WO2019068647A1 - Complete resistance to downy mildew in basil - Google Patents

Complete resistance to downy mildew in basil Download PDF

Info

Publication number
WO2019068647A1
WO2019068647A1 PCT/EP2018/076661 EP2018076661W WO2019068647A1 WO 2019068647 A1 WO2019068647 A1 WO 2019068647A1 EP 2018076661 W EP2018076661 W EP 2018076661W WO 2019068647 A1 WO2019068647 A1 WO 2019068647A1
Authority
WO
WIPO (PCT)
Prior art keywords
plant
snp
seq
basil
nucleotide
Prior art date
Application number
PCT/EP2018/076661
Other languages
French (fr)
Inventor
Elisabeth ESCH
Carolin GRAF
Lisa SCHLUCHTER-RICKER
Wim VRIEZEN
Original Assignee
Hild Samen Gmbh
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Hild Samen Gmbh filed Critical Hild Samen Gmbh
Publication of WO2019068647A1 publication Critical patent/WO2019068647A1/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H6/00—Angiosperms, i.e. flowering plants, characterised by their botanic taxonomy
    • A01H6/50—Lamiaceae, e.g. lavender, mint or chia
    • A01H6/506—Ocimum basilicum [basil]
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
    • A01H1/04—Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection
    • A01H1/045—Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection using molecular markers
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H5/00—Angiosperms, i.e. flowering plants, characterised by their plant parts; Angiosperms characterised otherwise than by their botanic taxonomy
    • A01H5/12—Leaves
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/13—Plant traits
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Definitions

  • This invention relates to the field of plant breeding.
  • the present invention relates to a cultivated plant of the species Ocimum basilicum resistant to downy mildew.
  • the present invention further relates to pollen and seed produced by the cultivated plant of the present invention, seed from which the cultivated plant of the present invention can be grown and a part from the cultivated plant according to the present invention.
  • the present invention further relates to a method of producing a plant according to the present invention.
  • Basil plants of the species Ocimum basilicum belong to the family of the Lamiaceae (mints) and are globally grown and used as a culinary herb, but also as ornamental plants. There is much variation within the species Ocimum basilicum which leads to many differences in morphology, growth habit and taste. Accordingly, many distinct Ocimum basilicum varieties have been described, including sweet basil, cinnamon basil and Thai basil (also known as anise basil or licorice basil). Sweet basil is the most commercially relevant cultivated basil plant which is based on its widespread use as a fresh culinary herb or for the production and use as a dried culinary herb. The high variability that can be observed between different Ocimum basilicum plants is reflected by a high genetic complexity that can be explained by the occurrence of allopolyploidy and/or additional chromosomes.
  • basil different species within the genus Ocimum or hybrids between different species in the genus Ocimum may also be called basil.
  • examples of such other species or hybrids include holy basil ⁇ Ocimum tenuiflorum) and lemon basil, which is a hybrid between the different species Ocimum basilicum and Ocimum americanum.
  • Cultivated plants of the species Ocimum basilicum have been developed for centuries to improve their characteristics such as plant architecture, growth habit and taste.
  • Particularly common cultivated sweet basil plants are of the so-called Genovese type that are characterized by a typical leaf shape, plant architecture and taste. Sweet basil of the Genovese type is particularly useful as a culinary herb in Italian cuisine.
  • Cultivated Ocimum basilicum plants are available as open pollinated crossbreds but also as hybrid plants which may have advantages such as improved uniformity, vitality and/or disease tolerance.
  • Nufar Fl is a Fl hybrid plant variety resistant against Fusarium wilt.
  • Basil downy mildew caused by the oomycetes Peronospora belbarii is a destructive disease that has a major impact on the cultivation of basil.
  • basil downy mildew spread from Switzerland where it was first noticed in 2001, through Europe into Africa, Asia, South- and North America. Infection with basil downy mildew results in chlorosis and necrosis of the affected leaf tissue, ultimately leading to defoliation and plant death.
  • the present invention relates to a cultivated plant of the species Ocimum basilicum comprising in its genome a single recessive gene conferring resistance to downy mildew when present in homozygous form.
  • the present invention further relates to pollen and seed produced by the cultivated plant of the present invention, seed from which the cultivated plant of the present invention can be grown and a part from the cultivated plant according to the present invention wherein the part comprises the single recessive gene as defined herein, preferably wherein the part is selected from the group consisting of a leaf, anther, pistil, stem, petiole, root, ovule, pollen, protoplast, tissue, seed, flower, cotyledon, hypocotyl, embryo and cell.
  • the present invention relates to a method of producing a cultivated plant of the species Ocimum basilicum comprising in its genome a single recessive gene conferring downy mildew resistance, said method comprising the step(s) of: (i) crossing a first basil plant and a second basil plant, wherein the first plant is the cultivated plant according to the present invention; (ii) optionally harvesting seed from the crossing of (i) and selecting seed comprising the single recessive gene as defined herein.
  • SEQ ID NO: 1 shows the DNA sequence of a downy mildew susceptible Ocimum basilicum plant comprising the susceptible type nucleotide for SNP 01.
  • SEQ ID NO: 2 shows the DNA sequence of a downy mildew resistant Ocimum basilicum plant comprising the resistant type nucleotide for SNP 01.
  • SEQ ID NO: 3 shows the DNA sequence of a downy mildew susceptible Ocimum basilicum plant comprising the susceptible type nucleotide for SNP 02.
  • SEQ ID NO: 4 shows the DNA sequence of a downy mildew resistant Ocimum basilicum plant comprising the resistant type nucleotide for SNP 02.
  • SEQ ID NO: 5 shows the DNA sequence of a downy mildew susceptible Ocimum basilicum plant comprising the susceptible type nucleotide for SNP 03.
  • SEQ ID NO: 6 shows the DNA sequence of a downy mildew resistant Ocimum basilicum plant comprising the resistant type nucleotide for SNP 03.
  • SEQ ID NO: 7 shows the DNA sequence of a downy mildew susceptible Ocimum basilicum plant comprising the susceptible type nucleotide for SNP 04.
