, which upon administration to the animal induces an immune response strong enough to minimally aid in the protection from a disease arising from an infection with a wild-type micro-organism, i.e., strong enough for aiding in the prevention of the disease, and/or preventing, ameliorating or curing the disease.
- feline including, in certain embodiments, humans, while in other embodiments being specifically not for humans
- a pharmaceutically acceptable carrier such as a liquid containing water
- a multivalent vaccine is a vaccine that comprises two or more different antigens.
- the multivalent vaccine stimulates the immune system of the recipient against two or more different pathogens.
- adjuvant and “immune stimulant” are used interchangeably herein, and are defined as one or more substances that cause stimulation of the immune system.
- an adjuvant is used to enhance an immune response to one or more vaccine antigens/isolates.
- adjuvants are agents that nonspecifically increase an immune response to a particular antigen, thus reducing the quantity of antigen necessary in any given vaccine, and/or the frequency of injection necessary in order to generate an adequate immune response to the antigen of interest.
- an adjuvant is used to enhance an immune response to one or more vaccine antigens/isolates.
- the American Association of Feline Practitioners Feline Vaccination Guidelines suggest the use of nonadjuvanted FeLV vaccines [AAFP Feline Advisory Panel, 15: 785-808 (2013)].
- nonadjuvanted vaccine is a vaccine or a multivalent vaccine that does not contain an adjuvant.
- the term "pharmaceutically acceptable” is used adjectivally to mean that the modified noun is appropriate for use in a pharmaceutical product.
- an excipient in a pharmaceutical vaccine when it is used, for example, to describe an excipient in a pharmaceutical vaccine, it characterizes the excipient as being compatible with the other ingredients of the composition and not disadvantageously deleterious to the intended recipient animal, e.g., feline.
- Parenteral administration includes subcutaneous injections, submucosal injections, intravenous injections, intramuscular injections, intradermal injections, and infusion.
- antigenic fragment in regard to a particular protein
- a protein antigen is a fragment of that protein that is antigenic, i.e., capable of specifically interacting with an antigen recognition molecule of the immune system, such as an immunoglobulin (antibody) or T cell antigen receptor.
- an antigenic fragment of an FeLV viral glycoprotein (gp85) is a fragment of the gp85 protein that is antigenic.
- an antigenic fragment of the present invention is immunodominant for antibody and/or T cell receptor recognition.
- an antigenic fragment with respect to a given protein antigen is a fragment of that protein that retains at least 25% of the antigenicity of the full length protein.
- an antigenic fragment retains at least 50% of the antigenicity of the full length protein. In more preferred embodiments, an antigenic fragment retains at least 75% of the antigenicity of the full length protein.
- Antigenic fragments can be as small as 20 amino acids or at the other extreme, be large fragments that are missing as little as a single amino acid from the full-length protein. In particular embodiments the antigenic fragment comprises 25 to 150 amino acid residues. In other embodiments, the antigenic fragment comprises 50 to 250 amino acid residues.
- the gp45 glycoprotein and the gp70 glycoprotein are antigenic fragments of the gp85 glycoprotein.
- one amino acid sequence is 100% “identical” or has 100% “identity” to a second amino acid sequence when the amino acid residues of both sequences are identical. Accordingly, an amino acid sequence is 50% “identical” to a second amino acid sequence when 50% of the amino acid residues of the two amino acid sequences are identical.
- the sequence comparison is performed over a contiguous block of amino acid residues comprised by a given protein, e.g., a protein, or a portion of the polypeptide being compared. In a particular embodiment, selected deletions or insertions that could otherwise alter the correspondence between the two amino acid sequences are taken into account.
- nucleotide and amino acid sequence percent identity can be determined using C, MacVector (MacVector, Inc. Cary, NC 27519), Vector NTI (Informax, Inc. MD), Oxford Molecular Group PLC (1996) and the Clustal W algorithm with the alignment default parameters, and default parameters for identity. These commercially available programs can also be used to determine sequence similarity using the same or analogous default parameters. Alternatively, an
- Advanced Blast search under the default filter conditions can be used, e.g., using the GCG (Genetics Computer Group, Program Manual for the GCG Package, Version 7, Madison, Wisconsin) pileup program using the default parameters.
