WO2019076478A1

WO2019076478A1 - Hydrogel-embedded oligodeoxynucleotides as tolerogenic adjuvant for subcutaneous immunotherapy

Info

Publication number: WO2019076478A1
Application number: PCT/EP2018/000479
Authority: WO
Inventors: Reinhard Bredehorst; Thomas Grunwald; Catherine LEONARD; Markus Ollert; Bernhard JUNGBLUT
Original assignee: Luxembourg Institute Of Health (Lih); Tolerogenics S.A.R.L
Priority date: 2017-10-18
Filing date: 2018-10-18
Publication date: 2019-04-25
Also published as: EP3723863A1

Abstract

The present invention discloses novel hydrogel-based technologies and methods for subcutaneous immunotherapy of allergic and autoimmune diseases which allows tolerogenic modulation of human antigen-presenting cells (APCs) including dendritic cells and macrophages with CpG-ODN or GpC-ODN or GpG-ODN at tolerated dose levels.

Description

HYDROGEL-EMBEDDED OLIGODEOXYNUCLEOTIDES AS TOLEROGENIC ADJUVANT FOR SUBCUTANEOUS IMMUNOTHERAPY

Background of the invention and state of the art

For the treatment of allergic and autoimmune diseases such as type I diabetes, rheumatoid arthritis, and multiple sclerosis, allergen- or autoantigen-specific immunotherapy has the potential of restoring lasting immunological tolerance, but supporting tolerance-promoting strategies are needed to increase the therapeutic efficacy of this approach.

One promising approach is the application of tolerance- promoting adjuvants. However, currently available adjuvants such as oils and alum trigger either Thl-type or Th2-type immune responses or both (for reviews, see Leroux-Roels, 2010; Nicholls et al . , 2010) . Based on the assumption that the induction of tolerance requires T-cell receptor activation in the absence of decision signals for effector T cells, currently available adjuvants are not suitable for the induction of tolerance. Adjuvants are needed that support the induction of tolerance-promoting regulatory T cells (Tregs) and tolerogenic antigen-presenting cells including tolerogenic dendritic cells (DCs) and tolerogenic macrophages.

CpG-ODN-mediated immunosuppression. Previous studies have demonstrated that CpG-rich oligodeoxynucleotides (CpG-ODN) stimulate a Thl biased response through the intracellular Toll-like receptor 9 (TLR9) resulting in lymphocyte maturation, enhanced APC function, and the release of inflammatory cytokines and type I IFNs (Hemmi et al . , 2000). However, recent studies have demonstrated that CpG-ODN not only act as immune stimulatory agents but can also induce strong immune suppression depending on the route of administration (Wingender et al . , 2006) and the quantity of administered CpG-ODN (Volpi et al., 2013). The suppressive effect is mediated by indoleamine 2 , 3-dioxygenase 1 (IDOl) (Mellor et al . , 2005; Fallarino and Puccetti, 2006) as indicated by the observation that CpG-ODN induced T cell suppression could be abrogated by 1-methyl-tryptophan (1-MT) , an inhibitor of IDO.

Studies with a set of knockout mice demonstrated that the CpG- ODN- induced immune suppression is dependent on TLR9 stimulation (Wingender et al . , 2006) . Further studies revealed a previously undescribed role for TRIF and TRAF6 proteins in TLR9 signaling. At high doses of CpG-rich oligodeoxynucleotides, association of TLR9 , TRIF and TRAF6 leads to activation of the alternate (noncanonical) pathway of NF- κΒ signaling and the induction of IRF3- and TGF- β-dependent immune- suppressive tryptophan catabolism (Volpi et al . , 2012; Volpi et al . , 2013) . In vivo, the TLR9-TRIF circuit and not the TLR9-MyD88 signaling is required for CpG-mediated immunosuppression.

Flexibility in presentation programs of dendritic cells (DCs) mostly reflects autocrine effects by a set of cytokines, which either reinforce or subvert a default presentation profile (Grohmann et al . , 2003). Typically, the interleukin (IL) - 12/IL-23 pair and IL-6 induce immunogenic presentation, whereas transforming growth factor (TGFj- β and type I or type II interferons (IFNs) promote tolerance, via transcriptional (Puccetti and Grohmann, 2007) or posttranslational (Orabona, C. et al., 2008) regulation of IDOl. The opposing activities of CpG ODN, immunostimulation as opposed to IDOl -dependent immunosuppression, could be traced to the respective dominance of IL-23 versus TGF- β production. GpC-ODN-mediated immunosuppression. GpC oligodeoxynucleotides (GpC-ODN) have also the ability to modulate dendritic cells (DCs) in a tolerogenic manner via TLR7/TRIF-mediated signaling events (Volpi et al., 2012).

Physiologically, TLR7 recognizes and responds to viral ssRNA through a signal transduction pathway leading to both induction of type I IFNs, typically involved in virus elimination—and differentiation of DCs (Kawai and Akira, 2006) . It is well documented that TLR7 activation by ssRNA is mainly MyD88 dependent. However, TLR7 is also capable of mediating opposite functional effects, depending on the ligand nature and experimental setting, resulting either in Thl7-type responses in humans (Yu et al . , 2010) or in inhibition of Thl7 responses via induction of IL-10 (Vultaggio et al . , 2011).

As demonstrated in a recent study, synthetic GpC-ODN are capable to confer highly suppressive activity on mouse and human splenic plasmacytoid dendritic cells (pDCs) via the TLR7-TRIF pathway (Volpi et al . , 2012). In this study, GpC-ODN 1826 (5' -TCCATGAGCTTCCTAAGCTT-3 ' ) and 1668 (5'-

TCCATGAGCTTCCTGATGCT-3 ' ) selectively conferred suppressive properties on pDCs, contingent on functional indoleamine 2,3- dioxygenase 1 (IDOl) . The induction of IDOl by these GpC-ODN was depended on autocrine TGF-β and alternate (noncanonical) NF-kB transcriptional activity. The downstream response culminating in IDOl induction, required TLR7/TIR domain- containing adapter inducing IFN-β (TRIF) -mediated signaling events (Volpi et al., 2012). Induction of IDO by these GpC- containing ODN could also be demonstrated in human dendritic cells, allowing those cells to assist FOXP3+ T cell generation in vitro (Volpi et al . , 2012).

The beneficial effect of GpC-ODN has been demonstrated in at least two experimental models of autoimmunity. In one study, GpG-ODN suppressed the severity of experimental autoimmune encephalomyelitis, downregulating autoreactive Thl and B cell responses (Ho et al . , 2003). In another study, GpG-ODN delayed the onset and attenuated the severity of lupus nephritis by antagonizing and blocking the activation of multiple TLRs (Graham et al., 2010).

Suppression of allergic airway inflammation requires high-dose CpG-ODN. In 2004, Hayashi and coworkers have demonstrated that TLR9 ligand-induced pulmonary IDO activity inhibits Th2 -driven experimental asthma. IDO activity expressed by resident lung cells after administration of bacterial DNA or synthetic immunostimulatory oligodeoxynucleotide analogs derived thereof suppressed lung inflammation and airway hyper-reactivity (Hayashi et al . , 2004).

The data of Hayashi et al . (2004) were confirmed by a recent study of Volpi et al . (2013) in which the effect of in vitro conditioning of plasmocytoid dendritic cells (pDCs) with CpG- ODN on the induction of airway inflammation upon cell transfer onto recipient hosts was investigated. Mice were sensitized and challenged by ovalbumin (OVA) to induce airway inflammation. OVA-pulsed splenic pDCs, either untreated or treated overnight with lOpg/ml CpG-ODN, were injected intravenously into mice before subjecting recipients to a fully immunogenic asthma protocol . Using different sets of pDCs for the treatment including wild-type, Myd88^~/^~ (myeloid differentiation primary response gene 88) , Ticarnl-/- (toll-like receptor adaptor molecule 1; alt. symbol TRIF) , or Myd88^~/_ and Ticaml-/- pDCs, the authors showed that TRIF, but not MyD88, is necessary to mediate the tolerogenic effect of pDCs exposed in vitro to CpG in this allergic airway model system.

It should be emphasized, however, that tolerogenic conditioning of pDCs required treatment with high-dose CpG-ODN (10 μg/ml) . Treatment of the cells with a 10-fold lower dose of CpG-ODN resulted in immunogenic conditioning (Volpi et al., 2013) .

5 Dose-limiting toxicity of CpG-ODN. Among the most extensively studied TLR9 agonists is CpG 7909, a synthetic 24mer single stranded oligonucleotide (ODN) (5¹ -TCGTCGTTTTGTCGTTTTGTCGTT- 3') containing 4 unmethylated CpG motifs (Jahresdorfer et al . , 2005) with a phosphorothioate backbone resistant to L0 degradation by DNAse (class B ODN) . CpG 7009 has been evaluated in several clinical studies.

A phase I study in healthy volunteers showed that CpG 7909 was well tolerated at subcutaneous (s.c.) doses up to 0.08 mg/kg

L5 and intravenous (i.v.) doses up to 0.32 mg/kg (Krieg et al . , 2004). There were minimal adverse events after i.v. administration, whereas after s.c. injection patients had transient injection site reactions and flu like symptoms, but there was no evidence of organ toxicity or autoimmunity (Krieg

20 et al., 2004). Further analyses revealed induction of systemic THl-like innate immunity in these normal volunteers after subcutaneous but not intravenous administration of CPG 7909.

In a phase I study with patients suffering from chronic 25 lymphocyte leukemia (CLL) , a single intravenous dose of CpG 7909 was well tolerated with no clinical effects and no significant toxicity up to 1.05 mg/kg. A single subcutaneous dose of CpG 7909 had a maximum tolerated dose of 0.45 mg/kg with dose limiting toxicity of myalgia and constitutional 30 effects (Zent et al . , 2012). Subcutaneous administration of this dose level resulted in an increase in activated T cells, associated with local inflammation at the site of injection and in draining lymph nodes as has been observed in other trials of CpG 7909 (Kim et al . , 2010). Both i.v. and s.c. 5 therapy resulted in changes in natural killer (NK) cells and T cells consistent with systemic immune activation and cytokine- induced immune activation (Zent et al. , 2012).

These clinical studies demonstrate that even maximum tolerated dose levels of CpG-ODN induce activation of the immune system via the TLR9-MyD88 pathway and not induction of tolerance via the TLR9-TRIF pathway. Based on the data of Volpi et al . (2013) , however, plasmocytoid dendritic cells (pDC) require a significant higher concentration of CpG-ODN in order to activate tolerogenic TLR9-TRIF signalling. Therefore, novel technologies are required to modulate human macrophages and DCs with CpG-ODN in a tolerogenic manner without toxicological side effects. The present invention solves this problem by using a hydrogel- based technology for subcutaneous administration in combination with a technology for direct targeting of macrophages and dendritic cells and, optionally, attraction of these cells to the subcutaneously injected hydrogel by hydrogel-embedded find-me signals. Thereby, the tolerance- inducing concentration of CpG-ODN is reduced to an extent that does not exceed the maximum tolerated dose .

Summary of the Invention

In one embodiment, a pharmaceutical non- liposomal composition (composition A) for the induction of tolerance by allergen- or autoantigen-specific immunotherapy in patients with allergic or autoimmune diseases is disclosed which comprises a thermogelling hydrogel suitable for a locally restricted but sustained release of hydrogel-embedded tolerance-promoting doses of

a) one or more hydrogel-embedded allergens or autoantigens or fragments including short T cell peptides derived thereof ,

b) tolerance-promoting concentrations of hydrogel-embedded synthetic oligodeoxynucleotides (ODN) comprising one or more CpG or GpC or GpG motifs,

c) one or more hydrogel-embedded find-me molecules for attracting peripheral antigen-presenting cells (APC) to the site of the administered hydrogel composition, and d) optionally one or more hydrogel-embedded tolerance- promoting immune modulators selected from vitamin D3 , vitamin D3 derivatives, glucocorticoids, Janus kinase inhibitors, antagonistic cytokine molecules, salicylate- based therapeutics for the inhibition of TNFR1-mediated pathways, peptide-based complement inhibitors or peptidomimetica-based complement inhibitors, and aptamer- based inhibitors of pro-inflammatory cytokines. In another embodiment, a pharmaceutical composition with liposomal ODN (composition B) for the induction of tolerance by allergen- or autoantigen-specific immunotherapy in patients with allergic or autoimmune diseases is disclosed which comprises a thermogelling hydrogel suitable for a locally restricted but sustained release of hydrogel-embedded tolerance-promoting doses of

a) one or more hydrogel-embedded allergens or autoantigens or fragments including short T cell peptides derived thereof,

b) hydrogel-embedded phosphatidyl-L-serine-presenting liposomes (PS-liposomes) containing tolerance-promoting concentrations of synthetic oligodeoxynucleotides (ODN) comprising one or more CpG or GpC or GpG motifs,

c) one or more hydrogel-embedded find-me molecules for attracting peripheral antigen-presenting cells (APC) to the site of the administered hydrogel composition, and d) optionally one or more tolerance-promoting immune modulators selected from vitamin D3 , vitamin D3 derivatives, glucocorticoids, Janus kinase inhibitors, antagonistic cytokine molecules, salicylate-based therapeutics for the inhibition of TNFR1-mediated pathways, peptide-based complement inhibitors or peptidomimetica-based complement inhibitors, and aptamer- based inhibitors of pro-inflammatory cytokines, wherein said immune modulators are included in the composition either as hydrogel-embedded immune modulators or as liposomal immune modulators in hydrogel-embedded PS- liposomes together with CpG-ODN or GpC-ODN or GpG-ODN.

In another embodiment, a pharmaceutical composition with liposomal peptides (composition C) for the induction of tolerance by allergen- or autoantigen-specific immunotherapy in patients with allergic or autoimmune diseases is disclosed which comprises a thermogelling hydrogel suitable for a locally restricted but sustained release of hydrogel-embedded tolerance-promoting doses of

a) hydrogel-embedded phosphatidyl-L-serine-presenting liposomes (PS-liposomes) containing one or more allergen- or autoantigen-derived fragments, preferably one or more allergen- or autoantigen-derived short T cell peptides, b) tolerance-promoting concentrations of hydrogel-embedded synthetic oligodeoxynucleotides comprising one or more CpG or GpC or GpG motifs,

c) one or more hydrogel-embedded find-me molecules for attracting peripheral antigen-presenting cells (APC) to the site of the administered hydrogel composition, and d) and optionally one or more hydrogel-embedded tolerance- promoting immune modulators selected from vitamin D3 , vitamin D3 derivatives, glucocorticoids, Janus kinase inhibitors, antagonistic cytokine molecules, salicylate- based therapeutics for the inhibition of TNFR1-mediated pathways, peptide-based complement inhibitors or peptidomimetica-based complement inhibitors, and aptamer- based inhibitors of pro-inflammatory cytokines, wherein said immune modulators are included in the composition either as hydrogel-embedded immune modulators or as liposomal immune modulators in hydrogel-embedded PS- liposomes together with i) CpG-ODN or GpC-ODN or GpG-ODN and ii) one or more allergen- or autoantigen-derived fragments, preferably one or more allergen- or autoantigen-derived short T cell peptides, wherein said immune modulators are included in the composition either as hydrogel-embedded immune modulators or as liposomal immune modulators in hydrogel-embedded PS- liposomes together with one or more allergen- or autoantigen-derived fragments, preferably one or more allergen- or autoantigen-derived short T cell peptides. In another embodiment, a pharmaceutical composition with liposomal ODN and peptides (composition D) for the induction of tolerance by allergen- or autoantigen-specific immunotherapy in patients with allergic or autoimmune diseases is disclosed which comprises a thermogelling hydrogel suitable for a locally restricted but sustained release of hydrogel- embedded tolerance-promoting doses of

a) hydrogel-embedded phosphatidyl-L-serine-presenting liposomes (PS-liposomes) containing i) one or more allergen- or autoantigen-derived fragments, preferably one or more allergen- or autoantigen-derived short T cell peptides, and ii) tolerance-promoting concentrations of synthetic oligodeoxynucleotides comprising one or more CpG or GpC or GpG motifs,

b) one or more hydrogel-embedded find-me molecules for attracting peripheral antigen-presenting cells (APC) to the site of the administered hydrogel composition, and c) and optionally one or more hydrogel-embedded tolerance- promoting immune modulators selected from vitamin D3 , vitamin D3 derivatives, glucocorticoids, Janus kinase inhibitors, antagonistic cytokine molecules, salicylate- based therapeutics for the inhibition of T FR1-mediated pathways, peptide-based complement inhibitors or peptidomimetica-based complement inhibitors, and aptamer- based inhibitors of pro-inflammatory cytokines, wherein said immune modulators are included in the composition either as hydrogel-embedded immune modulators or as liposomal immune modulators in hydrogel-embedded PS- liposomes together with i) CpG-ODN or GpC-ODN or GpG-ODN and ii) one or more allergen- or autoantigen-derived fragments, preferably one or more allergen- or autoantigen-derived short T cell peptides.

In another embodiment, thermogelling hydrogels are disclosed which are suitable for locally restricted sustained release of embedded therapeutics, which are biodegradable or biostable polymers, preferably biodegradable, in particular selected from the group consisting of polyethylene, polypropylene, polyethylene oxide (PEO) , polypropylene oxide (PPO) , polyurethane , polyurea, polyamides, polycarbonates, polyaldehydes , polyorthoesters, polyiminocarbonates, poly caprolactone (PCL) , poly-D, L-lactic acid (PDLLA) , poly-L- lactic acid (PLLA) , lactides of said lactic acids, polyphosphazenes, polyglycolic acids, monomethoxypoly (ethylene glycol) (MPEG) , or copolymers or mixtures of any of the above including poly (lactic-co-glycolic acid) (PLGA) , copolymers of L-lactide and D,L-lactide, polyester copolymers, diblock copolymers consisting of MPEG and PCL, MPEG and PCL-ran-PLLA, MPEG and PLGA, PEO and PLLA, triblock copolymers consisting of PEO and PLLA, PLGA-PEG-PLGA, PEG-PLGA-PEG, PEG-PCL-PEG, and PEO-PPO-PEO, wherein the gelling temperature is between 20°C and 0°C, preferably between 25°C and 35°C, and/or wherein 90% degradation of the polymer weight in body environment and/or 90% release of hydrogel-embedded components from the polymer is completed within 1 to 14 days, preferably within 2 to 7 days .

In another embodiment, synthetic oligodeoxynucleotides (ODN) with one or more CpG or GpC or GpG motifs are disclosed, wherein said ODN are selected from a) ODN containing a fully or partially nuclease-resistant phosphorothioated backbone with one or more CpG or GpC or GpG motifs, and b) ODN containing a nuclease-susceptible natural phosphodiester backbone (PO ODN) with one or more CpG or GpC or GpG motifs, wherein PO ODN are preferred for encapsulation in hydrogel- embedded PS- liposomes .

In another embodiment, tolerance-promoting PS-liposomes are disclosed including conventional PS-liposomes , PS-ethosomes, PS-niosomes, and elastic PS-liposomes, preferably conventional PS-liposomes , wherein conventional PS-liposomes include multilamellar and large or small unilamellar PS-liposomes, preferably unilamellar PS-liposomes with a diameter of 0.5-5 μνα, more preferably unilamellar PS-liposomes with a diameter of 0.8-1.5 μπι, wherein for the preparation of conventional PS- liposomes various lipid mixtures containing phosphatidyl -L- serine (PS) , phosphatidylcholine (PC) and, optionally, cholesterol (CH) are applicable, wherein lipid mixtures comprising molar ratios of PS: PC of 30:70 up to 50:50 for PS- containing liposomes without cholesterol and molar ratios of PS:PC:CH of 10:50:40 up to 30:30:40 for PS-containing liposomes with cholesterol are preferred.

In another embodiment, find-me molecules for attracting peripheral APC to the site of the administered hydrogel composition are disclosed including lysophosphatidyl-choline (LPC) , sphingosine-1 -phosphate (SIP) and the nucleotides ATP and UTP, wherein ATP and UTP are preferred find-me molecules. In another embodiment, tolerance-promoting immune modulators for encapsulation or incorporation in PS-liposomes or for embedment into hydrogels are disclosed including those which are capable of a) inducing tolerogenic APCs (including DCs and macrophages) and tolerance-promoting Tregs, b) suppressing effector T cell -mediated responses, and c) inhibiting proinflammatory cytokines and pro-inflammatory complement factors at the site of autoantigen or allergen presentation, wherein suitable immune modulators are listed in patent applications EP16001276 and EP3095440 and include but are not limited to a) vitamin D3 , vitamin D3 precursors such as calcidiol and selected vitamin D3 analogs such as calcipotriol , b) glucocorticoids such as dexamethasone phosphate, c) Janus kinase inhibitors, also known as JA inhibitors or jakinibs, such as tofacitinib, d) antagonistic cytokine molecules such as I1-4/IL-13 muteins, e) salicylate-based therapeutics for the inhibition of T FR1-mediated pathways such as acetylsalicylic acid and salicylic acid, f) peptide-based complement inhibitors such as the 13 -residue cyclic peptide (H-I [CWQD GHHRC] T-NH₂ or peptidomimetica-based complement inhibitors such as cyclic PMX53 , and g) aptamer-based inhibitors of pro- inflammatory cytokines, wherein preferred tolerance-promoting immune modulators for encapsulation or incorporation into PS-liposomes include but are not limited to those which a) can be incorporated into the lipid layer of liposomes such as the lipophilic vitamin D3 derivative calcipotriol , and b) which can be encapsulated in the aqueous compartment of liposomes such as the hydrophilic glucocorticoid derivative dexamethasone phosphate and the hydrophilic citrate derivative of tofacitinib, and wherein preferred tolerance-promoting immune modulators for direct embedment in a hydrogel include those which are soluble in the aqueous environment of the hydrogel such as the hydrophilic glucocorticoid derivative dexamethasone phosphate and the hydrophilic citrate derivative of tofacitinib.

In another embodiment, fields of applications are disclosed for which disease-specific compositions according to the method of the present invention are beneficial, preferably for the treatment of allergy, allergic asthma, and autoimmune diseases such as type 1 diabetes, rheumatoid arthritis, autoimmune uveitis, and multiple sclerosis, wherein preferred disease-specific compositions comprise PLGA-PEG-PLGA hydrogels containing allergens or disease-specific autoantigens or fragments including short T cell peptides derived thereof, wherein allergen- or antoantigen-derived short T cell peptides are preferably encapsulated in hydrogel-embedded PS-liposomes, ODN comprising one or more CpG or GpC or GpG motifs either as hydrogel-embedded ODN or as liposomal ODN in hydrogel -embedded PS-liposomes, ATP and/or UTP as find-me molecules, and optional tolerance-promoting immune modulators as hydrogel- embedded formulation or as liposomal formulation in hydrogel- embedded PS- liposomes .

In another embodiment, pharmaceutical formulations of the therapeutic compositions of the present invention are disclosed, wherein preferably all components of each hydrogel composition are mixed as a single preparation prior to injection, wherein the components are mixed with each other in a therapeutically effective quantity, wherein optionally galenic compounds are additionally admixed to the preparation, and wherein the composition is galenically prepared for subcutaneous, intramuscular, or intraocular administration, preferably for subcutaneous administration. In another embodiment, therapeutically effective doses of hydrogel-embedded components are disclosed including a) PS- liposomes, b) tolerance-promoting CpG-ODN, c) tolerance- promoting immune modulators including vitamin D3 derivative calcipotriol , selected glucocorticoids and tofacitinib, d) allergens peptides derived thereof, and e) autoantigens and peptides derived thereof.

In another embodiment, the present invention discloses therapeutic protocols for the treatment of allergic and autoimmune diseases .

In one specific embodiment patients with allergic or autoimmune diseases are treated with repeated administrations of allergens or disease-specific autoantigens or fragments including short T cell peptides derived thereof using an escalating dosing protocol.

In another specific embodiment patients with allergic or autoimmune diseases are treated with repeated administrations of allergens or disease-specific autoantigens or fragments including short T cell peptides derived thereof using identical doses for each administration.

In another specific embodiment patients with allergic or autoimmune diseases are treated with a combination of subcutaneous hydrogel-based immunotherapy with allergen- or autoantigen-derived fragments including short T cell peptides (Phase A) and a subsequent immunotherapy with B cell epitope- containing allergens or fragments thereof (Phase B) , wherein in Phase A repeated administrations of escalating or identical doses of one of the hydrogel-based composition of the present invention are performed, and after sufficient modulation of CD4⁺ T-cells towards IL-10-secreting CD4⁺ T cells with an anergic, regulatory phenotype Phase B is initiated, wherein the method for Phase B is selected from a) subcutaneous immunotherapy with a hydrogel-based composition according to the present invention comprising natural or recombinant allergens or autoantigens or B cell epitope-containing fragments thereof, b) subcutaneous immunotherapy with a composition comprising natural or recombinant allergens or autoantigens or B cell epitope-containing fragments thereof which are formulated in alum or microcrystalline tyrosine, c) sublingual immunotherapy with a composition comprising natural or recombinant allergens or autoantigens or B cell epitope-containing fragments thereof, d) transdermal immunotherapy with a composition comprising natural or recombinant allergens or autoantigens or B cell epitope- containing fragments thereof, and e) oral immunotherapy with recombinant or natural food allergens or B cell epitope- containing fragments thereof, wherein the treatment duration of the second immunotherapeutic step is determined individually based on the development of protective antibodies and the improvement of the clinical score, wherein for analysis of the clinical score in food allergic patients oral food challenges are performed. In still another embodiment, surrogate markers for the induction of tolerance are disclosed, wherein said markers indicate the modulation of CD4⁺ T-cells towards IL- 10 -secreting CD4⁺ T cells with an anergic, regulatory phenotype.