  • SEQ ID NO: 8 shows the DNA sequence of a downy mildew resistant Ocimum basilicum plant comprising the resistant type nucleotide for SNP 04.
  • SEQ ID NO: 9 shows the DNA sequence of a downy mildew susceptible Ocimum basilicum plant comprising the susceptible type nucleotide for SNP 05.
  • SEQ ID NO: 10 shows the DNA sequence of a downy mildew resistant Ocimum basilicum plant comprising the resistant type nucleotide for SNP 05.
  • SEQ ID NO: 11 shows the DNA sequence of a downy mildew susceptible Ocimum basilicum plant comprising the susceptible type nucleotide for SNP 06.
  • SEQ ID NO: 12 shows the DNA sequence of a downy mildew resistant Ocimum basilicum plant comprising the resistant type nucleotide for SNP 06.
  • TGTGATCCTA TCCTCTCTTC TCTATCAGCT CTCGGATATT CCCGTGGACA ATGTAGTAAA TATTTCATCA GAGAGCTCTA CCTTTGAATG CATATCATGG CTTGTGCTTA TGTCTTTTCT TCTACCTGAC ATGGATTGAC ATGTCACATG TATGTTTTCT TGATTGATTT TCAATGGAAA CAACCTATGT GCTAGTTATT GTTTACTCTT GGTTTGCATT TGTTGTTGAA CATTTTTTGG ACACTGTCAT TCTTGTATGT CTAATCATGA GAAAAAGAAC CCTACTTGTG TTGGATCTCA TGGTGTGCTA T
  • Figure 1 Example of a downy mildew susceptible Ocimum basilicum sweet basil plant of the "Adriana” variety.
  • Figure 2 Example of a rpbl plant; a cultivated plant of the species Ocimum basilicum comprising complete resistance to downy mildew.
  • the term "genome” relates to the genetic material of an organism. It consists of DNA. The genome includes both the genes and the non-coding sequences of the DNA.
  • genetic determinant relates to the genetic information in the genome of the plant that causes a particular trait of a plant. Accordingly, a genetic determinant comprises the genetic information (gene or locus or introgression) that confers a certain trait.
  • a genetic determinant may comprise a single gene (or one Quantitative Trait Locus (QTL)) or more than one gene. In the present invention, the genetic determinant comprises a single gene.
  • the term " single recessive gene conferring downy mildew resistance” relates to the genetic information, in the form of a single recessive gene, in the genome of the plant that causes the trait of downy mildew resistance in the plants of the invention, i.e. the resistance towards downy mildew.
  • the genetic determinant comprises a single gene (or one Quantitative Trait Locus (QTL)).
  • allelism test is a test known in the art that can be used to identify whether two genes conferring the same trait are located at the same locus.
  • the word "trait” in the context of this application refers to the phenotype of the plant.
  • its genome comprises the genetic determinants causing the traits of the invention.
  • the plant thus, has the genetic determinants of the invention. It is understood that when referring to a plant comprising the trait of the plant of the invention, reference is made to a basil plant comprising the trait of downy mildew resistance.
  • a genetic determinant can be inherited in a recessive manner, an intermediate manner, or in a dominant manner. Selection for the phenotypic trait is easier when intermediate or dominant inheritance is involved, as a larger part of the progeny of a cross reveals the trait.
  • a genetic determinant can also comprise a combination of recessive and/or intermediate and/or dominant genes or QTLs. In the present invention, the genetic determinant comprises a single recessive gene.
  • Selection for a genetic determinant can be done on phenotype (the trait that can be observed). Selection can also be done by using one or more molecular markers that are genetically linked to the resistance gene.
  • the use of molecular markers in breeding also referred to as "marker assisted selection" requires a smaller population for screening (when compared to phenotypical selection), and can be done in a very early stage.
  • a further advantage of molecular marker-assisted selection is the possibility to distinguish between heterozygous plants having one copy of the rpbl gene and homozygous plants having no copies of the rpbl gene of the present invention, which both show the same susceptible phenotype.
  • the skilled person will understand that the identification of molecular markers requires a large mapping population.
  • molecular markers such as SNPs (Single Nucleotide Polymorphisms), AFLPs (Amplified Fragment Length Polymorphisms; see, e.g., EP 534 858), or others, and by software analysis molecular markers which co-segregate with the downy mildew resistance trait in the segregating population can be identified and their order and genetic distance (centimorgan distance, cM) to the downy mildew resistance-conferring gene, locus or allele can be identified.
  • SNPs Single Nucleotide Polymorphisms
  • AFLPs Ampliclified Fragment Length Polymorphisms
  • a "plant line” or “breeding line” refers to a plant and its progeny.
  • the term “inbred line” refers to a plant line which has been repeatedly selfed and is nearly homozygous for every o
  • an "inbred line” or “parent line” refers to a plant which has undergone several generations (e.g. at least 5, 6, 7 or more) of inbreeding, resulting in a plant line with a high uniformity.
  • allele(s) means any of one or more alternative forms of a gene at a particular locus, all of which alleles relate to one trait or characteristic at a specific locus.
  • alleles of a given gene are located at a specific location, or locus (loci plural) on a chromosome.
  • loci plural locus on a chromosome.
  • One allele is present on each chromosome of the pair of homologous chromosomes.
  • a diploid plant species may comprise a large number of different alleles at a particular locus. These may be identical alleles of the gene (homozygous) or two different alleles (heterozygous).
  • locus means a specific place or places or a site on a chromosome where for example a gene or genetic marker is found.
  • locus is thus the location(s) in the genome of a basil plant where the downy mildew resistance-conferring gene is found.
  • gene means a (genomic) DNA sequence comprising a region (transcribed region), which is transcribed into a messenger RNA molecule (mRNA) in a cell, and an operably linked regulatory region (e.g. a promoter).
  • a gene may thus comprise several operably linked sequences, such as a promoter, a 5' leader sequence comprising e.g. sequences involved in translation initiation, a (protein) coding region (cDNA or genomic DNA) and a 3' non-translated sequence comprising e.g. transcription termination sites.