- GCG Genetics Computer Group, Program Manual for the GCG Package, Version 7, Madison, Wisconsin
- inactivated microorganism is an organism which is capable of eliciting an immune response in an animal, but is not capable of infecting the animal.
- An antigen of the present invention ⁇ e.g., an inactivated feline panleukopenia virus) may be
- inactivated feline calicivirus isolates combined with an RP of the present invention are inactivated by binary ethyleneimine.
- the alphavirus RNA replicon particles of the present invention may be lyophilized and rehydrated with a sterile water diluent.
- the alphavirus RNA replicon particles when stored separately, but intend to be mixed with other vaccine components prior to administration, the alphavirus RNA replicon particles can be stored in the stabilizing solution of those components, e.g., a high sucrose solution.
- a vaccine of the present invention can be readily administered by any standard route including intravenous, intramuscular, subcutaneous, oral, intranasal, intradermal, and/or intraperitoneal vaccination. The skilled artisan will appreciate that the vaccine composition is preferably formulated appropriately for each type of recipient animal and route of administration.
- the present invention also provides methods of immunizing a feline against FeLV and/or other feline pathogens.
- One such method comprises injecting a feline with an immunologically effective amount of a vaccine of the present invention, so that the feline produces appropriate FeLV antibodies.
- the present invention also provides multivalent vaccines.
- the coding sequence of a protein antigen or antigenic fragment thereof, or combination of such coding sequences of protein antigens useful in a feline vaccine can be added to an alphavirus RNA replicon particle (RP) or combined in the same RP as one that encodes a feline antigen of the FeLV [e.g., the FeLV viral glycoprotein (gp85)] in the vaccine.
- RP alphavirus RNA replicon particle
- gp85 the FeLV viral glycoprotein
- pathogens examples include feline rhinotracheitis Virus (FVR), feline calicivirus (FCV), feline panleukopenia Virus (FPL) feline herpesvirus (FHV), other FeLV strains, feline parvovirus (FPV), feline infectious peritonitis virus (FIPV), feline
- BDV borna disease virus
- rabies virus feline influenza virus
- canine influenza virus canine influenza virus
- avian influenza canine pneumovirus
- a coding sequence for a capsid protein or analogous protein from one or more of these feline or canine pathogens can be inserted into the same RP as the FeLV antigen.
- a coding sequence for a capsid protein or analogous protein from one or more of these feline or canine pathogens can be inserted into one or more other RPs, which can be combined with the RP that encodes the FeLV antigen in a vaccine.
- an alphavirus RNA replicon particle(RP) that encodes a feline antigen of the FeLV can be added together with one or more other live, attenuated virus isolates such as a live attenuated other FCV strain, a live attenuated feline herpesvirus and/or a live attenuated feline parvovirus and/or a live, attenuated feline leukemia virus, and/or a live, attenuated feline infectious peritonitis virus and/or a live, attenuated feline immunodeficiency virus and/or a live, attenuated borna disease virus and/or a live, attenuated rabies virus, and/or a live, attenuated feline influenza virus and/or a live, attenuated canine influenza virus, and/or a live, attenuated avian influenza, and/or a live, attenuated canine influenza virus, and/or a live, attenuated avian influenza,
- bronchiseptica and/or a live, attenuated Bartonella spp. can also be included in such multivalent vaccines.
- an alphavirus RNA replicon particle (RP) that encodes a feline antigen of the FeLV can be added together with one or more other killed virus isolates such as a killed FCV strain, and/or a killed feline herpesvirus and/or a killed feline parvovirus and/or a killed feline leukemia virus, and/or a killed feline infectious peritonitis virus and/or a killed feline immunodeficiency virus and/or a killed borna disease virus and/or a killed rabies virus, and/or a killed feline influenza virus and/or a killed canine influenza virus, and/or a killed avian influenza virus, and/or a killed canine pneumovirus, and/or a killed feline pneumovirus.