Specific preferred embodiments of the present invention will become evident from the following more detailed description and the claims.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1. Release of PS-liposomes from PLGA-PEG-PLGA hydrogels. For details see Example 12.

Figure 2: Release of ATP from PLGA-PEG-PLGA hydrogels. For details see Example 13.

Figure 3. Experimental design for the evaluation of the therapeutic efficacy of hydrogel-based compositions for Fel d 1-specific immunotherapy in a murine acute airway allergy model. For details see Example 17.

Figure 4. Analysis of immunoglobulin profiles in serum. For details see Example 17.

Figure 5. Assessment of airway resistance to inhaled methacholine . For details see Example 17.

Figure 6. Assessment of airway compliance to inhaled methacholine. For details see Example 17.

Figure 7. TH2 cytokine pattern in the bronchoalveolar lavage fluid. For details see Example 17.

Figure 8. TH1 cytokine pattern in the bronchoalveolar lavage fluid. For details see Example 17.

Figure 9. Lymphocytes and eosinophils in the bronchoalveolar lavage fluid. For details see Example 17.

Figure 10. Neutrophils and macrophages in the bronchoalveolar lavage fluid. For details see Example 17. Figure 11. Experimental design for the evaluation of the therapeutic efficacy of find-me signals in a murine acute airway allergy model. For details see Example 18. Figure 12. Assessment of airway resistance to inhaled methacholine . For details see Example 18.

Figure 13. Assessment of airway compliance to inhaled methacholine. For details see Example 18.

Detailed Description of the Invention

The present invention discloses novel hydrogel-based technologies and methods for subcutaneous allergen- or autoantigen-specific immunotherapy of allergic and autoimmune diseases using tolerance-promoting amounts of oligodeoxy- nucleotides (ODN) with one or more CpG or GpC or GpG motifs as adjuvant at tolerated dose levels

I. Tolerance-inducing strategies using CpG-, GpC- or GpG-ODN

The present invention discloses hydrogel-based compositions for the induction of allergen- or autoantigen-specific tolerance in patients suffering from allergic and autoimmune diseases .

Non-liposomal composition A. In one embodiment, a pharmaceutical composition for the induction of tolerance by allergen- or autoantigen-specific immunotherapy in patients with allergic or autoimmune diseases is disclosed which comprises a thermogelling hydrogel suitable for a locally restricted but sustained release of hydrogel-embedded tolerance-promoting doses of a) one or more hydrogel-embedded allergens or autoantigens or fragments including short T cell peptides derived thereof ,

c) one or more hydrogel-embedded find-me molecules for attracting peripheral antigen-presenting cells (APC) to the site of the administered hydrogel composition, and d) optionally one or more hydrogel-embedded tolerance- promoting immune modulators.

The thermosensitive hydrogel-based approach guarantees a sustained delivery of allergens or autoantigens or peptides derived thereof and tolerance-promoting amounts of CpG-ODN or GpC-ODN or GpG-ODN for a period of at least 2 to 3 days. On one hand, this is important for the development of immunologic memory upon allergen or autoantigen exposure since priming of an immune response requires the engagement of the T cell receptor (TCR) over 12-48 hours, and long lasting memory may even require repetitive exposure (Shakhar et al . , 2005; Garcia et al., 2007; Obst et al . , 2007). On the other hand, the sustained release of CpG-ODN or GpC-ODN or GpG-ODN allows to reduce the tolerance-promoting concentration of these ODN.

In addition, composition A provides also the advantage that the tolerance-promoting amount of hydrogel-embedded CpG-ODN or GpC-ODN or GpG-ODN can be further reduced due to optimized attraction of dendritic cells and macrophages to the site of the injected hydrogel composition mediated by a sustained release of find-me molecules from the hydrogel. The hydrogel- mediated sustained delivery technology of the present invention mimics the physiological role of find-me signals which are released continuously from apoptotic cells, thereby establishing a chemotactic gradient that stimulates the migration of phagocytes to the apoptotic cells. The hydrogel- mediated sustained delivery technology of the present invention provides an additional advantage in that also low molecular weight find-me molecules with a short plasma half- life such as ATP and UTP can be used for establishing a chemotactic gradient for efficient peripheral phagocytosis. Thereby, expenses for production and clinical testing can be reduced significantly. Composition B with liposomal ODN. In another embodiment, a pharmaceutical composition for the induction of tolerance by allergen- or autoantigen-specific immunotherapy in patients with allergic or autoimmune diseases is disclosed which comprises a thermogelling hydrogel suitable for a locally restricted but sustained release of hydrogel-embedded tolerance-promoting doses of

c) one or more hydrogel-embedded find-me molecules for attracting peripheral antigen-presenting cells (APC) to the site of the administered hydrogel composition, and d) optionally one or more tolerance-promoting immune modulators, wherein said immune modulators are included in the composition either as hydrogel-embedded immune modulators or as liposomal immune modulators in hydrogel- embedded PS- liposomes together with CpG-ODN or GpC-ODN or GpG-ODN.

Composition B provides several important therapeutic advantages over currently available techniques. Most important, composition B allows the induction of tolerance by CpG-ODN or Gpc-ODN or GpG-ODN at low dose levels due to direct targeting of dendritic cells and macrophages via the eat-me signal phosphatidyl-L-serine on the surface of CpG-ODN- or GpC-ODN- or GpG-ODN-containing PS-liposomes . Thereby, uptake of encapsulated CpG-ODN or GpC-ODN or GpG-ODN by antigen- presenting cells is most efficient and the intracellular concentration of CpG-ODN or GpC-ODN or GpG-ODN is increased significantly. In combination with hydrogel-embedded find-me molecules, the liposomal technology of combination B allows a significant reduction of liposomal ODN in the hydrogel composition without impairing their tolerance-promoting effects . In addition, the tolerance-promoting effects of high intracellular concentrations of CpG-ODN or GpC-ODN or GpG-ODN are supported by the tolerance- inducing effect of PS- liposomes. Both tolerance- inducing mechanisms are mediated by different receptors including several extracellular PS receptors and the intracellular receptors TLR9 and TLR7. Therefore, both mechanisms are likely to induce tolerance in a synergistic manner.

Composition C with liposomal peptides. In another embodiment, a pharmaceutical composition for the induction of tolerance by allergen- or autoantigen-specific immunotherapy in patients with allergic or autoimmune diseases is disclosed which comprises a thermogelling hydrogel suitable for a locally restricted but sustained release of hydrogel-embedded tolerance-promoting doses of

c) one or more hydrogel-embedded find-me molecules for attracting peripheral antigen-presenting cells (APC) to the site of the administered hydrogel composition, and d) and optionally one or more hydrogel-embedded tolerance- promoting immune modulators, wherein said immune modulators are included in the composition either as hydrogel-embedded immune modulators or as liposomal immune modulators in hydrogel-embedded PS-liposomes together with i) CpG-ODN or GpC-ODN or GpG-ODN and ii) one or more allergen- or autoantigen-derived fragments, preferably one or more allergen- or autoantigen-derived short T cell peptides, wherein said immune modulators are included in the composition either as hydrogel-embedded immune modulators or as liposomal immune modulators in hydrogel- embedded PS-liposomes together with one or more allergen- or autoantigen-derived fragments, preferably one or more allergen- or autoantigen-derived short T cell peptides.

Composition C provides the important advantage that peptides encapsulated in PS-liposomes are preferentially recognized and phagocytosed by APCs including dendritic cells and macrophages due to the eat-me signal phosphatidyl-L-serine on the surface of the peptide-containing PS-liposomes. As a result, peptides encapsulated in PS-liposomes are most efficiently presented to tolerance-promoting Tregs, whereas the uptake and subsequent presentation of non-encapsulated peptides by APCs is significantly less effective. For the treatment of allergic diseases, composition C provides another important advantage in that longer allergen-derived peptides containing multiple T cell epitopes can also be used. If non-encapsulated long peptides are injected subcutaneously or intradermally, the possibility of retained conformational structure within long peptides can cause IgE-mediated adverse reactions as observed in a clinical trial with two long 27 amino acid sequences from Fel d 1 (Wallner et al., 1994). In contrast, using composition C the liposome-encapsulated peptides do not have contact with allergen-specific IgE antibodies and cannot induce IgE- mediated adverse reactions.

With regard to hydrogel-embedded CpG-ODN or GpC-ODN or GpG- ODN, composition C provides the same opportunities as composition A for a reduction of the tolerance-promoting concentration of these ODN to tolerated dose levels without impairment of their tolerance-promoting effects.

Composition D with liposomal ODN and peptides . In another embodiment, a pharmaceutical composition for the induction of tolerance by allergen- or autoantigen-specific immunotherapy in patients with allergic^' or autoimmune diseases is disclosed which comprises a thermogelling hydrogel suitable for a locally restricted but sustained release of hydrogel-embedded tolerance-promoting doses of

b) one or more hydrogel-embedded find-me molecules for attracting peripheral antigen-presenting cells (APC) to the site of the administered hydrogel composition, and c) and optionally one or more hydrogel-embedded tolerance- promoting immune modulators, wherein said immune modulators are included in the composition either as hydrogel-embedded immune modulators or as liposomal immune modulators in hydrogel-embedded PS- liposomes together with i) CpG-ODN or GpC-ODN or GpG-ODN and ii) one or more allergen- or autoantigen-derived fragments, preferably one or more allergen- or autoantigen-derived short T cell peptides .

Composition D combines the important advantages of compositions B and C, but is difficult to standardize due to varying encapsulation efficiencies of tolerance-promoting ODN and allergen-or autoantigen-derived peptides in PS-liposomes.

Optional addition of tolerance-promoting immune modulators to hydrogel compositions. Tolerance-promoting immune modulators are selected from vitamin D3 , vitamin D3 derivatives, glucocorticoids, Janus kinase inhibitors, antagonistic cytokine molecules, salicylate-based therapeutics for the inhibition of TNFR1-mediated pathways, peptide-based complement inhibitors or peptidomimetica-based complement inhibitors, and aptamer-based inhibitors of pro-inflammatory cytokines, are added to each composition.

Preferred tolerance-promoting immune modulators for this approach are NF-κΒ inhibitors including but not limited to vitamin D3 and analogs thereof with short plasma half- lives such as calcipotriol , glucocorticoids, and the Janus kinase inhibitor tofacitinib. NF-κΒ inhibitors are known to inhibit the maturation process of dendritic cells (DCs) , thereby generating tolerizing DCs which are capable of inducing tolerance-promoting regulatory T cells. The Janus kinase inhibitor tofacitinib is a specific inhibitor of JAK3 and JAKl and is known to inhibit the differentiation of TH2 cells and inflammatory processes.

The addition of preferred tolerance-promoting immune modulators to hydrogel compositions enhances the induction of tolerance in a synergistic manner since each of the tolerance- inducing mechanisms mediated by CpG-ODN or GpC-ODN or GpG-ODN, PS-liposomes, NF-κΒ inhibitors and inhibitors of JAK3 and JAK1 tyrosine kinases interacts with different targets. Encapsulation or incorporation of tolerance-promoting immune modulators in PS- liposomes allows direct targeting of APCs including dendritic cells and macrophages due to the eat-me signal phosphatidyl-L-serine (PS) on the surface of PS- liposomes. Therefore, liposomal tolerance-promoting immune modulators are most effective in generating tolerizing APC capable of inducing tolerance-promoting regulatory T cells. This provides also the advantage that the tolerance-promoting amount of immune modulators can be reduced significantly without impairment of their tolerance-promoting effects.

Combinations . In another embodiment, the present invention discloses combinations of hydrogel composition A-D. All combinations are based on thermosensitive hydrogels for subcutaneous injection, containing at least one or more allergens or autoantigens or fragments including short T cell peptides derived thereof, either as hydrogel-embedded components or as encapsulated components in hydrogel-embedded PS-liposomes . Additional hydrogel-embedded components are selected from a) tolerance-promoting CpG-ODN or GpC-ODN or GpG-ODN, b) one or more find-me molecules, c) one or more tolerance-promoting immune modulators, d) PS-liposomes containing CpG-ODN or GpC-ODN or GpG-ODN, e) PS-liposomes containing CpG-ODN or GpC-ODN or GpG-ODN, and one or more immune modulators, f) PS-liposomes containing one or more allergen- or autoantigen-derived peptides and tolerance- promoting CpG-ODN or GpC-ODN or GpG-ODN, g) PS-liposomes containing one or more allergen- or autoantigen-derived peptides and one or more immune modulators, and h) PS- liposomes containing one or more allergen- or autoantigen- derived peptides, tolerance-promoting CpG-ODN or GpC-ODN or GpG-ODN, and one or more immune modulators.

II. Thermosensitive hydrogels

In another embodiment, the present invention discloses thermosensitive hydrogels which are suitable for subcutaneous administration and sustained local delivery of hydrogel- embedded components including one or more allergens or autoantigens or peptides derived thereof, one or more find-me molecules, one or more tolerance-promoting immune modulators, PS- liposomes containing CpG-ODN or GpC-ODN or GpG-ODN, PS- liposomes containing CpG-ODN or GpC-ODN or GpG-ODN and one or more tolerance-promoting immune modulators, PS-liposomes containing one or more allergen- or autoantigen-derived peptides in addition to CpG-ODN or GpC-ODN or GpG-ODN, and PS- liposomes containing one or more allergen- or autoantigen- derived peptides in addition to CpG-ODN or GpC-ODN and one or more tolerance-promoting immune modulators. Preferred thermosensitive hydrogels are injectable in situ- forming gel systems which a) undergo a sol-gel-sol transition, preferably forming a free flowing sol at room temperature and a non-flowing gel at body temperature, b) can serve as depot for sufficient quantities of above listed components, c) allow the release of sufficient quantities of the embedded components over a prolonged period of at least 2 to 3 days, d) are chemically and physically compatible with all embedded components, and e) are biodegradable. In a more preferred embodiment of the invention, biodegradable thermogelling hydrogels are used which are composed of FDA- approved biodegradable polymers . Preferred biodegradable polymers approved by the FDA and used in a clinical trial, include but are not limited to poly (D, L-lactic acid), poly (lactic-co-glycolic acid) (PLGA) , and copolymers of L- lactide and D, L- lactide . All FDA approved polymers have been studied extensively for their biocompatibility, toxicology, and degradation kinetics. Furthermore, these polymers have been shown to release embedded therapeutics for several hours up to several weeks in vivo.

Useful for the method of the present invention are biodegradable thermogelling block polymers which are based on monomethoxy poly (ethylene glycol) (MPEG) including but not limited to a) diblock copolymers consisting of MPEG and poly ( -caprolactone) (PCL) (Hyun et al . , 2007), b) MPEG-£>- (PCL-ran-PLLA) diblock copolymers ( ang et al., 2010), and c) diblock copolymers consisting of MPEG and PLGA (Peng et al . , 2010) . MPEG copolymers containing PCL provide the advantage that they do not create an acidic environment upon biodegradation in contrast to MPEG copolymers containing PLLA and PLGA (Hyun et al . , 2007) .

Preferred for the method of the present invention are biodegradable thermogelling triblock polymers including but not limited to a) PLGA-PEG-PLGA (Qiao et al . , 2005), b) PEG- PLGA-PEG (Zhang et al . , 2006), and c) PEG-PCL-PEG (PECE) (Gong et al., 2009a). Various biodegradable thermogelling triblock polymers made up of PLGA and PEG are disclosed in patent W099/18142. At lower temperatures, hydrogen bonding between hydrophilic PEG segments of the copolymer chains and water molecules dominate in aqueous solutions, resulting in the dissolution of these copolymers in water. As the temperature increases, the hydrogen bonding becomes weaker, while hydrophobic forces of the hydrophobic segments such as PLGA segments are getting stronger, leading to sol-gel transition. PEG, PLGA and PCL are well-known, FDA-approved, biodegradable and biocompatible materials which have been widely used in the biomedical field. Most preferred for the method of the present invention are biodegradable thermogelling PLGA-PEG-PLGA triblock polymers. Compared to other biodegradable hydrogels, injectable thermogelling PLGA-PEG-PLGA polymers possess several advantages including easy preparation, a formulation process which is free of harmful organic solvents (e.g., Qiao et al . 2005), application of building blocks which are approved for parenteral use in humans by the FDA, excellent biocompatibility, and well established procedures for the production of composits comprising liposomes (e.g., Xing et al., 2013). Furthermore, PLGA-PEG-PLGA hydrogels provide another important advantage in that tolerance-interfering Thl- type or Th2-type immune responses are avoided. Modification of the degradation kinetics of thermogelling hydrogels . Preferred are biodegradable thermogelling polymers for the method of the present invention which maintain their structural integrity for a few days but do not remain in the body for more than a month. Therefore, biodegradable thermogelling polymers which allow modification of their degradation kinetics, are preferred for the method of the present invention. For example, PLLA segments can be incorporated into the PCL segment of MPEG-PCL copolymers, since PLLA provides better accessibility of water to the ester bonds of PLLA which enhances the hydrolytic degradation of the copolymer (Kang et al . , 2010). In another example, the rate of PLGA-PEG-PLGA hydrogel erosion can be modified by altering the molar ratio of DL-lactide/glycolide in the PLGA segment. The DL-lactide moiety is more hydrophobic than the glycolide moiety. Therefore, by increasing the molar ratio of DL- lactide/glycolide in the PLGA segment of PLGA-PEG-PLGA triblock copolymers, more stable hydrogels are formed due to stronger hydrophobic interactions among the copolymer molecules (Qiao et al . 2005). III. Targeting of APC by PS-liposomes

In another embodiment, the present invention discloses phosphatidyl-L-serine (PS) -presenting liposomes capable of targeting antigen-presenting cells (APC) including dendritic cells (DCs) and macrophages.

In viable cells, PS is kept exclusively on the inner leaflet of the lipid bilayer via ATP-dependent translocases . In apoptotic cells, the concentration of PS on the outer leaflet of the lipid bilayer is estimated to increase by more than 280-fold within only a few hours after induction of apoptosis.

PS exposed on the surface of apoptotic cells represents the key signal for triggering phagocytosis by macrophages (for a review, see Hochreiter-Hufford and Ravichandran, 2013). This is indicated by the observation that phagocytosis of apoptotic lymphocytes by macrophages was inhibited in a dose-dependent manner by PS and PS-containing liposomes, but not by liposomes containing other anionic phospholipids including phosphatidyl- D-serine (Fadok et al . , 1992).

Clearance of apoptotic cells is initiated when phosphatidyl-L- serine-enriched membranes engage phosphatidyl-L-serine receptors. Two types of phosphatidyl-L-serine receptor have been described, those that bind the phospholipid directly and those that use bridging molecules to associate with it. Direct phosphatidyl-L-serine-binding receptors include T cell immunoglobulin and mucin receptor (TIM) proteins (TIM1, TIM3 and TIM4) ; the CD300 family members CD300a and CD300f (also known as CLM1) ; and the seven-transmembrane spanning receptors brain-specific angiogenesis inhibitor 1 (BAI1) , stabilin 1 and receptor for advanced glycosylation end products (RAGE) . The phosphatidyl-L-serine-bridging molecule MFGE8 is used for apoptotic clearance through νβ3 and ανβ5 integrins, which are indirect phosphatidyl-L-serine receptors. Similarly, GAS6 and protein S (PROS) are the bridging molecules that link the indirect phosphatidylserine receptors of the tyrosine protein kinase receptor 3 (TYR03 ) -AXL-MER (TAM) family to phosphatidyl-L-serine to mediate apoptotic clearance (for a review, see Amara and Mercer, 2015) .

Liposomes containing phosphatidyl-L-serine (PS-liposomes) mimic apoptotic cells and are engulfed by phagocytes including macrophages, dendritic cells and microglia (e.g., Wu et al . , 2010) . Therefore, CpG-ODN or GpC-ODN or GpG-ODN encapsulated in PS- liposomes are effectively targeted to APC. Furthermore, the PS-mediated uptake of CpG-ODN or GpC-ODN or GpG-ODN guarantees optimal interaction of these oligodeoxynucleotides with endosomal/lysosomal Toll- like receptor molecules. As a result, the tolerance-inducing dose of CpG-ODN or GpC-ODN or GpG-ODN can be reduced to tolerated dose levels.

IV. Promotion of tolerance by PS-liposomes

In another embodiment, the present invention discloses phosphatidyl-L-serine (PS) -presenting liposomes capable of inducing tolerance-promoting antigen-presenting cells (APC) including dendritic cells (DCs) and macrophages.

Phagocytosis of apoptotic cells inhibits the maturation of dendritic cells, their secretion of pro- inflammatory cytokines (Steinman et al . , 2000; Chen et al . , 2004), and there is evidence that PS-dependent phagocytosis of apoptotic cells transforms macrophages to an anti- inflammatory phenotype (Fadok et al . , 1998; Hoffmann et al . , 2001; Huynh et al . , 2002) .

PS- liposomes can mimic the effects of apoptotic cells on macrophages and microglia to induce the secretion of antiinflammatory mediators including TGF-βΙ and PGE2 (Otsuka et al., 2004; Zhang et al . , 2006b). As demonstrated in a recent study, expression of MyD88 , which is essential for the signal transduction in lipopolysaccharide (LPS) stimulation, is suppressed when macrophages are treated with PS- liposomes (Tagasugi et al . , 2013) .

Moreover, PS- liposomes inhibit the maturation of dendritic cells and enhance their secretion of anti- inflammatory cytokines. For example, large unilamellar PS- liposomes have been shown to inhibit the up-regulation of HLA-ABC, HLA-DR, CD80, CD86, CD40, and CD83, as well as the production of IL- 12p70 in human DCs in response to LPS. DCs exposed to PS had diminished capacity to stimulate allogeneic T cell proliferation and to activate IFN-γ-producing CD4 (+) T cells (Chen et al., 2004) . A corresponding effect of PS-liposomes on the maturation and immuno- stimulatory functions of murine DCs in response to l-chloro-2 , 4-dinitrobenze (DNCB) was observed in the study of Shi et al . (2007) . After treatment with PS- liposomes, murine DCs displayed reduced expression of MHC II, CD80, CD86 and CD40, but increased programmed death ligand-1 (PD-L1 and PD-L2) , increased IL-10 and inhibited IL-12 cytokine production. DCs treated with PS-liposomes exhibited normal endocytic function, but their ability to stimulate allogeneic T cells was reduced, similar to immature dendritic cell. Treatment of DCs with PS-liposomes also suppressed DNCB- induced CD4(+) T cell proliferation and IFN-γ production. Furthermore, DCs treated with PS-liposomes enhanced the ratio of CD4( + ) CD25 (high) Foxp3 ( + ) T cells to CD4 ( + ) T cells and PD- 1 expression on CD4(+) T cells. In vivo effects of PS and PS-liposomes have also been reported For example, intravenous injection of PS in mice has been demonstrated to reduce both T cell -dependent and T cell- independent antibody production (Ponzin et al., 1989) and intravenous injection of PS prior to the injection of bacterial LPS has been shown to reduce serum TNF- levels (Monastra and Bruni, 1992) . Comparable effects have been observed also after injection of PS- liposomes . For example, intraperitoneal injection of PS- liposomes ameliorated the course of extrinsic allergic encephalitis induced in mice by immunization with myelin basic protein (Monastra et al . , 1993) . Also, PS-liposomes specifically inhibited responses in mice to antigens as determined by decreased draining lymph node tissue mass, reduced numbers of total leukocytes and antigen- specific CD4+ T cells and decreased levels of antigen- specific IgG in blood. TGF-β appears to play a critical role in this inhibition, as the inhibitory effects of PS-liposomes were reversed by in vivo administration of anti-TGF-β antibodies (Hoffmann et al . , 2005) . A recent study demonstrated that after uptake of PS-liposomes in vitro and in vivo, macrophages secrete high levels of the anti- inflammatory cytokines TGF-β and IL-10 and upregulate the expression of CD206 (mannose receptor C type 1; MRC1) , concomitant with downregulation of pro-inflammatory markers such as TNF-a and the surface marker CD86 (Harel-Adar et al . , 2011) . CD86 (also known as B7-2) is a protein expressed on antigen-presenting cells that provides costimulatory signals necessary for T cell activation and survival. In subsequent experiments, the authors demonstrated that modulation of cardiac macrophages by PS-liposomes improves infarct repair. Injection of PS- liposomes via the femoral vein in a rat model of acute myocardial infarction promoted angiogenesis and prevented ventricular dilatation and remodeling (Harel-Adar et al . , 2011) .

