WO2019085237A1 - Method for inducing multiple layers of casparian strips in plant root - Google Patents

Abstract

A method for inducing multiple layers of Casparian strips in a plant root. The method induces a Casparian strip in a plant root using a plant transcription factor SHORT-ROOT (SHR) or MYB36 in combination with plant-derived small peptides CIF1 and CIF2. The constitutive (using a 35S promoter) or inductive (using an estrogen-inducible expression system) expression of SHR or MYB36 enables a plurality of genes involved in Casparian strip synthesis to be induced in cortical cells and other essential tissue cells in plant roots.

Description

Method for inducing multi-layer Kjeldahl belt in plant roots Technical field

The invention belongs to the field of agricultural biotechnology, and particularly relates to a method for inducing the formation of Kjeldahl belt in plant roots.

Background technique

The Casparian strip is a corked and lignified banded structure of the radial and lateral walls of the cell in the endothelial layer of higher plants. The corked Kjeldahl belt forms an insurmountable barrier to water and solutes, so the continuity of the apoplasts of higher plant roots is blocked here. After the water and mineral elements are absorbed by the epidermis of the root, they can be transported laterally to the vascular bundle along two pathways: one is the apoplast of the intercellular space; the other is the symplast pathway inside the cell. When moisture and solutes reach the endothelium, the apoplastic pathway of water and solutes is blocked by the presence of the corked banded Kjeldahl belt and must be selectively absorbed by the endothelial cells via the symbiotic pathway. This barrier is similar to the vascular bundle's fences and valves, allowing plants to selectively absorb water and nutrients as needed.

A common challenge in agricultural production is various environmental stresses, especially excessive moisture and excessively high levels of ions in the soil. At present, the quality of cultivated land in China has the phenomenon of “low, high, and dirty”. About 1/3 of the existing cultivated land is all kinds of low-yield cultivated land. Waterlogging, soil salinization and various heavy metal pollution seriously restrict the yield and quality of crops in China.

In view of the blocking effect of Kjeldahl belt on water and ions in plant roots, it is of great significance to achieve anti-caries and other anti-reverse effects by biotechnology to realize the expansion of K.

In higher plant Arabidopsis, studies have shown that the transcription factor SHR can promote the formation of the endothelial layer by inducing directional division of cortical endothelial stem cells. The expression of SHR in cortical and ectodermal cells induces a large number of cell divisions and produces multiple layers of cells outside the vascular tissues. Recent studies have also shown that SHR activates the transcription factor MYB36, and it has been reported that MYB36 regulates several important genes involved in the formation of the Kjeldahl belt. Therefore, it is possible to increase the cell layer having the Kjeldahl belt in the plant root by regulating the expression of SHR or MYB36. However, tests have shown that expression of SHR or MYB36 does not form a fully functional Kjeldahl belt. Recent reports have found that small peptides CIF1 and CIF2 synthesized by vascular bundles in plant roots can participate in the formation of the K-band structure of the endothelial layer. The present invention induces the formation of the essential gene of the Kjeldahl belt by constitutive expression, inducible expression, tissue-specific expression or inducible tissue-specific expression of the plant transcription factor SHR or MYB36 in plants, and simultaneously binds the synthetic small peptide CIF1 or CIF2 ( Or endogenously expressing CIF1 or CIF2), ultimately inducing the formation of multi-layered functional Kjeldahl bands in plant roots.

technical problem

The object of the present invention is to provide a method for inducing a multi-layer Kjeldahl belt in a plant root, and to realize the expansion of the Kjeldahl belt structure in the plant root, thereby achieving anti-caries and other anti-reverse effects.

Technical solution

A method for inducing a multi-layer Kjeldahl belt in a plant root, which induces the formation of a multi-layered functional Kjeldahl belt in a plant root by expressing a plant transcription factor SHR or MYB36 in combination with a small peptide CIF1 or CIF2. The essential genes for the formation of the Kjeldahl belt are induced by constitutive expression, inducible expression, tissue-specific expression or inducible tissue-specific expression of the plant transcription factor SHR or MYB36; synthetic small peptides are added to the plant roots expressing SHR or MYB36 CIF1 or CIF2, or endogenously expressing CIF1 or CIF2, ultimately induces the formation of multi-layered functional Kjeldahl bands in plant roots.

A composition is provided in which non-endothelial cells in the plant root induce the formation of the Kjeldahl belt. The composition includes the transcription factor SHORT-ROOT (SHR) (AT4G37650), or the transcription factor MYB36 (AT5G57620); also includes the synthetic polypeptide CIF1 or CIF2, or the Arabidopsis gene CIF1 (AT2G16385) and CIF2 which endogenously express the synthetic small peptide. (AT4G34600).

