WO2019077028A1 - BORDETELLA STRAINS EXPRESSING SERO-TYPE FIMBRIAE 3 - Google Patents
BORDETELLA STRAINS EXPRESSING SERO-TYPE FIMBRIAE 3 Download PDFInfo
- Publication number
- WO2019077028A1 WO2019077028A1 PCT/EP2018/078522 EP2018078522W WO2019077028A1 WO 2019077028 A1 WO2019077028 A1 WO 2019077028A1 EP 2018078522 W EP2018078522 W EP 2018078522W WO 2019077028 A1 WO2019077028 A1 WO 2019077028A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- functional
- fim3
- live attenuated
- vaccine
- strain
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/235—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Bordetella (G)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/02—Bacterial antigens
- A61K39/099—Bordetella
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/52—Bacterial cells; Fungal cells; Protozoal cells
- A61K2039/522—Bacterial cells; Fungal cells; Protozoal cells avirulent or attenuated
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/52—Bacterial cells; Fungal cells; Protozoal cells
- A61K2039/523—Bacterial cells; Fungal cells; Protozoal cells expressing foreign proteins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/54—Medicinal preparations containing antigens or antibodies characterised by the route of administration
- A61K2039/541—Mucosal route
- A61K2039/543—Mucosal route intranasal
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/545—Medicinal preparations containing antigens or antibodies characterised by the dose, timing or administration schedule
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
Definitions
- the invention relates generally to the fields of microbiology, immunology, vaccinology, sero-epidemiology, biochemistry and medicine. More particularly, the invention relates to live attenuated Bordetella strains modified to express serotype 3 fimbriae and their use in vaccines.
- B. pertussis infection in the US and the UK, combined with a phylodynamic analysis of clinical isolates showed that asymptomatic transmission is the principle cause of the recent pertussis resurgence.
- asymptomatic B. pertussis infection may not be anodyne, as epidemiological evidence suggests that B. pertussis infection may be related to auto-immune diseases, such as Celiac disease, multiple sclerosis, and even Alzheimer's disease
- BPZE1 The vaccine strain, called BPZE1 , lacks the gene coding for dermonecrotic toxin, produces genetically detoxified pertussis toxin and is deficient for tracheal cytotoxin production by the replacement of the B. pertussis ampG gene with the Escherichia coli ampG gene.
- BPZE1 has been shown to be safe in pre-clinical models, including in severely immunocompromised mice, and to be genetically stable after serial passages in vitro and in vivo for at least 12 months. It protects mice against B. pertussis challenge after a single nasal administration, both via protective CD4+ T cells and antibodies, and protection was shown to be long lived after a single nasal vaccination. It also has recently been shown to reduce nasopharyngeal infection by B. pertussis in baboons by 99.992 % compared to non-vaccinated baboons.
- BPZE1 has now successfully completed a first-in-man phase I clinical trial and was found to be safe in human adults, able to transiently colonize the human nasopharynx and to induce immune responses to all tested antigens in all colonized individuals.
- B. pertussis produces two serologically distinct fimbriae, composed of either Fim2 or Fim3 as the major fimbrial subunit. These fimbriae are involved in the attachment of the bacteria to respiratory epithelial cells. While BPZE1 produces only Fim2, it also produces hundreds of other antigens (e.g., pertussis toxin, FHA, and pertactin). It thus has been shown to induce significant protection against a wide array of B. pertussis clinical isolates, including those, which only produce Fim3.
- Fim2 and Fim3 subtypes have been identified. These include two Fim2 subtypes, Fim2-1 , Fim2-2, which vary from each other by a single amino acid difference.
- Fim2- 1 carries an arginine at position 174, whereas this is changed to a lysine in Fim2-2.
- the Fim3 subtypes are encoded by 6 different alleles.
- Fim3-2 differs from Fim3-1 by a single amino acid substitution at position 87: Alanine and Glutamate for Fim3-1 and Fim3-2, respectively.
- Fim3-3 carries, in addition to the Glutamate substitution at position 87, a change from Threonine in Fim3- 1 to Alanine in Fim3-3.
- the fim3-4 allele differs from fiim -X only by a single silent nucleotide polymorphism, whereas the other five alleles vary by three codons, each leading to one amino acid change in the major fimbrial subunit. Given the minor sequence differences between the various subtypes, it is likely that BPZEl f3 is protective against all of them.
- Fim2 and Fim3 production must be sufficiently stable in live B. pertussis vaccine strains.
- the stability of the Fim2 and Fim3 production deserves particular attention, since phase variation from one serotype to another has been described, especially during infection, and can be driven by vaccine pressure. This phase transition from high to low fimbrial production depends on the number of cytosines present in a C-string within the fim promoter region. The number of cytosines within this C-string may affect the distance between the -10 box of the fim promoters and the binding site of BvgA, the transcriptional activator required for the expression of fim and other B. pertussis virulence genes.
- the live attenuated Bordetella strain can be one that also stably produces Fim2.
- the live attenuated Bordetella strains described herein can also be rendered deficient in at least one (1, 2, or 3) of ⁇ the following virulence factors: a functional pertussis toxin (PTX), a functional dermonecrotic toxin (DNT), and a functional tracheal cyto toxin (TCT).