V. Preparation of empty and loaded PS-liposomes

In another embodiment, the present invention discloses the preparation of PS-liposomes. PS-liposomes include but are not limited to a) empty PS-liposomes, b) loaded PS-liposomes which contain CpG-ODN or GpC-ODN or GpG-ODN, c) loaded PS-liposomes which contain CpG-ODN or GpC-ODN or GpG-ODN and one or more tolerance-promoting immune modulators, d) loaded PS- liposomes which contain CpG-ODN or GpC-ODN or GpG-ODN and one or more allergen-or autoantigen-derived T cell peptides, and e) loaded PS- liposomes which contain CpG-ODN or GpC-ODN or GpG-ODN, one or more tolerance-promoting immune modulators and one or more allergen-or autoantigen-derived T cell peptides.

PS-Liposomes are thermodynamically stable vesicles composed of one or more concentric lipid bilayers. PS-liposomes have two compartments, an aqueous central core, and a lipophilic area within the lipid bilayer. Hydrophilic molecules such as hydrophilic CpG-ODN or GpC-ODN or GpG-ODN can be encapsulated in the inner aqueous volume, while hydrophobic molecules such as the tolerance-promoting immune modulator vitamin D3 can be incorporated into the lipid bilayers.

A variety of liposomal carrier systems have been used for encapsulating hydrophilic and incorporating hydrophobic molecules including conventional liposomes, ethosomes, niosomes, and elastic liposomes (the initial formulation approach being termed transferosomes) . Preferred for the method of the present invention are conventional PS-containing liposomes .

Conventional PS-liposomes are composed of PS and other phospholipids such as phosphatidylcholine (PC) from soybean or egg yolk, with or without cholesterol (CH) . The most common applied PS is derived from bovine brain, but other PS sources and synthetic PS preparations such as 1-palmitoyl-2 -oleyl- sn- 3 -glycerophospho-L-serine or 1, 2-distearoyl-sn-3-glycero- phospho-L-serine are also suitable. Cholesterol is used to stabilize the system. For the preparation of conventional PS- liposomes various lipid mixtures containing PS, PC and, optionally, CH are applicable including but not limited to lipid mixtures comprising molar ratios of PS: PC of 30:70 (Gilbreath et al . , 1985) or 50:50 (Fadok et al . , 2001) for PS- liposomes without cholesterol and molar ratios of PS:PC:CH of 30:30:40 (Hoffmann et al . , 2005; Harel-Adar et al . , 2011) for PS-liposomes with cholesterol. As demonstrated recently, however, efficient uptake by macrophages can also be achieved with liposomes containing PS as low as 6 mol% (Geelen et al . , 2012) . Conventional PS- liposomes can be prepared in several ways. Most frequently, a film hydration method is employed, where a thin layer of lipid is deposited on the walls of a container by evaporation of a volatile solvent. An aqueous solution, optionally containing the molecule to be entrapped, is added at a temperature above the transition temperature of the lipids, resulting in the formation of multilamellar vesicles. These systems contain several lipid bilayers surrounding the aqueous core. Further processing by sonication or filter extrusion generates large unilamellar vesicles (LUV, 1-5 μπι diameter), or small unilamellar vesicles (LUV, 0.1-0.5 μτη diameter) . PS- liposomes with 1 μπι diameter have been shown to trigger efficient uptake by macrophages (Harel-Adar et al . , 2011) . VI. PS-liposome-thermogelling hydrogel formulations

For sustained local delivery of PS-liposomes at the site of autoantigen or allergen presentation according to the method of the present invention, different liposome-hydrogel formulations are suitable (e.g., Xing et al . , 2013; Nie et al . , 2011) .

In a preferred embodiment, thermosensitive hydrogels comprising PLGA-PEG-PLGA are employed for sustained local delivery of PS-liposomes at the site of autoantigen or allergen presentation. As demonstrated in a recent study, liposome-loaded PLGA-PEG-PLGA hydrogels exhibit still reversible thermosensitive properties (Xing et al . , 2013). However, its sol-gel and gel-precipitate transition temperatures decreased with increasing liposome concentrations. Most important, the particle size of free liposomes and those released from the PLGA-PEG-PLGA hydrogels were found to be close regardless of particle size of liposomes, indicating that the liposomes were stable in the hydrogel and intact liposomes could be released (Xing et al . , 2013) .

VII. Synthetic CpG oligodeoxynucleotides (CpG-ODN)

In another embodiment, the present invention discloses synthetic CpG-ODN capable of inducing tolerance at high concentration via the TLR9-TRIF pathway.

Currently used synthetic CpG-ODN differ from microbial DNA in that they have a partially or completely phosphorothioated backbone instead of the typical phosphodiester backbone and a poly G tail at the 3' end, 5' end, or both. The phosphorothioated backbone modification protects the ODN from being degraded by nucleases in the body and poly G tails enhances cellular uptake due the formation of intermolecular tetrads resulting in high molecular weight aggregates.

Based on their sequence, secondary structure and effects on human peripheral blood mononuclear cells, different classes of synthetic CpG-ODN have been defined (for a review, see Vollmer and Krieg, 2009) . Class A CpG-ODN contain a central palindromic phosphodiester CpG sequence and a phosphorothioate-modified 3' poly-G tail. Class B CpG-ODN are 18-28mer linear oligodeoxynucelotides . They contain a fully nuclease-resistant phosphorothioated backbone with one or more 6mer CpG motifs. The optimal motif is GTCGTT in human and GACGTT in mouse. Class C ODN combine features of both classes A and B. They contain a complete phosphorothioate backbone and a CpG-containing palindromic motif.

For the method of the present invention, all three classes of CpG-ODN are suitable. Although class A ODNs are rapidly degraded in vivo with a half-life of nearly 5 to 10 min, they are also applicable for the method of the present invention if they are protected by encapsulation in PS-liposomes . Furthermore, for liposome-based hydrogel compositions cellular uptake enhancing poly G tails are not required. Furthermore, ODNs with one or more CpG motifs which are fully nuclease- susceptible are also suitable for the present invention if they are protected by encapsulation in PS-liposomes. VIII. GpC-ODN and GpG-ODN

In another embodiment, the present invention discloses synthetic GpC oligodeoxynucleotides (GpC-ODN) capable of inducing tolerance via the TLR7-TRIF pathway. For the method of the present invention, all GpC-ODN are suitable which are capable of inducing tolerance via the TLR7- TRIF pathway. Preferred GpC-ODN include but are not limited to GpC-ODN 1826 (5' -TCCATGAGCTTCCTAAGCTT-3 ' ) and GpC-ODN 1668 (5' -TCCATGAGCTTCCTGATGCT-3 ' ) both of which have been shown to confer suppressive properties on human splenic plasmacytoid dendritic cells (pDCs) , contingent on functional indoleamine 2 , 3-dioxygenase 1 (Volpi et al . , 2012), .

In still another embodiment, the present invention discloses synthetic GpG oligodeoxynucleotides (GpG-ODN) capable of attenuating experimental immune diseases. Preferred GpG-ODN include but are not limited to GpG-ODN 5- TGACTGTGAAGGTTAGAGATGA-3 which as been demonstrated to suppress the severity of experimental autoimmune encephalomyelitis, to downregulate autoreactive Thl and to induce an altered isotype switching of autoreactive B cell to a protective IgGl isotype (Ho et al . , 2003). Furthermore, this GpG-ODN delayed the onset and attenuated the severity of lupus nephritis by antagonizing and blocking the activation of multiple TLRs (Graham et al . , 2010).

IX. Attraction of APC by find-me molecules

In another embodiment, the present invention discloses hydrogel-embedded find-me molecules capable of attracting APCs to the site of subcutaneously injected hydrogels.

Effective local uptake of hydrogel-embedded allergens, autoantigens or peptides derived thereof and empty or loaded PS-liposome by dendritic cells and macrophages in subcutaneous tissues requires the presence of released find-me signals. For example, apoptotic cells are quickly recognized and removed by phagocytes, which can be either neighboring healthy cells or professional phagocytes recruited to the site of apoptotic cell death. Phagocytes are extremely efficient in sensing and detecting the dying cells at the earliest stages of apoptosis. This is a result of find-me signals released from apoptotic and the exposure of eat-me signals on apoptotic cells.

In the recent past, several find-me signals released from apoptotic cells have been identified (for a review, see Ravichandran, 2011) . In one embodiment, the present invention utilizes these find-me signals capable of triggering effective local phagocytosis including but not limited to fractalkine (chemokine CXC3CL1) , lysophosphatidylcholine (LPC) , sphingosine-1-phosphate (SIP) and the nucleotides ATP and UTP. Both nucleotides have been described as non-redundant find-me signals released by apoptotic cells (Elliott et al . , 2009). UTP acts only on P2Y-family receptors and UDP produced via degradation of released UTP by extracellular enzymes has been shown to promote phagocytic activity via the P2Y6 nucleotide receptor. In contrast, ATP acts on P2X- and P2Y- family- receptors, whereas ADP produced via degradation of released ATP by extracellular enzymes acts only on P2Y- family receptors (for a review, see Gombault et al., 2013).

Preferred for the method of the present invention are find-me signals which are chemically and physically compatible with such hydrogels, and which can be released from such hydrogels over a period of 1-3 days in a way that resembles the release of find-me from apoptotic cells.

In one embodiment, only one find-me signal selected from ATP, UTP, ADP or UDP is employed. In a preferred embodiment, equimolar quantities of ATP and UTP are employed as find-me signals. Using a transwell migration assay, both nucleotides have been demonstrated to effect maximal migration of phagocytes at a concentration of about 100 nM (Elliott et al . , 2009) . For the method of the present invention the release of ATP and/or UTP from subcutaneously injected hydrogel compositions at nanomolar concentrations is a strict requirement. At nanomolar concentrations, ATP activates receptors such as P2Y2 (EC50 <1 μΜ) which mediate chemotaxis. Furthermore, it has been demonstrated that at nanomolar concentrations ATP exerts antiinflammatory effects by suppressing the secretion of proinflammatory cytokines and promoting the release of of antiinflammatory cytokines (for a review, see Chekeni and Ravichandran, 2011) . In contrast, at concentrations of more than 1 μΜ ATP acts as a danger signal via activation of the nucleotide receptor P2X7 (EC50 >100 μΜ) , which in turn leads to activation of the inflammasone and release of pro- inflammatory cytokines (Kono and Rock, 2008) . X. Tolerance-promoting immune modulators In another embodiment, the present invention discloses tolerance-promoting immune modulators for encapsulation or incorporation in hydrogel-embedded PS- liposomes or for direct embedment into hydrogels. Although direct embedment of tolerance-promoting immune modulators into hydrogels does not provide for maximal effective tolerizing immune modulation of APCs, it allows extension of the tolerizing effect of these hydrogel-embedded immune modulators also to other immune cells in addition to APCs. For example, dexamethasone phosphate (DexP) exerts its immunosuppressive and anti- inflammatory activity not only in dendritic cells and macrophages, but also in various other immune cells including T cells, eosinophils, mast cells, and neutrophils. In all of these cells, DexP and its receptor regulate a complex network that inhibits a variety of inflammatory pathways via several mechanisms such as expression of anti-inflammatory proteins, induction and inhibition of cytokines, inhibition of inflammatory receptors, reduced expression of adhesion molecules, and the induction of Tregs (for reviews, see Barnes, 2001; Rhen and Cidlowski, 2005; Longui , 2007; Robinson, 2010).

Suitable tolerance-promoting immune modulators for the method of the present invention are those which are capable of a) inducing tolerogenic APCs (including DCs and macrophages) and tolerance-promoting Tregs, b) suppressing effector T cell- mediated responses, and c) inhibiting pro-inflammatory cytokines and pro-inflammatory complement factors at the site of autoantigen or allergen presentation. Such immune modulators are listed in patent applications EP16001276 and EP3095440 and include but are not limited to a) vitamin D3 and selected analogs such as calcipotriol , b) glucocorticoids such as dexamethasone phosphate, c) Janus kinase inhibitors, also known as JAK inhibitors or jakinibs, such as tofacitinib, d) antagonistic cytokine molecules such as I1-4/IL-13 muteins, e) salicylate-based therapeutics for the inhibition of T FR1- mediated pathways such as acetylsalicylic acid and salicylic acid, f) peptide-based complement inhibitors such as the 13- residue cyclic peptide (H-I [CWQDWGHHRC] T-NH₂ or peptidomimetica-based complement inhibitors such as cyclic PMX53 , and g) aptamer-based inhibitors of pro- inflammatory cytokines .

Preferred tolerance-promoting immune modulators for direct embedment in a hydrogel include those which are soluble in the aqueous environment of the hydrogel such as the hydrophilic glucocorticoid dexamethasone phosphate and the hydrophilic citrate derivative of tofacitinib. Preferred are also those tolerance-promoting immune modulators which are characterized by a short serum half-life, since such immune modulators are removed rapidly from circulation, thereby minimizing potential systemic side effects.

Glucocorticoids exhibiting a short plasma half-life (ranging between 30 min and 2 hours) and a relatively short biological half-life of 8-12 hours include cortisone and hydrocortisone, glucocorticoids exhibiting an intermediate plasma half- life (ranging between 2.5 and 5 hours) and an intermediate biological half-life of 18-36 hours include prednisone, prednisolone, methylprednisolone and triamcinolone, and glucocorticoids exhibiting a long plasma half-life (up to 5 hours) and a relatively long biological half -life of 36-54 hours include dexamethasone, betamethasone and fludrocortisone (for a review, see Longui, 2007) . However, most important for the method of the present invention is the glucocorticoid potency, which defines the capacity to elevate glycemia and which is proportional to the anti- inflammatory potency. In this respect cortisone and hydrocortisone exhibit a rather low potency, prednisone, prednisolone, methylprednisolone and triamcinolone an intermediate potency, whereas dexamethasone and betamethasone exhibit a rather high potency, which is 25- 30 -fold higher than that of cortisone or hydrocortisone (for a review, see Longui, 2007) . Therefore, glucocorticoids with a high anti-inflammatory potency are preferred for the method of the present invention despite their relatively long plasma and biological half-lives.

Hydrogel-embedded tofacitinib citrate formulations offer the possibility to use tofacitinib as supporting tolerance- promoting immune modulator at relatively low concentrations which provide therapeutic efficacy at the site of allergen or autoantigen presentation but minimize potential tofacitinib- mediated adverse effects. The hydrogel serves as sustained delivery system for tofacitinib at the site of allergen or autoantigen presentation and, thereby, eliminates peak serum levels of tofacitinib as observed after oral administrations. Furthermore, the short in vivo half-life of tofacitinib (2-3 h) minimizes systemic effects of tofacitinib upon diffusion and transport away from injected hydrogel-based compositions. Lowering the dose of tofacitinib without affecting its therapeutic efficacy is important since currently administered doses of tofacitinib for systemic treatment of arthritis is associated with potential serious adverse effects. For example, in a phase 3, randomized, double-blind, placebo- controlled clinical study with rheumatoid arthritis patients, there was an increased rate of serious infections during oral therapy with tofacitinib (at doses of 5 mg or 10 mg twice daily) as compared with placebo (Fleischmann et al . , 2012a). In months 0 to 3 of treatment, a total of 330 patients (54.1%) had 701 adverse events, with similar frequencies across the patients treated with 5 mg or 10 mg tofacitinib. The most common of these adverse events were upper respiratory tract infection, headache, and diarrhea. Twelve patients (2.0%) discontinued the study drug during this period of treatment owing to serious adverse events, with similar frequencies across the two tofacitinib-treated patient groups (Fleischmann et al., 2012a). More serious immunologic and hematological adverse effects have also been noted resulting in lymphopenia, neutropenia, anemia, and increased risk of cancer and infection (https: //pubchem.ncbi .nlm.nih.gov) .

Preferred tolerance-promoting immune modulators for encapsulation or incorporation into PS- liposomes include but are not limited to those a) which can be encapsulated in the aqueous compartment of liposomes such as the hydrophilic glucocorticoid derivative dexamethasone phosphate and the hydrophilic tofacitinib citrate, and b) which can be incorporated into the lipid layer of liposomes such as the lipophilic vitamin D3 derivative calcipotriol. Calcipotriol (or calcipotriene) is a synthetic derivative of calcitriol, which has similar VDR binding properties as compared to calcitriol, but has low affinity for the vitamin D binding protein (DBP) (for a review, see Tremezaygues and Reichrath; 2011) . In vivo studies in rats showed that effects of calcipotriol on calcium metabolism are 100-200 times lower as compared to calcitriol while the tolerance-promoting effects of calcipotriol are comparable to those of calcitriol (e.g., Al-Jaderi et al., 2013). The half-life of calcipotriol in circulation is measured in minutes ( ragballe, 1995) . The rate of clearance (serum half-life of 4 min in rats) is approximately 140 times higher for calcipotriol than for calcitriol. Furthermore, calcipotriol is rapidly metabolized and effects of the metabolites have been demonstrated to be 100 times weaker than those of the parent compound ( issmeyer and Binderup, 1991) .

XI. Fields of application and disease-specific compositions

In one embodiment, the present invention discloses fields of applications for which disease-specific compositions according to the method of the present invention are beneficial. Fields of applications include but are not limited to allergic and autoimmune diseases. Allergic diseases include but are not limited to allergic conjunctivitis, allergic rhinitis, allergic asthma and food allergy. Autoimmune diseases include but are not limited to type I diabetes, rheumatoid arthritis, multiple sclerosis, and autoimmune uveitis. For such diseases, the present invention discloses methods for restoring lasting immunological tolerance by allergen- or autoantigen-specific immunotherapy with hydrogel compositions comprising a hydrogel (selected from those listed in section II) and varying combinations hydrogel-embedded components including allergens or autoantigens or peptides derived thereof, CpG-ODN or GpC-ODN or GpG-ODN (selected from those listed in sections VII and VIII) , PS-liposomes (selected from those listed in sections III-V) , one or more find-me molecules (selected from those listed in section IX, and one or more tolerance-promoting immune modulators (selected from those listed in section X) .

XI.1. Allergen-specific immunotherapy of allergic diseases

The method of the present invention provides several concepts for significant improvement of the efficacy of subcutaneous allergen-specific immunotherapy of allergic diseases. All concepts aim for immune intervention by targeting the molecular mechanisms of allergen tolerance and reciprocal regulation of effector T cells via regulatory T cells induced by allergen-specific tolerogenic antigen-presenting cells.

All of the tolerance-inducing strategies using CpG- , GpC- or GpG-ODN as listed in section I are applicable for the treatment of allergic diseases according to the method of the present invention. Preferred are PLGA-PEG-PLGA hydrogel-based methods . Suitable oligodeoxynucleotides (ODN) for the treatment of allergic diseases include but are not limited to those listed in sections VII and VIII. Preferred are CpG-ODN listed in section VII. For encapsulation in PS-liposomes, fully nuclease-susceptible ODN containing one or more CpG motifs are preferred since in PS- liposomes they are protected against rapid degradation by nucleases. Furthermore, for PS-liposome- based approaches cellular uptake enhancing poly G tails are not required.

Suitable tolerance-promoting immune modulators for the treatment of allergic diseases include but are not limited to those listed in section X. Preferred are vitamin D3 derivatives, glucocorticoids, and Janus kinase inhibitors. More preferred are vitamin D3 derivative calcipotriol as PS- liposome- incorporated immune modulator, dexamethasone phosphate and tofacitinic citrate as hydrogel-embedded immune modulators. Compositions comprising calcipotriol and dexamethasone phosphate are preferred since both immune modulators generate tolerogenic DCs via distinct and additive signaling pathways and, therefore, are most effective in combination. Suitable find-me molecules for the treatment of allergic diseases include but are not limited to those listed in section IX. Preferred find-me signals are selected from ATP, UTP, ADP or UDP. In a preferred embodiment, ATP and UTP are employed as find-me signals. In a most preferred embodiment, equi-nanomolar quantities of ATP and UTP are employed as find- me signals .

Suitable PS-liposomes for the treatment of allergic diseases include but are not limited to those listed in section V. Preferred are conventional PS-liposomes. Most preferred are conventional cholesterol (CH) - and phosphatidylcholine (PC) - containing PS- liposomes comprising molar ratios of PS:PC:CH of 30:30:40 (section V) . Suitable allergens for the treatment of allergic diseases include natural or recombinant allergens or fragments including short T cell peptides derived thereof which are present in a) plant pollen derived from grass (ryegrass, timothy-grass) , weeds (ragweed, plantago, nettle, Artemisia vulgaris, Chenopodium album, sorrel) , and trees (birch, alder, hazel, hornbeam, Aesculus, willow, poplar, Platanus, Tilia, Olea, Ashe juniper, Alstonia scholaris) , b) in animal products derived from dust mite excretion (feces and chitin) , fur, dander, cockroach calyx, and wool, c) in food derived from legumes (peanuts, beans, peas, and soybeans) , tree nuts (pecans, and almonds), fruit (e.g., pumpkin, egg-plant), eggs (typically albumin, the white), milk, fish (e.g., shellfish), wheat and their derivatives, sesame seeds, mustard, celery, celeriac, and corn or maize, d) in insect venoms derived from wasps, honey bees, mosquitos, and fire ants, e) in airborne fungal allergens (e.g., the basidospore family which produces the dominant airborne fungal allergens and includes mushrooms, rusts, smuts, brackets, and puffballs) , and f) in latex. Furthermore, suitable allergens for the treatment of allergy according to the method of the present invention include also those derived from drugs (e.g., penicillin, sulfonamides, salicylates, neomycin), metal, wood, Balsam of Peru, and fragrance mix. XI.2. Autoantigen- specific immunotherapy of autoimmune

diseases

The method of the present invention provides several concepts for significant improvement of the efficacy of subcutaneous autoantigen-specific immunotherapy of autoimmune diseases. All concepts aim for immune intervention by targeting the molecular mechanisms of autoantigen tolerance and reciprocal regulation of effector T cells via regulatory T cells induced by autoantigen-specific tolerogenic antigen-presenting cells. All of the tolerance- inducing strategies using CpG- , GpC- or GpG-ODN as listed in section I are applicable for the treatment of autoimmune diseases according to the method of the present invention. Preferred are PLGA-PEG-PLGA hydrogel- based methods .

Suitable oligodeoxynucleotides (ODN) for the treatment of autoimmune diseases include but are not limited to those listed in sections VII and VIII . Preferred are CpG-ODN listed in section VII. For encapsulation in PS- liposomes, fully nuclease-susceptible ODN containing one or more CpG motifs are preferred since in PS- liposomes they are protected against rapid degradation by nucleases. Furthermore, for PS-liposome- based approaches cellular uptake enhancing poly G tails are not required.

Suitable tolerance-promoting immune modulators for the treatment of autoimmune diseases include but are not limited to those listed in section X. Preferred are vitamin D3 derivatives, glucocorticoids, Janus kinase inhibitors, and antisense oligonucleotides capable of gene silencing of different pro-inflammatory molecules including CD40, CD80, and CD86 (see patent applications EP16001276 and EP3095440) . Most preferred are vitamin D3 derivative calcipotriol as PS- liposome- incorporated immune modulator, dexamethasone phosphate and tofacitinib citrate as hydrogel-embedded immune modulators. Compositions comprising calcipotriol and dexamethasone phosphate are preferred since both immune modulators generate tolerogenic DCs via distinct and additive signaling pathways and, therefore, are most effective in combination. Suitable find-rae molecules for the treatment of autoimmune diseases include but are not limited to those listed in section IX. Preferred find-me signals are selected from ATP, UTP, ADP or UDP. In a preferred embodiment, ATP and UTP are employed as find-me signals. In a most preferred embodiment, equi-nanomolar quantities of ATP and UTP are employed as find- me signals. Suitable PS-liposomes for the treatment of autoimmune diseases include but are not limited to those listed in section V. Preferred are conventional PS-liposomes. Most preferred are conventional cholesterol (CH) - and phosphatidylcholine (PC) - containing PS-liposomes comprising molar ratios of PS:PC:CH of 30:30:40 (section V).

Suitable autoantigens or fragments thereof for the treatment of rheumatoid arthritis (RA) include type II bovine or chicken collagen, HCgp39, lyophilised Escherichia coli extract, the 15-mer synthetic peptide dnaJpl (QKRAAYDQYGAAFE) derived from HSP dnaJ, citrullinated (cit) proteins including but not limited to cit-vimentin, cit- fibrinogen, and cit-collagen type II as well as peptides derived of Cit-proteins (for a review, see Thomas, 2013) , and members of the heat shock protein family (HSP10, HSP60 , HSP70, HSP90, BIP,APL-1 and APL-2) or peptides derived thereof (for a review, see Spierings and van Eden, 2017) . In a preferred embodiment, HSP70-derived peptide B29 (VLRIVNEPTAAALAY) , an efficient inducer of Tregs (Van Herwijnen et al . , 2012), is used for autoantigen-specific immunotherapy of RA.

