WO2019077951A1

WO2019077951A1 - Antibody against muc1 or antigen-binding fragment thereof, gene encoding same, and use thereof

Info

Publication number: WO2019077951A1
Application number: PCT/JP2018/035631
Authority: WO
Inventors: 雅彦黒田; 慎一郎大野; 藤田　浩司; 裕一郎原田
Original assignee: 学校法人東京医科大学
Priority date: 2017-10-16
Filing date: 2018-09-26
Publication date: 2019-04-25

Abstract

Provided is a novel antibody against MUC1 or an antigen-binding fragment thereof. The antibody according to the present invention or an antigen-binding fragment thereof contains heavy chain variable regions and light chain variable regions, wherein: the heavy chain variable regions comprise an amino acid sequence of SEQ ID NO:1 or a heavy chain CDR1, a heavy chain CDR2 and a heavy chain CDR3, wherein the heavy chain CDR1, heavy chain CDR2 and heavy chain CDR3 are polypeptides respectively containing amino acid sequences of (H1-1) of SEQ ID NO: 2, (H2-1) of SEQ ID NO: 3 and (H3-1) of SEQ ID NO: 4; and the light chain variable regions comprise an amino acid sequence of SEQ ID NO: 5 or a light chain CDR1, a light chain CDR2 and a light chain CDR3, wherein the light chains CDR1, CDR2 and CDR3 are polypeptides respectively containing amino acid sequences of (L1-1) of SEQ ID NO: 6, (L2-2) of SEQ ID NO: 7 and (L3-3) of SEQ ID NO: 8.

Description

Antibody against MUC1 or antigen-binding fragment thereof, gene encoding them and use thereof

The present invention relates to a novel gene encoding an antibody against MUC1 or an antigen-binding fragment thereof, and uses thereof.

MUC1 is a core protein of mucin and, for example, it is known to be expressed in various cancer cells and involved in cancer growth, cell adhesion, and metastasis. Then, in the clinical site, for example, it has been attempted to diagnose cancer by detecting MUC1 as a cancer marker using a MUC1 antibody that binds to MUC1.

Since MUC1 antibodies can be used not only for cancer diagnosis but also for treatment and research, there is a need to provide new MUC1 antibodies that bind to MUC1.

Therefore, the present invention aims to provide a novel MUC1 antibody or an antigen-binding fragment thereof.

The MUC1 antibody or antigen-binding fragment thereof of the present invention comprises a heavy chain variable region and a light chain variable region,
The heavy chain variable region is the following (X1) or (X2):
The light chain variable region is the following (Y1) or (Y2):
It is characterized by binding to MUC1.

Heavy chain variable region (X1)
It is a polypeptide comprising an amino acid sequence of any one of the following (H-1) to (H-3):
(H-1) Amino acid sequence of SEQ ID NO: 1 (H-2) Amino acid sequence of 80% or more identity with amino acid sequence of SEQ ID NO: 1 (H-3) One or several amino acid sequences of SEQ ID NO: 1 Amino acid sequence in which the amino acid of (f) is deleted, substituted, inserted and / or added

Heavy chain variable region (X2)
Comprising heavy chain CDR1, heavy chain CDR2 and heavy chain CDR3;
The heavy chain CDR1 is a polypeptide comprising an amino acid sequence of any one of the following (H1-1) to (H1-3):
The heavy chain CDR2 is a polypeptide comprising an amino acid sequence of any one of (H2-1) to (H2-3),
The heavy chain CDR3 is a polypeptide comprising an amino acid sequence of any of (H3-1) to (H3-3).
(H1-1) Amino acid sequence of SEQ ID NO: 2 (H1-2) Amino acid sequence of 80% or more identity to the amino acid sequence of SEQ ID NO: 2 (H1-3) One or several amino acid sequences in SEQ ID NO: 2 (H2-1) amino acid sequence of SEQ ID NO: 3 (H2-2) amino acid sequence of 80% or more identity to the amino acid sequence of SEQ ID NO: 3 (H2-1) H2-3) Amino acid sequence in which one or several amino acids are deleted, substituted, inserted and / or added in the amino acid sequence of SEQ ID NO: 3 (H3-1) Amino acid sequence of SEQ ID NO: 4 (H3-2) Amino acid sequence having 80% or more identity to the amino acid sequence of SEQ ID NO: 4 (H3-3) Amino acid in which one or several amino acids are deleted, substituted, inserted and / or added in the amino acid sequence of SEQ ID NO: 4 Array

Light chain variable region (Y1)
It is a polypeptide comprising an amino acid sequence of any one of the following (L-1) to (L-3):
(L-1) Amino acid sequence of SEQ ID NO: 5 (L-2) Amino acid sequence of 80% or more identity to the amino acid sequence of SEQ ID NO: 5 (L-3) One or several amino acid sequences of SEQ ID NO: 5 Amino acid sequence in which the amino acid of (f) is deleted, substituted, inserted and / or added

Light chain variable region (Y2)
Comprising a light chain CDR1, a light chain CDR2 and a light chain CDR3;
The light chain CDR1 is a polypeptide comprising an amino acid sequence of any one of the following (L1-1) to (L1-3):
The light chain CDR2 is a polypeptide comprising an amino acid sequence of any one of (L2-1) to (L2-3),
The light chain CDR3 is a polypeptide comprising an amino acid sequence of any one of (L3-1) to (L3-3).
(L1-1) Amino acid sequence of SEQ ID NO: 6 (L1-2) Amino acid sequence of 80% or more identity to the amino acid sequence of SEQ ID NO: 6 (L1-3) One or several amino acid sequences of SEQ ID NO: 6 Amino acid sequence in which the amino acid of SEQ ID NO: 1 is deleted, substituted, inserted and / or added (L2-1) amino acid sequence of SEQ ID NO: 7 (L2-2) amino acid sequence of 80% or more identity L2-3) Amino acid sequence in which one or several amino acids are deleted, substituted, inserted and / or added in the amino acid sequence of SEQ ID NO: 7 (L3-1) Amino acid sequence of SEQ ID NO: 8 (L3-2) Amino acid sequence of 80% or more identity to the amino acid sequence of SEQ ID NO: 8 (L3-3) Amino acid in which one or several amino acids are deleted, substituted, inserted and / or added in the amino acid sequence of SEQ ID NO: 8 Array

The coding gene of the antibody against MUC1 of the present invention or the antigen binding fragment thereof is characterized in that it encodes the amino acid sequence of the antibody of the present invention or the antigen binding fragment thereof.

The expression vector of the present invention is characterized by containing the coding gene of the present invention.

The novel MUC1 antibodies or antigen-binding fragments thereof of the present invention are capable of binding to MUC1. Thus, the MUC1 antibody or antigen-binding fragment thereof of the present invention can be applied to various techniques that utilize binding to MUC1.

FIG. 1 is a photograph showing the result of Western blotting using an anti-MUC1 monoclonal antibody in Example 1. FIG. 2 is a schematic diagram showing the structure of a scFv expression vector in Example 2.

In the MUC1 antibody or antigen-binding fragment thereof of the present invention, for example, the combination of the heavy chain variable region and the light chain variable region is a combination of (X1) and (Y1), (X1) and (Y2) The combination is a combination of (X2) and (Y1) or a combination of (X2) and (Y2).

The MUC1 antibody or antigen-binding fragment thereof of the present invention contains, for example, a human constant region.