  • Different alleles of a gene are thus different alternative forms of the gene, which may be in the form of e.g.
  • a gene may be an endogenous gene (in the species of origin) or a chimeric gene (e.g. a transgene or cis-gene).
  • Transgene or “chimeric gene” refers to a genetic locus comprising a DNA sequence, such as a recombinant gene, which has been introduced into the genome of a plant by transformation, such as Agrobacterium mediated transformation.
  • a plant comprising a transgene stably integrated into its genome is referred to as "transgenic plant”.
  • RNA which is biologically active, i.e. which is capable of being translated into a biologically active protein or peptide (or active peptide fragment) or which is active itself (e.g. in posttranscriptional gene silencing or RNAi).
  • the coding sequence may be in sense-orientation and encodes a desired, biologically active protein or peptide, or an active peptide fragment.
  • a “quantitative trait locus”, or “QTL” is a chromosomal locus that encodes for one or more alleles that affect the expressivity of a continuously distributed (quantitative) phenotype.
  • "Physical distance" between loci (e.g. between molecular markers and/or between phenotypic markers) on the same chromosome is the actually physical distance expressed in bases or base pairs (bp), kilo bases or kilo base pairs (kb) or megabases or mega base pairs (Mb).
  • mutant allele refers herein to an allele comprising one or more mutations in the coding sequence (mRNA, cDNA or genomic sequence) compared to the wild type allele.
  • Such mutation(s) e.g. insertion, inversion, deletion and/or replacement of one or more nucleotide(s)
  • Mutant alleles can be either "natural mutant” alleles, which are mutant alleles found in nature (e.g. produced spontaneously without human application of mutagens) or "induced mutant” alleles, which are induced by human intervention, e.g. by mutagenesis.
  • Wild type plant or “susceptible plant” refers herein to a Ocimum basilicum plant comprising (conferring) no resistance against basil downy mildew. Such plants are for example suitable controls in phenotypic assays.
  • wild type plants are "cultivated Ocimum Basilicum plants” or "cultivated basil plants”.
  • the variety "Adriana” is a commercial cultivated basil plant susceptible to downy mildew.
  • Another example of a susceptible cultivated basil plant is the variety "Bavires”, while other varieties only show intermediate resistance to downy mildew. No cultivated basil plants conferring a complete resistance to basil downy mildew are known.
  • Introgression fragment or “introgression segment” or “introgression region” refers to a chromosome fragment (or chromosome part or region) which has been introduced into another plant of the same or related species by crossing or traditional breeding techniques, such as backcrossing, i.e. the introgressed fragment is the result of breeding methods referred to by the verb "to introgress” (such as backcrossing).
  • to introgress such as backcrossing
  • wild or primitive Ocimum basilicum accessions or wild relatives of Ocimum basilicum plants can be used to introgress fragments of the wild genome into the genome of a cultivated Ocimum basilicum plant.
  • Such a cultivated basil plant thus has a "genome of cultivated Ocimum basilicum plant", but comprises in the genome a fragment of a wild or primitive Ocimum basilicum or of a wild relative of Ocimum basilicum plant, e.g. an introgression fragment of a related wild Ocimum basilicum genome.
  • introduction fragment never includes a whole chromosome, but only a part of a chromosome.
  • the introgression fragment can be large, e.g.
  • a chromosome is preferably smaller, such as about 15 Mb or less, such as about 10 Mb or less, about 9 Mb or less, about 8 Mb or less, about 7 Mb or less, about 6 Mb or less, about 5 Mb or less, about 4 Mb or less, about 3 Mb or less, about 2.5 Mb or 2 Mb or less, about 1 Mb (equals 1,000,000 base pairs) or less, or about 0.5 Mb (equals 500,000 base pairs) or less, such as about 200,000 bp (equals 200 kilo base pairs) or less, about 100,000 bp (100 kb) or less, about 50,000 bp (50 kb) or less, about 25,000 bp (25 kb) or less.
  • the term "isogenic plant” refers to two plants which are genetically identical except for the genetic determinant for the downy mildew resistance trait.
  • a plant line (or variety) of interest with a plant comprising the genetic determinants for the downy mildew resistance trait and select for progeny expressing the desired trait.
  • nucleic acid sequence or “nucleic acid molecule” or polynucleotide are used interchangeably and refer to a DNA or RNA molecule in single or double stranded form, particularly a DNA encoding a protein or protein fragment according to the invention.
  • isolated nucleic acid sequence refers to a nucleic acid sequence which is no longer in the natural environment from which it was isolated, e.g. the nucleic acid sequence in a bacterial host cell or in the plant nuclear or plastid genome.
  • protein protein
  • amino acid sequence amino acid sequence
  • polypeptide polypeptide
  • a “fragment” or “portion” of a protein may thus still be referred to as a "protein”.
  • isolated protein is used to refer to a protein which is no longer in its natural environment, for example in vitro or in a recombinant bacterial or plant host cell.
  • active protein or “functional protein” is a protein which has protein activity as measurable in vitro, e.g.
  • a wild type protein is a fully functional protein, as present in the wild type plant.
  • a “mutant protein” is herein a protein comprising one or more mutations in the nucleic acid sequence encoding the protein, whereby the mutation results in (the mutant nucleic acid molecule encoding) a protein having altered activity.
  • “Functional derivatives” of a protein as described herein are fragments, variants, analogues, or chemical derivatives of the protein which retain at least a portion of the activity or immunological cross reactivity with an antibody specific for the mutant protein.
  • a fragment of a mutant protein refers to any subset of the molecule.
  • Variant peptides may be made by direct chemical synthesis, for example, using methods well known in the art.
  • An analogue of a mutant protein refers to a non-natural protein substantially similar to either the entire protein or a fragment thereof.
  • a "mutation" in a nucleic acid molecule is a change of one or more nucleotides compared to the wild type sequence, e.g. by replacement, deletion or insertion of one or more nucleotides.
  • a "point mutation” is the replacement of a single nucleotide, or the insertion or deletion of a single nucleotide.