Suitable autoantigens or fragments thereof for the treatment of type 1 diabetes (T1D) include proteins which have been identified by islet autoantibodies. The main autoantibodies include a) insulin autoantibodies, b) autoantibodies against the 65-kDa isoform of glutamic acid decarboxylase (GAD) , c) autoantibodies against the phosphatase-related IA-2 molecule (islet antigen 2; tyrosine phosphatase), and s) autoantibodies against the zinc transporter autoantibodies (ZnT8) which is localized on the membrane of insulin secretory granules (for a review, see Lenmark and Larsson, 2013) . Dependent on the presence of autoantibodies, preferred autoantigens or fragments thereof include insulin, proinsulin, GAD65, IA-2, ZnT8, HSP60-derived peptide DiaPep277, and other HSP60-derived peptides .

Suitable autoantigens or fragments thereof for the treatment of multiple sclerosis (MS) include myelin basic protein (MBP) , myelin oligodendrocyte protein (MOG) , proteolipid protein (PLP) , and various peptides derived of these myelin proteins including MBP13-32 , MBP₈3-99 , MBP₈s - 99 , MBPin-129 , MBPi₄6-i7o, MOG1-20 , MOG35-55, and PLP139-154. Based on successful clinical trials (Walczak et al . , 2013), the myelin peptides MBP13-32 , MBP83-99 , MBPiii-129, MBPi46-₁₇o , MOGi-20 , MOG35-55, PLP139-151, and PLP139-154 are preferred for autoantigen-specific immunotherapy of MS.

Suitable autoantigens or fragments thereof for the treatment of autoimmune uveitis (AU) include S-antigen, interphoto- receptor retinoid binding protein, cellular retinaldehyde binding protein, arrestin, and peptides derived of these autoantigens such as arrestin peptide 291-310.

XII . Pharmaceutical formulations

In one embodiment, the therapeutic compositions of the present invention are incorporated into pharmaceutical compositions suitable for administration. Such compositions typically comprise the therapeutic compositions of the present invention and pharmaceutically acceptable solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic systems, and the like, compatible with the components of the therapeutic compositions of the present invention. The use of such media and agents for pharmaceutically active substances is well known in the art. Solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents, antioxidants such as ascorbic acid or sodium bisulfite, chelating agents such as ethylenediamine-tetraacetic acid, buffers such as acetates, citrates or phosphates and agents for the adjustment of toxicity such as sodium chloride or dextrose. The pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, sodium chloride in the composition. The composition should be fluid to the extent that easy syringability exists. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case dispersion and by use of surfactants. The composition must be preserved against the contaminating action of microorganisms such as bacteria and fungi . Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents such as parabens, chlorobutanol , phenol, ascorbic acid, thimoseral, and the like. In all cases, the composition must be sterile. Sterile injectable solutions can be prepared by filtered sterilization. The preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.

XIII. THERAPEUTICALLY EFFECTIVE DOSES

In one embodiment, the present invention discloses therapeutic methods including suitable therapeutically effective doses of PS-liposomes selected from those listed in section V, liposomal or non- liposomal CpG-ODN selected from those listed in section VII, tolerance-promoting immune modulators selected from those listed in section IX, find-me signals for attraction of peripheral antigen-presenting cells to the injection site of therapeutic compositions selected from those listed in section X, and allergens or autoantigens or peptides derived thereof selected from those listed in section XI. Determination of a therapeutically effective dose is well within the capability of those skilled in the art. The therapeutically effective dose can be estimated initially in animal models, usually mice, rats, rabbits, dogs, pigs, or non-human primates . The animal model also can be used to determine the appropriate concentration range and route of administration. Such information can then be used to determine useful doses and routes for administration in humans.

Dosage regimens may be adjusted to provide the optimum therapeutic response. The quantity of the matrix-embedded components depends on the release kinetics of the depot- providing matrices and is adjusted to a level that guarantees the continuous release of therapeutically effective doses over a period of at least 2 to 5 days. The quantity of embedded components will vary according to factors such as the weight and the age of the individual, and the ability of the composition to induce an effective immune response in the individual .

The following data of this section provide useful guidelines for the determination of a therapeutically effective dose for those skilled in the art. XIII.1. Therapeutically effective doses of PS-liposoxnes

PS-liposomes have been studied in a variety of animal models in the recent past. Results obtained from these studies provide useful information for the application of PS-liposomes in humans. For example, using BALB mice (body weight approx. 20 g) , the effect of subcutaneously (s.c.) administered PS- liposomes on immune responses upon subsequent injection of ovalbumin (OVA) or keyhole limpet hemocyanine (KLH) in complete Freund's adjuvant (CFA) has been investigated (Hoffman et al . , 2005) . In this study, PS-containing liposomes comprising a 30:30:40 molar ratio of PS to PC to cholesterol, were first injected s.c. in one flank of 6-8 weeks old BALB mice (100 μΐ, corresponding to 0.5 mg of total lipid), followed after one hour by another s.c. injection of 150 μΐ of an emulsion containing 50 μg of OVA or 150 ^g of KLH in CFA in the same region. As evident from the data, subcutaneously administered PS-liposomes specifically inhibited responses to antigens. Numbers of total leukocytes and antigen- specific CD4+ T cells were reduced as well as the level of antigen- specific IgG in blood. There was also a decrease of draining lymph node tissue mass and the size of germinal centers in spleen and lymph nodes (Hoffman et al . , 2005) .

Using a rat model of acute myocardial infarction (MI) in another study, the effects of intraveneously (i.v.) administered PS-liposomes on cardiac macrophages has been investigated (Harel-Adar et al . , 2011). In this study, 150 μΐ of a 0.06 M solution of PS-liposomes comprising a 30:30:40 (1:1:1.33) molar ratio of PS to PC to cholesterol (9 μπιοΐ lipid or approx. 5.4 mg lipid; compare Example 1.1), were injected i.v. through the femoral vein of female Sprague- Dawley rats (body weight approx. 150 g) 48 hours after MI induction. As evident from the data, i.v. administered PS- containing liposomes promoted angiogenesis , preservation of small scars, and prevented ventricular dilatation and remodeling. Following uptake of PS-liposomes by macrophages, the cells secreted high levels of the anti- inflammatory cytokines TGF-β and IL-10 and upregulated the expression of the mannose receptor CD206, concomitant with downregulation of proinflammatory markers such as TNF- and the surface marker CD86 (Harel-Adar et al . , 2011).

XIII.2. Therapeutically effective doses of CpG-ODN

CpG-ODN have been studied in various experimental models and clinical trials.

Toxicity of CpG-ODN in mice. Using CpG-ODN 1018 (5'- TGACTGTGAACGTTCGAGATGA) , Campbe11 et al. (2009) have demonstrated that doses up to 2.5 mg/kg (50 μg/20-g mouse) of this B-class CpG-ODN are applicable in mice (associated with little weight loss in the range of 5%) , whereas a dose of 5 ^mSj/kg (100 ^g/20-g mouse) of CpG-ODN 1018 resulted in marked pulmonary inflammation in lung tissue sections from C57BL/6 mice harvested 4 days after treatment . The toxicity of CpG-ODN in mice is TLR9-dependent and mediated by TNF-a. Based on the differential TLR9 expression patterns in rodents (in monocyte/macrophage lineage cells as well as in plasmacytoid DCs (pDCs) and B cells) versus humans (B cells are the principal TLR9-expressing cells) CpG-ODN elicit TNF-a- dependent toxicity in rodents but not in humans (Campbell et al . , 2009) .

Tolerance-promoting amount of CpG-ODN 1826. Allergic broncho- pulmonary aspergillosis is a Th2-sustained allergic condition. In the study of Volpi et al . (2013), the effects of CpG-ODN 1826 (5' -TCCATGACGTTCCTGACGTT-3 ' , phosphorothioate-stabilized B-class CpG-ODN) on the hypersensitivity response to Aspergillus antigens in the mouse lung was evaluated. The animals were treated intraperitoneally with 30 μg CpG-ODN 1826 (approx. 5 nmol; MW approx. 6059) per mouse twice, on the same days as the first and second administration of A. fumigatus culture filtrate extract. The Th2 -dependent allergic phenotype was greatly attenuated by CpG, which enhanced the production of IL-10, a marker of protective Treg activity in Aspergillus allergy.

In the study of Wingender et al . (2006) C57BL/6 mice were immunized by i.v. or s.c. (intra ear pinna) injection of 100 μg OVA alone or in combination with 50 μg phosphorothioate- stabilized 20-mer CpG-ODN 1668 ( 5' -tccatgacgttcctgatgct-3' ) corresponding to 7.86 nmol (MW 6364) . Only the systemic application of CpG-ODN resulted in IDO-mediated suppression of T cell expansion and CTL activity in the spleen. Based on these data, induction of IDO in cells of draining lymph nodes via s.c. injection of CpG-ODN requires larger amounts of CpG- ODN than IDO induction in spleen cells via i.v. injection. However, even in spleen cells IDO induction requires i.v. injection of large amounts of CpG-ODN 1668. Smaller doses of i.v. administered CpG-ODN 1668 (0.5 μg and 5 μg) induced innate immunity as indicated by the finding that these doses drastically reduced the load of adenovirus in the host after i.v. infection with adenovirus expressing OVA. Tolerance-promoting amount of liposomal CpG-ODN 1826. In the study of Konur et al . (2008), weekly intradermal injection for two weeks of SUV composed of cholesterol (chol) , dilauroyl- phosphatidyl-ethanolamine (DLPE) and dioleoylphosphatidyl- serine (DOPS) (ratio of 1:1:1) containing both 300 μg TRP2 peptide and 5 nmol CpG-ODN 1826 (approx. 30 μg) , into the flanks of BL6 mice suppressed antigen-specific T cell responses and diminished lymphocyte numbers (see Fig.2B), whereas intradermal injection of 300 g TRP2 peptide and 5 nmol CpG-ODN 1826 (approx. 30 μg) as aqueous solution under identical conditions increased antigen-specific T cell responses significantly.

Several factors may have contributed to the immunosuppressive effects of the liposomal approach, first of all the high liposomal peptide amount, but also the increased concentration of tolerance-promoting phosphatidylserine (PS) -presenting liposomes and the amount of liposomal CpG-ODN 1826 which was sufficient to attenuate the allergic phenotype in the study of Volpi et al. (2013), and last not least the targeted delivery of the liposomes to antigen-presenting cells via presentation of PS. However, in order to generate tolerogenic effects with liposomal CpG-ODN in the presence of lower peptide quantities, the liposomal CpG-ODN content most likely needs to be increased.

Hydrogel-embedded PS-liposomes containing CpG-ODN. Taking the slow release of PS-liposomes from PLGA-PEG-PLGA hydrogels into consideration, administration of PLGA-PEG-PLGA hydrogel- embedded PS-liposomes containing up to 150 g of CpG-ODN/20 g mouse (corresponds to 7.5 mg/kg) appears to be a tolerable dose. This would lead to the release of approx. 15 g liposomal CpG-ODN within the first 12 hours (10% release) , approx. 25 g liposomal CpG-ODN within 24 hours (17% release) , and approx. 50 μg liposomal CpG-ODN within 48 hours (35% release) . Intracellular accumulation of phagocytosed CpG-ODN is prevented by using nuclease-susceptible CpG-ODN with a regular phosphodiester backbone. XIII.3. Therapeutically effective doses of calcipotriol

Calcipotriol has been used clinically for more than 10 years for topical treatment of psoriasis without systemic toxicity (for a review, see Plum and DeLuca, 2010) . Uptake of calcipotriol . Clinical studies with radiolabeled ointment indicate that approximately 6% of the applied dose of calcipotriene is absorbed systemically when the ointment is applied topically to psoriasis plaques or 5% when applied to normal skin.

In another study, it was found that calcipotriol permeated through all skins to only a limited extent over 2Oh after application but was efficiently retained in all skins at a level at 20h of between 40% (pig) and 60% (rat and mouse) of the applied dose (Li et al . , 2013) .

Toxicity studies. Single dose toxicicity studies of calcipotriol administered to rats by subcutaneous injection revealed LD50 values of 2.19 mg/kg in males (approx. 440 ^g/200-g male rat) and 2.51 mg/kg in females (approx. 380 ig/l50-g female rat) (Imaizumi et al . , 1996). Rats died probably due to the circulatory and renal disturbance. According to this study, no death occurred up to a single s.c. dose of 540 g/kg body weight (approx. 81 /xg/150-g female rat) , and no loss of body weight could be observed two weeks after administration.

Additional toxicity studies have been performed with calcitriol, the dose- limiting hypercalcemic effects of which are 100- to 200-fold more pronounced than those of calcipotriol . Mice can become hypercalcemic on day 2 or day 3 at calcitriol doses higher than 750 ng/mouse when administered as a single bolus i.p. (Muindi et al., 2004) . According to this study, however, calcitriol can be administered as a single bolus i.p. injection up to 500 ng/mouse (in 0.2 ml of normal saline) . Unlike daily calcitriol treatments, single calcitriol doses pose a lower hypocalcemia risk and, therefore, allow administration of higher doses. In other animal studies, mice were treated by a single i.p. injection of 0.1 ml propylene glycol containing 300 ng calcitriol (Cantorna et al., 1998a), or by a single i.p. injection of 0.1 ml scafflower oil containing up to 400 ng calcitriol (Nashold et al. , 2013) . Animal studies . In animal studies, vitamin D molecules and analogs thereof have been used for the treatment of OVA- induced allergy in mice (Ghoreishi et al . , 2009), OVA- induced allergic asthma in mice (Taher et al . , 2008), insulin- dependent diabetes mellitus in NOD mice (Zella et al . , 2003), Lyme arthritis and collagen- induced arthritis in mice (Cantorna et al . , 1998b), and experimental autoimmune encephalomyelitis (EAE) in mice (Branisteanu et al . , 1995).

In the allergy model, mice were treated on their shaved dorsal skin with 30 mg/day of calcipotriol ointment (contains 50 pg calcipotriol/g; 1.5 yg calcipotriol/30 mg) (Donovex, Leo Pharma) for three days followed by transcutaneous immunization with OVA in the presence of CpG adjuvant. This treatment abolished antigen-specific CD8+ T cell priming and induced CD4+CD5+ Tregs, thereby promoting antigen-specific tolerance (Ghoreishi et al . , 2009).

Additional animal studies have been performed with calcitriol. In a nurine model of allergic asthma, OVA-sensitized mice were subjected to allergen-specific immunotherapy by three s.c. injections of 100 μq OVA in the presence of 10 ng calcitriol (corresponding to approx. 1-2 μg calcipotriol) . This treatment significantly inhibited airway hyper- responsiveness and caused a significant reduction of serum OVA-specific IgE levels (Taher et al . , 2008).

In a murine model of type 1 diabetes, a diet containing 50 ng calcitriol/mouse/day (corresponding to approx. 5-10 μg calcipotriol/mouse/day) was administered three times/week. This treatment prevented diabetes onset in NOD mice as of 200 days (Zella et al. , 2003) .

In a murine arthritis model, mice received a daily diet supplemented with 20 ng calcitriol/mouse/day (corresponding to approx. 2-4 g calcipotriol/mouse/day) . This dose was found to be effective in inhibiting the progression of arthritis without producing hypercalcemia (Cantorna et al . , 1998b).

In a murine EAE model, i.p. injection of 5 pg of calcitriol/kg body weight (200 ng calcitriol/20g mouse; corresponding to approx. 20-40 μg calcipotriol/2Og mouse) every 2 days prevented the appearance of paralysis in 70% of the treated mice (Branisteanu et al . , 1995) Liposomal calcipotriol. Calcipotriol is lipophilic and is incorporated into the lipid bilayer of liposomes. Using liposomes made of DMPPC or egg-PC and a molar ratio of calcipotriol (MW 412.6) to lipid of 0.03 to 1, incorporation rates of more than 80% have been reported (Merz and Sternberg, 1994) .

Tolerance- inducing dose of hydrogel-embedded PS-liposomes containing calcipotriol. As demonstrated in the study of Ghoreshi et al . (2009), topical treatment of mice with 1.5 pg calcipotriol for three days abolished antigen-specific CD8+ T cell priming and induced CD4+CD5+ Tregs, thereby promoting antigen-specific tolerance. Based on the study of Li et al. (2013) , calcipotriol permeates through murine skins to only a limited extent over 20h after application, but is efficiently retained in murine skins at a level of 60% of the applied dose after 2Oh. Thus, transdermal uptake of less than 3 yg calcipotriol (1 \ig over 3 days) into the skin mediated the induction of tolerance in mice . Based on the study of Ghoreshi et al. (2009), subcutaneous administration of hydrogel-embedded 20 μg liposomal calcipotriol/mouse will deliver a sufficiently tolerizing quantity of liposomal calcipotriol to APC via PS-liposomes . Release studies with hydrogel-embedded PS-liposomes have demonstrated that 20 μg liposomal calcipotriol embedded in PLGA-PEG-PLGA hydrogels leads to the release of approx. 2.0 μg liposomal calcipotriol within the first 12 hours (10% release), approx. 3.4 ^g liposomal calcipotriol within 24 hours (17% release), and approx. 7.0 μg liposomal calcipotriol within 48 hours (35% release) . These amounts are equivalent to the tolerizing quantity of calcipotriol in the study of Ghoreshi et al . (2009).

On the other hand, administration of hydrogel-embedded 20 μg liposomal calcipotriol/mouse represents a tolerable dose. Calcitriol can be administered as a single bolus i.p. injection up to 500 ng/mouse (Muindi et al . , 2004). Assuming only a 100-times lower effect of calcipotriol on calcium metabolism as compared to calcitriol, 500 ng calcitriol corresponds to 50 μg calcipotriol.

XIII.4. Therapeutically effective doses of glucocorticoids

Most preferred glucocorticoids for the method of the present invention are those which exhibit a high anti-inflammatory potency which is proportional to their glucocorticoid potency established for their capacity to elevate glycemia. Glucocorticoids with a high anti- inflammatory potency include but not limited to dexamethasone and betamethasone (for a review, see Longui, 2007) . However, glucocorticoids with a moderate anti-inflammatory potency such as prednisone, prednisolone, methylprednisolone, and triamcinolone, as well as those with a lower anti-inflammatory potency such as cortisone and hydrocortisone are also applicable for the method of the present invention.

A dexamethasone dose of 0.25 mg/m²/day corresponds to 2.5 mg/m²/day of prednisolone and hydrocortisone 10 mg/m²/day (for a review, see Gupta and Bhatia, 2008) . All of these glucocorticoids have been studied in a variety of animal models and evaluated in clinical trials. For example, in mice dexamethasone has been administered by i.p. injection at doses of 10-40 g/20-g mouse (0.5-2.0 mg/kg) for 7 days, leading to a 30% decrease in the number of intestinal VDRs (Hirst and Feldman, 1982a) . In rats, dexamethasone has been administered at doses of 0.15-7.5 mg/150-g female rat (1.0- 50.0 mg/kg) for 7 days (Hirst and Feldman, 1982b).

In clinical trials, different glucocorticoids and varying combinations thereof have been evaluated. For example, several randomized controlled trials comparing dexamethasone with prednisolone in the treatment of acute asthma exacerbations in children have been published. One study compared emergency department (ED) treatment with an initial dose of oral prednisolone 2 mg/kg (max. 60 mg) followed by 1 mg/kg daily for four days with oral dexamethasone 0.6 mg/kg (max. 16 mg) daily for two days (Qureshi et al . , 2001).

Another study compared ED treatment with an initial dose of oral prednisolone 1 mg/kg (max. 30 mg) followed by 1 mg/kg twice daily for five days with a single dose of oral dexamethasone 0.6 mg/kg (max. 18 mg) (Altamimi et al., 2006).

Still another study compared ED treatment with a single dose of prednisolone 2 mg/kg (max. 80 mg) followed by 1 mg/kg (max. 30 mg) twice daily for five days with a single dose of 0.6 mg/kg oral dexamethasone (max. 16 mg) followed by one dose of

0.6 mg/kg oral dexamethasone to take the next day (Greenberg et al . , 2008) .

Liposomal dexamethasone phosphate (DexP) . In the study of Hegeman et al . (2011), liposomal DexP has been administered

1.v. at a concentration of 11.2 μg DexP/20-g mouse (adult male C57BL/6 mice with a body weight of 20-24g) . The DexP to lipid ratio was 28 μg DexP/μιηοΙ lipid (comprising PC, cholesterol and PE at a molar ration of 55:40:5) .

In another study (Anderson et al . , 2010), liposomal DexP has been administered i.v. at a concentration of 1 mg DexP/kg body weight for 3 days, corresponding to three injections of 20 g DexP/20-g mouse. The DexP to lipid ratio was 40 μg DexP/μιηοΙ lipid (comprising DPPC, DPPG and cholesterol at a molar ration Of 50 : 10 :40) . A more than three-fold higher amount of liposomal DexP (3.75 mg liposomal DexP/kg body weight, corresponding to 75 μg/20-g mouse or 563 μg/150-g female rat) has been administerd i.v to rats 6, 24 and 48 hours after induction of antigen- induced arthritis (US20060147511A1) .

XIII.5. Therapeutically effective doses of tofacitinib

Tofacitinib has been approved by FDA to treat adults with moderately to severely active rheumatoid arthritis (RA) who have had an inadequate response to, or who are intolerant of, methotrexate . Using the method of the present invention, the application of tofacitinib as tolerance-promoting immune modulator is restricted to a few days until its release from injected hydrogels is completed. Therefore, short-term clinical studies with tofacitinib provide valuable information about therapeutically effective doses of tofacitinib.

Phase II study of Kremer et al. (2009) over 6 weeks. Patients (n = 264) were randomized equally to receive placebo, 5 mg, 15 mg or 30 mg of tofacitinib twice daily for 6 weeks, and were followed up for an additional 6 weeks after treatment. By week 6, the American College of Rheumatology 20% improvement criteria (ACR20) response rates were 70.5%, 81.2% and 76.8% in the 5 mg, 15 mg and 30 mg twice-daily groups, respectively, compared with 29.2% in the placebo group. However, the infection rate in both the 15 mg and the 30 mg twice daily groups was 30.4% (versus 26.2% in the placebo group) . Phase II study of Fleischmann et al . (2012b) over 24 weeks . In this 24 -week, double-blind, phase lib study, patients with RA (n = 384) were randomized to receive placebo, tofacitinib at 1, 3, 5, 10 or 15 mg administered orally twice a day. Treatment with tofacitinib at a dose of ≥3 mg twice a day resulted in a rapid response with significant efficacy compared with placebo, as indicated by the primary end point (ACR20 response at week 12) , achieved in 39.2% (3 mg) , 59.2% (5 mg) , 70.5% (10 mg) and 71.9% (15 mg) in the tofacitinib group compared with 22.0% of patients receiving placebo.

Preferred concentration of tofacitinib at the site of allergen or autoantigen presentation. On oral administration of tofacitinib 5 or 10 mg twice a day, serum levels of approximately 100-300 nM are achieved, and such therapeutic levels are known to last for 4-6 h (Kubo et al . , 2014) . Based on the different inhibitory potency of tofacitinib for the four members of the Janus kinase family in enzyme assays (Flanagan et al., 2010; Meyer et al., 2010), lower concentrations of tofacitinib inhibit signalling via JAK1 and JAK3 (IL-2, IL-4, IL-7, IL-9, IL-15, IL-21, and IFN- γ ) , whereas higher concentrations of tofacitinib inhibit also signalling via JAK1 and TYK2 (IL-10, IL-12, IL-20, IL-22, IL- 23 and IF s) , and via JAKl, JAK2 and TYK2 (IL-6, IL-11, IL-27 and G-CSF) .

For the induction of tolerance according to the method of the present invention it is important, to inhibit JAK1/JAK3- mediated signalling, but to avoid inhibition of JAK1/TYK2- mediated signalling since IL-10 is essential for the induction of tolerance .

Since partial inhibition of JAKl/TYK2 -mediated signaling is likely to occur at a concentration of 100-300 nM, for the method of the present invention a therapeutic serum level of tofacitinib of 50-100 nM is preferred.

XIII.6. Therapeutically effective doses of allergens or peptides derived thereof

A number of experimental and clinical evidence has shown that exposure to high amounts of allergen molecules favors the development of tolerance. However, a major limitation is the associated risk of systemic side-effects. The injection of allergens into an IgE- sensitized individual always implies a risk, however small, of inducing anaphylactic side-effects.

Allergen- specific immunotherapy typically involves administration of escalating doses of allergen in the early phase of treatment, before a high maintenance dose is reached, resulting in allergic desensitization. It is widely accepted that use of dose escalation strategies minimizes the risk of adverse effects associated with allergen-specific immunotherapy, which may range from mild symptoms to anaphylaxis .