In the MUC1 antibody or antigen-binding fragment thereof of the present invention, for example, the antigen-binding fragment is a scFv.

The MUC1 antibody or antigen-binding fragment thereof of the present invention is, for example, a polypeptide in which the heavy chain containing the above-mentioned heavy chain variable region comprises an amino acid sequence of any of (V1) to (V3) A light chain comprising is a polypeptide comprising an amino acid sequence of any of (W1) to (W3).
(V1) amino acid sequence of SEQ ID NO: 9 (V2) amino acid sequence of 80% or more identity to the amino acid sequence of SEQ ID NO: 9 (V3) 1 or several amino acids are deleted in the amino acid sequence of SEQ ID NO: 9, Amino acid sequence substituted, inserted and / or added (W1) amino acid sequence of SEQ ID NO: 10 (W2) amino acid sequence of 80% or more identity to the amino acid sequence of SEQ ID NO: 10 (W3) Amino acid sequence in which one or several amino acids have been deleted, substituted, inserted and / or added

<Antibody or Antigen-Binding Fragment Thereof>
In the MUC1 antibody or antigen-binding fragment thereof of the present invention, as described above, the heavy chain variable region is the (X1) or (X2), and the light chain variable region is the (Y1) or (Y2) And is characterized by binding to MUC1. Hereinafter, the antibody of the present invention or the antigen-binding fragment thereof will be collectively referred to as "the MUC1 binding molecule of the present invention".

MUC1 is a core protein family of mucins. The origin of MUC1 to which the MUC1 binding molecule of the present invention binds is not particularly limited, and examples thereof include humans and non-human animals excluding humans and the like, and the non-human animals are, for example, mice, rats, dogs, monkeys, Mammals such as rabbits, sheep and horses can be mentioned. The amino acid sequence of MUC1 can refer to, for example, information registered in an existing database. As a specific example, human-derived MUC1 includes, for example, the following amino acid sequence (SEQ ID NO: 15) registered under NCBI Accession No. NP_001191215.

The MUC1 binding molecule of the present invention includes, in addition to the molecule that binds to a protein consisting of the full-length amino acid sequence of MUC1, the meaning of a molecule that binds to a peptide fragment of MUC1, for example. Hereinafter, unless otherwise indicated, the MUC1 includes, for example, the meaning of the peptide fragment as well as the protein consisting of a full-length amino acid sequence.

The MUC1 binding molecule of the present invention may be, for example, a so-called "antibody" whose molecular structure is an immunoglobulin, or an antigen binding fragment thereof. The MUC1 binding molecule of the present invention may have the aforementioned heavy chain variable region and the aforementioned light chain variable region. When the MUC1 binding molecule of the present invention is an antibody, for example, its immunoglobulin class and isotype are not limited in any way. Examples of the isotype include IgG, IgM, IgA, IgD, IgE and the like.

The "antigen-binding fragment" in the present invention means a part of the antibody, for example, a partial fragment, which recognizes and binds to the MUC1. Examples of the antigen-binding fragment include Fab, Fab ′, F (ab ′) ₂ , variable region fragment (Fv), disulfide bond Fv, single chain variable fragment (scFv), and polymers of these.

The MUC1 binding molecule of the present invention may have, for example, a constant region in addition to the heavy chain variable region and the light chain variable region described above, and the constant region is, for example, a human constant region. In the case of antibodies (immunoglobulins), the constant region of the heavy chain comprises, for example, the regions CH1, CH2 and CH3, and the constant region of the light chain comprises, for example, the region CL. When the MUC1 binding molecule of the present invention has the constant region, for example, the heavy chain variable region is bound to at least one of CH1, CH2 and CH3, and the light chain variable region is bound to the CL. The heavy chain variable region is, for example, directly linked to CH1.

In general, the heavy chain and the light chain of an antibody molecule each have three complementarity determining regions (CDRs). CDRs are also referred to as hypervariable domains. The CDRs are variable regions of the above-mentioned heavy chain and light chain, in particular, regions having a high degree of variability of the primary structure, and are usually separated into three places in the primary structure. In the present invention, the three CDRs in the heavy chain are referred to as heavy chain CDR1, heavy chain CDR2 and heavy chain CDR3 from the amino terminal side in the amino acid sequence of heavy chain, and the three CDRs in the light chain are From the amino terminal side in the chain amino acid sequence, light chain CDR1, light chain CDR2, and light chain CDR3 are represented. These sites are in close proximity to each other on the conformation to determine their specificity for the binding antigen.

Hereinafter, the heavy chain variable region and the light chain variable region of the MUC1 binding molecule of the present invention will be described.

In the MUC1 binding molecule of the present invention, the heavy chain variable region is the following (X1) or (X2), and the light chain variable region is the following (Y1) or (Y2), and binds to MUC1.

The amino acid sequence of SEQ ID NO: 1 is shown in Table 2 below. In Table 2 below, the boxed regions are, for example, CDR1, CDR2, and CDR3 from the N-terminal side.

Sequence number 2: DYWMN
Sequence number 3: DIRLKSYNYATHYAESVKGRFT
Sequence number 4: GNSFAY

In the heavy chain variable region (X2), the combination of the heavy chain CDR1, the heavy chain CDR2 and the heavy chain CDR3 is not particularly limited.

The amino acid sequence of SEQ ID NO: 5 is shown in Table 3 below. In Table 3 below, the boxed regions are, for example, CDR1, CDR2 and CDR3 from the N-terminal side.

Sequence number 6: RSSTGAVTTSNYAN
Sequence number 7: GTNNRAP
Sequence number 8: ALWYSNHWV

In the light chain variable region (Y2), the combination of the light chain CDR1, the light chain CDR2 and the light chain CDR3 is not particularly limited.

In the MUC1 binding molecule of the present invention, the combination of the heavy chain variable region and the light chain variable region is not particularly limited. For example, the combination of (X1) and (Y1), (X1) and (Y2) Or a combination of (X2) and (Y1) or a combination of (X2) and (Y2).

In the MUC1 binding molecule of the present invention, for example, one in which the heavy chain containing the heavy chain variable region is (V) and the light chain containing the light chain variable region is (W) is Be

Heavy chain (V)
It is a polypeptide comprising an amino acid sequence of any one of the following (V1) to (V3).
(V1) amino acid sequence of SEQ ID NO: 9 (V2) amino acid sequence of 80% or more identity to the amino acid sequence of SEQ ID NO: 9 (V3) 1 or several amino acids are deleted in the amino acid sequence of SEQ ID NO: 9, Amino acid sequence substituted, inserted and / or added

The amino acid sequence of SEQ ID NO: 9 is shown in Table 4 below. In Table 4 below, the underlined part is, for example, a heavy chain variable region, and the boxed region is, for example, CDR1, CDR2, or CDR3 from the N-terminal side.

Light chain (W)
It is a polypeptide comprising an amino acid sequence of any one of the following (W1) to (W3).
(W1) Amino acid sequence of SEQ ID NO: 10 (W2) Amino acid sequence of 80% or more identity to the amino acid sequence of SEQ ID NO: 10 (W3) In the amino acid sequence of SEQ ID NO: 10, one or several amino acids are deleted Amino acid sequence substituted, inserted and / or added

The amino acid sequence of SEQ ID NO: 10 is shown in Table 5 below. In Table 5 below, the underlined part is, for example, a light chain variable region, and the boxed region is, for example, CDR1, CDR2, or CDR3 from the N-terminal side.