- PTX pertussis toxin
- DNT functional dermonecrotic toxin
- TCT functional tracheal cyto toxin
- vaccines that include a live attenuated Bordetella strain engineered to stably produce Fim3 mentioned herein and a pharmaceutically acceptable carrier.
- the vaccine can be provided in a single dosage form which includes at least 1 x 10 6 (e.g., at least 1 x 10 6 , 5 x 10 6 , or 1 x 10 7 ) colony forming units (CFU) of the strain.
- a mammalian subject e.g., a human being
- methods of protecting a mammalian subject which include the step of administering to the mammalian subject a vaccine including a pharmaceutically acceptable carrier and a live attenuated Bordetella strain engineered to stably produce Fim3, wherein the live attenuated Bordetella strain retains the ability to colonize a mammalian subject's lungs and induce a protective immune response against Bordetella infection.
- a bacterial strain that "stably produces" an antigen is one that can be passaged at least once (e.g., 1, 2, 3, 4, 5 or more times) through a host animal without losing more than 50% (or more than 60, 70, 80, 90, 95, 97, 98, or 99%) of the expression of that antigen.
- an isolated Bordetella bacterial strain engineered to stably produce Fim3 is one that has been genetically modified to express Fim3, and retain at least 50% (e.g., 50, 60, 70, 80, 90, 95, 97, 98, or 99%) of the expression of Fim-3 after being passaged through a mouse, e.g., by the methods described in the Examples section below.
- Reference to a "functional" virulence factor means that a bacterial strain possesses at least 50% of the enzymatic activity of that virulence factor compared to a the wild-type version of that virulence factor.
- a bacterial strain that "has been rendered deficient in at least one virulence factor” is a strain engineered to express less than 70, 80, 90, 95, 96, 97, 98, or 99% of the enzymatic or functional activity of that virulence factor as compared to the parent strain from which is was derived.
- Figure 1A is a graph showing the production of Fim2 by BPZE1 (in diamonds) and BPZElf3 (in squares).
- Figure IB is a graph showing the production of Fim3 by BPZE1 (in diamonds) and BPZElf3 (in squares).
- Figure 2A is a graph showing the in vitro growth of BPZE1 (in diamonds) and BPZElf3 (in squares) in modified Stainer-Scholte medium.
- Figure 2B is a graph showing the in vitro growth of BPZE 1 (in diamonds) and BPZE 1 f3 (in squares) in fully synthetic Thijs medium.
- Figure 3 is a graph showing lung colonization of mice nasally inoculated with 10 6 CFU of BPZE 1 (in black) or BPZElf3 (in grey), where the bacterial loads in the lungs were measured at the indicated time points.
- FIG 4 is a series of graphs (4A-4E) showing BPZE1- and BPZE lf3 -induced protection against clinical B. pertussis isolates where mice received nasally either 10 5 CFU of BPZE1 (black bars) or BPZElf3 (grey bars), or were left untreated (white bars).
- mice received nasally either 10 5 CFU of BPZE1 (black bars) or BPZElf3 (grey bars), or were left untreated (white bars).
- the mice were challenged with 10 6 CFU of 1617pFl (A), 403pFl (B), P134 (C), 1412pFl (D) or 403pF3 (E).
- DO left part of the panels
- D7 days right part of the panels, D7 after challenge, the bacterial loads in the lungs were measured and are presented as means and standard deviations of CFU.
- Three (for DO) or five (for D7) mice per group were used. ***, /? ⁇ 0.001.
- FIG. 5 is a graph comparing BPZE1- and BPZElf3-induced protection against B. parapertussis where mice received nasally either 10 6 CFU of BPZE 1 (black bars) or BPZE 1 f3 (grey bars), or were left untreated (white bars). Two months after vaccination the mice were challenged with 10 6 CFU of B. parapertussis . Three h (left part of the panel, DO) or 7 days (right part of the panel, D7) after challenge, the bacterial loads in the lungs were measured and are presented as means and standard deviations of CFU. Three (for DO) or five (for D7) mice per group were used. ***, /? ⁇ 0.001.
- Figure 6 is a graph showing the stability of Fim2 and Fim3 production by BPZElf3, where BPZEIG was passaged three times in mice, and at each passage (PI to P3), 94 colonies were analysed by whole-cell ELISA for the presence of Fim2 (white bars) and Fim3 (black bars) using anti-Fim2 and anti-Fim3 monoclonal antibodies.
- Described herein is a Fim3 -producing BPZE1 derivative with sufficiently stable fim3 expression to provide improved protection in mice against Fim3-only producing clinical B. pertussis isolates.
- the fim3 expression in BPZElf3 did not alter the protective efficacy against Fim2+ strains, nor against strains that produce neither Fim2 nor Fim3.
- the below described embodiments illustrate representative examples of these methods. Nonetheless, from the description of these embodiments, other aspects of the invention can be made and/or practiced based on the description provided below.