Allergens . The effective doses, measured as μg of major allergens, to be administered during maintenance treatment were established for the main allergens (Incorvaia et al . , 2006) . Regarding pollens, the range of effectiveness corresponds to 25-41 and 13-20 μg of major allergens Phi p 5 and Phi p 6 for grasses, to 10-47 μg of Amb a 1 for ragweed, to 12 μg of Bet v 1 for birch, and to 6.2 μg of Par j 1 for Parietaria. With house dust mites, a maintenance dose of 5- 11.5 μg of the major allergen from Dermatophagoides pteronyssinus Der p 1 is associated to clinically relevant effects, and with cat epithelium the clinical success is observed using a dose of 13-15 μg of Fel d 1. The efficacy of venom immunotherapy has been analysed in several studies which employed a usual maintenance dose of 100 μg of venom (Bonifazi et al . , 2005) .

Allergen-derived peptides. T cell reactive sites have been mapped for many allergens and are catalogued in The Immune Epitope Database (www.iedb.org). A meta-analysis of this database confirmed 1406 allergen-derived CD4+ T cell epitopes based on human T cell reactivity (for a review, see Prickett et al. , 2015) .

In one study with cat-allergic subjects, subcutaneously administered Fel d 1 peptides comprised an equimolar mixture of two long 27 amino acid sequences from the two chains of Fel d 1 and contained multiple T cell epitopes. After four subcutaneous injections of the peptide mixture (750 μg/ml of each peptide) , clinical benefit was demonstrable at 6 weeks but adverse events included nasal congestion, flushing, pruritus and chest tightness for minutes to hours after peptide delivery. The possibility of retained conformational structure within the long peptides and IgE-mediated reactivity likely explained the early adverse events (Norman et al. , 1996) .

In a subsequent clinical trial with allergen-derived T cell peptides, shorter peptides from allergenic proteins were used immunotherapy for bee venom allergy since they are unable to cross-link IgE and possess minimal inflammatory potential. In this study, bee venom-allergic patients were treated by subcutaneous injection with three T cell epitope peptides of the major bee venom allergen phospholipase A2 (PLA2) , each of 11-18 amino acid residues. The treatment included injection, in successive doses, of 0.1 μg of an equimolar mixture consisting of the three peptides, followed by 1 μg, 3 μg, 6 μg, 12 μg, 25 μg, 50 μg, and then three times 100 μg in weekly intervals, resulting in a cumulative dose of 397.1 μg of the peptide mixture. Consistent with linked suppression, clinical efficacy was achieved to a subsequent PLA2 challenge and live whole bee sting challenge. However, some subjects developed peptide-specific IgE and two subjects developed local erythema with occasional palmar pruritus (Miiller et al . , 1998). These findings emphasize the importance of using the shortest possible peptides comprising T cell epitopes to minimize the risk of IgE-mediated adverse events.

Another important consideration is the quantity of subcutaneously or intradermally administered T cell peptides. Since administration of T cell peptides at a concentration of 750 μg caused several adverse events, including late asthma responses due to a flare of released cytokines from peptide- stimulated T cells, the quantity of T cell peptides was tenfold reduced to approx. 75 μg (for a review, see Prickett et al., 2015). Early-phase studies with short T cell peptides, typically 13-17 amino acids in length, administered at this concentration via the intradermal route into non- inflamed skin demonstrated safety and clinical efficacy (Worm et al . , 2013) .

5 The shortness of the peptides avoids any potential for IgE cross- linking or inflammatory cell activation and careful dose adjustment seems to avoid the late asthma response observed earlier with higher concentrations of peptides.

L0 PS- liposomes loaded with allergen-derived peptides . Methods for encapsulation of peptides in liposomes are known to the person skilled in the art. Various formulations of liposomes containing encapsulated peptides have been prepared (for a review, see Mohan et al . , 2015) and studied in a variety of

L5 animal models (e.g., onur et al . , 2008; Belogurov et al . , 2013) .

Encapsulation efficiencies of peptides into liposomes depend on the hydrophilicity or hydrophobicity of the peptides, the

20 lipid composition and the molar ratio of lipid to peptide. In one study, a peptide derived from the tyrosinase-related protein 2 (TRP2 : SVYDFFVWL) was encapsulated in liposomes at a lipid-to-TRP2 molar ratio of 20:1. Using a lipid mixture composed of cholesterol, dilauroylphosphatidyl-ethanolamine

25 and dioleylphosphatidyl-serine at a molar ratio of 1:1:1, the encapsulation efficiency of TRP2 ranged between 20-50% (Konur et al . , 2008). In another study, three peptides derived from the myelin basic protein (MBP 46-62, MBP 124-139; MBP 147-170) were encapsulated in mannosylated liposomes (prepared from egg

30 phosphatidyl-choline and 1% monomannosyl dioleyl glycerol) at a lipid-to-peptide weight ratio of 330:1. Using this high lipid-to-peptide ratio, the resulting small unilamellar liposomes entrapped more than 90% of the initial peptide amount (Belogurov et al . , 2013) . Same considerations apply to 5 allergen-derived T cell peptides. Therapeutic concentrations of liposome-encapsulated allergen- derived peptides are based on the data of clinical trials with short allergen-derived T cell peptides (for a review, see Prickett et al . , 2015). Various injection protocols are suitable for the method of the present invention. In a preferred embodiment, the treatment is performed in monthly- intervals by subcutaneous injections of successive doses of hydrogel-embedded PS- liposomes containing short allergen- derived T cell peptides. Taking the slow release of PS- liposomes from subcutaneously injected hydrogel compositions into consideration (approx. 10% within the first 12 hours, approx. 17% with 24 hours and approx. 35% within 48 hours) , the content of allergen-derived peptides in hydrogel compositions needs to be higher than those in escalating dose protocols of previous clinical trials with short allergen- derived T cell peptides. For example, the first hydrogel composition may contain 200 μg liposomal peptides, leading to the release of approx. 20 μg liposomal peptides within the first 12 hours, another 15 μg liposomal peptides within 24 hours (total of 35 μg) , and another 35 μg liposomal peptides within 48 hours (total of 70 μg) . The second hydrogel composition may contain 300 μg liposomal peptides, and the third hydrogel composition 400 μg liposomal peptides. The maintenance dose may be reached with the fourth hydrogel composition containing 500 μg liposomal peptides, leading to the release of approx. 50 μg liposomal peptides within the first 12 hours, another 35 g liposomal peptides within 24 hours (total of 85 μg) , and another 85 g liposomal peptides within 48 hours (total of 175 g) .

XIII.7. Therapeutically effective doses of autoantigens or peptides derived thereof

Dose escalation strategies apply also to autoantigen-specific immunotherapy of autoimmune diseases, since dose escalation permits administration of larger antigen doses which are required for efficient tolerance induction.

The dose escalating approach has been used in several clinical trials (for a review, see Garber, 2014) . In one trial, immunotherapy of RA patients with recombinant human cartilage glycoprotein-39 (HC gp-39) has been performed by intranasal administration of 30, 150, 300 or 600 μg of HC gp-39 once a week for 13 weeks (Landewe et al., 2010) . However, the mucosal route did not improve the clinical score significantly, although mucosal routes of administration have proven safe and effective in animal models of autoimmunity.

In another trial, nine patients with MS received a single injection of manipulated immune cells, in escalating doses. The four patients receiving the highest doses showed a reduction in the number of T cells targeting self-antigens (Lutterotti et al . , 2013). The most promising trial included 30 patients with relapsing- remitting MS (Walczak et al . , 2013), randomized in 1 of 3 arms to receive placebo (n=10 patients), a mixture of 1 mg of PLPi39-i5i, 1 mg of MOG35-55, and 1 mg of MBP₈s-99 (n=16), or a mixture of 10 mg of PLP139-151, 10 mg of MOG35-55, and 10 mg of MBP85-99 (n = 4). Myelin antigens were dissolved in phosphate- buffered saline and were applied transdermally in an adhesive skin patch placed on the right upper arm that was changed once per week for 4 weeks and then once per month for 11 months. The effect of myelin peptides was detected at as early as 3 months of treatment, as demonstrated by the reduction in the cumulative number of Gd⁺ lesions vs the placebo group at this point of the study.

PS-liposomes loaded with autoantigen-derived peptides. Methods for encapsulation of peptides in liposomes are known to the person skilled in the art. Various formulations of liposomes containing encapsulated peptides have been prepared (for a review, see Mohan et al., 2015) and studied in a variety of animal models (e.g., Konur et al . , 2008; Belogurov et al., 2013) .

Encapsulation efficiencies of peptides into liposomes depend on the hydrophilicity or hydrophobicity of the peptides, the lipid composition and the molar ratio of lipid to peptide, as described in detail in section XIII.1.

Therapeutic concentrations of liposome-encapsulated autoantigen-derived peptides have been evaluated in animal experiments and in clinical trials. For example, experimental autoimmune encephalomyelitis (EAE) in Dark Agouti rats has been treated with mannosylated liposomes containing three peptides derived from the myelin basic protein (MBP 46-62, MBP 124-139; MBP 147-170) . Treatment was started on d 7 after EAE induction, i.e., at the time of the first clinical manifestations of the disease. Each rat received 6 single daily subcutaneous injections of mannosylated liposomes (approx. 150 mg lipid/1.0 ml PBS) containing 150 μg of each peptide . Treated rats almost completely recovered from EAE within a week after the first clinical manifestations of the disease, whereas untreated rodents remained severely disabled (Belogurov et al . , 2013). A subsequent clinical trial with mannosylated liposomes containing the three peptides derived from the myelin basic protein, included 18 patients with relapse-remitting MS (RRMS) or secondary progressive MS (SPMS) . Patients received weekly subcutaneous injection of increasing doses of liposomal MBP peptides (50 μg, 150 μg, 225 g, 450 μg, 900 μg and 900 μg) over 6 weeks (total dose: 2.675 mg) . During the follow-up (up to 12 weeks after the final injection) cytokine levels returned to normal levels of healthy subjects, especially for IL-2, IL-7, CCL2 , CCL4 , and TNF-a (Belogurov et al., 2016).

XIV. SURROGATE MARKERS FOR TOLERANCE INDUCTION

A dose escalation strategy for subcutaneous auto-antigen- specific tolerance induction has been developed recently (Burton et al . , 2014). Using the Tg4 T-cell receptor (TCR) transgenic model of EAE (where >90% of CD4⁺ T cells recognize the nine-residue N-terminal peptide of MBP ; MBP Acl-9) , the authors show that self-antigen-specific tolerance can be effectively induced via the subcutaneous (s.c.) route, eliciting IL-10-secreting CD4⁺ T cells with an anergic, regulatory phenotype. At each consecutive stage of the dose escalation the sequential modulation of CD4⁺ T-cell phenotype has been characterized. Dose escalation minimized CD4⁺ T-cell activation and proliferation during the early stages of immunotherapy, preventing excessive systemic cytokine release. Furthermore, the s.c. route of administration proved to be more effective than the intranasal route, with a 1,000-fold lower dose of antigen being effective for anergy induction when compared with previous studies. The ability of cells to secrete IL-10, which serves as a promising mediator of effective antigen-specific immunotherapy (Sabatos-Peyton et al., 2010), and to suppress EAE increased in a dose-dependent manner. Tolerance induced by escalating dose immunotherapy was effective whether administered prophylactically or therapeutically (Burton et al . , 2014).

The gradual establishment of a regulatory CD4⁺ T-cell phenotype is characterized by expression of specific negative co- stimulatory molecules and transcription factors, in addition to the regulatory cytokine IL-10, all of which are used as surrogate markers for allergen/autoantigen-specific tolerance induction according to the method of the present invention. Transcription factors previously associated with IL-10 expression include Maf, Ahr and Nfil3 (Pot et al., 2009; Motomura et al . , 2011; Apetoh et al., 2010). The induction of IL-21 expression is also noteworthy, as IL-21 contributes to the IL-27-driven production of IL-10 in murine T cells (Pot et al. , 2009) .

The most notable correlation with effective immunotherapy is the induction of a set of negative co-stimulatory molecules including PD-1, LAG-3, TIM-3 and TIGIT. Some of these molecules have previously been associated with T cell exhaustion (Wherry, 2011) , while others have been described as markers of IL-10-secreting Trl cells (Gagliani et al . , 2013; Okamura et al . , 2009). Burton et al . (2014) demonstrated a positive correlation between IL-10 production and the expression of LAG-3 , TIGIT, PD-1 and TIM-3. However, expression of these markers is not uniquely restricted to the IL-10⁺ population; only 11% of LAG-3⁺ cells are IL-10⁺ and -50% of Tim-3⁺ or TIGIT⁺ cells are IL-10⁺ (Burton et al . , 2014). These results suggest that while LAG-3 and PD-1 are good markers of the anergic CD4⁺ T-cell population induced by escalating dose immunotherapy, TIGIT and TIM-3 are better discriminators of IL-10-secreting cells induced by immunotherapy (Burton et al . , 2014). CD49b was also found to correlate with IL-10 expression in CD4⁺ T cells from autoantigen-treated mice; however, within the LAG-3⁺CD49b⁺ population, only 33% of cells were found to express IL-10 (Burton et al. , 2014). Although the necessary extent of established regulatory CD4⁺ T- cell phenotypes for the induction of tolerance may vary for different patients and also for different allergic and autoimmune diseases, a recent successful, escalating dose immunotherapeutic approach for the treatment of EAE provides valuable cornerstones (Burton et al., 2014). In this study, mice were treated every 3-4 days six times s.c. with an escalating dose of autoantigen (escalating from 0.08 μg to 0.8 μg and then to 4 x 8 μg, or escalating from 0.08 μg to 0.8 μg and then to 8 g and finally to 3 x 80 μg) . Induction of tolerance was associated with a percentage of CD4⁺ T cells expressing IL-10, c-Maf or LAG-3 in at least 50% of the cells. A rising percentage of TIGIT⁺ cells also accumulated during autoantigen-specific immunotherapy (20% of activated CD4⁺ T cells) . The proportion of cells expressing TIM-3 remained relatively stable throughout the treatment, while the percentage of PD-1⁺ cells increased upon initial CD4⁺ T-cell activation and further increased during the later stages of the treatment . XV. THERAPEUTIC PROTOCOLS

In one embodiment, the present invention discloses therapeutic protocols for the treatment of allergic and autoimmune diseases . XV.1. Subcutaneous allergen/autoantigen-specific immunotherapy

Current standard subcutaneous allergen-specific immunotherapy (SCIT) protocols, in general, involve weekly injections of recombinant allergens or allergen extracts via the subcutaneous route 8-16 weeks during an up-dosing phase, followed by monthly maintenance injections for a period of 3-5 years. Therefore, there is a need for shorter treatment periods providing also lasting restoration of tolerance. The method of the present invention has the potential to improve significantly the efficacy of subcutaneous allergen-specific immunotherapy and, thereby, to shorten the length of treatment .

In one embodiment of the present invention, hydrogel-based compositions according to the method of the present invention comprising allergen extracts or recombinant allergens or B cell epitope-presenting allergen fragments, are administered subcutaneously by at least three injections during an up- dosing phase (escalating dosing phase) , followed by monthly maintenance injections. Injections during the up-dosing phase can be performed at intervals ranging from one-week up to four-weeks intervals. Preferred are three- to four-weeks intervals to allow for a complete release of hydrogel-embedded components. The allergen dose continually increases in the compositions, being lowest in the composition used for the first injection. The number of required subcutaneous injections for the induction of tolerance during the maintenance phase is determined by analysis (combination of microarray analyses and real-time PCR including RT-PCR) of the sequential modulation of CD4⁺ T-cell phenotype towards IL-10- secreting CD4⁺ T cells with an anergic, regulatory phenotype after each injection step as described in section XIV.

Autoantigen-specific immunotherapy trials, in general, involved also repeated administrations of autoantigens using an escalating dosing protocol. For example, immunotherapy of RA patients with recombinant human cartilage glycoprotein-39 (HC gp-39) has been performed by intranasal administration of 30, 150, 300 or 600 μg of HC gp-39 once a week for 13 weeks (Landewe et al . , 2010). For subcutaneous autoantigen-specific immunotherapy with hydrogel-based compositions according to the method of the present invention an escalating dosing protocol during an up-dosing phase is also applied. After completion of the up-dosing phase, monthly subcutaneous maintenance injections of hydrogel-based compositions according to the method of the present invention are performed, wherein the number of required subcutaneous injections for the induction of tolerance during the maintenance phase is determined by analysis (combination of microarray analyses and real-time PCR including RT-PCR) of the sequential modulation of CD4⁺ T-cell phenotype towards IL-10- secreting CD4⁺ T cells with an anergic, regulatory phenotype after each injection step as described in section 14.

In some cases, few injections of a hydrogel -based composition of the present invention may also be sufficient to induce IL- 10 -secreting CD4⁺ T cells with an anergic, regulatory phenotype to an extent that allows suppression of allergic disease symptoms. For example, a single s.c. injection of tolerizing liposomes loaded with antigen and NF-κΒ inhibitors into mice suffering from antigen- induced inflammatory arthritis has been demonstrated to reduce the mean clinical score by approximately 50% within four days (Capini et al . , 2009) . However, in the majority of cases several s.c. injections of a hydrogel-based composition of the present invention may be necessary to induce tolerance via a gradual establishment of a regulatory CD4⁺ T-cell phenotype.

XV.2. Subcutaneous immunotherapy with allergen/autoantigen- derived T cell epitope-containing peptides

Various treatment protocols are suitable for subcutaneous immunotherapy with allergen/autoantigen-derived T cell epitope-containing peptides (T cell peptides) according to the method of the present invention. In a preferred embodiment of the present invention, hydrogel - based compositions according to the method of the present invention comprising T cell peptides encapsulated in PS- liposomes are subcutaneously injected up to six times at monthly intervals. Thereafter, the modulation of CD4⁺ T-cells towards IL- 10 -secreting CD4⁺ T cells with an anergic, regulatory phenotype is analyzed by a combination of microarray analyses and real-time PCR including RT-PCR as described in section XIV. If further modulation of CD4⁺ T-cells for the induction of tolerance is necessary, additional subcutaneous injections at monthly intervals are performed. In a preferred specific embodiment, the treatment includes an up-dosing phase (escalating dosing phase) with at least three subcutaneous injections of hydrogel-based compositions according to the method of the present invention comprising increasing amounts of T cell peptides in PS-liposomes , followed by monthly maintenance injections of hydrogel-based compositions according to the method of the present invention. Injections during the up-dosing phase can be performed at intervals ranging from one-week up to four-weeks intervals. Preferred are three- to four-weeks intervals to allow for a complete release of hydrogel-embedded components. The number of required subcutaneous injections for the induction of tolerance during the maintenance phase is determined by analysis (combination of microarray analyses and real-time PCR including RT-PCR) of the sequential modulation of CD4⁺ T-cell phenotype towards IL- 10-secreting CD4⁺ T cells with an anergic, regulatory phenotype after each injection step as described in section 14. If further modulation of CD4⁺ T-cells for the induction of tolerance is necessary, additional subcutaneous injections at monthly intervals are performed.

XV.3. Combination immunotherapy with allergen/autoantigen- derived T cell peptides (Phase Ά) and intact allergens/autoantigens (Phase B) .

The rationale for a combination of subcutaneous immunotherapy with allergen/autoantigen-derived T cell epitope-containing peptides (T cell peptides) and subsequent immunotherapy with natural or recombinant allergens/autoantigens or B cell epitope containing fragments thereof or allergen extracts is based on the recent failure of a phase III field study in the field of cat allergy using a combination of seven short Fel d 1-derived T cell peptides. Possible reasons for the failure of this study include a) insufficient uptake and presentation of the intradermally administered short peptides by antigen- presenting cells (APCs) , b) insufficient tolerization of the peptide-presenting APCs due to the omission of tolerance- promoting adjuvants, and c) lack of allergen-specific protective antibodies capable of inhibiting the binding of inhaled or otherwise internalized allergens to mast cell- linked IgE. Apparently, the generation of protective antibodies which requires presentation of allergen-associated B cell epitopes, is as important as the development of tolerance-supporting Tregs since the appearance of protective antibodies has been shown to correlate with improvement of allergy-associated symptoms.

In view of these considerations, the combination of T cell- and B cell-directed therapeutic approaches has the potential to be more efficient than each approach by itself. In order to provide a local tolerogenic cytokine milieu by regulatory T cells at the site of allergen/autoantigen presentation to B cells, immunotherapy with allergen/autoantigen-derived T cells is performed first (Phase A) , followed by immunotherapy with natural or recombinant allergens/autoantigens or B cell epitope-containing fragments thereof (Phase B) . Using this protocol, generation of protective antibodies in the second immunotherapeutic phase with intact allergens/autoantigens or B cell epitope-containing fragments is expected to be more efficient and less time-consuming.

In one embodiment of the present invention, the first phase with allergen/autoantigen-derived T cell peptides is performed subcutaneously as described in section XV.2. After sufficient modulation of CD4⁺ T-cells towards IL-10-secreting CD4⁺ T cells with an anergic, regulatory phenotype, Phase B is initiated using natural or recombinant allergens/autoantigens or B cell epitope-containing fragments thereof or allergen extracts. Different allergen/autoantigen formulations are applicable for Phase B including those for oral, sublingual, subcutaneous and transdermal applications, wherein formulations for subcutaneous injection include but are not restricted to those based on hydrogels, alum or microcrystalline tyrosine. Phase B is performed as described in section XV.1 or according to the manufacturers recommendations, wherein the maintenance phase is likely to be much shorter dependent on the development of protective antibodies and the improvement of the clinical score . In a preferred embodiment of the present invention, phase A with allergen/autoantigen-derived T cell peptides is performed subcutaneously as described in section XV.2. After sufficient modulation of CD4⁺ T-cells towards IL- 10 -secreting CD4⁺ T cells with an anergic, regulatory phenotype, phase B is initiated using hydrogel-based compositions according to the method of the present invention comprising natural or recombinant allergens/autoantigens or B cell epitope-presenting fragments thereof or allergen extracts. Phase B is performed subcutaneously as described in section XV.1, wherein the number of required subcutaneous injections for the induction of tolerance during the maintenance phase is determined by analysis of the development of protective antibodies and the improvement of the clinical score.

EXAMPLES

The following examples are intended to illustrate but not limit the present invention.

EXAMPLE 1: SYNTHESIS OF PLGA-PE6-PL6A HYDROGELS

The biodegradable triblock polymer described in this example has a PLG/PEG weight ratio of 2.3 (70/30), and a lactide/glycolide molar ratio of approx. 15/1. Synthesis of the triblock copolymer is performed according to published protocols (Qiao et al., 2005).

Copolymer synthesis. Polyethylene glycol (PEG 1000) is purchased from Fluka, poly (DL-lactide) from Sigma, glycolide (1, 4-Dioxane-2, 5-dione) from Sigma, and stannous 2- ethylhexanoate from Aldrich.

A total of 25 g of DL-lactide, glycolide and PEG are used for polymerization (16.6 g DL-lactide, 0.9 g glycolide, 7.5 g PEG 1000) (PLG/PEG weight ratio of 70/30 (2.3)). Under nitrogen atmosphere, PEG 1000 is dried under vacuum and stirring at 120°C for 2 h in a vigorously dried Erlenmeyer reaction flask. Then the reaction flask is filled with dry argon. DL-lactide and gycolide monomers are added under stirring followed by the addition of Stannous 2-ethylhexanoate (0.2% w/w) . Then the tube is sealed under argon. The sealed flask is immersed and kept in an oil bath thermostated at 130°C. After approx. 16 h the flask is cooled to room temperature, and the product is dissolved in cold water. After completely dissolved, the copolymer solution is heated to 80°C to precipitate the copolymer and to remove the water-soluble low molecular weight copolymers and unreacted monomers. The supernatant is decanted, the precipitated copolymer is again dissolved in cold water followed by heating to induce precipitation. This process of dissolution followed by precipitation is repeated three times. Alternatively the polymer can be dissolved in acetonitrile, sterile filtred, and precipitated by mixing with sterile water and heating. Finally, the copolymer is dried under vacuum at room temperature until constant weight.

Molecular weight determination. The molecular weight of the copolymer is determined by gel permeation chromatography using polystyrene standards as described by Qiao et al . (2005) . Measurement of gelation temperature. The gelation temperature is determined as described by Qiao et al. (2005). A 2 ml transparent vial is filled with 200 μΐ water solution of the copolymer (20% w/w and 25% w/w) , is placed in a water bath. The solution is heated in 1°C steps beginning at 26 °C in a thermomixing device (Eppendorf) . At each temperature step the gelation is checked by careful inversion of the tube. When the solution is not free-flowing, gelation of the solution occurred, the temperature read from the thermometer is determined as gelation temperature .

EXAMPLE 2: SYNTHESIS OF PS-LIPOSOMES

This example describes the synthesis of unilamellar PS- liposomes from a lipid mixture of phosphatidyldserine (PS) (either 1, 2-dipalmitoyl-sn-glycero-3-phospho-L-serine sodium salt (Sigma-Aldrich) , l-palmitoyl-2-oleoyl-sn-3-glycerophospho -L-serine (POP-L-S) , or bovine brain phosphatidyldserin (Avanti Polar Lipids)), phosphatidylcholine (PC) (either 1,2- dipalmitoyl-sn-glycero-3 -phosphocholine (DMPC; Sigma-Aldrich) , l-palmitoyl-2-oleoyl-sn-3-glycerophosphocholine (POPC; Avanti Polar Lipids) , or egg phosphatidylcholine (egg-PC; Avanti Polar Lipids) ) , and cholesterol (CH; Avanti Polar Lipds) at a ratio of 30:30:40 (PS to PC to CH) according to Hoffmann et al. (2005) .