  • a "mutation" in an amino acid molecule making up a protein is a change of one or more amino acids compared to the wild type sequence, e.g. by replacement, deletion or insertion of one or more amino acids.
  • operably linked refers to a linkage of polynucleotide elements in a functional relationship.
  • a nucleic acid is “operably linked” when it is placed into a functional relationship with another nucleic acid sequence.
  • a promoter or rather a transcription regulatory sequence, is operably linked to a coding sequence if it affects the transcription of the coding sequence.
  • Operably linked means that the nucleic acid sequences being linked are typically contiguous.
  • sequence similarity or identity may be determined by searching against databases such as FASTA, BLAST, etc., but hits should be retrieved and aligned pairwise to compare sequence identity.
  • Such sequences are also referred to as 'variants' herein, e.g.
  • hybridisation is generally used to mean hybridisation of nucleic acids at appropriate conditions of stringency (stringent hybridisation conditions) as would be readily evident to those skilled in the art depending upon the nature of the probe sequence and target sequences.
  • stringency stringent hybridisation conditions
  • Conditions of hybridisation and washing are well - known in the art, and the adjustment of conditions depending upon the desired stringency by varying incubation time, temperature and/or ionic strength of the solution are readily accomplished. See, for example, Sambrook, J. et al., Molecular Cloning: A Laboratory Manual, 2nd edition, Cold Spring Harbor Press, Cold Spring Harbor, New York, 1989.
  • the choice of conditions is dictated by the length of the sequences being hybridised, in particular, the length of the probe sequence, the relative G-C content of the nucleic acids and the amount of mismatches to be permitted.
  • Low stringency conditions are preferred when partial hybridisation between strands that have lesser degrees of complementarity is desired.
  • high stringency conditions are preferred.
  • the hybridisation solution contains 6X S.S.C., 0.01 M EDTA, IX Denhardt's solution and 0.5% SOS. hybridisation is carried out at about 68°C for about 3 to 4 hours for fragments of cloned DNA and for about 12 to about 16 hours for total eukaryotic DNA.
  • the temperature of hybridisation is reduced to about 42°C below the melting temperature (TM) of the duplex.
  • the TM is known to be a function of the G-C content and duplex length as well as the ionic strength of the solution.
  • hybridizes to a DNA or RNA molecule means that the molecule that hybridizes, e.g., oligonucleotide, polynucleotide, or any nucleotide sequence (in sense or antisense orientation) recognizes and hybridizes to a sequence in another nucleic acid molecule that is of approximately the same size and has enough sequence similarity thereto to effect hybridisation under J. o
  • a 100 nucleotide long molecule from the 3' coding or non-coding region of a gene will recognize and hybridize to an approximately 100 nucleotide portion of a nucleotide sequence within the 3' coding or non-coding region of that gene or any other plant gene so long as there is about 70% or more sequence similarity between the two sequences. It is to be understood that the size of the corresponding portion will allow for some mismatches in hybridisation such that the
  • corresponding portion may be smaller or larger than the molecule which hybridizes to it, for example 20-30%) larger or smaller, preferably no more than about 12-15 % larger or smaller.
  • sequence comprising at least 70% sequence identity or "a sequence comprising at least 70% amino acid sequence identity” or "a sequence comprising at least 70% nucleotide sequence identity” means a sequence having at least 70% e.g. at least 72%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or even at least 99.1% e.g. at least 99.2%, 99.4%, 99.5%, or even 99.7%) or 99.8%) or 99.9% sequence identity when compared with the reference sequence that is indicated. Sequence identity can be determined according the methods described herein.
  • a "fragment" of the gene or DNA sequence refers to any subset of the molecule, e.g., a shorter polynucleotide or oligonucleotide. In one aspect the fragment comprises the mutation as defined by the invention.
  • a “variant” refers to a molecule substantially similar to either the entire gene or a fragment thereof, such as a nucleotide substitution variant having one or more substituted nucleotides, but which maintains the ability to hybridize with the particular gene or to encode mRNA transcript which hybridizes with the native DNA.
  • the variant comprises the genetic determinant s) as defined by the invention i.e. as present in the plant deposited under NCIMB 42775.
  • a "variant” or “orthologous” or “ortholog” sequence of a genetic determinant which in the context of the present invention is a single recessive gene, refers to a resistance conferring genetic determinant, or an introgression fragment comprising a genetic determinant, which is derived from different wild basil plant or wild relative of basil plant than the genetic determinant present in NCIMB 42775, but which variant comprises one or both of the genetic determinants of the plant of the current invention, i.e.
  • variant genomic sequence and/or amino acid sequence encoded by the gene comprises substantial sequence identity to the genetic determinant(s) in NCIMB 42775, i.e. at least 85%, 90%, 92%, 95%, 98%, 99% sequence identity or more.
  • a "homologue” refers to a fragment or variant sequence from a different plant family, genus or species.
  • the homologue comprises the gene or locus as defined by the invention i.e. as present in the plant deposited under NCIMB 42775, wherein the homologous genomic sequence and/or amino acid sequence encoded by the homologous gene comprises substantial sequence identity to the , ,
  • an "analogue” refers to a non-natural molecule substantially similar to or functioning in relation to either the entire molecule, a variant or a fragment thereof.
  • the analogue comprises the gene or locus as defined by the invention i.e. as present in the plant deposited under NCIMB 42775.
  • the term "plant” includes the whole plant or any parts or derivatives thereof, such as plant organs (e.g., harvested or non-harvested flowers, leaves, etc.), plant cells, plant protoplasts, plant cell or tissue cultures from which whole plants can be regenerated, regenerable or non-regenerable plant cells, plant calli, plant cell clumps, and plant cells that are intact in plants, or parts of plants, such as embryos, pollen, ovules, ovaries (e.g., harvested tissues or organs), flowers, leaves, seeds, tubers, clonally propagated plants, roots, stems, cotyledons, hypocotyls, root tips and the like. Also any developmental stage is included, such as seedlings, immature and mature, etc.
  • the plant part or derivative comprises the gene or locus as defined by the current invention.