- Bordetella species e.g., Bordetella pertussis, Bordetella parapertussis, and Bordetella bronchiseptica
- Fim3 e.g., Fim3-1 , Fim3-2, Fim3-3, or Fim3-4
- BPZE1 a chronic pulmonary disease 2019
- Bordetella strains engineered to produce Fim3 might also be used to prevent transmission of Bordetella infections.
- Fim2-/Fim3-producing Bordetella pertussis is preferred for use in human subjects.
- Bordetella strains for use in making Fim3 -producing bacteria can be isolated from natural sources (e.g., colonized subjects) or obtained from various culture collections. Bordetella strains that have been engineered to produce Fim3 can be made by the methods described below.
- Attenuation might be achieved by mutating the strain to reduce its production of one or more (e.g., 1 , 2, 3, 4, 5 or more) of the following: pertussis toxin (PTX), dermonecrotic toxin (DNT), tracheal cytotoxin (TCT), adenylate cyclase (AC), lipopolysaccharide (LPS), filamentous hemagglutinin (FHA), pertactin, or any of the &vg-regulated components.
- PTX pertussis toxin
- DNT dermonecrotic toxin
- TCT tracheal cytotoxin
- AC adenylate cyclase
- LPS lipopolysaccharide
- FHA filamentous hemagglutinin
- pertactin or any of the &vg-regulated components.
- the Bordetella strains engineered to produce Fim 3 can be formulated as a vaccine for administration to a subject.
- a suitable number of live bacteria are mixed with a pharmaceutically suitable excipient or carrier such as phosphate buffered saline solutions, distilled water, emulsions such as an oil/water emulsions, various types of wetting agents sterile solutions and the like.
- the vaccine can be lyophilized and then reconstituted prior to administration.
- pharmaceutically suitable excipients or carriers which are compatible with mucosal (particularly nasal, bronchial, or lung) administration are preferred for the purpose of colonizing the respiratory tract. See Remington's Pharmaceutical Sciences, a standard text in this field, and in USP/NF.
- each dose of the vaccine can include a sufficient number of live Bordetella bacteria to result in colonization of the respiratory tract, e.g., approximately (i.e., +/- 50%) 5x l0 3 to 5x l0 9 bacteria, depending on the weight and age of the mammal receiving it.
- the dose can include approximately l x lO 6 , 5x l0 6 , l x lO 7 , 5x l0 7 , lx lO 8 , 5x l0 8 , l x lO 9 , 5x l0 9 , or l x lO 10 live Fim3 -producing Bordetella bacteria.
- the dose may be given once or on multiple (2, 3, 4, 5, 6, 7, 8 or more) occasions at intervals of 1, 2, 3, 4, 5, or 6 days or 1 , 2, 3, 4, 5, or 6 weeks, or 1, 2, 3, 4, 5, 6, or 12 months.
- sufficient amounts of the vaccine are administered to result in colonization and the protective response. Additional amounts are administered after the induced protective response wanes.
- the vaccines described herein can be administered to a mammalian subject (e.g., a human being, a human child or neonate, a human adult, a human being at high risk from developing complications from pertussis, a human being with lung disease, and a human being that is or will become immunosuppressed) by any suitable method that deposits the bacteria within the vaccine in the respiratory tract.
- a mammalian subject e.g., a human being, a human child or neonate, a human adult, a human being at high risk from developing complications from pertussis, a human being with lung disease, and a human being that is or will become immunosuppressed
- the vaccines may be administered by inhalation or intranasal introduction, e.g., using an inhaler, a syringe, an insufflator, a spraying device, etc.
- While administration of a single dose of between l x lO 4 to l x l O 7 (e.g., l x l O 4 , 5x l 0 4 , l x l O 5 , 5x l0 5 , l x lO 6 , 5x l0 6 , or l x lO 7 +/- 10, 20, 30, 40, 50, 60, 70, 80, or 90%) live bacteria is typically sufficient to induce protective immunity against developing a Bordetella infection such as pertussis, one or more (1 , 2, 3, 4, or more) additional doses might be administered in intervals of 4 or more days (e.g., 4, 5, 6, or 7 days; or 1 , 2 3, 4, 5, 6, 7, or 8 weeks) until a sufficiently protective immune response has developed.
- l lO 4 to l x l O 7 e.g., l l O 4 , 5x l 0 4 , l x l O 5 , 5
- a protective immune response can be evaluated by methods known in the art such as quantifying Bordetella-speciFic antibody titers and measuring of Bordetella antigen-specific T cells responses (e.g., using an ELISPOT assay).
- a vaccine-induced protective immune response may again be administered the vaccine in order to boost the anti-Bordetella immune response.
- All B. pertussis strains were grown on Bordet Gengou (BG) agar with 10% (v/v) sheep blood, in modified Stainer Scholte (SS) medium under agitation as described (Imaizumi et al., Infect Immun 1983;41 : 1 138-43) or in fully synthetic Thijs medium (Thalen et al., J Biotechnol 1999;75: 147-59).
- the media were supplemented with the appropriate antibiotics (100 ug/ml of streptomycin or 10 ug/ml of gentamycin for the strains carrying pFUS2 BctAl).