A chloroform/methanol (2:1, v/v) solution containing 30 μιηοΐ PS (approx. 22.7 mg) , 30 mol PC (approx. 22.0 mg) and 40 mol CH (approx. 15.5 mg) is placed in a conical flask and dried by rotary evaporation to prepare a thin lipd film. Thereafter, the flask is placed in a desiccator for at least one hour to completely remove the solvent. Then, 1.7 ml of phosphate- buffered saline (PBS) is added (approx. 35 mg total lipid/ml) and multilamellar vesicles are generated by intense vortex dispersion. For the preparation of unilamellar vesicles, the multilamellar preparation is extruded 10 times through a 1 m pore polycarbonate membrane (Nucleopore, USA) . PS- liposomes with a particle size of approx. 1 μπι are suitable for efficient uptake by macrophages (Harel-Adar et al . , 2011). The liposome suspension is centrifuged at 5000xg for 5 minutes and the supernatant is discarded by pipetting and replaced by 1.7 ml of PBS and vortexed to resuspend the liposomes.

The final liposomal suspension contains approx. 59 ymol (approx. 35 mg) of lipd/ml (59 mM liposomal suspension) . Unilamellar PS- liposomes prepared by this procedure have been shown to disperse uniformly in physiological medium at a concentration of 60 mM total lipid due to repulsion forces (Harel-Adar et al . , 2011). The degree of PS exposure on liposomes is assessed by binding of FITC-annexin V to surface-exposed PS and subsequent analysis by FACS .

EXAMPLE 3: SYNTHESIS OF PS-LIPOSOMES CONTAINING CpG-ODN

This example describes the synthesis of unilamellar PS- liposomes containing encapsulated CpG-ODN 1826 (5'- TCCATGACGTTCCTGACGTT-3 ' ; MW approx. 6059) with a natural phosphodiester backbone (PO CpG-ODN 1826) according to the method of example 2.

Synthesis . A chloroform/methanol (2:1, v/v) solution containing 30 μιηοΐ PS (approx. 22.7 mg) , 30 pmol PC (approx. 22.0 mg) and 40 pmol CH (approx. 15.5 mg) is placed in a conical flask and dried by rotary evaporation to prepare a thin lipid film. Thereafter, the flask is placed in a desiccator for at least one hour to completely remove the solvent. Then, 2.5 ml HEPES-buffer, pH 7.4, containing 25 mg of PO CpG-ODN 1826 (approx. 4.13 μπιοΐ) is added (approx. 24 mg total lipid/ml) and multilamellar vesicles are generated by intense vortex dispersion. For the preparation of unilamellar vesicles, the multilamellar preparation is extruded 10 times through a 1 μιη pore polycarbonate membrane (Nucleopore, USA) . PS-liposomes with a particle size of approx. 1 m are suitable for efficient uptake by macrophages (Harel-Adar et al., 2011) . The liposome suspension is centrifuged at SOOOxg for 5 minutes and the supernatant is discarded by pipetting and replaced by 1.7 ml of PBS and vortexed to resuspend the liposomes .

Analysis of the encapsulation efficiency of CpG-ODN 1826. The encapsulation efficiency is determined by generating a standard curve of free PO CpG-ODN 1826. All samples and standards contain normalized lipid amounts and the detergent C12E8 (dodecyl octaethylene glycol ether; Sigma-Aldrich) at a final concentration of 1%. SYBR Green I (Invitrogen) is added to the plate at a final dilution of 1:15,000 and the fluorescence quantified in a fluorescence plate reader using an excitation of 485 nm and emission of 528 nm.

The encapsulation conditions of example 3 are similar to the conditions used in the study of Konur et al . (2008) . In this study, encapsulation of 10 mg CpG-ODN 1826 (MW approx. 6059; 1.65 μτηοΐ) solved in 1.0 ml HEPES-buffer, pH 7.4, in small unilamellar liposomes (SUV) composed of cholesterol (chol) , dilauroyl-phosphatidyl-ethanolamine (DLPE) and dioleoyl- phosphatidylserine (DOPS) at a molar ratio of 1:1:1 (40 μπιοΐ of total lipid; ODN to lipid ratio of approx. 1:25), resulted in an encapsulation efficiency in the range of 10%. The final liposome preparation contained approx. 1 mg ODN or 165 nmol ODN/40 μπιοΐ lipid (4.125 nmol ODN/1.0 μιηοΐ lipid).

In example 3, the final liposome preparation contains approx. 1.5 mg ODN or 247 nmol ODN/59 μπιοΐ lipid (4.186 nmol ODN/1.0 μτηοΐ lipid) . The study of Golali et al., (2012) demonstrates that CpG-ODN 1826 with a nuclease-resistant phosphorothioate backbone (PS CpG-ODN 1826) and CpG-ODN 1826 with a natural phosphodiester backbone (PO CpG-ODN 1826) are encapsulated with comparable efficiencies in large unilamellar liposomes (composed of distearoyl-phosphatidylcholine (DSPC) and cholesterol (chol) at a molar ratio of 2:1). Using 200 μg CpG-ODN (approx. 33 nmol) per 30 μπιοΐ lipid (ODN to lipid ratio of 1:1000), the encapsulation efficiencies of PO CpG-ODN 1826 and PS CpG-ODN 1826 were 9.8 ± 1.2% and 9.2 ± 0.8% (n=3), respectively.

The final liposomal suspension contains approx. 59 μιηοΐ (approx. 35 mg) of lipid/ml (59 mM liposomal suspension) and approx. 1.5 mg encapsulated PO CpG-ODN 1826 (approx. 0.247 ^mol)/ml, corresponding to an encapsulation efficiency of approx. 10%.

EXAMPLE 4: SYNTHESIS OF PS-LIPOSOMES CONTAINING MOG(35-55) PEPTIDE

This example describes the synthesis of unilamellar PS- liposomes containing the myelin oligodendrocyte glycoprotein (MOG) -derived peptide 35-55 (MOG(35-55)) according to the method of example 2. MOG (35-55) is used as model antigen for the induction and treatment of EAE in mice (Schweingruber et al . , 2011; Wust et al., 2008). The sequences of murine and rat MOG (35-55) are identical, whereas human MOG (35-55) contains one different amino acid residue. For this example, the murine MOG(35-55) peptide (MEVGWYRSPFSRWHLYRNGK; MW 2582; purity >95%; AnaSpec, USA) is used. The murine MOG (35-55) has been used for the induction of EAE at a concentration of 3 mg/ml PBS (Sharp et al . , 2008). In water, the solubility of murine MOG(35-55) is approx. 2 mg/ml (product information of Abbiotec) . Synthesis . A chloroform/methanol (2:1, v/v) solution containing 30 ymol PS (approx. 22.7 mg) , 30 μπιοΐ PC (approx. 22.0 mg) and 40 pmol CH (approx. 15.5 mg) is placed in a conical flask and dried by rotary evaporation to prepare a thin lipd film. Thereafter, the flask is placed in a desiccator for at least one hour to completely remove the solvent. Then, 1.7 ml of phosphate-buffered saline (PBS) containing 3.4 mg murine MOG (35-55) (2.0 mg/ml; AnaSpec, USA) is added. Multilamellar vesicles are generated by intense vortex dispersion. For the preparation of unilamellar vesicles, the multilamellar preparation is extruded 10 times through a 1 ym pore polycarbonate membrane (Nucleopore, USA) . The liposome suspension is centrifuged at 5000xg for 5 minutes and the supernatant is discarded by pipetting and replaced by 1.7 ml of PBS and vortexed to resuspend the liposomes. Optionally, residual unincorporated MOG (35-55) that has not been removed by the centrifugation step, may be removed by subsequent size exclusion chromatography on a Sephadex G50 column.

Analysis of the encapsulation efficiency. The concentration of encapsulated MOG (35-55) is determined by ELISA using rabbit anti-MOG (35-55) polyclonal anibodies (AnaSpec, USA) after dissolution of the liposomes in 1% (v/v) Triton X-100.

As demonstrated in a recent study (Belogurov et al . , 2013), liposomal encapsulation of three peptides derived from the myelin basic protein (MBP) at a peptide to lipid ratio /w/w) of 1:330 (0.15 mg peptides/ml : 50 mg lipid/ml) provided an encapsulation efficiency of more than 90%. Since in this example a significantly higher peptide to lipid ratio of 1:18 (2 mg peptide/ml: 35 mg/lipid/ml) is used (approx. 6-fold higher if related to one MBP-derived peptide) , the encapsulation efficiency of MOG (35-55) is lower (in the range of 30-50%) . The final liposomal suspension contains approx. 59 μπιοΐ (approx. 35 mg) of lipid/ml (59 mM liposomal suspension) and approx. 0.6-1.0 mg MOG (35-55) /ml (based on 30-50% encapsulation efficiency) .

EXAMPLE 5: SYNTHESIS OF PS-LIPOSOMES CONTAINING CALCIPOTRIOL

This example describes the synthesis of unilamellar PS- liposomes containing the vitamin D3 derivative calcipotriol (Tocris Bioscience, UK) according to the method of example 2.

Calcipotriol molecules are incorporated into the lipid bilayer and intercalate between the hydrocarbon chains of phospholipid molecules (Merz and Sternberg, 1994) . Using calcipotriol for incorporation into liposomes made of DMPPC or egg-PC in a molar ratio of calcipotriol (MW 412.6) to lipid of 0.03 to 1, incorporation rates of more than 80% have been reported (Merz and Sternberg, 1994) . Since in this example, a two-fold lower molar ratio of calcipotriol to lipid of 0.015 to 1 is used, the incorporation rate is slightly higher.

Synthesis . A chloroform/methanol (2:1, v/v) solution containing 30 mol PS (approx. 22.7 mg) , 30 ymol PC (approx. 22.0 mg) and 40 μπιοΐ CH (approx. 15.5 mg) is placed in a conical flask, mixed with a stock solution of calcipotriol in methanol (10 mg/ml) in a molar ratio of calcipotriol to lipid of 0.015 to 1.0 (620 iq calcipotriol corresponding to approx. 1.5 ymol) , and dried by rotary evaporation to prepare a thin lipid film. Thereafter, the flask is placed in a desiccator for at least one hour to completely remove the solvent. Then, 1.7 ml of phosphate-buffered saline (PBS) is added and multilamellar vesicles are generated by intense vortex dispersion. For the preparation of unilamellar vesicles, the multilamellar preparation is extruded 10 times through a 1 m pore polycarbonate membrane (Nucleopore, USA) . The liposome suspension is centrifuged at 5000xg for 5 minutes and the supernatant is discarded by pipetting and replaced by 1.7 ml of PBS and vortexed to resuspend the liposomes. Analysis of the encapsulation efficiency. The calcipotriol concentration in the liposomal suspensions is determined by UV absorption at 252 nm (molar extinction coefficient of 42,000; Plum et al., 2004) after dissolution of the liposomes in ethanol . Alternatively, the calcipotriol concentration in the liposomal suspensions can be determined by reversed phase HPLC using a C18 -column and acetonitrile : water (77:23) as elution agent (Cirunay et al . , 1998). Calcipotriol is detected by UV absorption at 263 nm. The final liposomal suspension contains approx. 59 pmole (approx. 35 mg) of lipid/ml (59 mM liposomal suspension) , and approx. 310 μς (751 nmole) calcipotriol/ml liposomal suspension, based on an incorporation rate of 85%. EXAMPLE 6: SYNTHESIS OF PS-LIPOSOMES CONTAINING DEXAMETHASONE PHOSPHATE

This example describes the synthesis of unilamellar PS- liposomes containing water-soluble dexamethasone phosphate (DexP) .

In water DexP (MW 516.4) is soluble at a concentration of 50 mg/ml (product information of Santa Cruz Biotechnology) , in PBS at a concentration of at least 25 mg/ml (Anderson et al . , 2010), and in 10 mM HEPES and 135 mM NaCl, pH 6.7, at a concentration of at least 50 mg/ml (Koning et al . , 2006) .

Synthesis . A chloroform/methanol (2:1, v/v) solution containing 30 pmol PS (approx. 22.7 mg) , 30 μιηοΐ PC (approx. 22.0 mg) and 40 ymol CH (approx. 15.5 mg) is placed in a conical flask and dried by rotary evaporation to prepare a thin lipd film. Thereafter, the flask is placed in a desiccator for at least one hour to completely remove the solvent. Then, 1.7 ml of phosphate-buffered saline (PBS) containing 20 mg DexP (Dex-ratio-pharm, Ratiopharm) ) is added. Multilamellar vesicles are generated by intense vortex dispersion. For the preparation of unilamellar vesicles, the multilamellar preparation is extruded 10 times through a 1 ym pore polycarbonate membrane (Nucleopore, USA) . The liposome suspension is centrifuged at 5000xg for 5 minutes and the supernatant is discarded by pipetting and replaced by 1.7 ml of PBS and vortexed to resuspend the liposomes. Optionally, residual un- incapsulated DexP that has not been removed by the centrifugation step, may be removed by subsequent size exclusion chromatography on a Sephadex G50 column.

Analysis of the encapsulation efficiency. After extraction of the liposomal preparations with chloroform, the aqueous phase is used to determine DexP content using a spectrophotometric method (Singh and Verma, 2008) . The method involves oxidation of the corticosteroid by iron (III) and subsequent complexation of iron (II) with potassium hexacynoferate (III) , forming a bluish green colored complex with maximum absorbance at 780 nm (Beer's law range: 10-50 ^g/ml; molar absorptivity for DexP: 0.55 x 10⁴ M^cm^-1) . Alternatively, the DexP content is determined by reversed-phase HPLC at 254 nm using a C18- column and methanol : water (1:1) as solvent (Kwak and D'Amico, 1995) . Furthermore, anti-DexP polyclonal antibodies (MyBioSource) are commercially available for the determination of DexP by Elisa.

The liposomal encapsulation efficiency of DexP depends on the concentration of DexP, high DexP concentrations result in low encapsulation efficiencies and vice versa. For example, the addition of 1000 mg DexP in 10 ml of sterilized water with 1093 mg of a lipid film comprising PC, PE and cholesterol, resulted in capsulation efficiencies ranging from 4.8% to 17.6% depending on the kinds of lipids used for the preparation of unilamellar liposomes (US20090226509A1) . A comparable liposomal encapsulation efficiency of DexP has been reported by Koning et al . (2006) . In this study, a lipid film (comprising PC, cholesterol, and PE in a molar ratio of 1.85:1:0.15) was hydrated in 10 mM HEPES, 135 mM NaCl, pH 6.7, containing 50 mg/ml DexP at a ratio of 1 mg DexP/^mole total lipid. Liposomal DexP contents (detected via absorbance at 254 nm) varied between 30 and 60 μg DexP/^mole total liposomal lipid, representing an encapsulation efficiency of 3-6%.

Based on the study of Koning et al . (2006), a liposomal encapsulation efficiency for DexP in the range of approx. 10% is assumed, since in this example a five-fold lower DexP: lipid ratio of 0.2 mg DexP/^mole total lipid is used for hydration of the lipid film. The final liposomal suspension contains approx. 59 pmol (approx. 35 mg) of lipid/ml (59 mM liposomal suspension) , and approx. 1.2 mg liposomal DexP/ml (based on 10% encapsulation efficiency) , corresponding to 20 pg DexP/μιηοΙ lipid which is comparable to 40 μg DexP/μπιοΙ lipid reported by Anderson et al. (2010), and 28 g DexP/μπιοΙ lipid reported by Hegeman et al . (2011) .

EXAMPLE 7: SYNTHESIS OF PS-LIPOSOMES CONTAINING CALCIPOTRIOL AND DEXAHETHASONE PHOSPHATE

This example describes the synthesis of unilamellar PS- liposomes containing the vitamin D3 derivative calcipotriol (Tocris Bioscience, UK) according to the method of example 5 and water-soluble dexamethasone phosphate (DexP) according to the method of example 6. Synthesis . A chloroform/methanol (2:1, v/v) solution containing 30 μιτιοΐ PS (approx. 22.7 mg) , 30 μπιοΐ PC (approx. 22.0 mg) and 40 ymol CH (approx. 15.5 mg) is placed in a conical flask, mixed with a stock solution of calcipotriol in methanol (10 mg/ml) in a molar ratio of calcipotriol to lipid of 0.015 to 1.0 (620 pg calcipotriol corresponding to approx. 1.5 μπιοΐ) , and dried by rotary evaporation to prepare a thin lipid film. Thereafter, the flask is placed in a desiccator for at least one hour to completely remove the solvent . Then, 1.7 ml of phosphate-buffered saline (PBS) containing 20 mg DesP (Dex-ratio-pharm, Ratiopharm) ) is added. Multilamellar vesicles are generated by intense vortex dispersion. For the preparation of unilamellar vesicles, the multilamellar preparation is extruded 10 times through a 1 μπι pore polycarbonate membrane (Nucleopore, USA) . The liposome suspension is centrifuged at 5000xg for 5 minutes and the supernatant is discarded by pipetting and replaced by 1.7 ml of PBS and vortexed to resuspend the liposomes. Optionally, residual un- incapsulated DexP that has not been removed by the centrifugation step, may be removed by subsequent size exclusion chromatography on a Sephadex G50 column.

Analysis of the encapsulation efficiency. The encapsulation efficiency of DexP and calcipotriol is analyzed as described in examples 5 and 6.

The final liposomal suspension contains approx. 59 μιηοΐ (approx. 35 mg) of lipid/ml (59 mM liposomal suspension) , approx. 310 μg (751 nmol) calcipotriol/ml liposomal suspension (based on 85% incorporation rate), and approx. 1.2 mg liposomal DexP/ml (based on 10% encapsulation efficiency) , corresponding to 20 g DexP/μιηοΙ lipid.

EXAMPLE 8: SYNTHESIS OF PS-LIPOSOMES CONTAINING CALCIPOTRIOL AND CpG-ODN This example describes the synthesis of unilamellar PS- liposomes containing bilayer- incorporated calcipotriol according to the method of example 5 and encapsulated CpG-ODN 1826 ( 5 ' -TCCATGACGTTCCTGACGTT- 3 " ; MW approx. 6059) with a natural phosphodiester backbone (PO CpG-ODN 1826) according to the method of example 2.

Synthesis . A chloroform/methanol (2:1, v/v) solution containing 30 ymol PS (approx. 22.7 mg) , 30 μπιοΐ PC (approx. 22.0 mg) and 40 mol CH (approx. 15.5 mg) is placed in a conical flask, mixed with a stock solution of calcipotriol in methanol (10 mg/ml) in a molar ratio of calcipotriol to lipid of 0.015 to 1.0 (620 μq calcipotriol corresponding to approx. 1.5 ymol) , and dried by rotary evaporation to prepare a thin lipid film. Thereafter, the flask is placed in a desiccator for at least one hour to completely remove the solvent. Then, 2.5 ml HEPES-buffer, pH 7.4, containing 25 mg of PO CpG-ODN 1826 (approx. 4.13 μπιοΐ) is added (approx. 24 mg total lipid/ml) and multilamellar vesicles are generated by intense vortex dispersion. For the preparation of unilamellar vesicles, the multilamellar preparation is extruded 10 times through a 1 i pore polycarbonate membrane (Nucleopore, USA) . PS-liposomes with a particle size of approx. 1 pm are suitable for efficient uptake by macrophages (Harel-Adar et al . , 2011) . The liposome suspension is centrifuged at 5000xg for 5 minutes and the supernatant is discarded by pipetting and replaced by 1.7 ml of PBS and vortexed to resuspend the liposomes.

Analysis of the encapsulation efficiency of CpG-ODN 1826. The encapsulation efficiency is determined as described in examples 3 and 5.

The final liposomal suspension contains approx. 59 mol (approx. 35 mg) of lipid/ml (59 mM liposomal suspension) , approx. 310 ig (751 nmol) calcipotriol/ml liposomal suspension (based on 85% incorporation rate), and approx. 1.5 mg encapsulated PO CpG-ODN 1826 (approx. 0.247

corresponding to an encapsulation efficiency of approx. 10%. EXAMPLE 9: SYNTHESIS OF PS-LIPOSOMES CONTAINING CALCIPOTRIOL AND MOG (35-55) PEPTIDE

This example describes the synthesis of unilamellar PS- liposomes containing bilayer-incorporated calcipotriol according to the method of example 5 and encapsulated peptide MOG(35-55) according to the method of example 4.

Synthesis . A chloroform/methanol (2:1, v/v) solution containing 30 μπιοΐ PS (approx. 22.7 mg) , 30 pmol PC (approx. 22.0 mg) and 40 pmol CH (approx. 15.5 mg) is placed in a conical flask, mixed with a stock solution of calcipotriol in methanol (10 mg/ml) in a molar ratio of calcipotriol to lipid of 0.015 to 1.0 (620 μg calcipotriol corresponding to approx. 1.5 pmol), and dried by rotary evaporation to prepare a thin lipid film. Thereafter, the flask is placed in a desiccator for at least one hour to completely remove the solvent. Then, 1.7 ml of phosphate-buffered saline (PBS) containing 3.4 mg murine MOG (35-55) (2.0 mg/ml; AnaSpec, USA) is added. Multilamellar vesicles are generated by intense vortex dispersion. For the preparation of unilamellar vesicles, the multilamellar preparation is extruded 10 times through a 1 pm pore polycarbonate membrane (Nucleopore, USA) . The liposome suspension is centrifuged at 5000xg for 5 minutes and the supernatant is discarded by pipetting and replaced by 1.7 ml of PBS and vortexed to resuspend the liposomes. Optionally, residual un- incorporated MOG (35-55) that has not been removed by the centrifugation step, may be removed by subsequent size exclusion chromatography on a Sephadex G50 column.

Analysis of the encapsulation efficiency. The encapsulation efficiency is determined as described in examples 4 and 5. The final liposomal suspension contains approx. 59 μπιοΐ (approx. 35 mg) of lipid/ml (59 mM liposomal suspension) , approx. 310 μg (751 nmol) calcipotriol/ml liposomal suspension (based on 85% incorporation rate), and approx. 0.6-1.0 mg MOG (35-55) /ml (based on 30-50% encapsulation efficiency).

EXAMPLE 10: SYNTHESIS OF PS-LIPOSOMES CONTAINING CpG-ODN AND MOG (35-55) PEPTIDE

This example describes the synthesis of unilamellar PS- liposomes containing encapsulated CpG-ODN 1826 (5'- TCCATGACGTTCCTGACGTT-3 ' ; MW approx. 6059) with a natural phosphodiester backbone (PO CpG-ODN 1826) according to the method of example 3, and encapsulated peptide MOG (35-55) according to the method of example 4.

Synthesis . A chloroform/methanol (2:1, v/v) solution containing 30 ymol PS (approx. 22.7 mg) , 30 pmol PC (approx. 22.0 mg) and 40 μιηοΐ CH (approx. 15.5 mg) is placed in a conical flask and dried by rotary evaporation to prepare a thin lipid film. Thereafter, the flask is placed in a desiccator for at least one hour to completely remove the solvent. Then, 2.5 ml HEPES-buffer, pH 7.4, containing 25 mg of PO CpG-ODN 1826 (approx. 4.13 μτηοΐ) and 1.7 ml HEPES- buffer, pH 7.4, containing 3.4 mg murine MOG (35-55) (2.0 mg/ml; AnaSpec, USA) are added (approx. 14.3 mg total lipid/ml) and multilamellar vesicles are generated by intense vortex dispersion. For the preparation of unilamellar vesicles, the multilamellar preparation is extruded 10 times through a 1 pm pore polycarbonate membrane (Nucleopore, USA) . PS-liposomes with a particle size of approx. 1 pm are suitable for efficient uptake by macrophages (Harel-Adar et al . , 2011) . The liposome suspension is centrifuged at 5000xg for 5 minutes and the supernatant is discarded by pipetting and replaced by 1.7 ml of PBS and vortexed to resuspend the liposomes. Optionally, residual un- incorporated MOG(35-55) that has not been removed by the centrifugation step, may be removed by subsequent size exclusion chromatography on a Sephadex G50 column.

Analysis of the encapsulation efficiency of CpG-ODN 1826. The encapsulation efficiency is determined as described in examples 3 and 4. The final liposomal suspension contains approx. 59 mol (approx. 35 mg) of lipid/ml (59 mM liposomal suspension) , approx. 1.5 mg encapsulated PO CpG-ODN 1826 (approx. 0.247 μτηο1)/ιη1, corresponding to an encapsulation efficiency of approx. 10%, and approx. 0.6-1.0 mg MOG (35-55 ) /ml (based on 30-50% encapsulation efficiency) .