  • a "plant line” or “breeding line” refers to a plant and its progeny.
  • Plant variety is a group of plants within the same botanical taxon of the lowest grade known, which (irrespective of whether the conditions for the recognition of plant breeder's rights are fulfilled or not) can be defined on the basis of the expression of characteristics that result from a certain genotype or a combination of genotypes, can be distinguished from any other group of plants by the expression of at least one of those characteristics, and can be regarded as an entity, because it can be multiplied without any change.
  • the term "plant variety” cannot be used to denote a group of plants, even if they are of the same kind, if they are all characterized by the presence of 1 locus or gene (or a series of phenotypical characteristics due to this single locus or gene), but which can otherwise differ from one another enormously as regards the other loci or genes.
  • "Fl , F2, etc.” refers to the consecutive related generations following a cross between two parent plants or parent lines. The plants grown from the seeds produced by crossing two plants or lines is called the Fl generation. Selfing the Fl plants results in the F2 generation, etc.
  • Fl hybrid (or Fl seed, or hybrid) is the generation obtained from crossing two inbred parent lines.
  • Shelfing accordingly, refers to the self-pollination of a plant, i.e. to the union of gametes from the same plant.
  • Backcrossing refers to a breeding method by which a (single) trait, such as downy mildew resistance, can be transferred from one genetic background (also referred to as “donor”; generally but not necessarily this is an inferior genetic background) into another genetic background (also referred to as "recurrent parent”; generally but not necessarily this is a superior genetic background).
  • An offspring of a cross e.g. an Fl plant obtained by crossing a wild basil or wild relative of basil with a cultivated basil plant; or an F2 plant or F3 plant, etc., obtained by selfing the Fl
  • the trait 15 is “backcrossed” to the parent with the superior genetic background, e.g. to the cultivated parent. After repeated backcrossing, the trait 15
  • the terms "gene converted” or “conversion plant” or “single locus conversion” in this context refer to plants which are developed by backcrossing wherein essentially all of the desired morphological and/or physiological characteristics of the recurrent parent are recovered in addition to the one or more genes transferred from the donor parent.
  • the plants grown from the seeds produced by backcrossing of the Fl plants with the cultivated parent plant line is referred to as the "BC1 generation”. Plants from the BC1 population may be selfed resulting in the BC1F2 generation, or backcrossed again with the cultivated parent plant line to provide the BC2 generation.
  • An "Ml population” is a plurality of mutagenized seeds / plants of a certain cultivated plant line. "M2, M3, M4, etc.” refers to the consecutive generations obtained following selfing of a first mutagenized seed / plant (Ml).
  • Base plants or “Ocimum basilicum plants” are plants of the species Ocimum basilicum, i.e. any plant of the species Ocimum basilicum, including wild basil plants and cultivated basil plants.
  • the term “basil plants” as used herein thus comprises "cultivated plants of the species Ocimum basilicum", also named herein as “cultivated basil plants” or “Ocimum basilicum cultivars” or “basil cultivars”, which are basil plants cultivated by humans and having good agronomic characteristics. Cultivated plants include for example varieties and breeding lines of a species. In the context of the present invention, accordingly, the terms “cultivated plants” and “cultivars” are used interchangeably.
  • Wild plants are plants which generally have much poorer yields and poorer agronomic characteristics than cultivated plants and e.g. grow naturally in wild populations.
  • Wild plants include for example ecotypes, PI (Plant Introduction) lines, landraces and wild accessions of a species.
  • Wild relatives of Ocimum basilicum are "wild plants" of the genus Ocimum other than Ocimum basilicum including, but not limited to, Ocimum americanum (such as O. americanum var. americanum and O. americanum var. pilosum), Ocimum kilimandscharium, Ocimum tenuiflorum, Ocimum gratissimum and Ocimum minimum.
  • Ocimum americanum such as O. americanum var. americanum and O. americanum var. pilosum
  • Ocimum kilimandscharium such as O. americanum var. americanum and O. americanum var. pilosum
  • Ocimum tenuiflorum such as O. americanum var. americanum and O. americanum var. pilosum
  • Ocimum kilimandscharium such as O. americanum var. americanum and O. americanum var. pilosum
  • Ocimum kilimandscharium such as O
  • the cultivated Ocimum basilicum plants of the present invention may, be any cultivated basil, any commercial variety of basil, any basil breeding line or other, it may be open pollinated or hybrid, or reproduced vegetatively.
  • the male and the female plant should have the same ploidy, e.g. 2n x 2n or 4n x 4n.
  • the ploidy of a diploid can be doubled using methods known in the art, e.g. using colchicine.
  • the term "food” is any substance consumed to provide nutritional support for the body. It is usually of plant or animal origin, and contains essential nutrients, such as carbohydrates, fats, proteins, vitamins, or minerals. The substance is ingested by an organism and assimilated by the organism's cells lb
  • the term food includes both substance consumed to provide nutritional support for the human and animal body.
  • “Vegetative propagation” or “clonal propagation” refers to propagation of plants from vegetative tissue, e.g. by propagating plants from cuttings or by in vitro propagation. In vitro propagation involves in vitro cell or tissue culture and regeneration of a whole plant from the in vitro culture. Clones (i.e. genetically identical vegetative propagations) of the original plant can thus be generated by in vitro culture.
  • Cell culture or “tissue culture” refers to the in vitro culture of cells or tissues of a plant.
  • “Regeneration” refers to the development of a plant from cell culture or tissue culture or vegetative propagation.
  • “Non-propagating cell” refers to a cell which cannot be regenerated into a whole plant.
  • Average refers herein to the arithmetic mean.
  • comparisons between different plant lines involves growing a number of plants of a line (or variety) (e.g. at least 5 plants, preferably at least 10 plants per line) under the same conditions as the plants of one or more control plant lines (preferably wild type plants) and the determination of statistically significant differences between the plant lines when grown under the same environmental conditions.
  • a line or variety
  • the plants are of the same line or variety.
  • downy mildew refers to the plant disease caused by oomycetes of the genus Peronospora.