In the MUC1 binding molecule of the present invention, the combination of the heavy chain and the light chain is not particularly limited.

In the present invention, "identity" is, for example, the degree of identity when the sequences to be compared are properly aligned, and means the appearance rate (%) of the exact match of the amino acids between the sequences. The identity is, for example, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more. The identity can be calculated by default parameters using, for example, analysis software such as BLAST and FASTA (the same applies hereinafter).

In the present invention, “one or several” relating to substitution or the like is, for example, 1 to 5, 1 to 4, 1 to 3, 1 and 2, 1 or 2, respectively.

The substitution of the amino acid may be, for example, a conservative substitution. The above-mentioned conservative substitution means, for example, substitution of one or several amino acids with other amino acids and / or amino acid derivatives so as not to substantially modify the function of the protein. The “substituted amino acid” and the “substituted amino acid” are preferably similar in nature and / or function, for example. Specifically, it is preferable that, for example, hydrophobicity and hydrophilicity index (hydropathy), polarity, chemical properties such as charge, or physical properties such as secondary structure are similar. Amino acids or amino acid derivatives of similar nature and / or function are, for example, known in the art. Specific examples of nonpolar amino acids (hydrophobic amino acids) include, for example, alanine, valine, isoleucine, leucine, proline, tryptophan, phenylalanine, methionine and the like, and polar amino acids (neutral amino acids) include glycine, serine and threonine And tyrosine, glutamine, asparagine, cysteine, etc., and positively charged amino acids (basic amino) acids such as arginine, histidine, lysine etc. negatively charged amino acids (acidic amino acids) are aspartic acid, etc. Glutamate etc. can be mentioned.

The identity, the substitution and the like may be in the range where the MUC1 binding molecule of the present invention binds to MUC1.

As described above, the MUC1 binding molecule of the present invention may be, for example, the above antibody or the above antigen binding fragment, and the above antigen binding fragment may be, for example, scFv. The scFv comprises, for example, the heavy chain variable region and the light chain variable region. The heavy chain variable region and the light chain variable region are linked, for example, by a polypeptide linker. The scFv may have, for example, the heavy chain variable region at the N-terminal side, the light chain variable region at the C-terminal side, or the light chain variable region at the N-terminal side, C You may have the said heavy chain variable region at the terminal side. As the scFv, for example, from the N-terminal side, the heavy chain variable region, the linker, the polypeptide to which the light chain variable region is linked, the light chain variable region, the linker, the heavy chain variable region are linked And the like.

The linker is not particularly limited, and, for example, a polypeptide used in general scFv design can be adopted. Examples of the linker include a repeating sequence of GGGGS (SEQ ID NO: 11) and the like. The number of repetitions is not particularly limited, and for example, GGGGSGGGGSGGGGS (SEQ ID NO: 12) can be exemplified as a sequence repeated three times as the linker.

In addition, when the scFv is produced by a genetic engineering method as described later, for example, it may further have a signal peptide at at least one of the N-terminus and C-terminus, or the N-terminus and C-terminus. At least one of the ends may further have a tag peptide used for purification.

The signal peptide is not particularly limited, and examples thereof include a signal peptide for secreting the peptide from the host, and specific examples include an IL2 signal peptide. Examples of the signal peptide include MYRMQLLSCIALSLALVTNS (SEQ ID NO: 13). The tag peptide is not particularly limited, and examples thereof include His tag peptide. The His tag peptide is not particularly limited, and examples thereof include HHHHHH (SEQ ID NO: 14).

The method for producing the MUC1 binding molecule of the present invention is not particularly limited, and can be produced by genetic engineering based on, for example, the aforementioned amino acid sequence information. Specifically, for example, it can be performed as follows. The present invention is not limited to this example.

First, an expression vector that expresses the MUC1 binding molecule of the present invention is introduced into a host to obtain a transformant. Then, the transformant is cultured, a fraction containing the MUC1 binding molecule is recovered, and the MUC1 binding molecule is isolated or purified from the obtained fraction obtained. The expression vector is, for example, a vector containing a coding gene of the MUC1 binding molecule. The coding gene and the expression vector will be described later.

The method for culturing the transformant is not particularly limited, and can be appropriately determined according to the type of the host. The fraction containing the MUC1 binding molecule can be recovered as an extracellular fraction or an intracellular fraction, for example, depending on the form of expression of the MUC1 binding molecule. When the MUC1 binding molecule is an intracellular molecule, it can be recovered as a liquid fraction, for example, by disrupting the cultured transformant and releasing it from cells. When the MUC1 binding molecule is an extracellular secretion molecule, it can be recovered as a liquid fraction by removing the transformant from the culture solution. In the latter case, for example, as described above, it is preferable to express the MUC1 binding molecule in a state in which the signal peptide is linked. The isolation or purification of the MUC1 binding molecule is not particularly limited, and known methods can be employed.

When the MUC1 binding molecule of the present invention is the above-mentioned antibody, for example, a monoclonal antibody, a chimeric antibody, a humanized antibody, a human antibody (also referred to as a fully human antibody) and the like can be mentioned.

The chimeric antibody is an antibody in which the variable region of a non-human animal-derived antibody and the constant region of a human antibody are linked. The chimeric antibody can be produced, for example, as follows. First, the coding gene of the variable region (V region) that binds to MUC1 and the coding gene of the constant region (C region) of a human antibody are linked, and this is further linked to a vector to obtain an antibody expression vector Prepare. Then, the transformant transfected with the expression vector is cultured, and the antibody expressed by the transformant is recovered. Thereby, a chimeric antibody can be prepared. The method for producing the chimeric antibody is not limited thereto, and can be produced with reference to known methods such as the method described in Japanese Patent Publication No. 3-73280. The MUC1 binding molecule of the present invention can be made a chimeric antibody, for example, by using the coding gene for the heavy chain variable region and the coding gene for the light chain variable region as the coding gene for the variable region.

The humanized antibody is an antibody in which only the CDRs are derived from animals other than human and the other regions are derived from human. The humanized antibody can be produced, for example, as follows. First, the gene encoding the CDRs is grafted to a gene of a human antibody, for example, a constant region (CDR grafting), and this is further ligated to a vector to prepare an expression vector. Then, the transformant transfected with the expression vector is cultured, and the antibody expressed by the transformant is recovered. Thereby, the humanized antibody can be prepared. The method for producing the humanized antibody is not limited to this, and for example, it is produced with reference to known methods such as the methods described in JP-A-4-506458 and JP-A-62-296890. it can. The MUC1 binding molecule of the present invention can be made into a humanized antibody, for example, by using the coding gene of each CDR of the heavy chain variable region and the coding gene of each CDR of the light chain variable region.

The human antibody is an antibody derived from human in all regions. The human antibody can be produced, for example, by introducing a human antibody gene into a non-human animal. As the animal into which the human antibody gene is introduced, for example, a transgenic animal for human antibody production can be used. The type of the animal is not particularly limited, and mice and the like can be mentioned. The method for producing the human antibody is, for example, described in Nature Genetics, Vol. 7, p. 13-21, 1994; Nature Genetics, Vol. 15, p. 146-156, 1997; Manufactured with reference to known methods described in JP-A 7-509137; WO 94/25585; Nature, Vol. 368, p. 856-859, 1994; it can. The human antibody can also be produced, for example, using a phage display method, and, for example, Marks, J. D. et al .: J. Mol. Biol., Vol. 222, p. It can be manufactured with reference to known methods described in 1991 et al.