- RP alphavirus RNA replicon particle
- bacterins of Chlamydophila felis, and/or Bordetella bronchiseptica and/or Bartonella spp. can also be included in such multivalent vaccines.
- Feline Leukemia Virus envelope glycoprotein SEQ ID NO: 1 atggagtcaccaacacaccctaaaccttctaaagacaaaaccctctcgtggaatctcgccttccttgt gggcatcctgttcacaatcgacatcggcatggccaacccttcgccgcatcagatctacaatgtgacat gggtcattactaatgtgcagacaaacacccaggcaaatgctacttctatgcttggtactctgactgat gcttatccaaccctgcacgtcgacctttgcgatctcgtcggtgacacatgggagcccatcgtgtgaa tccaactaatgtcaaacatggtgccaggtgccaggtattctctagcaaatacgggtgtaagaccactgatcggggt
- Feline Calicivirus (F9-like) capsid SEQ ID NO: 7
- Feline Calicivirus (F9-like) capsid SEQ ID NO: 8
- Feline Calicivirus (F9-like) capsid SEQ ID NO: 13
- RNA viruses have been used as vector-vehicles for introducing vaccine antigens, which have been genetically engineered into their genomes. However, their use to date has been limited primarily to incorporating viral antigens into the RNA virus and then introducing the virus into a recipient host. The result is the induction of protective antibodies against the incorporated viral antigens.
- Alphavirus RNA replicon particles have been used to encode pathogenic antigens. Such alphavirus replicon platforms have been developed from several different
- alphaviruses including Venezuelan equine encephalitis virus (VEE) [Pushko et al., Virology 239:389-401 (1997)], Sindbis (SIN) [Bredenbeek et ai, Journal of Virology 67:6439-6446 (1993) the contents of which are hereby incorporated herein in their entireties], and Semliki Forest virus (SFV) [Liljestrom and Garoff, Biotechnology (NY) 9:1356-1361 (1991 ), the contents of which are hereby incorporated herein in their entireties].
- alphavirus RNA replicon particles are the basis for several USDA-licensed vaccines for swine and poultry. These include: Porcine Epidemic Diarrhea Vaccine, RNA Particle (Product Code 19U5.P1 ), Swine
- RNA Particle Prescription Product
- An amino acid sequence for FeLV gp85 were used to generate codon- optimized (feline codon usage) nucleotide sequences in silico. Optimized sequences were prepared as synthetic DNA by a commercial vendor (ATUM, Newark, CA). Accordingly, a synthetic gene was designed based on the amino acid sequence of gp85.
- the construct (gp85_wt) was wild-type amino acid sequence [SEQ ID NO: 2], codon-optimized for feline, with flanking sequence appropriate for cloning into the alphavirus replicon plasmid.
- VEE replicon vectors designed to express FeLV gp85 were constructed as previously described [see, U.S. 9,441 ,247 B2; the contents of which are hereby incorporated herein by reference in their entireties], with the following modifications.
- the TC-83-derived replicon vector "pVEK” [disclosed and described in
- U.S. 9,441 ,247 B2] was digested with restriction enzymes Ascl and Pad.
- the synthetic gene cassette was then ligated into the digested pVEK vector, and the resulting clone was re-named "pVHV- FeLV gp85".
- the "pVHV" vector nomenclature was chosen to refer to pVEK-derived replicon vectors containing transgene cassettes cloned via the Ascl and Pad sites in the multiple cloning site of pVEK.
- RNA replicon particles Production of TC-83 RNA replicon particles (RP) was conducted according to methods previously described [U.S. 9,441 ,247 B2 and U.S. 8,460,913 B2; the contents of which are hereby incorporated herein by reference]. Briefly, pVHV replicon vector DNA and helper DNA plasm ids were linearized with Not! restriction enzyme prior to in vitro transcription using MegaScript T7 RNA polymerase and cap analog (Promega, Madison, Wl). Importantly, the helper RNAs used in the production lack the VEE subgenomic promoter sequence, as previously described [Kamrud et ai, J Gen Virol. 91 (Pt 7):1723-1727 (2010)].