- B. pertussis BPSM and BPZE1 as well as Bordetella parapertussis used in this study have been described previously (Mielcarek et al., PLoS Pathog 2006;2:e65; Menozzi et al., Infect Immun 1994;62:769-78).
- B. pertussis strains B0403, B1412, B1617 and B0005 (strain 134 Pillmer) came from the RJVM collection (Bilthoven, The Netherlands). For counter-selection purposes some of the clinical isolates strains were electroporated with the pFUS2 BctAl suicide plasmid to acquire the gentamycin resistance as described in Antoine et al.
- Strain P134S was obtained by selecting a streptomycin derivative of B. pertussis B0005. Strain P134S carries, in addition to streptomycin resistance mediated by a mutation in the rpsl gene, a mutation in the fimC gene leading to the loss of the fimbriae production. Escherichia coli SM10 (Simon et al., Bio/Technology 1983;1 :784-91) was used for conjugation of the various plasmid constructs into B. pertussis.
- a 2265-bp PCR fragment encompassing the locus was amplified by using the following oligonucleotides (SPfim3UP2: GAGCTCTTTACCGCGGCCGCCAGTTGTTCATCAATG and ASPfim3L02: GGATCCATCATCGAGACCGACTGG) and cloned into the Sac ⁇ and S mHI restriction sites of a pBluescript II SK+ plasmid (Addgene). From resulting plasmid, a 904-bp fragment containing the whole locus was removed by Sphl restriction to obtain pSKfim3UPLO.
- SPfim3UP2 GAGCTCTTTACCGCGGCCGCCAGTTGTTCATCAATG
- ASPfim3L02 GGATCCATCATCGAGACCGACTGG
- the 1351 -bp Sacl- BamHI fragment of pSKfim3UPLO was inserted into the Sacl and BamHI sites of pJQ200mpl8rpsL (Antoine, J. Mol. Biol. (2005) 351,799-809).
- the recombinant plasmid was then used for double homologous recombination in BPZE1 using conjugation as described previously (Mielcarek et al., PLoS Pathog 2006;2:e65).
- the transconjugants were checked for deletion of the whole fim3 locus by PCR using oligonucleotides SPfim3UP2 and ASPfim3L02.
- Reintroducing the whole fim3 locus with the 14 C stretch in the promoter was done as follows.
- a 911 -bp synthetic gene encompassing the whole locus with the 14 C stretch was synthesized by GeneArt® Gene Synthesis (ThermoFisher SCIENTIFIC). Sphl sites at the extremities of the synthetic fragment were used to insert it into the Sphl site of pSKfim3UPLO giving rise to pSKfIm3+. The correct orientation of the insert was checked by restrictions.
- the 2256-bp Sacl- Bamill fragment of this plasmid was transferred into the same restriction sites of pJQ200mpl8rpsL leading to pJQfim3+. This plasmid was used to do the double homologous recombination to obtain ⁇ .
- the recombinant strain was verified by PCR using oligonucleotides SPfim3UP2 and ASPfim3L02.
- the B. pertussis strains were first inactivated by heating at 56°C for 30 minutes. The heat-inactivated strains were then coated at an optical density (OD) 600nm of 0.075 in 96-well plates (Nunc Maxi Sorp,) and incubated overnight at 37°C until the wells were dry. The wells were then blocked with 100 ⁇ of PBS Tween 0.1% (PBST), containing 1% of Bovine Serum Albumin (BSA). Fim2 and Fim3 monoclonal antibodies (NIBSC, 04/154 and 04/156, respectively) were added in serial dilutions from 1/50 to 1/36450 in PBST (v/v).
- PBST PBS Tween 0.1%
- BSA Bovine Serum Albumin
- the plates were incubated with 100 ⁇ of horseradish-peroxidase-labeled goat anti-mouse IgG (Southern Biotech) in PBST. Following five washes, the plates were incubated with 100 ⁇ of HRP Substrate TMB solution (Interchim) for 30 min at room temperature. The reaction was stopped by the addition of 50 ⁇ of 1 M H3PO4. The OD was measured with a Biokinetic reader EL/340 microplate at 450 nm.
- PCR amplification of chromosomal DNA was performed using Phusion High-Fidelity DNA Polymerase (Thermo fisher) or KAPA HiFi DNA Polymerase (Kapa Biosystems) according to the manufacturer's instructions.
- the PCR fragments were purified with a QiaQuick PCR purification kit (Qiagen) and sequenced with the primers used for amplification.
- Primers ptxP Up and ptxP Low used for PCR amplification of ptxP have been described previously (Mooi et al., Emerg Infect Dis 2009;15: 1206-13).
- Primers prn AF and prn AR used for partial PCR amplification of prn has been described previously (Mooi et al., Infect Immun 1998;66:670-5). Primers fim2 Up 5 '- AGCTAGGGGTAGACCACGGA-3 ' and fini2 Low 5'- ATAACTCTTCTGGCGCCAAG-3' were used for amplification and sequencing of fim2. Primers fim3 Up 5'-CATGACGGCACCCCTCAGTA-3' and fim3 Low 5'- TTCACGTACGAGGCGAGATA-3' were used for amplification and sequencing of fim3.