  • downy mildew is caused by the oomycetes Peronospora belbahrii; see Thines et al. Mycological Research 113 (2009) 532-540.
  • Downy mildew infection in basil results in chlorosis and necrosis of affected leaf tissue, which allows detection of the pathogen by visible inspection.
  • Sporulation is induced under favorable weather conditions, which is visible by the formation of brown sporangia on the underside of the affected leaves.
  • the Peronospora belbahrii pathogen can be readily isolated from infected basil plants grown in the field.
  • plant resistant to downy mildew or “plant resistant to Peronospora belbahrii” or a “plant comprising complete resistant to downy mildew” as used herein refers to plants having no downy mildew symptoms on adult leaves or (significantly) less downy mildew symptoms on adult leaves when compared to intermediate level control plants, such as defined herein.
  • Downy mildew resistance can, for example, be assessed using a downy mildew resistance assay or alternatively in the field, tunnel or greenhouse in growing areas where natural downy mildew infection occurs.
  • Various downy mildew resistance assays are possible, e.g. as described in the downy mildew test in the
  • a downy mildew resistance assay may, for example, involve artificial inoculation of the leaves of a plurality of plants when the plants are at least 2 weeks old (e.g. 2 weeks old, 3 weeks old, 4 weeks old, 5 weeks old, 6 weeks old, 7 weeks old, 8 weeks old or more), optionally followed by a second inoculation of the leaves e.g. 1 week later, 2 week later, or 3 weeks later, incubating the plants and control plants for a suitable period of time and under suitable conditions, induce sporulation under suitable conditions and evaluating symptoms one or more times post inoculation (e.g. 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 15 days, 20 days or 30 days post inoculation).
  • a times post inoculation e.g. 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 15 days, 20 days or 30 days post inoculation.
  • the susceptible control should be severely symptomatic for the test to be successful (e.g. at least 30%, preferably at least 40%, or 50%, or more than 60% (»50%) of the leaf area showing leaf necrosis).
  • at least 20 e.g. at least 30, 40, 50, 60, 70, 100, 125, 150, 175, or even more than 200 plants per genotype are included in each replicate and preferably several replicates are carried out.
  • a line or variety is considered resistant if at least 90%, 95% or 100%) of the plants of the line or variety shows less than 25% of leaf area showing leaf necrosis (e.g.
  • a plant is considered to be resistant to downy mildew when it scores a 7 or higher e.g. 7, 8, or 9, in the downy mildew resistance test protocol as defined in the Examples of this document, while the susceptible control has a score of 1.
  • a plant is considered to have an intermediate level of resistance when it scores a 5 or 6 in the downy mildew resistance test protocol as defined in the Examples of this document.
  • a plant is considered to have a low level of resistance when it scores a 4, 3 or 2 in the downy mildew resistance test protocol as defined in the Examples of this document.
  • a plant is considered to have no resistance when it scores a 1 in the downy mildew resistance test protocol as defined in the Examples of this document.
  • the present invention provides a cultivated plant of the species Ocimum basilicum comprising in its genome a single recessive gene conferring resistance to downy mildew when present in homozygous form.
  • the single recessive gene is designated herein as rpbl which stands for resistance to Perenospora balbahrii 1.
  • the rpbl gene of the present invention was first identified in a wild donor lo
  • the inventors succeeded in developing a cultivated Ocimum basilicum plant resistant to downy mildew by introgressing the rpbl gene from the donor plant into a non-resistant basil line, especially into a cultivated basil line, e.g. a sweet basil line.
  • the single recessive gene conferring said downy mildew resistance is comprised in an introgression fragment.
  • the single recessive gene conferring said downy mildew resistance may also be comprised in a complete chromosome that is inherited by the cultivated Ocimum basilicum plant of the present invention from the wild donor plant.
  • the cultivated plant comprises a recombinant chromosome
  • said chromosome comprises the introgression fragment which comprises rpbl gene.
  • the introgression fragment contains genes and molecular markers that facilitate the distinction between plants comprising the rpbl gene and plants not comprising the rpbl gene.
  • the introgression fragment comprises molecular markers, e.g. single nucleotide polymorphisms (SNPs), linked to the rpbl allele of the donor, which are polymorphic between cultivated basil and the wild donor and thereby allow the introgression fragment to be identified.
  • the markers are closely linked to the rpbl allele, e.g. within 5cM, 4cM, 3cM, 2cM, lcM or less.
  • a marker is an in-gene marker, i.e. within the rpbl allele.
  • the resistance trait of the present invention is inherited by a single recessive gene. Only plants that are homozygous for the rpbl gene of the present invention were found to show complete resistance to downy mildew.
  • the cultivated plant of the present invention is homozygous for the single recessive gene conferring the downy mildew resistance. Plants heterozygous for the single recessive gene conferring the downy mildew resistance as provided by the present invention are particularly useful for breeding methods, for instance by selling the heterozygous plant to provide offspring that is at least partially homozygous for the single recessive gene conferring the downy mildew resistance.
  • a representative sample of seeds of a basil line comprising the rpbl gene in homozygous form has been deposited under Accession number NCIMB 42775.
  • the single recessive gene provided by the present invention is as present in, or as obtainable from, or as obtained from, or as comprised in the genome of an Ocimum basilicum plant designated rpbl, of which a representative number of seeds have been deposited with the NCIMB under deposit number NCIMB 42775, or progeny of the deposited plants.
  • the rpbl gene is comprised in an introgression fragment, whereby said introgression fragment is detectable by one or more SNP nucleotides linked to the rpbl gene. Accordingly, Single Nucleotide Polymorphisms (SNPs) were identified on the introgression fragment which are closely linked to rpbl allele conferring the downy mildew resistance trait.
  • SNPs Single Nucleotide Polymorphisms
  • the single recessive gene is in an introgression fragment, wherein said introgression fragment comprises a sequence of a donor plant conferring resistance to downy mildew when present in homozygous form comprising one or more (or all) SNPs having the resistant nucleotides selected from the group consisting of SNP 01, SNP 02, SNP 03, SNP 04, SNP 05 and SNP 06 as described herein, e.g. in Table 6.