- RNA for the replicon and helper components were combined and mixed with a suspension of Vero cells, electroporated in 4 mm cuvettes, and returned to OptiPro® SFM cell culture media (Thermo Fisher, Waltham MA). Following overnight incubation, alphavirus RNA replicon particles were purified from the cells and media by passing the suspension through a ZetaPlus BioCap depth filter (3M, Maplewood, MN), washing with phosphate buffered saline containing 5% sucrose (w/v), and finally eluting the retained RP with 400 mM NaCI buffer.
- ZetaPlus BioCap depth filter 3M, Maplewood, MN
- Eluted RP were formulated to a final 5% sucrose (w/v), passed through a 0.22 micron membrane filter, and dispensed into aliquots for storage. Titer of functional RP was determined by immunofluorescence assay on infected Vero cell monolayers.
- a vaccine comprising an alphavirus RNA replicon particle (RP) comprising the capsid protein and glycoproteins of the avirulent TC-83 strain of Venezuelan Equine Encephalitis Virus (VEE) and encoding the FeLV viral glycoprotein (gp85), was formulated in 5% sucrose. The liquid vaccine was frozen for storage before use. This vaccine was compared with a commercially available vaccine comprising a recombinant canary pox encoding FeLV, as shown in Table 1 below. Five groups of eight feline subjects were vaccinated either with a single dose at 8-9 weeks, or in a prime/boost regimen of 8-9 weeks of age and then 21 days later. The doses for each experimental vaccinate group is provided in Table 1 below.
- All cats were challenged with a virulent culture of FeLV four weeks after the booster vaccination (four weeks after the one-shot vaccination for the Group 3 cats).
- the cats were challenged on four separate days over one week (study days 49, 52, 54 and 56) by administering 1 .0 mL of challenge virus by the oronasal route (0.3 mL in each nostril and 0.4 mL orally).
- Three weeks after challenge serum samples were collected each week through ten weeks post-challenge. Serum samples were tested by ELISA for the presence of FeLV p27 antigen. An animal is considered infected with FeLV if it is persistently antigenemic.
- Antigenemia is defined as a positive p27 ELISA result for three consecutive weeks or on five or more occasions during the eight week testing period.
- An FeLV vaccine must protect 75% of the cats vaccinated with the test product for USDA licensure.
- 80% of the control cats must be persistently antigenemic [see, Shipley et ai, JAVMA, Vol. 199, No. 10, (Nov 15, 1991 )]. The results of the challenge are summarized in the Table 2 below.
- the RP-FeLV vaccines protected 100% of the cats when administered in a two-dose regimen (i.e. , primary and booster vaccination) at both doses tested. Moreover, the RP-FeLV vaccine protected 87% of the cats when administered as a single dose. In direct contrast, the commercially available vaccine only protected 57% of the cats, even with a two-dose regimen. In addition, the challenge is regarded as valid because greater than 80% of the control cats were persistently antigenemic [see, Table 2]. Finally, all of the RP-FeLV vaccine formulations were found safe in cats.
- the RP-FeLV vaccine of Example 2 was formulated in a vaccine formulation that included enzymatically hydrolyzed casein (NZ-amine ® ), gelatin, and sucrose. The vaccine was then lyophilized. Four groups of ten cats each were vaccinated as summarized in Table 3 below:
- the cats were 8-9 weeks of age at the time of initial vaccination. Following the vaccination the cats were observed for adverse reactions to the vaccines by observing their general daily health, as well as palpating the site of injection for the two days following each vaccination and twice per week for the two weeks following each vaccination. No adverse reactions to any of the vaccines were observed.
- All of the cats were challenged with a virulent culture of FeLV three weeks after the booster vaccination.
- Cats were challenged on four separate days over one week (study days 42, 45, 47 and 49) by administering 1 .0 mL of challenge virus by the oronasal route (0.3 mL in each nostril and 0.4 mL orally).