The small peptide CIF1 amino acid sequence DYGNNSPSPRLERPPFKLIPN, CIF2 amino acid sequence DYGHSSPKPKLVRPPFKLIPN.

By the method of the present invention, the application of multi-layer Kjeldahl belt formation in crop roots is induced in the cultivation of highly resistant crops.

Plants of the invention refer to Arabidopsis or other higher plants. Since SHR function is conserved among Arabidopsis and other higher plants including rice, the present invention is also widely applicable to crops other than Arabidopsis.

The present invention uses Arabidopsis SHR and MYB36, but the orthologous gene function of SHR and MYB36 in crops is highly conserved. Therefore, SHR and MYB36 using other higher plant sources are also covered in the invention.

A plant expression vector containing the above SHR or MYB36 transcription factor.

A host strain containing the above SHR or MYB36 transcription factor gene.

Beneficial effect

The invention can artificially induce the formation of the Kjeldahl belt structure in the plant non-endothelial cells, and the analysis results show that the induced Kjeldahl belt structure can block the free entry of external moisture into the root. In view of the fact that the Kjeldahl belt is an important structure for plants to regulate water and ion absorption, the invention is of great significance for the use of biotechnology to breed highly resistant various crop varieties.

DRAWINGS

Figure 1. Inducible expression vector, pG1090-XVE::SHR and pG1090-XVE::MYB36 express SHR or MYB36 in all cells in Arabidopsis roots. In the wild-type Arabidopsis roots, the genes controlling the Kjeldahl band, such as PER64, ESB1 and SGN3, are only expressed in the endothelial layer (represented by the reporter-linked GFP reporter system, the fluorescent signal part in the figure), in contrast, expression In the roots of SHR or MYb36, these genes are significantly up-regulated and expressed in most cells.

In Fig. 2, (a) expression of SHR induces expression of the Kjeldahl position-localized protein CASP1-GFP in cortical cells (cor in the figure), but exhibits a discontinuous structure (indicated by arrows in the figure). However, the addition of CIF1 (c in the figure) or CIF2 (d in the figure) can promote the formation of a continuous band structure of CASP1-GFP (indicated by the arrows in the figure). After the addition of the small peptide, the root expressed by SHR can exclude the red propidium iodide dye from the cortical cells (as indicated by b), indicating that the Kjeldahl band formed in this layer of cells is functional. Further lignin staining experiments revealed that the normal roots (shown as e) were distributed in the Kjeldahl belt of the endothelial layer and extended to cortical cells (shown by f) in the roots treated with SHR expressing CIF peptide.

Embodiments of the invention

Example 1 SHR with MYB36 Expression system construction

Arabidopsis root RNA was extracted according to OMEGA's E.Z.N.A.® Plant RNA Kit kit instructions. This was reverse transcribed into cDNA according to the TransScript All-in-One First-Strand cDNA Synthesis SuperMix for qPCR (TRANS) instructions. The cDNA sequences of SHR and MYB36 were searched on the TAIR website (http://www.arabidopsis.org/), and the primers SHR(+): 5'GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGATACTCTCTTTAGA3' and SHR(-):5' were designed. GG BB GG GG GG GG GG GG GG GG GG GG ://www.thermofisher.com/order/catalog/product/12536017). The DH5α competent state was prepared, the ligation product was transferred to DH5α, positive colonies were screened with kanamycin containing 100 mg/L, and the plasmid was verified by PCR, and the positive plasmid was sent to the company for sequencing. The correct plasmid and the expression vector pMDC7 were mixed, LR enzyme was added, and the target fragment carrying the SHR cDNA was ligated to the expression vector by LR reaction, transferred to DH5α, and positive colonies were screened with 100 mg/L of spectinomycin. The plasmid was verified by PCR to obtain expression vectors pG1090-XVE: SHR and pG1090-XVE: MYB36.

Example 2 : Establishing plant expression systems

(1) Preparation of GV3101 Agrobacterium competent cells, transfer pG1090-XVE:SHR and pG1090-XVE:MYB36 plasmids into Agrobacterium, respectively, with 100 mg/L of spectinomycin plus 50 mg/L rifampicin and 15 mg/ L-gentamicin screened positive colonies.

(2) Arabidopsis seeds are placed in a 4 ° C refrigerator for 3-4 days, and the high temperature sterilized culture medium (nutrient soil: vermiculite: perlite = 5:3:1) is filled into the culture pot. Seeds were uniformly seeded with 5-6 seeds, covered for 3-4 days, and placed in a growth chamber (22-23 ° C, light for 16 h). After the Arabidopsis thrushed, the inflorescences were all cut off from the bottom of the main inflorescence with scissors, and the inflorescences were re-extracted and a large number of immature flower clusters were formed, which could be used for transformation.