  • the downy mildew resistance SNP nucleotide for SNP 01, SNP 02, SNP 03, SNP 04, SNP 05 and/or SNP 06 is the SNP nucleotide of the introgression fragment comprising the rpbl gene, i.e.
  • the introgression fragment comprises one or more nucleotides selected from the list comprising:
  • Thymine at nucleotide 193 of SEQ ID NO: 8 or of a sequence comprising at least 90%> sequence identity to SEQ ID NO : 8 ;
  • the SNP nucleotides of plants having the downy mildew resistance trait i.e. the resistant SNP nucleotides, are present in homozygous form for SNP l to SNP 6 in the seeds deposited under deposit number NCIMB 42775.
  • the SNPs can be used to test the presence of an introgression fragment comprising rpbl gene in a plant cell, plant tissue, plant part, and/or in marker assisted selection (MAS) to transfer the rpbl gene into other basil lines or varieties.
  • the SNPs can also be used to select plants comprising smaller introgressions fragments than the fragments present in the deposited seeds, whereby the smaller u
  • sub-fragments retain the rpbl gene.
  • the SNPs can be used to identify other donors which comprise the rpbl gene and to introgress said gene into (cultivated) plants of the species Ocimum basilicum.
  • the present invention therefore, relates in one aspect to cultivated plants of the species Ocimum basilicum (or plant parts) comprising in its genome an introgression fragment of a donor plant showing resistance to downy mildew, wherein the introgression fragment comprises a sequence of the donor plant comprising the rpbl gene in-between SNP 01 and SNP 02, or in-between SNP 01 and SNP 03, or in-between SNP 01 and SNP 04, or in-between SNP 01 and SNP 05, or in-between SNP 01 and SNP 06, or in-between SNP 02 and SNP 03, or in-between SNP 02 and SNP 04, or in- between SNP 02 and SNP 05, or in-between SNP 02 and SNP 06, or in-between SNP 03 and SNP 04, or in-between SNP 03 and SNP 05, or in-between SNP 03 and SNP 06, or in-between SNP 04 and SNP 05, or in-between SNP 04 and SNP 06, or in-between SNP 04 and
  • the rpbl gene is present on the introgression fragment, as can be determined, inter alia, by performing the downy mildew disease resistance test as described herein.
  • the introgression fragment comprising the donor sequence (and the resistance gene) "in-between" two SNPs (Single Nucleotide Polymorphisms)
  • this encompasses in one aspect that one or both of the two SNPs themselves are also from the downy mildew resistant donor, i.e. have the donor ("resistant") nucleotide.
  • SNP 01, SNP 02, SNP 03, SNP 04, SNP 05 and SNP 06 may all have the donor nucleotide.
  • SNP 01, SNP 02, SNP 03, SNP 04, SNP 05 and SNP 06 may have the downy mildew resistant donor nucleotide; or only 4 different SNPs selected from the group consisting of SNP 01, SNP 02, SNP 03, SNP 04, SNP 05 and SNP 06 may have the downy mildew resistant donor nucleotide; or only 3 different SNPs selected from the group consisting of SNP 01, SNP 02, SNP 03, SNP 04, SNP 05 and SNP 06 may have the downy mildew resistant donor nucleotide; or only 2 different SNPs selected from the group consisting of SNP 01, SNP 02, SNP 03, SNP 04, SNP 05 and SNP 06 may have the downy mildew resistant donor nucleotide; or only a single SNP selected from the group consisting of SNP 01, SNP 02, SNP 03, SNP 04, SNP 05 and SNP 06 may have the downy mildew resistant donor nucleot
  • the SNPs that do not have the resistant donor nucleotide thus have another genotype, e.g. the recipient (susceptible) nucleotide.
  • the recipient nucleotide for a SNP may be any of the other 3 nucleotides, i.e. for SNP 01 the recipient nucleotide may be Adenine, Guanine or Thymine.
  • the reason that not all of the SNPs provided herein need to have the resistant nucleotide is that the introgression fragment comprising the rpbl gene from the donor may be smaller than the fragment introgressed e.g. in the deposited seeds, but the fragment still comprises the rpbl gene.
  • a plant can be recognized to contain the introgression fragment (comprising the rpbl gene) by the phenotype, and/or by transferring the fragment to a recipient plant and thereby transferring the downy mildew resistance phenotype, or by sequencing the region between the SNP markers to identify the donor fragment, or other methods known to the skilled person, such as saturating the region with more SNP markers, allelism tests, identifying the causal gene, etc.
  • the introgression fragment comprising the rpbl gene
  • a downy mildew resistant plant of the invention comprises an introgression fragment conferring downy mildew resistance that has the same nucleotide sequence as the introgression fragment found in seeds deposited under NCIMB 42775, or a smaller fragment thereof retaining the rpbl gene.
  • An introgression fragment from one specific, unique donor accession can be easily identified and distinguished in a plant not only by the genotype of the SNP markers (described above) but also by its nucleotide sequence. For example, by whole genome sequencing the genome of the deposit one can identify the introgression fragment as present in the deposit or as derived from the deposit (e.g. in progeny).
  • the presence of the specific introgression fragment as present in the seed deposit can be determined, e.g. by whole genome sequencing of the resistant basil plant and of the seed deposit and identifying the introgression fragment.
  • the one or more SNP nucleotides of the basil plant comprising the introgression fragment comprising the rpbl gene is one or more of the resistant nucleotides, i.e. at least one SNP has the nucleotide as indicated in Table 1 , below.
  • the introgression fragment comprising the rpbl gene must be in homozygous form to confer resistance to downy mildew
  • the present invention is also directed to plants comprising the rpbl gene of the present invention in heterozygous form since, e.g. such heterozygous plants can be used for breeding to generate offspring that is homozygous for the rpbl gene by selfing.