- Three weeks after challenge serum samples were collected each week through twelve weeks post- challenge.
- Serum samples were tested by ELISA for the presence of FeLV p27 antigen. An animal is considered infected with FeLV if it is found to be persistently antigenemic.
- Antigenemia is defined as a positive p27 ELISA result for three consecutive weeks, or on five or more occasions during the eight-week testing period.
- the minimum protective dose of the RP-FeLV vaccine for 100% protection of the cats was between about 1 .0 x 10 5 to about 2.0 x 10 6 RPs, when administered in a two dose (primary and booster vaccination) regimen.
- the challenge was valid because at least 80% of the control cats were persistently antigenemic. All RP-FeLV vaccine formulations tested were safe in cats.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Virology (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Microbiology (AREA)
- Medicinal Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- General Engineering & Computer Science (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Immunology (AREA)
- Epidemiology (AREA)
- Molecular Biology (AREA)
- Mycology (AREA)
- Biochemistry (AREA)
- Communicable Diseases (AREA)
- Oncology (AREA)
- Hematology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Description
Claims
Priority Applications (9)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU2018358077A AU2018358077A1 (en) | 2017-11-06 | 2018-11-05 | Feline leukemia virus vaccine |
EP18803572.9A EP3706788A1 (en) | 2017-11-06 | 2018-11-05 | Feline leukemia virus vaccine |
RU2020118586A RU2784533C2 (en) | 2017-11-06 | 2018-11-05 | Vaccine against feline leukemia virus |
US16/759,927 US11311616B2 (en) | 2017-11-06 | 2018-11-05 | Feline leukemia virus vaccine |
BR112020008957-5A BR112020008957A2 (en) | 2017-11-06 | 2018-11-05 | vaccine against feline leukemia virus |
JP2020524369A JP2021501761A (en) | 2017-11-06 | 2018-11-05 | Feline leukemia virus vaccine |
CA3080427A CA3080427A1 (en) | 2017-11-06 | 2018-11-05 | Feline leukemia virus vaccine |
US17/698,205 US20220211839A1 (en) | 2017-11-06 | 2022-03-18 | Feline leukemia virus vaccine |
JP2023135272A JP2023159327A (en) | 2017-11-06 | 2023-08-23 | feline leukemia virus vaccine |
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US201762582050P | 2017-11-06 | 2017-11-06 | |
US62/5820,50 | 2017-11-06 | ||
US62/582,050 | 2017-11-06 |
Related Child Applications (2)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US16/759,927 A-371-Of-International US11311616B2 (en) | 2017-11-06 | 2018-11-05 | Feline leukemia virus vaccine |
US17/698,205 Continuation US20220211839A1 (en) | 2017-11-06 | 2022-03-18 | Feline leukemia virus vaccine |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2019086646A1 true WO2019086646A1 (en) | 2019-05-09 |
WO2019086646A8 WO2019086646A8 (en) | 2020-06-04 |
Family
ID=64316486
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/EP2018/080094 WO2019086646A1 (en) | 2017-11-06 | 2018-11-05 | Feline leukemia virus vaccine |
Country Status (4)
Country | Link |
---|---|
JP (2) | JP2021501761A (en) |
AU (1) | AU2018358077A1 (en) |
CA (1) | CA3080427A1 (en) |
WO (1) | WO2019086646A1 (en) |