- BALB/c mice were obtained from Charles River (l'Abresle, France) and maintained under specific pathogen-free conditions in the animal facilities of the Institut Pasteur de Lille. Six week-old BALB/c mice were lightly sedated by intraperitoneal injection with an anesthetic cocktail (ketamine+atropine+valium) before intranasal (i.n.) administration with 20 ⁇ PBS containing 10 6 colony-forming units (CFU) of B. pertussis BPZE1 or ⁇ , as previously described (Mielcarek et al., PLoS Pathog 2006;2:e65). Three mice per group were sacrificed at selected time points after i.n. administration, and their lungs were harvested, homogenized in PBS and plated in serial dilutions onto BG-blood agar to count CFUs after incubation at 37°C for three to four days.
- anesthetic cocktail ketamine+atropine+valium
- CFU colony-forming units
- mice Six week-old BALB/c mice were i.n. vaccinated with 10 5 CFU of B. pertussis BPZE1 or BPZElf3, as described above. Four weeks later, naive and vaccinated mice were challenged with 10 6 CFU of B. pertussis BPSM, the indicated clinical B. pertussis isolates or B. parapertussis in 20 ⁇ of PBS. Lung colonization was determined 3 h and 7 days later with 3 and 5 mice per group, respectively.
- BPZElfi Construction of BPZElfi.
- the fim3 gene was first deleted from BPZE 1.
- the upstream and downstream flanking regions of fim3 were amplified by PCR using the BPZE1 chromosomal DNA as template and were spliced together in the non- replicative vector pJQ200mp 18rpsL (Antoine, J. Mol. Biol. (2005) 351, 799-809).
- the fim3 gene of BPZE1 was then deleted by allelic exchange after conjugation with E. coli SM10 containing the recombinant plasmid.
- the resulting strain BPZElAfim3 was used to re-integrate the fim3 gene together with a functional promoter into the original fim3 locus.
- the 13-C stretch of the original promoter was replaced by a 14-C stretch, allowing for fim3 expression and inserted into pSKfim3UPLO together with the fim3 open reading frame.
- the resulting plasmid pJQFim3+ was conjugated into BPZElAfim3 via conjugation with E. coli SM10: pJQFim3+. This resulted in BPZEIG.
- This protocol was used because it is best suited to detect potential differences between vaccine lots, as the standard vaccination protocol using 10 6 CFU of the vaccine strain followed two months later by infection with 10 6 CFU of the challenge strain usually results in total clearance 7 days after challenge.
- the potency of the two vaccine strains was tested against four different clinical isolates from the B. pertussis culture collection of the RIVM (Bilthoven, The Netherlands).
- the five strains had the following characteristics with respect to Fim2 and Fim3 production: 1617F1 (Fim2+Fim3-), 403pFl (Fim2+Fim3-), P134 (Fim2-Fim3-), 1412pFl (Fim2-Fim3+) and 403pF3 (Fim2+Fim3+).
- the genomic key features of these strains are presented in table I below. After vaccination and challenge infection the bacterial load of the challenge strain was measured in the lungs 3 h and 7 days after infection.
- BPZE1 and ⁇ protected equally well against 1617pFl , 403pFl , PI 34 and 403pF3, diminishing the bacterial loads in each case by 4 to 5 logs at 7 days post-infection, compared to the bacterial loads in non-vaccinated mice (Fig. 4). There was no statistically significant difference between BPZE1 -vaccinated and BPZElf3 -vaccinated mice. However, when the mice were challenged with 1412pFl, the strain that only produces Fim3 and not Fim2, ⁇ appeared to protect significantly better than BPZE1 (Fig. 4D).
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Organic Chemistry (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Microbiology (AREA)
- Oncology (AREA)
- Communicable Diseases (AREA)
- Epidemiology (AREA)
- Mycology (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Pulmonology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Gastroenterology & Hepatology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Priority Applications (10)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CA3077428A CA3077428A1 (en) | 2017-10-18 | 2018-10-18 | Bordetella strains expressing serotype 3 fimbriae |
| JP2020520777A JP7335874B2 (ja) | 2017-10-18 | 2018-10-18 | 血清型3線毛を発現するボルデテラ(bordetella)菌株 |
| EP18815945.3A EP3697439A1 (en) | 2017-10-18 | 2018-10-18 | Bordetella strains expressing serotype 3 fimbriae |