The MUC1 binding molecule of the present invention can also be prepared, for example, by immunizing an animal with an antigen. Examples of the antigen include a protein consisting of the full-length amino acid sequence of MUC1 or a peptide fragment thereof. The peptide fragment may be, for example, a peptide fragment consisting only of an antigenic determinant (epitope), or may be a peptide fragment containing the antigenic determinant. Examples of the peptide fragment include a polypeptide consisting of the amino acid sequence 146-170 (GVTSAPDTRPAPGSTAPPAHGBTSA: SEQ ID NO: 16) in the amino acid sequence of SEQ ID NO: 15 described above (sequence enclosed by a box in Table 1).

The monoclonal antibodies obtained by immunizing the above animals are described, for example, in “Current Protocols in Molecular Biology” (John Wiley & Sons (1987)), Antibodies: A Laboratory Manual, Ed. Harlow and David Lane, Cold Spring Harbor Laboratory (1988). ) And the like, and the like, and can be manufactured with reference to known methods. Specifically, for example, an animal is immunized with an antigen, and antibody-producing cells collected from the immunized animal are fused with a myeloma cell (myeloma cell) lacking the ability to produce an autoantibody to produce a hybridoma. Subsequently, antibody-producing cells are screened from the hybridomas, and cloning is performed to produce single clones of hybridomas. Then, this hybridoma clone is administered to an animal, and a monoclonal antibody is purified from the obtained peritoneal cavity. Alternatively, the hybridoma is cultured and the monoclonal antibody is purified from the culture solution. Thus, monoclonal antibodies with uniform specificity can be stably supplied by preparing the hybridoma clones.

The myeloma cells are preferably derived from, for example, mice, rats, humans and the like. The myeloma cells and the antibody-producing cells may be, for example, of the same or different origin, but preferably of the same type.

The MUC1 binding molecule of the invention binds to MUC1 as described above. Therefore, the MUC1 binding molecule of the present invention can be used, for example, in various methods utilizing binding to MUC1. MUC1 targeted by the MUC1 binding molecule of the present invention is, for example, a MUC1 variant comprising the amino acid sequence of SEQ ID NO: 16 and a peptide fragment comprising the amino acid sequence of SEQ ID NO: 16 in the MUC1 variant. As described above, since MUC1 is expressed, for example, in cancer cells, it can also be used, for example, for diagnosis of cancer by detecting binding to MUC1, treatment using binding to MUC1, and the like.

The cancer targeted for diagnosis and treatment utilizing binding to MUC1 is not particularly limited. For example, breast cancer, lung cancer, ovarian cancer, cervical cancer, prostate cancer, stomach cancer, colon cancer, and pancreatic cancer Cancer, liver cancer, myeloma, leukemia etc. In addition to these, detection of MUC1 using a MUC1 antibody can also diagnose, for example, a cervical intraepithelial neoplasia. The fact that detection of MUC1 enables diagnosis of cervical intraepithelial neoplasia is found by the present inventors (International Patent Application No. PCT / JP2016 / 069468).

MUC1 is, as mentioned above, a core protein of mucin and is known as a component of mucus. On the other hand, since cervical epithelium does not have mucus, it is technical common knowledge that there is no MUC in cervical epithelium. However, the present inventors have found that in cervical intraepithelial neoplasia, MUC1 whose expression is not confirmed in normal epithelia has specific expression. Therefore, by detecting the presence of MUC1, a biological sample isolated from cervical epithelium can be tested for the possibility of cervical cancer. Specifically, since MUC1 expression is not confirmed in normal epithelium, for example, whether or not cervical cancer can be determined by the presence or absence of MUC, and expression is not confirmed in normal epithelium The problem of false positive or false negative can also be avoided, and reliable results can be obtained.

MUC1 can be detected, for example, by detecting a signal generated directly or indirectly by the binding of the MUC1 binding molecule of the present invention to the MUC1.

The detection of the binding between the MUC1 binding molecule and MUC1 of the present invention can employ, for example, a conventionally known detection method relating to the binding of a target and a binding substance to the target. In the MUC1 binding molecule of the present invention, for example, a method of detecting an antigen-antibody reaction can be employed. Specific examples thereof include ELISA (Enzyme-Linked Immunosorbent Assay) method, RIA (radioimmunoassay) method, immunochromatography method, immunostaining method such as immunohistochemical staining, and flow cytometry method. The MUC1 binding molecule of the present invention may be labeled, for example, with an enzyme, a radioactive isotope, a labeling substance such as particles, a labeling substance such as particles, a dye such as a fluorescent dye, or a chromogenic substrate of an enzyme. Examples of the particles include metal particles such as gold and silver, and latex particles such as colored latex particles. In addition, the binding substance may be used in combination with a substrate of an enzyme, a reducing agent such as divalent iron (Fe 2+), or the like depending on, for example, the type of the detection method.

When detecting MUC1 in a biological sample, the biological sample is not particularly limited, and may be, for example, a cell or a tissue. The form of the biological sample may be solid or liquid, and in the latter case, it may be, for example, a suspension in which cells or tissues are suspended in a solvent, or a suspension in which cells or tissues are suspended in a solvent. The type of the solvent is not particularly limited, and examples thereof include water, saline, buffers, preservation solutions for cells or tissues, and the like.

When the biological sample is a sample of cervical epithelium, it may be, for example, a sample obtained by abrasion from the cervix, and among samples to be subjected to cytology, a sample remaining in preparation of a specimen may be used. In recent years, Liquid based cytology (LBC method) is widely used for preparation of specimens used for cytology. In the LBC method, the cervix is abraded with a special brush, the special brush is washed in the LBC storage solution to suspend the cells, and the obtained cell suspension is uniformly applied to the slide to obtain a specimen. Is a method of making According to this method, it is possible to avoid, for example, the problem of an inappropriate sample in which the amount of cells is insufficient, or the correct determination can not be made due to drying of cells or the like. Therefore, for example, the cell suspension may be used as the biological sample. When the cell suspension is used, for example, it is preferable to combine flow cytometry. Examples of the dedicated brush include, for example, a Bloom-type brush (for example, a surfex brush) and the like, and as the dedicated storage solution, for example, commercially available products can be used.

<Coding gene>
As described above, the coding gene of the present invention is a coding gene for an antibody against MUC1 or an antigen-binding fragment thereof, and is characterized in that it encodes the amino acid sequence of the MUC1-binding molecule (antibody or antigen-binding fragment thereof) of the present invention. I assume. The coding gene of the present invention is also referred to as a coding gene for a MUC1 binding molecule.

The coding gene of the present invention is a gene encoding the amino acid sequence of the MUC1 binding molecule of the present invention. Therefore, the MUC1 binding molecule of the present invention described above can be obtained by expressing the coding gene of the present invention.

Hereinafter, although the coding gene of the present invention is exemplified, it is not limited thereto, and may be a sequence encoding the amino acid sequence of the MUC1 binding molecule of the present invention. In addition, the coding sequence of the present invention may be, for example, a complementary sequence consisting of a complementary base sequence to the sequences exemplified below.