Cited By (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN112852840A (en) * | 2021-01-20 | 2021-05-28 | 西南民族大学 | Niuxin-bur virus recombinant VP1 gene, recombinant protein and application thereof |
US11167027B2 (en) | 2017-11-06 | 2021-11-09 | Intervet Inc. | Multivalent feline vaccine |
WO2021228731A1 (en) | 2020-05-11 | 2021-11-18 | Intervet International B.V. | Feline severe acute respiratory syndrome coronavirus 2 vaccine |
WO2022101307A1 (en) | 2020-11-12 | 2022-05-19 | Intervet International B.V. | Recombinant vectors encoding chimeric coronavirus spike proteins and use thereof |
RU2812330C1 (en) * | 2023-07-31 | 2024-01-29 | Федеральное государственное бюджетное учреждение "Федеральный центр охраны здоровья животных" (ФГБУ "ВНИИЗЖ") | Associated vaccine against panleukopenia, calicivirus and feline viral rhinotracheitis |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20130064839A1 (en) * | 2010-10-27 | 2013-03-14 | Harrisvaccines, Inc. | Method of rapidly producing improved vaccines for animals |
US8460913B2 (en) | 2007-06-21 | 2013-06-11 | Alpha Vax, Inc. | Promoterless cassettes for expression of alpha virus structural proteins |
US9441247B2 (en) | 2004-05-18 | 2016-09-13 | Alphavax, Inc. | TC-83-derived alphavirus vectors, particles and methods |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
ATE335507T1 (en) * | 2002-09-23 | 2006-09-15 | Mologen Ag | VACCINE AGAINST INFECTIONS WITH ONCOVIRUS, SUCH AS THE FELINE LEUCOSE VIRUS OF THE CAT |
-
2018
- 2018-11-05 AU AU2018358077A patent/AU2018358077A1/en active Pending
- 2018-11-05 CA CA3080427A patent/CA3080427A1/en active Pending
- 2018-11-05 JP JP2020524369A patent/JP2021501761A/en active Pending
- 2018-11-05 WO PCT/EP2018/080094 patent/WO2019086646A1/en unknown
-
2023
- 2023-08-23 JP JP2023135272A patent/JP2023159327A/en active Pending
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US9441247B2 (en) | 2004-05-18 | 2016-09-13 | Alphavax, Inc. | TC-83-derived alphavirus vectors, particles and methods |
US8460913B2 (en) | 2007-06-21 | 2013-06-11 | Alpha Vax, Inc. | Promoterless cassettes for expression of alpha virus structural proteins |
US20130064839A1 (en) * | 2010-10-27 | 2013-03-14 | Harrisvaccines, Inc. | Method of rapidly producing improved vaccines for animals |
Non-Patent Citations (39)
Title |
---|
AAFP FELINE ADVISORY PANEL, vol. 15, 2013, pages 785 - 808 |
ARJONA ET AL., JOURNAL OF CLINICAL MICROBIOLOGY, vol. 38, 2000, pages 3448 - 3449 |
ATKINS GREGORY J ET AL: "Therapeutic and prophylactic applications of alphavirus vectors", EXPERT REVIEWS IN MOLECULAR MEDI, CAMBRIDGE UNIVERSITY PRESS, CAMBRIDGE, vol. 10, no. 1, 1 December 2008 (2008-12-01), pages e33/1 - 18, XP009116159, ISSN: 1462-3994, [retrieved on 20081111], DOI: 10.1017/S1462399408000859 * |
BRALEY, FELINE PRACTICE, vol. 22, 1994, pages 25 - 29 |
BREDENBEEK ET AL., JOURNAL OF VIROLOGY, vol. 67, 1993, pages 6439 - 6446 |
DENORONHA ET AL., VIROLOGY, vol. 85, 1978, pages 617 - 621 |
FLYNN ET AL., J. VIROL., vol. 76, no. 5, 2002, pages 2306 - 2315 |