| SG11202003333WA SG11202003333WA (en) | 2017-10-18 | 2018-10-18 | Bordetella strains expressing serotype 3 fimbriae |
| CN202411102248.9A CN118979003A (zh) | 2017-10-18 | 2018-10-18 | 表达血清3型菌毛的鲍特菌属菌株 |
| CN201880067004.8A CN111278456B (zh) | 2017-10-18 | 2018-10-18 | 表达血清3型菌毛的鲍特菌属菌株 |
| AU2018353409A AU2018353409B2 (en) | 2017-10-18 | 2018-10-18 | Bordetella strains expressing serotype 3 Fimbriae |
| US16/848,793 US11446372B2 (en) | 2017-10-18 | 2020-04-14 | Bordetella strains expressing serotype 3 fimbriae |
| US17/817,272 US12403188B2 (en) | 2017-10-18 | 2022-08-03 | Bordetella strains expressing serotype 3 fimbriae |
| JP2023089684A JP7812352B2 (ja) | 2017-10-18 | 2023-05-31 | 血清型3線毛を発現するボルデテラ(bordetella)菌株 |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201762574068P | 2017-10-18 | 2017-10-18 | |
| US62/574,068 | 2017-10-18 |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US16/848,793 Continuation US11446372B2 (en) | 2017-10-18 | 2020-04-14 | Bordetella strains expressing serotype 3 fimbriae |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2019077028A1 true WO2019077028A1 (en) | 2019-04-25 |
| WO2019077028A4 WO2019077028A4 (en) | 2019-06-27 |
Family
ID=64664226
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2018/078522 Ceased WO2019077028A1 (en) | 2017-10-18 | 2018-10-18 | BORDETELLA STRAINS EXPRESSING SERO-TYPE FIMBRIAE 3 |
Country Status (8)
| Country | Link |
|---|---|
| US (2) | US11446372B2 (cg-RX-API-DMAC7.html) |
| EP (1) | EP3697439A1 (cg-RX-API-DMAC7.html) |
| JP (2) | JP7335874B2 (cg-RX-API-DMAC7.html) |
| CN (2) | CN118979003A (cg-RX-API-DMAC7.html) |
| AU (1) | AU2018353409B2 (cg-RX-API-DMAC7.html) |
| CA (1) | CA3077428A1 (cg-RX-API-DMAC7.html) |
| SG (1) | SG11202003333WA (cg-RX-API-DMAC7.html) |
| WO (1) | WO2019077028A1 (cg-RX-API-DMAC7.html) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2022108950A1 (en) | 2020-11-17 | 2022-05-27 | Iliad Biotechnologies, Llc | Treatment and prevention of neuropathology associated with neurodegenerative diseases |
| US11446372B2 (en) * | 2017-10-18 | 2022-09-20 | Institut Pasteur De Lille | Bordetella strains expressing serotype 3 fimbriae |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9119804B2 (en) | 2006-03-10 | 2015-09-01 | Institut Pasteur De Lille | Live attenuated bordetella strains as a single dose vaccine against whooping cough |
| SG175803A1 (en) | 2009-04-28 | 2011-12-29 | Pasteur Institut | Vaccine for prophylaxis or treatment of an allergen-driven airway pathology |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9119804B2 (en) | 2006-03-10 | 2015-09-01 | Institut Pasteur De Lille | Live attenuated bordetella strains as a single dose vaccine against whooping cough |
Family Cites Families (26)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4883761A (en) * | 1986-03-25 | 1989-11-28 | The United States Of America As Represented By The Department Of Health And Human Services | Pertussis toxin gene: cloning and expression of protective antigen |
| US6713072B1 (en) | 1987-11-02 | 2004-03-30 | Chiron S.R.L. | Immunologically active polypeptides with altered toxicity useful for the preparation of an antipertussis vaccine |
| IT1236971B (it) * | 1989-11-03 | 1993-05-07 | Eniricerche Spa | Regione promotore dei geni codificanti le subunita' piliniche fim2, fm3 e fimx di bordetella pertussis e loro impiego per l'espressione di geni che codificano una proteina di interesse. |
| GB9115332D0 (en) | 1991-07-16 | 1991-08-28 | Connaught Lab | Manipulation of gene copy number in bordetella |
| FR2718750B1 (fr) | 1994-04-19 | 1996-06-14 | Pasteur Institut | Protéines recombinantes de l'hémagglutinine filamenteuse de Bordetella, notamment, B. Pertussis, production et application à la production de protéines étrangères ou de principes actifs vaccinants. |
| FR2754543B1 (fr) * | 1996-10-11 | 1998-12-31 | Pasteur Institut | Souche de bordetella deficiente dans la production de toxine et exprimant une proteine hydride, liposomes comprenant de la fha et leurs utilisations comme vaccins, et utilisation de la fha pour stimuler les reponses immunitaires |
| FR2840319B1 (fr) | 2002-05-30 | 2004-08-20 | Pasteur Institut | Souches de bordetella rendues deficientes par attenuation genetique |