Coding sequence (x1) of heavy chain variable region (X1)
It is a polynucleotide comprising the base sequence of any one of the following (h-1) to (h-3).
(H-1) Nucleotide sequence of SEQ ID NO: 17 (h-2) Nucleotide sequence of 80% or more identity to the nucleotide sequence of SEQ ID NO: 17 (h-3) In the nucleotide sequence of SEQ ID NO: 17 Base sequence with deletion, substitution, insertion and / or addition of

The base sequence of SEQ ID NO: 17 is shown in Table 6 below. In Table 6 below, the boxed regions are, for example, the coding sequence of CDR1, the coding sequence of CDR2, and the coding sequence of CDR3 from the 5 terminal side.

Coding sequence (x2) of heavy chain variable region (X2)
A coding sequence for heavy chain CDR1, a coding sequence for heavy chain CDR2 and a coding sequence for heavy chain CDR3;
The coding sequence of the heavy chain CDR1 is a polynucleotide comprising a nucleotide sequence of any one of the following (h1-1) to (h1-3):
The coding sequence of the heavy chain CDR2 is a polynucleotide comprising the nucleotide sequence of any one of the following (h2-1) to (h2-3):
The coding sequence of the heavy chain CDR3 is a polynucleotide comprising a base sequence of any one of the following (h3-1) to (h3-3).

(H1-1) nucleotide sequence of SEQ ID NO: 18 (h1-2) nucleotide sequence of 80% or more identity to the nucleotide sequence of SEQ ID NO: 18 (h1-3) 1 or several nucleotides in the nucleotide sequence of SEQ ID NO: 18 SEQ ID NO: 18: GACTACTGGATGAAC wherein the base of SEQ ID NO: 18 has been deleted, substituted, inserted and / or added

(H2-1) nucleotide sequence of SEQ ID NO: 19 (h2-2) nucleotide sequence of 80% or more identity to the nucleotide sequence of SEQ ID NO: 19 (h2-3) 1 or several nucleotides in the nucleotide sequence of SEQ ID NO: 19 SEQ ID NO: 19: GATATTAGATTGAAATCTTATAATTATGCAACACATTATGCGGAGTCTGTGAAAGGGAGGTTCAC sequence of SEQ ID NO: 19 with deletion, substitution, insertion and / or addition of

(H3-1) nucleotide sequence of SEQ ID NO: 20 (h3-2) nucleotide sequence of 80% or more identity to the nucleotide sequence of SEQ ID NO: 20 (h3-3) 1 or several nucleotides in the nucleotide sequence of SEQ ID NO: 20 SEQ ID NO: 20 with deletion, substitution, insertion and / or addition of the base of
GGT AACTCCTTTGCTTAC

Coding sequence (y1) of light chain variable region (Y1)
It is a polynucleotide comprising the base sequence of any one of the following (1-1) to (1-3).
(I-1) Nucleotide sequence of SEQ ID NO: 21. (1-2) Nucleotide sequence of 80% or more identity to the nucleotide sequence of SEQ ID NO: 21. (1-3) In the nucleotide sequence of SEQ ID NO: 21, one or several Base sequence with deletion, substitution, insertion and / or addition of

The base sequence of SEQ ID NO: 21 is shown in Table 7 below. In Table 7 below, the boxed regions are, for example, the coding sequence of CDR1, the coding sequence of CDR2, and the coding sequence of CDR3 from the 5 terminal side.

Coding sequence (y2) of light chain variable region (Y2)
A light chain CDR1 coding sequence, a light chain CDR2 coding sequence and a light chain CDR3 coding sequence,
The coding sequence of the light chain CDR1 is a polynucleotide comprising a nucleotide sequence of any one of the following (11-1) to (11-3):
The coding sequence of the light chain CDR2 is a polynucleotide comprising a nucleotide sequence of any one of the following (12-1) to (12-3):
The coding sequence of the light chain CDR3 is a polynucleotide comprising a base sequence of any one of the following (13-1) to (13-3).

(L1-1) Nucleotide sequence of SEQ ID NO: 22. (l1-2) Nucleotide sequence of 80% or more identity to the nucleotide sequence of SEQ ID NO: 22. (l1-3) In the nucleotide sequence of SEQ ID NO. SEQ ID NO: 22: CGCTCAAGTACTGGGGCTGTTACAACTAGTAACTATGCCAAC, wherein the base of SEQ ID NO: 22 has been deleted, substituted, inserted and / or added

(12-1) Nucleotide sequence of SEQ ID NO: 23 (12-2) Nucleotide sequence of 80% or more identity to the nucleotide sequence of SEQ ID NO: 23 (12-3) One or several nucleotide sequences of SEQ ID NO: 23 SEQ ID NO: 23 with deletion, substitution, insertion and / or addition of the base

(L3-1) Nucleotide sequence of SEQ ID NO: 24. (l3-2) Nucleotide sequence of 80% or more identity to the nucleotide sequence of SEQ ID NO: 24. (l3-3) 1 or several nucleotides in the nucleotide sequence of SEQ ID NO: 23 SEQ ID NO: 24 with deletion, substitution, insertion and / or addition of the base of SEQ ID NO: 24: GCTC TAGTGACAGCAACCATTGGGTG

Coding sequence (v) of heavy chain (V) comprising said heavy chain variable region
(V1) Nucleotide sequence of SEQ ID NO: 25 (v2) Nucleotide sequence of 80% or more identity to the nucleotide sequence of SEQ ID NO: 25 (v3) In the nucleotide sequence of SEQ ID NO: 25, one or several bases are deleted Nucleotide sequence substituted, inserted and / or added

The base sequence of SEQ ID NO: 25 is shown in Table 8 below. In Table 8 below, the underlined part is, for example, the coding sequence of the heavy chain variable region, and the boxed region is, for example, the coding sequence of CDR1, the coding sequence of CDR2, the coding sequence of CDR3 from the 5 terminal side. It is.

A light chain (W) coding sequence (w) comprising the light chain variable region
(W1) nucleotide sequence of SEQ ID NO: 26 (w2) nucleotide sequence of 80% or more identity to the nucleotide sequence of SEQ ID NO: 26 (w3) In the nucleotide sequence of SEQ ID NO: 26, one or several bases are deleted Nucleotide sequence substituted, inserted and / or added

The base sequence of SEQ ID NO: 26 is shown in Table 9 below. In Table 9 below, the underlined part is, for example, the coding sequence of the light chain variable region, and the boxed region is, for example, the coding sequence of CDR1, the coding sequence of CDR2, the coding sequence of CDR3 from the 5 terminal side. It is.

In the present invention, “identity” is, for example, the degree of identity when the sequences to be compared are properly aligned, and means the appearance rate (%) of exact matches of bases between the sequences. The identity is, for example, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more. The identity can be calculated by default parameters using, for example, analysis software such as BLAST and FASTA (the same applies hereinafter).

The identity, the substitution and the like may be, for example, in such a range that the reading frame for the amino acid sequence of the MUC1 binding molecule of the present invention does not change.

The expression vector of the present invention is an expression vector of the MUC1 binding molecule (an antibody against MUC1 or an antigen binding fragment thereof) of the present invention, and is characterized by containing the coding gene of the present invention. The expression vector of the present invention only needs to express the MUC1 binding molecule of the present invention, and the other constitution is not particularly limited.