GROSENBAUGH D A ET AL: "COMPARISON OF THE SAFETY AND EFFICACY OF A RECOMBINANT FELINE LEUKEMIA VIRUS (FELV) VACCINE DELIVERED TRANSDERMALLY AND AN INACTIVATED FELV VACCINE DELIVERED SUBCUTANEOUSLY", VETERINARY THERAPEUTICS, VETERINARY LEARNING SYSTEMS, TRENTON, NJ, US, vol. 5, no. 4, 21 December 2004 (2004-12-21), pages 258 - 262, XP001536412, ISSN: 1528-3593 * |
GUGLIELMO LUCCHESE ET AL: "How a single amino acid change may alter the immunological information of a peptide", FRONTIERS IN BIOSCIENCE : ELITE EDITION, vol. 4, no. 5, 1 January 2012 (2012-01-01), US, pages 1843 - 1852, XP055467091, ISSN: 1945-0494, DOI: 10.2741/e506 * |
HINES ET AL., J AM VET MED ASSOC, vol. 199, 1991, pages 1428 - 1430 |
HOOVER ET AL., J AM VET MED ASSOC, vol. 199, 1991, pages 1287 - 1297 |
HOSIE ET AL., VETERINARY RECORDS, vol. 128, 1989, pages 293 - 297 |
KAMRUD ET AL., J GEN VIROL., vol. 91, 2010, pages 1723 - 1727 |
KASS ET AL., J. AM VET MED ASSOC, vol. 203, no. 3, 1993, pages 396 - 405 |
KASS PHILIP H ET AL: "Epidemiologic evidence for a causal relation between vaccination and fibrosarcoma tumorigenesis in cats", JOURNAL OF THE AMERICAN VETERINARY MEDICAL ASSOCIATION, vol. 203, no. 3, 1993, pages 396 - 405, XP055536940, ISSN: 0003-1488 * |
KRISTIN STUKE ET AL: "Efficacy of an inactivated FeLV vaccine compared to a recombinant FeLV vaccine in minimum age cats following virulent FeLV challenge", VACCINE, vol. 32, no. 22, 1 May 2014 (2014-05-01), AMSTERDAM, NL, pages 2599 - 2603, XP055536766, ISSN: 0264-410X, DOI: 10.1016/j.vaccine.2014.03.016 * |
LEVY ET AL., J FELINE MED SURG, vol. 10, 2008, pages 300 - 316 |
LEVY; CRAWFORD: "Textbook of Veterinary Internal Medicine", 2005, WB SAUNDERS |
LILJESTROM; GAROFF, BIOTECHNOLOGY (NY, vol. 9, 1991, pages 1356 - 1361 |
LJUNGBERG KARL ET AL: "Self-replicating alphavirus RNA vaccines", EXPERT REVIEW OF VACC, EXPERT REVIEWS LTD, GB, vol. 14, no. 2, 1 February 2015 (2015-02-01), pages 177 - 194, XP008175780, ISSN: 1744-8395, DOI: 10.1586/14760584.2015.965690 * |
M. PATEL ET AL: "ABSTRACT", CLINICAL AND VACCINE IMMUNOLOGY, vol. 22, no. 7, 1 July 2015 (2015-07-01), US, pages 798 - 805, XP055536768, ISSN: 1556-6811, DOI: 10.1128/CVI.00034-15 * |
MALIK ET AL., AUSTRALIAN VETERINARY JOURNAL, vol. 75, 1997, pages 323 - 327 |
MATHES ET AL., NATURE, vol. 274, 1978, pages 687 - 689 |
NUNBERG ET AL., PNAS, vol. 81, 1983, pages 3675 - 3679 |
PACITTI ET AL., VET REC, vol. 118, 1986, pages 381 - 384 |
PATEL ET AL., CLIN VACCINE IMMUNOL, vol. 22, no. 7, 2015, pages 798 - 808 |
PATEL ET AL., CLINICAL AND VACCINE IMMUNOLOGY, vol. 22, no. 7, 2015, pages 798 - 805 |
PEDERSEN, J VET INTERN MED, vol. 7, 1993, pages 34 - 39 |
PUSHKO ET AL., VIROLOGY, vol. 239, 1997, pages 389 - 401 |
PUSHKO ET AL., VIROLOGY, vol. 239, no. 2, 1997, pages 389 - 401 |
RAYNER J O ET AL: "ALPHAVIRUS VECTORS AND VACCINATION", REVIEWS IN MEDICAL VIRO, CHICHESTER, GB, vol. 12, no. 5, 1 September 2002 (2002-09-01), pages 279 - 296, XP008035758, ISSN: 1052-9276, DOI: 10.1002/RMV.360 * |
ROJKO; KOCIBA, J AM VET MED ASSOC, vol. 199, 1991, pages 1305 - 1310 |
SHIPLEY ET AL., JAVMA, vol. 199, no. 10, 15 November 1991 (1991-11-15) |
SPARKES, J SMALL ANIM PRACT, vol. 38, 1997, pages 187 - 194 |
STUKE ET AL., VACCINE, vol. 32, 2014, pages 2599 - 2603 |
THOMSEN ET AL., JOURNAL OF GENERAL VIROLOGY, vol. 73, 1992, pages 1819 - 1824 |