| EP1617805A4 (en) | 2003-04-11 | 2012-07-04 | Medimmune Llc | METHODS FOR PREVENTING OR TREATING RESPIRATORY CONDITIONS |
| GB0402131D0 (en) * | 2004-01-30 | 2004-03-03 | Isis Innovation | Delivery method |
| CA2669485C (en) | 2006-11-15 | 2017-01-03 | Folia Biotech Inc. | Papaya mosaic virus-based vaccines for influenza |
| EP2134359A4 (en) | 2007-02-23 | 2010-06-16 | Penn State Res Found | USE OF A NONVIRULENT BORDETELLA MUTANT AS LIVING VACCINE VECTOR |
| CN100537767C (zh) * | 2007-04-29 | 2009-09-09 | 中国药品生物制品检定所 | 百日咳疫苗保护性抗原的重组表达及其应用 |
| WO2008156753A1 (en) | 2007-06-18 | 2008-12-24 | Hemispherx Biopharma | Early intervention of viral infections with immune activators |
| SG175803A1 (en) | 2009-04-28 | 2011-12-29 | Pasteur Institut | Vaccine for prophylaxis or treatment of an allergen-driven airway pathology |
| DK2442826T3 (en) | 2009-06-15 | 2015-09-21 | Univ Singapore | Influenza vaccine, composition and methods of using |
| DK2773371T3 (da) * | 2011-11-02 | 2020-03-09 | Nat Univ Singapore | Virkning af en svækket bordetella-stamme mod allergisk sygdom |
| AU2013301312A1 (en) * | 2012-08-06 | 2015-03-19 | Glaxosmithkline Biologicals S.A. | Method for eliciting in infants an immune response against RSV and B. pertussis |
| EP2722338A1 (en) * | 2012-10-17 | 2014-04-23 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Novel recombinant Bordetella strains |
| US9655959B2 (en) * | 2014-10-01 | 2017-05-23 | National University Of Singapore | Adenylate cyclase deficient bordetella strains |
| EP4541809A3 (en) | 2016-03-29 | 2025-06-25 | Institut Pasteur de Lille | Mutant bordetella strains and methods of use |
| US10799573B2 (en) * | 2016-03-30 | 2020-10-13 | Regents Of The University Of Minnesota | Pertussis vaccines and methods of making and using |
| US20200171169A1 (en) * | 2017-05-15 | 2020-06-04 | Vanderbilt University | LONG-CIRCULATING ZWITTERIONIC POLYPLEXES FOR siRNA DELIVERY |
| CN111032078A (zh) * | 2017-07-18 | 2020-04-17 | 血清研究所印度私人有限公司 | 具有改善的稳定性、增强的免疫原性和降低的反应原性的免疫原性组合物及其制备方法 |
| SG11202003333WA (en) * | 2017-10-18 | 2020-05-28 | Pasteur Institut | Bordetella strains expressing serotype 3 fimbriae |
| US12036405B2 (en) * | 2018-03-23 | 2024-07-16 | The Board Of Regents Of The University Of Oklahoma | System and method of electric-induced acoustic tomography for electrotherapy monitoring |
| WO2020049133A1 (en) | 2018-09-05 | 2020-03-12 | National University Of Singapore | Adenylate cyclase catalytic domain deficient bordetella strains |
-
2018
- 2018-10-18 SG SG11202003333WA patent/SG11202003333WA/en unknown
- 2018-10-18 CN CN202411102248.9A patent/CN118979003A/zh active Pending
- 2018-10-18 CN CN201880067004.8A patent/CN111278456B/zh active Active
- 2018-10-18 AU AU2018353409A patent/AU2018353409B2/en active Active
- 2018-10-18 JP JP2020520777A patent/JP7335874B2/ja active Active
- 2018-10-18 EP EP18815945.3A patent/EP3697439A1/en active Pending
- 2018-10-18 WO PCT/EP2018/078522 patent/WO2019077028A1/en not_active Ceased
- 2018-10-18 CA CA3077428A patent/CA3077428A1/en active Pending
-
2020
- 2020-04-14 US US16/848,793 patent/US11446372B2/en active Active
-
2022
- 2022-08-03 US US17/817,272 patent/US12403188B2/en active Active
-
2023
- 2023-05-31 JP JP2023089684A patent/JP7812352B2/ja active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9119804B2 (en) | 2006-03-10 | 2015-09-01 | Institut Pasteur De Lille | Live attenuated bordetella strains as a single dose vaccine against whooping cough |
Non-Patent Citations (21)
| Title |
|---|
| ANDREW R GORRINGE ET AL: "Bordetella pertussis fimbriae (Fim): relevance for vaccines", EXPERT REVIEW OF VACCINES, vol. 13, no. 10, 8 August 2014 (2014-08-08), GB, pages 1205 - 1214, XP055557187, ISSN: 1476-0584, DOI: 10.1586/14760584.2014.930667 * |
| ANNE-SOPHIE DEBRIE ET AL: "Construction and evaluation of Bordetella pertussis live attenuated vaccine strain BPZE1 producing Fim3", VACCINE, vol. 36, no. 11, 1 March 2018 (2018-03-01), AMSTERDAM, NL, pages 1345 - 1352, XP055556650, ISSN: 0264-410X, DOI: 10.1016/j.vaccine.2018.02.017 * |
| ANTOINE ET AL., J MOL BIOL, vol. 351, 2005, pages 799 - 809 |
| ANTOINE, J. MOL. BIOL., vol. 351, 2005, pages 799 - 809 |
| AUSUBEL ET AL.: "Current Protocols in Molecular Biology", GREENE PUBLISHING AND WILEY-INTERSCIENCE |
| COLIGAN ET AL.: "Current Protocols in Immunology", JOHN WILEY & SONS |