The expression vector of the present invention may be, for example, an expression vector comprising a nucleic acid sequence encoding the heavy chain variable region and a nucleic acid sequence encoding the light chain variable region, or a nucleic acid sequence encoding the heavy chain variable region It may be a set of an expression vector comprising the expression vector and an expression vector comprising the nucleic acid sequence encoding the light chain variable region. The expression vector of the present invention can be prepared, for example, by ligating the coding gene of the present invention into a vector. The type of vector to which the coding gene is linked is not particularly limited, and examples thereof include pUC, pET, pGEX, pBS, pBluescript, pcDNA3.1 and the like. The vector can also be appropriately set, for example, according to the host into which the expression vector is to be introduced. The host is not particularly limited, and examples thereof include mammalian cells such as HEK cells, CHO cells, NSO cells, SP2 / 0 cells, and the like.

The transformant of the present invention is characterized by containing the coding gene of the present invention. The transformant of the present invention may be capable of expressing the coding gene of the present invention. The transformant preferably has, for example, the expression vector of the present invention. The method for introducing the expression vector into the host is not particularly limited, and known methods can be employed.

<Detection method and test method>
The MUC1 binding molecule of the present invention can be applied to various methods utilizing binding to MUC1.

The detection method of the present invention is a method for detecting MUC1, and is characterized by comprising the step of detecting MUC1 in a biological sample using the MUC1 binding molecule of the present invention. The detection method of the present invention is characterized by using the MUC1 binding molecule of the present invention, and the other conditions and configurations are not limited at all.

The detection reagent of the present invention is a detection reagent of MUC1, and is characterized by containing the MUC1 binding molecule of the present invention, and can be used in the detection method of the present invention. The detection reagent of the present invention is characterized in that it contains the above-mentioned MUC1 binding molecule, and the other conditions and constitution are not limited at all. In addition, the description of the MUC1 binding molecule of the present invention can be incorporated into the detection reagent of the present invention unless otherwise indicated.

The test method of the present invention is a test method for testing the possibility of morbidity of cervical cancer, and MUC1 is detected from the biological sample isolated from the cervix using the MUC1 binding molecule of the present invention. And a step of The test method of the present invention is characterized by using the MUC1 binding molecule of the present invention, and the other conditions and configurations are not limited at all.

The test reagent of the present invention is characterized by containing the MUC1 binding molecule of the present invention, and can be used in the test method of the present invention. The test reagent of the present invention is characterized by containing the above-mentioned MUC1 binding molecule, and the other conditions and constitution are not limited at all. In addition, the description of the MUC1 binding molecule of the present invention can be incorporated into the test reagent of the present invention unless otherwise indicated.

In the detection step, the detection of MUC1 may be, for example, detection (qualification) of the presence or absence of MUC1 or detection (quantification) of the amount of MUC1. In the test method of the present invention, for example, when the expression of MUC1 is detected in the detection step, it is determined that there is a possibility of cervical cancer. The method of the present invention, for example, excludes actions by a physician.

The detection step indirectly detects the expression of MUC, for example, by detecting the binding between MUC1 and the MUC1 binding molecule in the biological sample. According to the MUC1 binding molecule, for example, the presence or absence of the binding between MUC1 and the MUC1 binding molecule correlates with the presence or absence of MUC1, and the amount of binding between MUC1 and the MUC1 binding molecule correlates with the amount of MUC1. Thus, the binding can indirectly detect the expression of MUC1.

The detection step can detect the expression of MUC1 by, for example, detecting a signal generated directly or indirectly by the binding of the MUC1 to the MUC1 binding molecule. The signal can be generated, for example, by labeling the MUC1 binding molecule with a labeling substance as described later.

For detection of the binding between MUC1 and the MUC1 binding molecule, for example, a general method for detecting binding between an antigen and an antibody can be adopted. Specific examples thereof include ELISA (Enzyme-Linked Immunosorbent Assay) method, RIA (radioimmunoassay) method, immunochromatography method, immunostaining method such as immunohistochemical staining, and flow cytometry method. The MUC1 binding molecule may be labeled, for example, with enzymes, radioactive isotopes, labeling substances such as particles, dyes such as fluorescent dyes, chromogenic substrates of enzymes, etc., depending on the type of the detection method. Examples of the particles include metal particles such as gold and silver, and latex particles such as colored latex particles. In addition, the binding substance may be used in combination with a substrate of an enzyme, a reducing agent such as divalent iron (Fe 2+), or the like depending on, for example, the type of the detection method.

In the detection, for example, only the MUC1 binding molecule (MUC1 antibody) may be used as a primary antibody, or the primary antibody may be used in combination with a secondary antibody that binds to the primary antibody. In the former case, for example, the binding of the primary antibody to MUC1 may be detected, and in the latter case, for example, the binding of the secondary antibody to the primary antibody bound to MUC1 may be detected. In the former case, it is preferable that the primary antibody is, for example, a labeled antibody labeled with the labeling substance. In the latter case, the secondary antibody is preferably, for example, a labeled antibody labeled with the labeling substance.

The biological sample may be, for example, a cell or a tissue. The biological sample is preferably, for example, a sample derived from cervical epithelium. The form of the biological sample may be solid or liquid, and in the latter case, it may be, for example, a suspension in which cells or tissues are suspended in a solvent, or a suspension in which cells or tissues are suspended in a solvent. The type of the solvent is not particularly limited, and examples thereof include water, saline, buffers, preservation solutions for cells or tissues, and the like.

The biological sample may be, for example, a sample obtained by abrasion from a cervix, and among samples to be subjected to the aforementioned cytology, a sample remaining in preparation of a specimen may be used. In recent years, Liquid based cytology (LBC method) is widely used for preparation of specimens used for cytology. In the LBC method, the cervix is abraded with a special brush, the special brush is washed in the LBC storage solution to suspend the cells, and the obtained cell suspension is uniformly applied to the slide to obtain a specimen. Is a method of making According to this method, it is possible to avoid, for example, the problem of an inappropriate sample in which the amount of cells is insufficient, or the correct determination can not be made due to drying of cells or the like. Therefore, in the present invention, for example, the cell suspension may be used as the biological sample. When the cell suspension is used, for example, it is preferable to combine flow cytometry. Examples of the dedicated brush include, for example, a Bloom-type brush (for example, a surfex brush) and the like, and as the dedicated storage solution, for example, commercially available products can be used.

In addition, the detection reagent or test reagent of the present invention is characterized in that the diagnostic reagent is a diagnostic reagent for cervical cancer and contains a binding substance for MUC. The diagnostic reagent of the present invention can be used in the method of diagnosing cervical cancer of the present invention. The diagnostic reagent of the present invention is characterized in that it contains the binding substance, and the other conditions and configurations are not limited in any way. In addition, the description of the test reagent of the present invention can be incorporated into the diagnostic reagent of the present invention unless otherwise indicated.

The diagnostic method of the present invention is, for example, a method of diagnosing cervical cancer, which comprises the step of detecting MUC1 from a biological sample isolated from the cervix using the MUC1 binding molecule of the present invention. It is characterized by The diagnostic method of the present invention is characterized by using the MUC1 binding molecule of the present invention, and the other conditions and constitution are not limited at all.