EXAMPLE 11: SYNTHESIS OF HYDROGEL/PS -LIPOSOME COMPOSITIONS

This example describes the synthesis and chacterization of thermogelling PLGA- PEG- PLGA hydrogels containing either empty or loaded phosphatidylserine (PS) -liposomes .

Synthesis of PLGA- PEG-PLGA hydrogels. The biodegradable triblock polymer described in this example has a PLG/PEG weight ratio of 2.3 (70/30) , and a lactide/glycolide molar ratio of approx. 15/1. Synthesis of the triblock copolymer is performed and characterized as described in example 1.

Synthesis of empty PS-liposomes . PS- liposomes are prepared as described in example 2. The final liposomal suspension contains approx. 59 μιηοΐ (approx. 35 mg) of lipd/ml (59 mM liposomal suspension) .

Synthesis of PS-liposomes loaded with one component. PS- liposomes loaded with one component are prepared as described in examples 3-6. The final liposomal suspension contains approx. 59 μιτιοΐ (approx. 35 mg) of lipid/ml (59 mM liposomal suspension) . Furthermore, PS-liposomes of example 3 contain approx. 1.5 mg encapsulated PO CpG-ODN 1826 (approx. 0.247 ^moD/ml, based on 10% encapsulation efficiency, PS-liposomes of example 4 contain approx. 0.6-1.0 mg MOG (35-55) /ml based on 30-50% encapsulation efficiency, PS-liposomes of example 5 contain approx. 310 μg (751 nmole) calcipotriol/ml liposomal suspension, based on an incorporation rate of 85%, and PS- liposomes of example 6 contain approx. 1.2 mg liposomal DexP/ml (based on 10% encapsulation efficiency) , corresponding to 20 pg DexP/pmol lipid.

Synthesis of PS-liposomes loaded with two components. PS- liposomes loaded with two components are prepared as described in examples 7-10. The final liposomal suspension contains approx. 59 pmol (approx. 35 mg) of lipid/ml (59 mM liposomal suspension) . Furthermore, PS-liposomes of example 7 contain approx. 310 pg (751 nmol) calcipotriol/ml liposomal suspension (based on 85% incorporation rate) and approx. 1.2 mg liposomal DexP/ml (based on 10% encapsulation efficiency) , PS-liposomes of example 8 contain approx. 310 yg (751 nmol) calcipotriol/ml liposomal suspension (based on 85% incorporation rate) and approx. 1.5 mg encapsulated PO CpG-ODN 1826 (approx. 0.247 μπιο1)/ιη1, corresponding to 10% encapsulation efficiency, PS- liposomes of example 9 contain approx. 310 yg (751 nmol) calcipotriol/ml liposomal suspension (based on 85% incorporation rate) and approx. 0.6-1.0 mg MOG (35-55) /ml (based on 30-50% encapsulation efficiency) , and PS-liposomes of example 10 contain approx. 1.5 mg encapsulated PO CpG-ODN 1826 (approx. 0.247 μπιο1)/ιη1, corresponding to an encapsulation efficiency of approx. 10%, and approx. 0.6-1.0 mg MOG (35-55) /ml (based on 30-50% encapsulation efficiency).

Preparation of hydrogel/PS-liposome composits. Different concentrations of the PLGA-PEG-PLGA copolymer of Example 2.1 (22.5% w/w, and 30% w/w) in water are mixed with liposomal suspensions in PBS of example 2 at a ratio of two volumes hydrogel solution to one volume of liposomal suspension. The final concentration of the hydrogel is 15% (w/w) or 20% (w/w) containing empty or loaded PS-liposomes at a concentration of approx. 20 ymol (12 mg) of lipid/ml.

Gelation characteristics of hydrogel/PS-liposome composits.

The gelation temperature of hydrogel/PS-liposome composits is determined as described by Qiao et al . (2005). Transparent vials are filled with 200 μΐ water containing different concentrations of the copolymer (22.5% w/w, and 30% w/w), cooled to 4°C and mixed with 100 μΐ PBS containing empty or loaded PS-liposomes or 100 μΐ PBS containing no liposomes. The final concentration of the copolymer is 15% (w/w) and 20% (w/w) containing liposomes at a concentration of approx. 20 ymol (12 mg) of lipid/ml. The vials are placed in a water bath and each solution is heated in 1°C steps beginning at 20 °C in a thermos-mixing device (Eppendorf) . At each temperature step the gelation is checked by careful inversion of the tube. When the solution is not free- flowing, gelation of the solution occurred and the temperature is determined as gelation temperature .

In vitro degradation of hydrogel/PS-liposome composits.

The in vitro degradation behavior of hydrogel/PS-liposome composits is evaluated by the mass loss and/or the molecular weight reduction with time upon incubation in PBS.

Samples (0.2 ml) are incubated in PBS, pH 7.4, at 37°C under mild agitation in a water bath. The solid residues are removed from the incubation medium at scheduled time intervals and lyophilized. The samples are weighted and the weight loss is calculated. For determination of the molecular weight reduction, the solid residues are solved in cold water and analyzed by gel permeation chromatography using polystyrene standards as described by Qiao et al . (2005) . EXAMPLE 12: RELEASE OF PS-LIPOSOMES FROM HYDROGELS

This example describes the in vitro release characteristics of PS-Liposomes with encapsulated FITC-BSA from thermogelling PLGA- EG-PLGA hydroge1s . Synthesis of thermogelling PLGA-PEG-PLGA hydrogels . The biodegradable triblock polymer described in this example has a PLG/PEG weight ratio of 2.3 (70/30), and a lactide/glycolide molar ratio of approx. 15/1. Synthesis of the triblock copolymer is performed as described in example 1.

Synthesis of FITC-BSA-containing PS-liposomes . A chloroform/methanol (2:1, v/v) solution containing 30 pmol PS (approx. 22.7 mg) , 30 μηιοΐ PC (approx. 22.0 mg) and 40 mol CH (approx. 15.5 mg) is placed in a conical flask and dried by rotary evaporation to prepare a thin lipd film. Thereafter, the flask is placed in a desiccator for at least one hour to completely remove the solvent. Then, 1.5 ml of PBS containing 1.5 mg FITC-labeled bovine serum albumin (FITC-BSA, Sigma- Aldrich) is added and multilamellar vesicles are generated by intense vortex dispersion. For the preparation of unilamellar vesicles, the multilamellar preparation is extruded 10 times through a 1 m pore polycarbonate membrane (Nucleopore, USA) . The liposome suspension is centrifuged at 5000xg for 5 minutes and the supernatant is discarded by pipetting and replaced by 1.5 ml of PBS and vortexed to resuspend the liposomes. The final liposomal suspension contains approx. 66.7 ymol (40.1 mg) of lipid/1.0 ml.

The amount of encapsulated FITC-BSA in liposomes is determined by dissolving the lipid vesicles with 1% (v/v) Triton X-100 and monitoring the absorbance of FITC-BSA at 495 nm. Using the conditions of this example, the encapsulation efficacy is 22% (220 g FITC-BSA/ml PS-liposome suspension) . In vitro release of FITC-BSA-containing PS-liposomes from hydrogel/liposome composits. The in vitro release of FITC-BSA- containing PS- liposomes from hydrogel/PS-liposome composits is determined after gelling of the hydrogel/PS-liposome composits at 37°C by monitoring the supernatant for the development of absorbance at 495 nm in the presence of Triton X-100.

Vials are filled with 200 μΐ water containing different concentrations of the copolymer (22.5% w/w, and 30% w/w) , cooled to 4°C and mixed with 100 μΐ PBS containing FITC-BSA- loaded PS- liposomes . The final concentrations of the copolymer are 15% (w/w) and 20% (w/w) containing PS- liposomes with encapsulated FITC-BSA at a concentration of 22.2 μπιοΐ lipid/ml (13.3 mg/ml) . The reaction mixtures are incubated at 37°C under mild agitation in a water bath until gelling. Thereafter, 1.7 ml PBS, pH 7.4, is added to each sample and incubation at 37°C is continued. At specified sample collection times, 0.5 ml aliquots of the supernatant are withdrawn and replaced by an identical volume of PBS, pH 7.4, to maintain release conditions. The amount of released PS-liposomes is determined by measuring encapsulated FITC-BSA via absorbance at 495 nm in the supernatant after dissolving the lipid vesicles with 1% (v/v) Triton X-100 (Cohen et al . , 1991) or by fluorescense detection in suitable detection systems. Using the experimental conditions of example 12, approx. 7% of the PS-liposomes are released from the hydrogel within the first 5 hours, approx. 15% after 24 hours and approx. 35% after 48 hours. Results are shown in figure 1. EXAMPLE 13: RELEASE OF FIND-ME SIGNALS FROM HYDROGELS This example describes the release of find-me signal ATP for attraction of peripheral antigen-presenting cells to the injection site of hydrogel-based composits. Synthesis of thermogelling PLGA-PEG-PLGA hydrogels. The biodegradable triblock polymer described in this example has a PLG/PEG weight ratio of 2.3 (70/30), and a lactide/glycolide molar ratio of approx. 15/1. The synthesis is performed as described in example 1.

In vitro release of ATP from PLGA-PEG-PLGA hydrogels. An aliquot of 20 μΐ of a 10 mM solution of ATP is combined with 160 μΐ of 25% hydrogel solution and 20 μΐ of lOx PBS (final concentration of ATP: 1 mM) . The mixture is incubated for 2 minutes at 37°C to induce gelling and overlayed with 1 ml of lx PBS. At frequent time points the supernatant is removed by pipetting and stored at 4°C. The removed supernatant is replaced by fresh 1 ml of lx PBS. After 48 hours the samples are measured at 260 nm and the amount of released ATP is calculated as percentage of a reference sample containing a concentration of ATP equaling 100% release.

Using these experimental conditions, approx. 50% of the hydrogel-embedded ATP is released within the first 5 hours in an initial burst, followed by another 10% with the next 20 hours. After 48 hours approx. 75% of the hydrogel-embedded ATP is released. Results are shown in figure 2.

EXAMPLE 14: RELEASE OF VITAMIN D3 FROM HYDROGELS

This example describes the release of calcitriol (la, 25- dihydroxyvitamin D3; 1 , 25- (OH) ₂D3 ) from PLGA-PEG-PLGA hydrogels . Solubility of calcitriol. The solubility of calcitriol (MW 416.65) in ethanol is approx. 50 mg/ml, in a 1:5 solution of ethanol: PBS, pH 7.2, approx. 0.15 mg/ml. Synthesis of hydrogel/calcitriol composits. The biodegradable PLGA-PEG-PLGA triblock polymer described in this example has a PLG/PEG weight ratio of 2.3 (70/30), and a lactide/glycolide molar ratio of approx. 15/1. Synthesis of the triblock copolymer is performed as described in example 1. An aliquot of 20 μΐ of a stock solution of calcitriol (2 mg/ml; 4.8 mM) in absolute ethanol (Cayman/Biomol GmbH) is combined with 160 μΐ of 25% gel solution and 20 μΐ of lOx PBS (final concentration of calcitriol: 0.2 mg/ml or 0.48 mM; final concentration of ethanol: 10%) .

Release assay. The hydrogel/calcitriol composit is incubated for 2 minutes at 37°C to induce gelling and overlayed with 200 μΐ of lx PBS. At frequent time points the supernatant is removed by pipetting and stored at 4°C. The removed supernatant is replaced by fresh 200 μΐ of lx PBS. Controls of the same concentration of calcitriol in lx PBS without gel are incubated and sampled in parallel.

Analysis of calcitriol release. After 48 hours the samples and controls are analysed using a Vitamin D ELISA kit, according to the manual of the manufacturer (Euroimmun AG, Luebeck) . The assay is applicable for the determination of 25 -OH vitamin D3 and other hydroxylated vitamin D3 molecules, and sufficiently linear from 4.0 to 120 ng/ml of 25-OH vitamin D3 (cross reactivity with calcitriol: 45%) .

In brief, 20 μΐ of diluted samples are mixed with 230 μΐ of sample buffer containing a biotin-labed 25-OH vitamin D derivative. 200 μΐ of the mixture are transferred to an ELISA well of an 8-well strip and incubated at room temperature for 2 hours. The wells are washed with 3x 300 μΐ washing buffer. Peroxidase-labelled steptavidin (100 μΐ) is added and incubated for a further hour. The well is again washed 3x with 300 μΐ washing buffer. Tetramethyl-benzidine (100 μΐ) substrate solution is added and developed until sufficient coloring. The reaction is stopped by addition of 100 μΐ 0.5 M sulphuric acid and measured at 420 nm with reference 650 nm.

Using these experimental conditions, approx. 15% of the hydrogel-embedded calcitriol is released within the first 2 hours, approx. 30% after 6 hours, approx. 45% after 12 hours, approx. 65% after 24 hours, and approx. 85% after 48 hours.

EXAMPLE 15: SYNTHESIS OF HYDROGEL COMPOSITIONS FOR THE TREATMENT OF OVA-ALLERGIC MICE

This example describes the synthesis of PLGA-PEG-PLGA hydrogel compositions comprising hydrogel-embedded ovalbumin (OVA) , hydrogel-embedded PS-liposomes containing encapsulated CpG- ODN, and hydrogel-embedded ATP and UTP for the treatment of OVA-sensitized mice.

Concentration of liposomal CpG-ODN. The study of Volpi et al . (2013) provides an estimate of the tolerance-promoting amount of CpG-ODN 1826 in mice. C57BL/6 mice were sensitized by the concomitant intraperitoneal (100 g) and subcutaneous (100 ^g) administration of Aspergillus fumigatus culture filtrate extract followed 1 week later by the intranasal instillation of 20 ^g of the extract. After an additional 7 days, bronchial colonization of A. fumigatus was induced by resting conidia (asexually produced spores) administered intratracheally (1 x 10⁷) , and the animals were evaluated 1 week later for parameters of allergic airway inflammation. Treatment with CpG-ODN 1826 was performed by intraperitoneal injection of 30 ^g of class B CpG-ODN 1826 (approx. 4.7 nmol; MW approx. 6364) per mouse twice, on the same days as the first and second administration of Aspergillus fumigatus culture filtrate extract. The Th2 -dependent allergic phenotype was greatly attenuated by CpG. Taking the slow release of PS- liposomes from PLGA-PEG-PLGA hydrogels into consideration, administration of PLGA-PEG-PLGA hydrogel -embedded PS-liposomes containing up to 100 g of CpG- ODN/20 g mouse (corresponds to 5 mg/kg) appears to be a tolerable dose. This would lead to the release of approx. 10 g liposomal CpG-ODN within the first 12 hours (10% release) , approx. 17 g liposomal CpG-ODN within 24 hours (17% release) , and approx. 35 μg liposomal CpG-ODN within 48 hours (35% release) . Intracellular accumulation of phagocytosed CpG-ODN is prevented by using nuclease-susceptible CpG-ODN with a regular phosphodiester backbone .

Concentration of hydrogel -embedded ATP and UTP. For the method of the present invention it is important to restrict the concentration of released ATP and/or UTP to the nanomolar range since extracellular nucleotides at concentrations of more than 1 μΜ are considered pro- inflammatory (Kono and Rock, 2008) . Therefore, for therapeutic applications PLGA-PEG-PLGA hydrogels are loaded with ATP and/or UTP at a concentration of approx. 1 μΜ. Thereby, the concentration of released nucleotides will not exceed the critical limit of 1 μΜ, since within the first hour only approx. 20% of embedded nucleotides are released, followed by another 10% with the next hour and decreasing percentages during the following hours. Furthermore, triphosphate nucleotides released from the hydrogel into the extracellular space are rapidly degraded by extracellular enzymes to di- and mono-phosphate nucleotides.

15.1. Synthesis of the PLGA-PEG-PLGA hydrogel. The biodegradable PLGA-PEG-PLGA triblock polymer described in this example has a PLG/PEG weight ratio of 2.3 (70/30), and a lactide/glycolide molar ratio of approx. 15/1. Synthesis of the triblock copolymer is performed as described in example 1.

15.2. Synthesis of PS-liposomes containing CpG-ODN 1826. The synthesis of unilamellar PS-liposomes containing encapsulated

CpG-ODN 1826 ( 5' -TCCATGACGTTCCTGACGTT-3 ' _/ MW approx. 6059) with a natural phosphodiester backbone (PO CpG-ODN 1826) is performed as described in example 3. The final liposomal suspension contains approx. 59 μπιοΐ (approx. 35 mg) of lipid/ml (59 mM liposomal suspension) and approx. 1.5 mg encapsulated PO CpG-ODN 1826 (MW 6059; approx. 0.247 μπιθ1)/πι1, corresponding to an encapsulation efficiency of approx. 10%.

15.3. Synthesis of a PLGA-PEG-PLGA hydrogel composition comprising hydrogel-embedded ovalbumin (OVA) , hydrogel- embedded PS-liposomes with encapsulated CpG-ODN, and hydrogel - embedded ATP and UTP.

The PLGA-PEG-PLGA triblock copolymer of Example 1.1., dried under vacuum at room temperature until constant weight, is dissolved at 4°C in PBS at a concentration of 30% w/v polymer, and then mixed with PS-liposomes containing CpG-ODN 1826 at a ratio of two volumes hydrogel solution to one volume of liposomal suspension.

The final concentration of the hydrogel is 20% (w/w) containing CpG-ODN-loaded PS-liposomes at a concentration of approx. 20 μιηοΐ (12 mg) of lipid/ml and approx. 0.5 mg (82.5 nmol) encapsulated PO CpG-ODN/ml.

Per 1.0 ml of this mixture, 1.0 mg OVA/5 μΐ H₂0 (200 mg/ml; solubility approx. 1 g/ml H₂0) , 1.0 nmol ATP/ 5 μΐ H₂0 (40 μΜ) , 1.0 nmol UTP/ 5 μΐ H₂0 (40 μΜ) are added. The final hydrogel composition contains in 200 μΐ a) 20% w/v PLGA-PEG-PLGA, b) approx. 4 ymol (2.4 mg) PS-liposomes containing approx. 100 g (16.5 nmol) encapsulated PO CpG-ODN, c) 200 ig OVA, and d) 0.2 nmol ATP and 0.2 nmol UTP (the concentration of both nucleotides in the composition is 1 μΜ) .

EXAMPLE 16: SYNTHESIS OF HYDROGEL COMPOSITIONS FOR THE TREATMENT OF CAT-ALLERGIC MICE

This example describes the synthesis of PLGA-PEG-PLGA hydrogel compositions comprising hydrogel-embedded cat allergen (Fel d 1) , hydrogel-embedded CpG-ODN, and hydrogel-embedded ATP and UTP for the treatment of allergy.

16.1. Concentration of hydrogel-embedded CpG-ODN. As described in Example 15, the study of Volpi et al . (2013) provides an estimate of the tolerance-promoting amount of CpG-ODN 1826 in mice. Treatment with CpG-ODN 1826 was performed by intraperitoneal injection of 30 μg class B CpG-ODN 1826 (approx. 4.7 nmol; MW approx. 6364) per mouse twice, on the same days as the first and second administration of Aspergillus fumigatus culture filtrate extract.

For the composition of this example, the 20-mer class B CpG- ODN 1826 (MW 6364; 5' -tccatgacgttcctgacgtt-3' ) containing a full phosphorothioate backbone (specific for murine TLR9) is used. Since the immunotherapeutic treatment is performed with three subcutaneous injections, 20 μg class B CpG-ODN 1826 (approx. 3.1 nmol) are applied for each injection. 16.2. Concentration of hydrogel-embedded ATP and UTP. For the composition of this example, the concentration of ATP and UTP in the hydrogel composition is reduced to 250 nM (compare Example 15) . 16.3. Cat allergen Fel d 1. In order to exclude the influence of endotoxin on the outcome of the experiments, LoTox natural Fel d 1 (purity >95%; endotoxin <0.03 EU/ μg; Indoor Biotechnologies) is used for the composition of this example.

16.4. Synthesis of a PLGA-PEG-PLGA hydrogel composition comprising hydrogel-embedded Fel d 1, hydrogel-embedded CpG- ODN 1826, and hydrogel-embedded ATP and UTP. The PLGA-PEG-PLGA triblock copolymer of Example 1.1., dried under vacuum at room temperature until constant weight, is dissolved at 4°C in endotoxin-free PBS at a concentration of 20% w/v polymer. Per 1.5 ml of the 20% w/v hydrogel, 63 μΐ (200 pg) class B CpG-ODN 1826 (approx. 31.4 nmol) in endotoxin- free water (concentration according to the recommendation of Indoor Biotechnologies) , 100 μΐ (100 yg) LoTox natural Fel d 1 in endotoxin- free water, 50 μΐ of 10 μΜ ATP (500 nmol) in endotoxin-free water, 50 μΐ of 10 μΜ UTP (500 nmol) in endotoxin-free water and 237 μΐ endotoxin- free water (total volume 2.0 ml) .

The final hydrogel composition contains in 200 μΐ a) 15% w/v PLGA-PEG-PLGA, b) 20 ig class B CpG-ODN 1826 (approx. 3.1 nmol), c) 10 \ig Fel d 1, and d) 0.05 nmol ATP and 0.05 nmol UTP (the concentration of both nucleotides in the composition is 250 nM) . EXAMPLE 17: IMMUNOTHERAPY OF Fel d 1-SENSITIZED MICE

In this example, the therapeutic efficacy of the hydrogel composition of Example 16 for allergen-specific immunotherapy in Fel d 1-sensitized mice is evaluated. 17.1. Murine acute airway allergy model A schematic outline of this experiment is shown in Fig.3. Female Balb/c mice (8 weeks old at starting day) are used.

Sensitization is performed by 3 successive intraperitoneal (IP) injections of 10 yg Fel d 1 (natural LoTox Fel d 1) with 500 g Al(OH)₃ in 200 μΐ PBS, at days 0, 14 and 28. A control group receives 3 successive IP injections of 500 g Al(OH) 3 in 200 μΐ PBS. Specific immunotherapy is performed by 3 successive subcutaneous (SC) injections (at days 42, 56 and 70) . Three groups of mice are compared.

Group I: Treatment with 200 μΐ hydrogel composition of Example 16 comprising a) 15% w/v PLGA-PEG- PLGA, b) 20 μς class B CpG-ODN 1826 (approx. 3.1 nmol) , c) 10 μς Fel d 1, and d) 0.05 nmol ATP and 0.05 nmol UTP (the concentration of both nucleotides in the composition is 250 nM) (Hydrogel + Find Me group) . Group II (allergy group) : Treatment with 200 μΐ PBS via IP injections (Allergic group) .

Group III (control group) : Treatment with 200 μΐ PBS via IP injections (Control group) .

Challenge is performed by nasal instillation (NI) with 5 μg Fel d 1 in 50 μΐ PBS on days 83, 84 and 85. Control mice receive only PBS during the nasal instillations. Read outs : On day 86, serum immunoglobulin profiles are determined, the airway hyperreactivity of the mice is tested by flexiVent analysis upon methacholine challenges, then BALF analyses are performed. 17.1. Analysis of serum levels of antibodies Mice are bled at day 86 and analysed for Fel d 1-specific IgE, Fel d 1-specific IgA, and Fel d 1-specific IgGl by ELISA.

Plates are coated with Fel d 1 in 100 μΐ 0.1 M NaHC0₃ for 6 h at 37°C, followed by blocking with 200 μΐ 3% BSA in PBS, pH 7.4, for 2 h at 37°C. After washing, 100 μΐ of 1:40 serum dilutions with PBS, pH 7.4, containing 1% BSA are incubated overnight at 4°C. The amount of bound antibody is analyzed using horseradish peroxidise-conjugated antibodies with specificity for murine heavy chain classes (IgE, IgGA, and IgGl) . Analysis is performed at 405 nm in a microplate autoreader .

Results are shown in figure 4. Fel d 1-specific IgE and Fel d 1-specific IgGl are decreased significantly after immunotherapy. Since IgE and IgGl are good markers for the induction of an allergic TH2 response in mice (Adel-Patient et al . , 2000), the decrease of both immunoglobulins indicates the successful induction of tolerance.

17.3. Analysis of airway hyperreactivity (AHR)

Three to five mice of each group are analyzed for airway responsiveness to inhaled methacholine . A detailed description of the procedure for the assessment of airway responsiveness to inhaled methacholine in mice using the forced oscillation technique (flexiVent; SCIREQ Inc, Montreal, Qc, Canada) is provided by McGovern et al . (2013) .

Figure 5 shows the airway resistance (opposition to flow caused by the forces of friction, defined as the ratio of driving pressure to the rate of air flow) of the different groups at 25 mg/ml methacholine and at 50 mg/ml methacholine. At both concentrations resistance is back to baseline levels after immunotherapy. Figure 6 shows the airway compliance (a measure of the ease of expansion of the lungs, determined by pulmonary volume and elasticity) of the different groups at 25 mg/ml methacholine and at 50 mg/ml methacholine. At both concentrations compliance is back to baseline levels after immunotherapy.

17.4. Bronchoalveolar lavage (BAL) analysis

The lungs from three to five mice of each group are lavaged in situ with three 3 successive washes: first with 700 μΐ PBS- BSA-protease inhibitor to collect cells and cytokines, then 2 times with 700 μΐ PBS only to collect the rest of the cells.