| FAUCI ET AL.: "Harrison's Principles of Internal Medicine, 17th Edition", 2008, MCGRAW-HILL PROFESSIONAL |
| FEUNOU P F ET AL: "Genetic stability of the live attenuated Bordetella pertussis vaccine candidate BPZE1", VACCINE, ELSEVIER, AMSTERDAM, NL, vol. 26, no. 45, 23 October 2008 (2008-10-23), pages 5722 - 5727, XP026046068, ISSN: 0264-410X, [retrieved on 20080830], DOI: 10.1016/J.VACCINE.2008.08.018 * |
| HANS O. HALLANDER ET AL: "Should fimbriae be included in pertussis vaccines? Studies on ELISA IgG anti-Fim2/3 antibodies after vaccination and infection", APMIS, vol. 117, no. 9, 1 September 2009 (2009-09-01), DK, pages 660 - 671, XP055557456, ISSN: 0903-4641, DOI: 10.1111/j.1600-0463.2009.02521.x * |
| IMAIZUMI ET AL., INFECT IMMUN, vol. 41, 1983, pages 1138 - 43 |
| MCPHEE; PAPADAKIS: "Current Medical Diagnosis and Treatment 2010, 49th Edition", 2010, MCGRAW-HILL MEDICAL |
| MENOZZI ET AL., INFECT IMMUN, vol. 62, 1994, pages 769 - 78 |
| MIELCAREK ET AL., PLOS PATHOG, vol. 2, 2006, pages e65 |
| MOOI ET AL., EMERG INFECT DIS, vol. 15, 2009, pages 1206 - 13 |
| MOOI ET AL., INFECT IMMUN, vol. 66, 1998, pages 670 - 5 |
| NATHALIE MIELCAREK ET AL: "Live Attenuated B. pertussis as a Single-Dose Nasal Vaccine against Whooping Cough", PL O S PATHOGENS (PRINT), vol. 2, no. 7, 1 January 2006 (2006-01-01), US, pages e65, XP055556693, ISSN: 1553-7366, DOI: 10.1371/journal.ppat.0020065 * |
| REDDY ET AL.: "Methods for General and Molecular Microbiology, 3rd ed.", ASM PRESS |
| SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual, 2nd ed", vol. 1-3, 2001, COLD SPRING HARBOR LABORATORY PRESS |
| SIMON ET AL., BIO/TECHNOLOGY, vol. 1, 1983, pages 784 - 91 |
| THALEN ET AL., J BIOTECHNOL, vol. 75, 1999, pages 147 - 59 |
| WILLEMS ET AL., EMBO J, vol. 9, 1990, pages 2803 - 9 |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11446372B2 (en) * | 2017-10-18 | 2022-09-20 | Institut Pasteur De Lille | Bordetella strains expressing serotype 3 fimbriae |
| WO2022108950A1 (en) | 2020-11-17 | 2022-05-27 | Iliad Biotechnologies, Llc | Treatment and prevention of neuropathology associated with neurodegenerative diseases |
| US11986499B2 (en) | 2020-11-17 | 2024-05-21 | Iliad Biotechnologies, Llc | Treatment and prevention of neuropathology associated with neurodegenerative diseases |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111278456B (zh) | 2024-08-09 |
| CA3077428A1 (en) | 2019-04-25 |
| CN111278456A (zh) | 2020-06-12 |
| JP2021500325A (ja) | 2021-01-07 |
| JP2023109996A (ja) | 2023-08-08 |
| SG11202003333WA (en) | 2020-05-28 |
| WO2019077028A4 (en) | 2019-06-27 |
| AU2018353409A1 (en) | 2020-04-16 |
| US20200297833A1 (en) | 2020-09-24 |
| AU2018353409B2 (en) | 2025-07-17 |
| JP7335874B2 (ja) | 2023-08-30 |
| US11446372B2 (en) | 2022-09-20 |
| EP3697439A1 (en) | 2020-08-26 |
| JP7812352B2 (ja) | 2026-02-09 |
| CN118979003A (zh) | 2024-11-19 |
| US20220362369A1 (en) | 2022-11-17 |
| US12403188B2 (en) | 2025-09-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US12403188B2 (en) | Bordetella strains expressing serotype 3 fimbriae | |
| AU2022221438B2 (en) | Mutant bordetella strains and methods for use | |
| US10369207B2 (en) | Prevention of pertussis using adenylate cyclase deficient Bordetella strains | |
| WO2020049133A1 (en) | Adenylate cyclase catalytic domain deficient bordetella strains | |
| US6660261B1 (en) | Bordetella strain expressing the FHA hybrid, liposomes and vaccines | |
| HK40115864A (zh) | 表达血清3型菌毛的鲍特菌属菌株 | |
| JP2023545176A (ja) | 高用量シゲラ属(Shigella)ワクチン製剤 | |
| HK40026630A (en) | Bordetella strains expressing serotype 3 fimbriae | |
| HK40026630B (zh) | 表达血清3型菌毛的鲍特菌属菌株 | |
| CA3018126C (en) | Mutant bordetella strains and methods of use | |
| HK1262896B (zh) | 突变型博德特氏菌属菌株及其使用方法 | |
| HK1262896A1 (en) | Mutant bordetella strains and methods for use |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 18815945 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 3077428 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2020520777 Country of ref document: JP Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2018353409 Country of ref document: AU Date of ref document: 20181018 Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2018815945 Country of ref document: EP Effective date: 20200518 |