The diagnostic reagent of the present invention is a diagnostic reagent for cervical cancer, and is characterized in that it contains the MUC1 binding molecule of the present invention. The diagnostic reagent of the present invention can be used in the method of diagnosing cervical cancer of the present invention. The diagnostic reagent of the present invention is characterized by containing the MUC1 binding molecule of the present invention, and the other conditions and constitution are not limited at all. In addition, the description of the MUC1 binding molecule of the present invention can be incorporated into the diagnostic reagent of the present invention unless otherwise indicated.

The diagnostic method of the present invention is preferably performed, for example, in combination with cytology. For example, a biological sample is collected from a patient, a part is used as a cytology sample, and a part is used as a MUC1 detection sample. Then, cytology is performed on the sample for cytology only for a biological sample determined as MUC1 positive by detection of MUC1 using the MUC1 binding molecule. According to such a method, as described above, it is possible to avoid performing cytodiagnosis on a large amount of biological sample, and to significantly reduce the cost and labor.

Next, examples of the present invention will be described. However, the present invention is not limited by the following examples. Commercially available reagents were used based on their protocol unless otherwise indicated.

Example 1
A peptide fragment of MUC1 (SEQ ID NO: 16) was used as an antigen to immunize mice to obtain an anti-MUC1 monoclonal antibody that binds to MUC1. The amino acid sequence of the MUC1 monoclonal antibody was analyzed, and for the heavy chain, full length (SEQ ID NO: 25), heavy chain variable region (SEQ ID NO: 17), CDR1 (SEQ ID NO: 18), CDR2 (SEQ ID NO: 19), CDR3 (SEQ ID NO: 20) For the light chain, full length (SEQ ID NO: 26), light chain variable region (SEQ ID NO: 21), CDR1 (SEQ ID NO: 22), CDR2 (SEQ ID NO: 23), CDR3 (SEQ ID NO: 24) were identified.

The binding of MUC1 to the MUC1 monoclonal antibody was confirmed by Western blotting.

The western blotting was performed as follows. Human cervical cancer cell line (SiHa), SiHa cells overexpressing full-length MUC1 (Full), and SiHa cells overexpressing full-length MUC1, glycated MUC1 and an N-terminal fragment of MUC1 (N-terminal fragment) Then, the protein was extracted and subjected to PAGE to separate protein and peptide fragments. The full-length MUC1 (amino acid sequence of SEQ ID NO: 27) and the glycosylated MUC1 are derived from the SiHa cell and have the same amino acid sequence as the antigenic determinant (amino acid sequence of SEQ ID NO: 16), and the N-terminal fragment is And an N-terminal fragment (388 amino acid residues long at the N-terminus) of MUC1 derived from the SiHa cell, and having the same amino acid sequence as the antigenic determinant (the amino acid sequence of SEQ ID NO: 16). The separated proteins and peptide fragments were then transferred to a membrane and blocked. Next, the membrane and the MUC1 monoclonal antibody were reacted, and the secondary antibody was further reacted to confirm the binding of the monoclonal antibody. In addition, as a control, GAPDH antibody was also used to detect GAPDH.

SEQ ID NO: 27
MTPGTQSPFFLLLLLTVLTVVTGSGHASSTPGGEKETSATQRSSVPSSTEKNAVSMTSSVLSSHSPGSGSSTTQGQDVTLAPATEPASGSAATWGQDVTSVPVTRPALGSTTPPAHDVTSAPDNKPAPGSTAPPAHGVTSAPDTRPAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTPAPGSTAPPAHGVTSAPDTRPAPGSTAPPAHGVTSAPDNRPALGSTAPPVHNVTSASGSASGSASTLVHNGTSARATTTPASKSTPFSIPSHHSDTPTTLASHSTKTDASSTHHSTVPPLTSSNHSTSPQLSTGVSFFFLSFHISNLQFNSSLEDPSTDYYQELQRDISEMFLQIYKQGGFLGLSNIKFRPGSVVVQLTLAFREGTINVHDVETQFNQYKTEAASRYNLTISDVSVSDVPFPFSAQSGAGVPGWGIALLVLVCVLVALAIVYLIALAVCQCRRKNYGQLDIFPARDTYHPMSEYPTYHTHGRYVPPSSTDRSPYEKVSAGNGGSSLSYTNPAVAATSANL

These results are shown in FIG. FIG. 1 shows the result of Western blotting, the upper figure shows the result of using the MUC1 monoclonal antibody, and the lower figure shows the result of control using GAPDH antibody. In FIG. 1, lane 1 is the result of SiHa, lane 2 is the cell (Full), and lane 3 is the result of the cell (N-terminal fragment).

As shown in FIG. 1, according to the MUC1 monoclonal antibody, any of glycated MUC1, full-length MUC1 and an N-terminal fragment of MUC1 could be detected. According to the MUC1 monoclonal antibody, since the glycated MUC1 can be detected, it is possible to detect, for example, MUC1 whose sugar modification has been changed during the process of canceration. Further, according to the MUC1 monoclonal antibody, since the N-terminal fragment can be detected, it is also applicable to analysis by flow cytometry, for example, by recognition of the N-terminal which is an extracellular domain. Moreover, since the N-terminal fragment which is an extracellular domain of MUC1 may be cleaved and released, the MUC1 antibody can be used, for example, for detection of an N-terminal fragment secreted in body fluid.

From these results, it could be confirmed that the MUC1 antibody of the present invention has a binding ability to MUC1.

Example 2
An scFv having a heavy chain variable region and a light chain variable region in the MUC1 antibody of Example 1 was produced.

Specifically, from the N-terminal side, IL2 signal sequence for extracellular secretion (SEQ ID NO: 13), heavy chain variable region (SEQ ID NO: 1), linker (SEQ ID NO: 12), light chain variable region (SEQ ID NO: 5) and A sequence (SEQ ID NO: 29) encoding a scFv (amino acid sequence: SEQ ID NO: 28) to which a His tag (SEQ ID NO: 14) is linked is synthesized, ligated to a plasmid vector (vector name pcDNA3.1 (+)), An expression vector was constructed. An outline of the structure of the scFv expression vector is shown in FIG.

SEQ ID NO: 28
A, A, A, A, A, B, A, B, A, B, A, A, B, A, B, A, B, A, A, B, A, A, A, A, A, A, A, A, A, B;

SEQ ID NO: 29
ATGTACCGGATGCAGCTGCTGTCCTGCATCGCCCTGTCCCTGGCCCTGGTGACCAACAGCGAGGTGAAGCTGGAGGAGAGCGGGGGGGGGCTGGTGCAGCCTGGAGGATCTATGAAGCTGAGCTGCGTGGCCTCTGGCTTCTCTTTCAGTGACTACTGGATGAATTGGGTGAGGCAGAGTCCTGACAAGGGGCTGGAGTGGATTTCTGATATTAGGCTGAAGAGCTACAACTACGCTACACACTACGCCGAGTCTGTGAAGGGCAGGTTTACCATTTCCCGGGACGATAGCAAAAGCGGCGTGTACCTGCAGATGAACAACCTGAGGGCCGAGGACACCGGCCTGTACTACTGCACATTCGGCAACAGCTTCGCCTACTGGGGCCAGGGCACCCTGGTGACCGTGTCCGCAGGAGGCGGCGGATCCGGAGGAGGAGGATCTGGCGGAGGAGGAAGCCAGGCCGTGGTGACCCAGGAGTCCGCCCTGACTACATCCCCTGGAGAAACAGTGACTCTGACATGTAGGTCCAGTACAGGAGCTGTGACAACAAGCAACTACGCTAACTGGGTGCAGGAGAAGCCTGATCACCTGTTCACCGGACTGATCGGCGGCACCAACAACAGGGCCCCCGGCGTGCCTGCCAGGTTCAGTGGATCCCTGATCGGCGACAAAGCCGCCCTGACTATTACAGGAGCCCAGACCGAAGACGAGGCCATTTACTTCTGCGCCCTGTGGTACTCCAACCACTGGGTGTTCGGAGGCGGAACCAAGCTGACCGTGCTGGGGCACCACCATCACCACCAC

Although the present invention has been described above with reference to the embodiments, the present invention is not limited to the above embodiments. Various changes that can be understood by those skilled in the art can be made to the configuration and details of the present invention within the scope of the present invention.