TORRES ET AL., VET IMMUNOL IMMUNOPATHOL, vol. 134, 2010, pages 122 - 131 |
VANDER VEEN ET AL., ANIM HEALTH RES REV, vol. 13, no. 1, 2012, pages 1 - 9 |
VANDER VEEN RYAN L ET AL: "Alphavirus replicon vaccines", ANIMAL HEALTH RESEARCH REV, CAB INTERNATIONAL ; CAMBRIDGE : CAMBRIDGE UNIVERSITY PRESS, UK, vol. 13, no. 1, 1 June 2012 (2012-06-01), pages 1 - 9, XP009166113, ISSN: 1475-2654, DOI: 10.1017/S1466252312000011 * |
Cited By (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US11167027B2 (en) | 2017-11-06 | 2021-11-09 | Intervet Inc. | Multivalent feline vaccine |
US11730809B2 (en) | 2017-11-06 | 2023-08-22 | Intervet Inc. | Multivalent feline vaccine |
WO2021228731A1 (en) | 2020-05-11 | 2021-11-18 | Intervet International B.V. | Feline severe acute respiratory syndrome coronavirus 2 vaccine |
WO2022101307A1 (en) | 2020-11-12 | 2022-05-19 | Intervet International B.V. | Recombinant vectors encoding chimeric coronavirus spike proteins and use thereof |
CN112852840A (en) * | 2021-01-20 | 2021-05-28 | 西南民族大学 | Niuxin-bur virus recombinant VP1 gene, recombinant protein and application thereof |
RU2812330C1 (en) * | 2023-07-31 | 2024-01-29 | Федеральное государственное бюджетное учреждение "Федеральный центр охраны здоровья животных" (ФГБУ "ВНИИЗЖ") | Associated vaccine against panleukopenia, calicivirus and feline viral rhinotracheitis |
Also Published As
Publication number | Publication date |
---|---|
JP2021501761A (en) | 2021-01-21 |
WO2019086646A8 (en) | 2020-06-04 |
JP2023159327A (en) | 2023-10-31 |
CA3080427A1 (en) | 2019-05-09 |
AU2018358077A1 (en) | 2020-05-14 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2019086646A1 (en) | Feline leukemia virus vaccine | |
US11992526B2 (en) | Rabies virus vaccine | |
JP7374893B2 (en) | feline calicivirus vaccine | |
AU2022209359A1 (en) | Multivalent feline vaccine | |
US20220211839A1 (en) | Feline leukemia virus vaccine | |
US11730809B2 (en) | Multivalent feline vaccine | |
RU2784533C2 (en) | Vaccine against feline leukemia virus | |
RU2792898C2 (en) | Vaccine against feline calicivirus | |
RU2797538C2 (en) | Polyvalent vaccine for cats | |
US20230355741A1 (en) | Feline Severe Acute Respiratory Syndrome Coronavirus 2 Vaccine |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 18803572 Country of ref document: EP Kind code of ref document: A1 |
|
ENP | Entry into the national phase |
Ref document number: 3080427 Country of ref document: CA |
|
ENP | Entry into the national phase |
Ref document number: 2020524369 Country of ref document: JP Kind code of ref document: A |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
ENP | Entry into the national phase |
Ref document number: 2018358077 Country of ref document: AU Date of ref document: 20181105 Kind code of ref document: A |
|
ENP | Entry into the national phase |
Ref document number: 2018803572 Country of ref document: EP Effective date: 20200608 |
|
REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112020008957 Country of ref document: BR |
|
ENP | Entry into the national phase |
Ref document number: 112020008957 Country of ref document: BR Kind code of ref document: A2 Effective date: 20200505 |