The BAL is centrifuged and the cytokine supernatant is profiled using a panel of cytokines including IL-4, IL-5, IL- IL-13, IL-17, IFN-γ and TNF-a. As shown in figure 7, BAL levels of the TH2 cytokines IL-5 and IL-13 are decreased significantly after immunotherapy which is in accordance with a successful induction of tolerance. Furthermore, the decrease of IL-17 to baseline levels (figure 8) may point to the induction of tolerance- inducing regulatory T cells, since recent studies support a hypothesis that a reciprocal relationship between regulatory T cells and TH17 differentiation pathway may exist (Bettelli et al., 2006). The effect of immunotherapy on IFN-γ, the principal TH1 effector cytokine, is difficult to evaluate since significant variations in the Bal levels of this cytokines are observed in control animals, allergic animals and therapeutically treated animals (figure 8) . The increased BAL level of TNF-a in therapeutically treated mice is due to the fact that high doses of CpG-ODN elicit TNF-a-dependent toxicity in rodents. Rodents express TLR9 in monocyte/macrophage lineage cells as well as in plasmacytoid DCs (pDCs) and B cells, whereas in humans B cells are the principal TLR9-expressing cells (Campbell et al., 2009). The cell pellets are suspended in 250 μΐ saline. BAL protein concentrations are measured in the supernatants by the bicinchoninc acid (BCA) assay using the BCA™ Protein Assay Kit (Pierce, USA) and bovine serum albumin as standard. Total leukocytes are counted in a hemocytometer using trypan blue dye exclusion as a measure of viability. Cytospin slides are made and stained with May-Grunwald/Giemsa to determine the BAL cell differential. The remaining cells are analyzed by fluorescence flow cytometry. For these analyses, BAL samples are washed in phosphate-buffered saline (PBS) containing 0.2% bovine serum albumin and 0.1% a 3. Aliquots containing 10⁴ to 10^s cells are incubated with 100 μΐ of appropriately diluted antibodies for 30 min at 4°C. After staining, the cells are washed twice with the above PBS solution, and relative fluorescence intensities are determined on a -decade log scale by flow cytometric analysis using a FACScan (Becton Dickinson) .

Results are shown in figures 9 and 10. Most important is the decreased BAL level of eosinophils after immunotherapy (figure 8) . Since the accumulation of eosinophils in BAL fluids is associated with asthma and allergy, the significant decrease of eosinophils in BAL fluids after immunotherapy points to a successful induction of tolerance.

EXAMPLE 18: EVALUATION OF FIND-ME SIGNALS FOR IMMUNOTHERAPY OF Fel d 1-SENSITIZED MICE

In this example, the therapeutic efficacy of find-me signals (ATP and UTP) within the hydrogel composition of Example 16 for allergen-specific immunotherapy in Fel d 1-sensitized mice is evaluated.

18.1. Murine acute airway allergy model

A schematic outline of this experiment is shown in Fig.11. Female Balb/c mice (8 weeks old at starting day) are used. Sensitization is performed by 3 successive intraperitoneal (IP) injections of 10 g Fel d 1 (natural LoTox Fel d 1) with 500 g Al(OH)₃ in 200 μΐ PBS, at days 0, 14 and 28. A control group receives 3 successive IP injections of 500 yg Al(OH)3 in 200 μΐ PBS .

Specific immunotherapy is performed by 3 successive subcutaneous (SC) injections (at days 42, 56 and 70) . Four groups of mice are compared.

Group I: Treatment with 200 μΐ hydrogel composition of Example 16 comprising a) 15% w/v PLGA-PEG- PLGA, b) 20 μg class B CpG-ODN 1826 (approx. 3.1 nmol) , c) 10 pg Fel d 1, and d) 0.05 nmol ATP and 0.05 nmol UTP (the concentration of both nucleotides in the composition is 250 nM) (SIT

Hydrogel + Find Me group) .

Group II: Treatment with 200 μΐ hydrogel composition of Example 16 comprising a) 15% w/v PLGA-PEG- PLGA, b) 20 class B CpG-ODN 1826 (approx. 3.1 nmol), c) 10 μς Fel d 1, but without ATP and UTP (SIT Hydrogel) .

Group III (allergy group) : Treatment with 200 μΐ PBS via IP injections (Allergic group) .

Group IV (control group) : Treatment with 200 μΐ PBS via IP injections (Control group) .

Challenge is performed by nasal instillation (NI) with 5 μg Fel d 1 in 50 μΐ PBS on days 83, 84 and 85. Control mice receive only PBS during the nasal instillations.

Read outs : On day 86, the airway hyperreactivity of the mice is tested by FlexiVent analysis upon methacholine challenges. 18.2. Analysis of airway hyperreactivity (AHR)

Three to five mice of each group are analyzed for airway responsiveness to inhaled methacholine as described in Example 17. Results are shown in figures 12 and 13. As evident from the figures, addition of sub-micromolar concentrations of the find-me molecules ATP and UTP to the hydrogel compositions further decreases airway hyperreactivity to inhaled methacholine .

References

Adel-Patient . , et al . , J. Immunol. Meth. 235: 21-32; 2000.

Al-Jaderi Z., et al., Toxins 5 : 1932-1947 ; 2013.

Altamimi S., et al . Pediatr. Emerg. Care 22: 786-793; 2006.

Amara A., Mercer J., Nat. Rev. Microbiol. 13: 461-469; 2015. Anagnostou K. , Clark A., Annu. Rev. Med. 67: 375-385; 2016.

Anderson R. , et al . Arthr. Res. Ther. 12 : R147 ; 2010.

Apetoh L. et al . , Nat. Immunol. 11: 854-861; 2010.

Barnes P.J., Allergy 56: 928-936; 2001.

Belogurov Jr. A., et al . FASEB J. 27: 222-231; 2013.

Belogurov Jr. A.; et al . , Neurotherap. 13: 895-904; 2016.

Bettelli E., et al . , Nature 441: 235-238; 2006.

Bonifazi F.,et al . , Allergy 60:1459-1470; 2005.

Branisteanu D.D., et al . J. Neuroimmunol . 61: 151-160; 1995.

Burton B.R., et al . Nature Communications 5, article 4741;

2014.

Campbell J.D., et al . , J. Clin. Invest. 119: 2564-2576; 2009. Cantorna M.T., et al . J. Immunol. 160: 5314-5319; 1998a. Cantorna M.T., et al. J. Nutr. 128: 68-72; 1998b.

Capini C, et al . J. Immunol. 182: 3556-3565; 2009.

Chekeni F.B., Ravichandran K.S., J. Mol . Med. 89: 13-22; 2011. Chen X., et al., J. Immunol. 173: 2985-2994; 2004.

Cirunay J.J.N. , et al. J. Chromatogr. Sci. 36: 417-421; 1998. Cohen S., et al . Biochim. Biophys . Acta 1063: 95-102; 1991. Elliott, M.R., et al., Nature 461 : 282-286 ; 2009.

Fadok V.A., et al., J. Immunol. 148 : 2207-2216 ; 1992.

Fadok V.A., et al., J. Clin. Invest. 101: 890-898; 1998.

Fallarino F., Puccetti, P., Eur. J. Immunol. 36: 8-11; 2006. Flanagan M.E., et al . , J Med Chem. 53:8468-8484; 2010.

Fleischer D.M., et al . , J. Allergy Clin. Immunol. 131: 119- 127; 2013.

Fleischmann R., et al . , N. Engl. J. Med. 367: 495-507; 2012a. Fleischmann R. , et al . , Arthritis Rheum. 64: 617-629; 2012b. Gagliani N. , et al . Nat. Med. 19: 739-746; 2013.

Garber . Nature 507: 418-420; 2014

Garcia Z., et al., Proc. Natl. Acad. Sci. USA 104: 4553-4558;

2007

Ghoreishi M. , et al . , J. Immunol. 182: 6071-6078; 2009.

Golali E., et al . , Iranian J. Basic Med. Sci. 15 : 1032-1045 ; 2012.

Golali E., et al . , Iranian J. Basic Med. Sci. 15 : 1032-1045 ;

2012.

Gombault A., et al . , Frontiers Immunol. 3: article 414; 2013. Gong C.Y., et al . , Int. J. Pharm. 365: 89-99; 2009.

Graham K.L., et al . , Autoimmunity 43: 140-155; 2010.

Greenberg R.A. , et al . Clin. Pediatr. (Phila.) 47: 817-823;

2008.

Grohmann U. , et al . , J. Immunol. 171: 2581-2587; 2003.

Gupta P., Bhatia V. Indian J. Pediatr. 75: 1039-1044; 2008.

Harel-Adar T., et al . , Proc. Natl. Acad. Sci. USA 108 : 1827- 1832 ; 2011.

Hayashi T., et al . , J. Clin. Invest. 114: 270-279; 2004.

Hegeman M.A. , et al . Brit. J. Pharmacol. 163: 1048-1058; 2011. Hemmi H. , et al . , Nature 408: 740-745; 2000.

Hirst M. , Feldman D. Biochem. Biophys. Res. Commun. 105: 1590- 1596; 1982a.

Hirst M. , Feldman D. Endocrinol. Ill: 1400-1402; 1982b.

Ho P.P., P. et al., J. Immunol. 171: 4920-4926; 2003.

Hochreiter-Hufford A., Ravxchandran K.S., Cold Spring Harb. Perspect. Biol. 5: a008748; 2013.

Hoffmann P.R., et al., J. Cell Biol. 155: 649-659; 2001.

Hoffmann P.R. , et al., J. Immunol. 174 : 1393-1404 ; 2005.

Hyun H., et al . , Biomacromolecules 8: 1093-1100; 2007.

Huynh M.L., et al . , J. Clin. Invest. 109: 41-50; 2002.

Imaizumi T. , et al . J. Toxicol. Sci. 21 (supplement II):277- 285; 1996.

Incorvaia C, et al., Monaldi Arch. Chest. Dis. 65:41-43; 2006. Ishii M., et al. Intern. Immunopharmacol .10 : 1041-1046; 2010. Jahrsdorfer B. , et al., Clin. Cancer Res. 11:1490-1499; 2005. Kang Y.M. , et al., Biomaterials 31: 2453-2460; 2010.

Kawai T., Akira S., Nat. Immunol. 7: 131-137; 2006.

Keet C.A., et al., J. Allergy Clin. Immunol. 129: 448-455;

2012

Kim Y.H., et al., J. Am. Acad. Dermatol. 63: 975-83; 2010.

Kissmeyer A.-M., Binderup, L. , Biochem. Pharmacol .41 : 1601- 1606; 1991.

Koning G.A., et al . Arthritis Rheum. 54: 1198-1208; 2006.

Kono H., Rock, K.L., Nature Rev. Immunol. 8 : 279-289 ; 2008. Konur A., et al . , Open Cancer J. 2: 15-24; 2008.

Kragballe K. , Pharmacol. Toxicol. 77: 241-246; 1995.

Kremer J.M., et al . , Arthritis Rheumatism 60: 1895-1905; 2009.

Krieg A.M., et al . , J. Immunother. 27: 460-71; 2004.

Kubo S., et al., Ann. Rheum. Dis. 73 : 2192-2198 ; 2014.

Kwak H.W., D'Amico D.J. Korean J. Ophthalmol. 9 : 79-83 ;

1995.

Landewe R.B.N. , et al . Ann. Rheum. Dis. 69: 1655-1659; 2010.

Le U.H., Wesley Burks A., World Allergy Org. J. 7: 35; 2014.

Lenmark A., Larsson H.E. Nature Rev. Endocrinology 9: 92-103;

2013.

Leroux-Roels G. , Vaccine 285: C25-C36; 2010.

Li X., et al., Biomed. Chromatogr. 27: 1714-1719; 2013.

Longui C.A. , J. Pediatr. (Rio J.) 83: S163-171; 2007.

McGovern T.K., et al . , J. Vis. Exp. 2013; (75): 50172.

Mellor A.L., et al . , J. Immunol. 175: 5601-5605; 2005. Meyer D.M., et al . , J. Inflamm. (Lond) 7:41; 2010.

Merz K. , Sternberg B. , J. Drug Target. 2: 411-417; 1994.

Mohan A., et al., RSC Advances, 2015, 5, 79270.

Monastra G. , Bruni, A., Lymphokine Cytokine Res. 11 : 39-43 ;

1992.

Monastra G. , et al., Neurology 43 : 153-163 ; 1993.

Motomura Y. , et al . Nat. Immunol. 12: 450-459; 2011.

Miiller U. , et al . , J. Allergy Clin. Immunol. 101:747-754;

1998.

Muindi J.R., et al . Oncology 66: 62-66; 2004.

Nagata Y. , et al., PLoS ONE 12(1): e01170577; 2017.

Narisety S.D., et al . , J. Allergy Clin. Immunol. 135: 1275- 1282; 2015.

Nashold F.E., et al . J. Neuroimmunol . 263: 64-74; 2013.

Nicholls E.F., et al . , Ann. N.Y. Acad. Sci. 1213: 46-61; 2010. Nie S., et al . , Internatl. J. Nanomed. 6: 151-166; 2011.

Norman P.S, et al . , Am. J. Respir. Crit. Care Med. 154:1623- 1628; 1996.

Obst R., et al., Proc . Natl. Acad. Sci. USA 104: 15460-15465;

2007.

Okamura T., et al . Proc. Natl. Acad. Sci. USA 106: 13974- 13979; 2009.

Orabona C, et al . , Proc. Natl Acad. Sci. USA 105: 20828- 20833; 2008.

Otsuka M. , et al . , Biochem. Biophys . Res. Commun. 324: 1400- 1405; 2004.

Palomares O. , J. Investig. Allergol. Clin. Immunol. 23: 371- 382; 2013

Peng K.T., et al . , Biomaterials 31: 5227-5236; 2010.

Plum L.A., et al . Proc. Natl. Acad. Sci. USA 1001: 6900-6904;

2004.

Plum L.A. , DeLuca H.F., Nat. Rev. Drug Discov. 9: 941-955;

2010.

Ponzin D., et al . , Immunopharmacol . 18 : 167-176 ; 1989.

Pot C, et al. J. Immunol. 183: 797-801; 2009. Prickett S.R., et al., Clin. Exp. Allergy 45: 1015-1026; 2015. Puccetti P., Grohmann U. , Nat. Rev. Immunol. 7: 817-823; 2007. Qiao M. , et al., Int. J. Pharm. 294: 103-112; 2005.

Qureshi F., et al . J. Pediatr. 139 : 20-26 ; 2001.

Ravichandran K.S., Immunity 35 : 445-455 ; 2011.

Rhen T., Cidlowski J.A., N. Engl. J. Med. 353 : 1711- 1723 ;

2005.

Robinson D.S., J. Allergy Clin. Immunol. 126: 1081-1091; 2010. Sabatos- eyton C. A., et al. Curr. Opin. Immunol. 22: 609-615;

2010

Schweingruber N. , et al . J. Immunol. 187 : 4310-4318 ; 2011. Shakhar G. , et al . , Nat. Immunol. 6: 707-714; 2005.

Sharp A., et al . J. Neuroinflamm. 5 : 33 ; 2008.

Shi D. , et al., Arch. Dermatol. Res. 299: 327-336; 2007.

Singh D.K., Verma R. Iranian J. Pharmacol. Ther. 7: 61-65;

2008.

Spierings, J., van Eden, W. , Rheumatology 56: 198-208; 2017. Steinman R.M., et al . , J. Exp. Med. 191: 411-416; 2000.

Taher Y.A. , et al. J. Immunol. 180: 5211-5221; 2008.

Takasugi Y., et al . , Pharmacol. Pharmacy 4 : 248-254 ; 2013. Thomas R. , Arthritis Res. Therapy 15: 204-214; 2013.

Tremezaygues L. , Reichrath J. Dermatoendocrinol . 3: 180-186;

2011.

Van Herwijnen M.J., et al . , Proc . Natl. Acad. Sci. USA 109:

14134-14139; 2012.

Vazquez-Ortiz M. , Turner P.J., Pediatr. Allergy Immunol. 27:

117-125; 2016.

Vollmer J., Krieg A.M., Advanced Drug Delivery Rev. 61: 195- 204; 2009.

Volpi C, et al., J. Immunol 189: 2283-2289; 2012.

Volpi C, et al., Nat. Commun. 4: 1852- ; 2013.

Vultaggio A., et al . , J. Immunol. 186: 4707-4715; 2011.

Walczak A., et al . , J. Am. Med. Assoc. Neurol. 70: 1105-1109;

2013.

allner B.P., et al . , Allergy 49: 302-308; 1994. Wherry E.J. Nat. Immunol. 12: 492-499; 2011.

Wingender G. , et al . , Eur. J. Immunol. 36: 12-20; 2006.

Worm M. , et al., Expert Opin. Investig. Drugs 22:1347-1357;

2013.

Wu Z._f et al., J. Immunol. 184 : 3191-3201 ; 2010.

Wiist S., et al. J. Immunol. 180 : 8434-8443 ; 2008.

Xing Y. , et al . , J. Liposome Res. 24 : 10-16; 2014.

Yang M. , et al., Clin. Exp. Allergy 40: 668-678; 2010.

Yu C.F., et al., J. Immunol. 184: 1159-1167; 2010.

Zella J.B., et al. Arch. Biochem. Biophys. 417: 77-80; 2003. Zent C.S., et al . , Leuk. Lymphoma 53: 211-217; 2012.

Zhang J., et al . , Biomacromolecules 7: 2492-2500; 2006a.

Zhang J., et al . , J. Neuroimmunol . 172: 112-120; 2006b.

Claims

Pharmaceutical composition for the induction of tolerance by allergen- or autoantigen-specific immunotherapy in patients with allergic or autoimmune diseases, comprising a thermogelling hydrogel containing a) one or more hydrogel-embedded allergens or autoantigens or fragments derived thereof including short T cell peptides, b) tolerance-promoting concentrations of hydrogel-embedded synthetic oligodeoxynucleotides (ODN) with one or more CpG or GpC or GpG motifs, c) one or more hydrogel- embedded find-me molecules for attracting peripheral antigen-presenting cells (APC) to the site of the administered hydrogel composition, and d) optionally one or more tolerance-promoting immune modulators.

Pharmaceutical composition according to claim 1 wherein the thermogelling hydrogel for Phase A compositions is selected from the group consisting of polyethylene, polypropylene, polyethylene oxide (PEO) , polypropylene oxide (PPO) , polyurethane, polyurea, polyamides, polycarbonates, polyaldehydes , polyorthoesters, polyiminocarbonates , poly caprolactone (PCL), poly-D,L- lactic acid (PDLLA) , poly-L- lactic acid (PLLA) , lactides of said lactic acids, polyphosphazenes , polyglycolic acids, monomethoxypoly (ethylene glycol) (MPEG) , or copolymers or mixtures of any of the above including poly (lactic-co-glycolic acid) (PLGA) , copolymers of L- lactide and D, L-lactide, polyester copolymers, diblock copolymers consisting of MPEG and PCL, MPEG and PCL-ran- PLLA, MPEG and PLGA, PEO and PLLA, and triblock copolymers consisting of PEO-PPO-PEO, PEG-PCL-PEG, PEG- PLGA-PEG, and PLGA-PEG-PLGA, wherein the thermogelling hydrogel is a biodegradable or biostable polymer, preferably biodegradable, more preferably biodegradable and reverse thermogelling, wherein the gelling temperature is between 20°C and 40°C, preferably between 25°C and 35°C, and/or wherein 90% degradation of the polymer weight in body environment and/or 90% release of hydrogel-embedded components from the polymer is completed within 1 to 14 days, preferably within 2 to 7 days .

Composition according to claims 1 and 2, wherein hydrogel- embedded synthetic oligodeoxynucleotides (ODN) comprising one or more CpG or Gpc or GpG motifs are selected from a) ODN containing a fully or partially nuclease-resistant phosphorothioated backbone with one or more CpG or GpC or GpG motifs, and b) ODN containing a nuclease-susceptible natural phosphodiester backbone (PO ODN) with one or more CpG or GpC or GpG motifs, wherein PO ODN are preferred for co-encapsulation with food allergen-derived T cell peptides in hydrogel-embedded tolerance-promoting phosphatidyl-L-serine-presenting liposomes (PS- liposomes) .

Pharmaceutical composition according to claims 1 to 3, wherein the allergen-derived or autoantigen-derived fragments including short T cell peptides are encapsulated in hydrogel-embedded tolerance-promoting PS- liposomes together with tolerance-promoting amounts of ODN comprising one or more CpG or Gpc or GpG motifs.

Pharmaceutical composition according to claims 1 to 3, wherein find-me molecules for attracting peripheral APC to the site of administered hydrogel Phase A compositions are selected from lysophosphatidyl-choline (LPC) , sphingosine-1-phosphate (SIP) and the nucleotides ATP and UTP, wherein ATP and UTP are preferred find-me molecules. Pharmaceutical composition according to claims 1 to 5, wherein optional tolerance-promoting immune modulators are selected from vitamin D3 , preferably calcidiol, vitamin D3 derivatives exhibiting a short serum half -life and comparable tolerance-promoting effects as calcitriol and calcidiol, but low effects on calcium metabolism, preferably calcipotriol , and water-soluble glucocorticoids, preferably dexamethasone phosphate, wherein lipophilic tolerance-promoting immune modulators including vitaimin D3 and derivatives thereof preferably are incorporated into the lipid layer of hydrogel - embedded PS- liposomes containing encapsulated tolerance- promoting amounts of ODN comprising one or more CpG or Gpc or GpG motifs, or both ODN comprising one or more CpG or Gpc or GpG motifs and allergen-derived or autoantigen-derived fragments including short T cell peptides, and wherein water-soluble glucocorticoids are provided as hydrogel- embedded immune modulators or as liposomal immune modulators encapsulated in hydrogel - embedded PS- liposomes together with tolerance-promoting amounts of ODN comprising one or more CpG or Gpc or GpG motifs, or both ODN comprising one or more CpG or Gpc or GpG motifs and allergen-derived or autoantigen-derived fragments including short T cell peptides.

Composition according to claims 1 to 6, wherein tolerance- promoting PS-liposomes include conventional PS-liposomes, PS-ethosomes, PS-niosomes, and elastic PS-liposomes, preferably conventional PS-liposomes, wherein conventional PS-liposomes include multilamellar and large or small unilamellar PS-liposomes, preferably unilamellar PS-liposomes with a diameter of 0.5-5 μχη, more preferably unilamellar PS-liposomes with a diameter of 0.8-1.5 μπι, wherein for the preparation of conventional PS-liposomes various lipid mixtures containing phosphatidyl-L-serine (PS) , phosphatidylcholine (PC) and, optionally, cholesterol (CH) are applicable, wherein lipid mixtures comprising molar ratios of PS: C of 30:70 up to 50:50 for PS-containing liposomes without cholesterol and molar ratios of PS:PC:CH of 10:50:40 up to 30:30:40 for PS- containing liposomes with cholesterol are preferred.

. Composition according to any of the claims 1 to 7, wherein all components of each hydrogel composition are mixed as a single preparation prior to injection, wherein the components are mixed with each other in a therapeutically effective quantity, wherein optionally galenic compounds are additionally admixed to the preparation, and wherein the composition is galenically prepared for subcutaneous, intramuscular, or intraocular administration, preferably for subcutaneous administration.

. Use of a composition according to one of the claims 1 to 8 for the induction of tolerance by subcutaneous autoantigen- or allergen-specific immunotherapy in an organism, preferably a human, in need thereof, preferably for the treatment of allergy, allergic asthma, type 1 diabetes, rheumatoid arthritis, autoimmune uveitis, and multiple sclerosis, and wherein the pharmaceutical composition is administered in a therapeutically effective dose.

0. Use of a composition according to one of the claims 1 to 8 for the induction of tolerance in patients with allergic or autoimmune diseases by a combination of subcutaneous hydrogel-based immunotherapy with allergen- derived or autoantigen-derived T cell peptides according to one of the claims 1 to 8 (Phase A) , and subsequent immunotherapy with B cell epitope-containing allergens or autoantigens or fragments thereof (Phase B) after sufficient modulation of CD4⁺ T-cells towards IL-10- secreting CD4⁺ T cells with an anergic, regulatory phenotype, wherein Phase B immunotherapy is selected preferably from a) subcutaneous immunotherapy with hydrogel-based compositions according to one of the claims 1 to 8 comprising natural or recombinant allergens or autoantigens or B cell epitope-containing fragments thereof, b) subcutaneous immunotherapy with natural or recombinant allergens or autoantigens or B cell epitope- containing fragments thereof formulated in alum or microcrystalline tyrosine, c) sublingual immunotherapy with compositions comprising natural allergens or recombinant allergen or B cell epitope-containing fragments thereof, and d) oral immunotherapy with compositions comprising natural allergens or recombinant allergen or B cell epitope-containing fragments thereof, wherein the treatment duration of Phase B immunotherapy is determined individually based on the development of protective antibodies and the improvement of the clinical score upon challenge with allergen or autoantigen.