This application claims the priority based on Japanese Patent Application No. 2017-200471 filed on October 16, 2017, the entire disclosure of which is incorporated herein.

According to the present invention, novel MUC1 antibodies or antigen-binding fragments thereof can be provided. For this reason, the present invention can be said to be extremely useful in the field of medicine and the like.

Claims

Comprising a heavy chain variable region and a light chain variable region,
The heavy chain variable region is the following (X1) or (X2):
The light chain variable region is the following (Y1) or (Y2):
An antibody against MUC1 or an antigen-binding fragment thereof, characterized in that it binds to MUC1.
Heavy chain variable region (X1)
It is a polypeptide comprising an amino acid sequence of any one of the following (H-1) to (H-3):
(H-1) Amino acid sequence of SEQ ID NO: 1 (H-2) Amino acid sequence of 80% or more identity with amino acid sequence of SEQ ID NO: 1 (H-3) One or several amino acid sequences of SEQ ID NO: 1 Amino acid sequence heavy chain variable region (X2) in which the amino acid of SEQ ID NO: 1 is deleted, substituted, inserted and / or added
Comprising heavy chain CDR1, heavy chain CDR2 and heavy chain CDR3;
The heavy chain CDR1 is a polypeptide comprising an amino acid sequence of any one of the following (H1-1) to (H1-3):
The heavy chain CDR2 is a polypeptide comprising an amino acid sequence of any one of (H2-1) to (H2-3),
The heavy chain CDR3 is a polypeptide comprising an amino acid sequence of any of (H3-1) to (H3-3).
(H1-1) Amino acid sequence of SEQ ID NO: 2 (H1-2) Amino acid sequence of 80% or more identity to the amino acid sequence of SEQ ID NO: 2 (H1-3) One or several amino acid sequences in SEQ ID NO: 2 (H2-1) amino acid sequence of SEQ ID NO: 3 (H2-2) amino acid sequence of 80% or more identity to the amino acid sequence of SEQ ID NO: 3 (H2-1) H2-3) Amino acid sequence in which one or several amino acids are deleted, substituted, inserted and / or added in the amino acid sequence of SEQ ID NO: 3 (H3-1) Amino acid sequence of SEQ ID NO: 4 (H3-2) Amino acid sequence having 80% or more identity to the amino acid sequence of SEQ ID NO: 4 (H3-3) Amino acid in which one or several amino acids are deleted, substituted, inserted and / or added in the amino acid sequence of SEQ ID NO: 4 Sequence light chain variable region (Y1)
It is a polypeptide comprising an amino acid sequence of any one of the following (L-1) to (L-3):
(L-1) Amino acid sequence of SEQ ID NO: 5 (L-2) Amino acid sequence of 80% or more identity to the amino acid sequence of SEQ ID NO: 5 (L-3) One or several amino acid sequences of SEQ ID NO: 5 Amino acid sequence light chain variable region (Y2) in which the amino acid of SEQ ID NO: 1 is deleted, substituted, inserted and / or added
Comprising a light chain CDR1, a light chain CDR2 and a light chain CDR3;
The light chain CDR1 is a polypeptide comprising an amino acid sequence of any one of the following (L1-1) to (L1-3):
The light chain CDR2 is a polypeptide comprising an amino acid sequence of any one of (L2-1) to (L2-3),
The light chain CDR3 is a polypeptide comprising an amino acid sequence of any one of (L3-1) to (L3-3).
(L1-1) Amino acid sequence of SEQ ID NO: 6 (L1-2) Amino acid sequence of 80% or more identity to the amino acid sequence of SEQ ID NO: 6 (L1-3) One or several amino acid sequences of SEQ ID NO: 6 Amino acid sequence in which the amino acid of SEQ ID NO: 1 is deleted, substituted, inserted and / or added (L2-1) amino acid sequence of SEQ ID NO: 7 (L2-2) amino acid sequence of 80% or more identity to the amino acid sequence of SEQ ID NO: 7 L2-3) Amino acid sequence in which one or several amino acids are deleted, substituted, inserted and / or added in the amino acid sequence of SEQ ID NO: 7 (L3-1) Amino acid sequence of SEQ ID NO: 8 (L3-2) Amino acid sequence of 80% or more identity to the amino acid sequence of SEQ ID NO: 8 (L3-3) Amino acid in which one or several amino acids are deleted, substituted, inserted and / or added in the amino acid sequence of SEQ ID NO: 8 Array
The combination of the heavy chain variable region and the light chain variable region is a combination of (X1) and (Y1), a combination of (X1) and (Y2), a combination of (X2) and (Y1) or The antibody or antigen-binding fragment thereof according to claim 1, which is a combination of X2) and (Y2).
The antibody or antigen-binding fragment thereof according to claim 1 or 2, which comprises a human constant region.
The antibody or antigen-binding fragment thereof according to any one of claims 1 to 3, wherein the antigen-binding fragment is a scFv.
The heavy chain comprising the heavy chain variable region is (V),
The antibody or antigen-binding fragment thereof according to claim 1 or 2, wherein the light chain containing the light chain variable region is (W).
Heavy chain (V)
It is a polypeptide comprising an amino acid sequence of any one of the following (V1) to (V3).
(V1) amino acid sequence of SEQ ID NO: 9 (V2) amino acid sequence of 80% or more identity to the amino acid sequence of SEQ ID NO: 9 (V3) 1 or several amino acids are deleted in the amino acid sequence of SEQ ID NO: 9, Amino acid sequence light chain (W) substituted, inserted and / or added
It is a polypeptide comprising an amino acid sequence of any one of the following (W1) to (W3).
(W1) Amino acid sequence of SEQ ID NO: 10 (W2) Amino acid sequence of 80% or more identity to the amino acid sequence of SEQ ID NO: 10 (W3) In the amino acid sequence of SEQ ID NO: 10, one or several amino acids are deleted Amino acid sequence substituted, inserted and / or added
A coding gene of an antibody against MUC1 or an antigen-binding fragment thereof, which encodes the amino acid sequence of the antibody or antigen-binding fragment thereof according to any one of claims 1 to 5.
An expression vector of an antibody against MUC1 or an antigen-binding fragment thereof, comprising the coding gene according to claim 6.
A method of detecting MUC1 comprising the step of detecting MUC1 in a biological sample using the antibody or antigen-binding fragment thereof according to any one of claims 1 to 5.
A cervix characterized by comprising the step of detecting MUC1 for a biological sample isolated from the cervix using the antibody according to any one of claims 1 to 5 or an antigen-binding fragment thereof. Test method to test the possibility of the disease.