(3) Prepare Agrobacterium carrying the gene of interest, and shake it in large quantities at 28 °C with liquid LB medium containing 100 mg/L of spectinomycin plus 50 mg/L of rifampicin and 15 mg/L of gentamicin. Shake to OD600 = 1.2-1.6. The Agrobacterium was centrifuged at 2000 r/min for 10 min in a large centrifuge, and Agrobacterium (DD600 = 0.8) was resuspended in 5% sucrose solution.

(4) Add Silwet L-77 to the final concentration of 0.05% before infestation and mix well. The inflorescence of Arabidopsis thaliana was immersed in Agrobacterium solution for 30s-60s. After the infection, cover the whole pot seedling bag with a black plastic bag, and put it in the growth chamber for 16-24h, then normal culture.

(5) Pour the harvested Arabidopsis seeds into a 50mL centrifuge tube and add 40 mL. 70% ethanol, shake for 10s, let stand to remove the supernatant; add 40 mL of sterile deionized water, shake up and remove 2 times; add 40 mL of 5% sodium hypochlorite (containing 0.1% Triton100), shake for 10 minutes , aspirate the supernatant; add 40 mL of sterile deionized water, aspirate and aspirate, repeat more than 3 times; add sterile MS medium containing 0.1% agar, shake well, seed suspended in the medium, will It is poured on a 1/2MS plate (Hyg On the 50mg/L), gently rotate the plate to mix the seeds across the plate.

(6) The sealed plate was placed in a refrigerator at 4 ° C, and after 3 days, it was placed in a tissue culture incubator at 22 ° C for light culture. About 10 days, the positive seedlings were transplanted into pots for cultivation, collected and homozygously screened.

Example 3 : Small peptide processing

(1) The TAIR website searches for small peptide amino acid sequences, CIF1: DYGNNSPSPRLERPPFKLIPN, CIF2: DYGHSSPKPKLVRPPFKLIPN, and the company synthesizes small peptides.

(2) Take a small amount of the selected homozygous transgenic seeds, pour into a plastic centrifuge tube, open the lid, place in a glass sealed cylinder, add 45mL sodium hypochlorite and 5mL concentrated hydrochloric acid to the small beaker in the sterilization tank, and seal it quickly. Cylinder seal, sterilized 2.5-3 h. The above operations are all done in a fume hood. After the sterilization is completed, the seeds are placed on a clean bench for half an hour, and the seeds are spotted on a 1/2 MS plate with a toothpick. The refrigerator was lyophilized in a refrigerator at 4 ° C for 3-4 days, and placed in an incubator at 22 ° C for 5 days under light. Seedlings were transferred to 1/2 MS medium containing 10 μM small peptide (CIF1 or CIF2) and 10 μM estrogen and treated under normal light for 2 days. Laser scanning confocal microscope (Zeiss Observe the root under LSM880) (Figures 1 and 2).

Example 4 : Functional Kelvin Band Verification

Propidium iodide (PI) is a fluorescent dye that cannot pass through the cell membrane of living cells and can only enter the roots through the intercellular space. The place where the PI solution enters will fluoresce under the microscope, due to the presence of the root layer in the mature layer. The Kjeldahl belt prevents the entry of the PI solution into the vascular bundle, thereby determining which layer of Arabidopsis roots can form a functional Kjeldahl belt. A drop of the prepared PI solution (1-10 μg/ml) was placed on the slide, and the Arabidopsis seedlings were picked up with tweezers, the roots were immersed in the PI solution, placed flat on the glass slides, and the coverslips were gently covered. , observed under the microscope (Figure 2).

The above are only the preferred embodiments of the present invention, and all changes and modifications made to the scope of the present invention should fall within the scope of the present invention.

Claims (4)

1. A method for inducing a multi-layer Kjeldahl belt in a plant root, characterized in that a multi-functional Kjeldahl belt is formed in a plant root by inducing a plant transcription factor SHR or MYB36 in combination with a small peptide CIF1 or CIF2.
2. The method for inducing a multi-layer Kjeldahl belt in a plant root according to claim 1, wherein the small peptide CIF1 amino acid sequence DYGNNSPSPRLERPPFKLIPN, CIF2 amino acid sequence DYGHSSPKPKLVRPPFKLIPN.
3. The method for inducing a multi-layer Kjeldahl belt in a plant root according to claim 1, wherein the plant transcription factor SHR is specifically expressed by constitutive expression, inducible expression, tissue-specific expression or induced tissue-specific expression MYB36 induces the essential genes for the formation of the Kjeldahl belt.
4. The method for inducing a multi-layer Kjeldahl belt in a plant root according to claim 1, wherein a synthetic small peptide CIF1 or CIF2 is added to the plant seedling root expressing SHR or MYB36, or CIF1 is endogenously expressed or CIF2 ultimately induces the formation of multi-layered functional Kjeldahl bands in plant roots.