  • SNP Single Nucleotide Polymorphism
  • SNP 01 refers to nucleotide 83 of SEQ ID NO:2 (or of a sequence C
  • SNP 02 refers to nucleotide 200 of SEQ ID NO:4 (or of a sequence G
  • SNP 03 refers nucleotide 105 of SEQ ID NO:6 (or of a sequence C
  • SNP 04 refers nucleotide 193 of SEQ ID NO: 8 (or of a sequence T
  • SNP 05 refers nucleotide 201 of SEQ ID NO: 10 (or of a sequence C
  • SNP 06 refers nucleotide 201 of SEQ ID NO: 12 (or of a sequence G
  • the rpbl resistance gene, or the introgression fragment on which it is located, or a sub- fragment thereof comprising the gene can be transferred from a plant grown from a seed deposited under accession number NCIMB 42775 to another basil plant by various methods known to the skilled person.
  • the donor of the rpbl resistance gene can be a progeny of said plant, or a plant grown from a cell culture derived from a plant grown from a seed deposited under accession number NCIMB 42775.
  • the transferred gene can confer recessive resistance to downy mildew, particularly resistance to Peronospora belbahrii infection, in the recipient plant.
  • the single recessive gene is introgressed from a Ocimum basilicum plant designated rpbl, of which representative number of seeds have been deposited with the NCIMB under deposit number NCIMB 42775; or the single recessive gene is introgressed from a progeny plant of said Ocimum basilicum plant designated rpbl, wherein said progeny plant comprises said single recessive gene as present in the genome of, or obtainable from, or obtained from, or as comprised in an Ocimum basilicum plant designated rpbl, of which a representative number of seeds have been deposited with the NCIMB under deposit number NCIMB 42775.
  • the fragment can also be identified by one or more molecular markers (e.g. SNP markers, AFLP markers, RFLP markers, etc.), especially molecular markers which are polymorphic between the recipient plant and the donor plant of the introgression fragment.
  • the fragment can also be identified by whole genome sequencing.
  • the present invention thus provides a cultivated plant that shows complete resistance against downy mildew when the single recessive gene is present in homozygous form.
  • Said complete resistance against downy mildew preferably reflects an average resistance level of at least 7.
  • the resistance level is determined on a scale of 1 for no resistance (fully susceptible) to 9 for absence of symptoms.
  • the resistance level is preferably determined using the procedure as described herein. Accordingly, a resistance level of 1 stands for no resistance (fully susceptible) leading to heavy infection and a resistance level of 9 stands for absence of symptoms.
  • a plant having a complete resistance level is defined herein as a resistance level of 7 or 8 or 9, preferably a resistance level of 8 or 9, most preferably a resistance level of 9.
  • a plurality of plants of the present invention having a complete resistance level accordingly shows an average resistance level of at least 7, more preferably shows an average resistance level of at least 8. Most preferably, a plurality of plants of the present invention shows an average resistance level of 9, wherein said plant shows absence of downy mildew symptoms upon infestation.
  • downy mildew is generally caused by infection with the oomycetes Peronospora belbahrii.
  • the downy mildew is preferably caused by the oomycetes Peronospora belbahrii.
  • Tests or assays for the presence of mildew against downy mildew in a basil plant comprise using qualitative disease resistance assays under controlled environment conditions and preferably allow the distinction between no resistance (fully susceptible) plants, plants having a low level of resistance, plants having an intermediate level of resistance and plants having complete resistance.
  • the skilled person is familiar with applying different protocols for assays.
  • seedlings of a plurality of plants of the plant genotype to be tested e.g. at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more plants
  • the seedlings are incubated under conditions which are favorable to the pathogen.
  • each plant is categorized according to the proportion of the leaf surface that is affected by downy mildew.
  • the downy mildew resistance is classified according to the following scheme.
  • control plants e.g. a susceptible line or variety, a resistant line or variety
  • a susceptible control plant should preferably show a resistance level of 1.
  • the cultivated plant of the present invention is selected from the group consisting of sweet basil, cinnamon basil and Thai basil.
  • Sweet basil is the most common Ocimum basilicum type which is also commercially most relevant.
  • Cinnamon basil is a specific Ocimum basilicum type that is particularly characterized by its strong scent of cinnamate.
  • Thai basil which is also known as anise basil or licorice basil, is a basil type that is characterized by its silvery leaves and a strong scent of anethole.
  • the plant of the present invention is sweet basil.
  • the plant of the present invention may be grown for food or feed purposes.
  • the plant may be an inbred, a hybrid, a Fl hybrid, a land race, a double haploid, a transgenic plant, a mutant plant, a single locus converted plant comprising the rpbl gene, etc.
  • the basil plant of the present invention is a hybrid plant.
  • the rpbl gene, and/or the introgression fragment comprising the gene (or a sub-fragment thereof), can be easily transferred into any basil plant.
  • the rpbl gene can be introduced into any other basil plant by introgression from a plant grown from seeds of which a representative chunk ,
  • rpbl resistance gene of the invention is a source of the rpbl resistance gene of the invention, as are basil plants not directly obtained from the deposit, but for example indirectly obtained (e.g. later released commercial varieties) and which contain rpbl gene of the invention.
  • Other sources of the rpbl gene may be identified, e.g. in wild basil or wild relatives of basil and e.g. an allelism test may be used to determine whether another recessive gene, conferring the same resistance phenotype as the plant of the invention, is the same gene or a different gene.
  • Alternative methods to determine whether another gene is the same gene include the development of molecular markers linked to the rpbl gene of the invention, e.g. the use of the marker provided herein, and analyzing whether the markers also occur in plants comprising the other gene. Or whole genome sequencing or gene mapping can be used to identify the rpbl gene, and/or the introgression fragment comprising the gene, in rpbl plants and compare it to the gene in another plant, and/or to the genomic sequence of another plant.
  • the cultivated plant of the present invention is a non-transgenic plant.
  • the present invention provides a method of producing a basil plant of the species Ocimum basilicum comprising in its genome a single recessive gene conferring downy mildew resistance, said method comprising the step of (i) crossing a first basil plant and a second basil plant, wherein the first basil plant is the cultivated plant according to the present invention.
  • Said method of producing a basil plant optionally comprises a further step of (ii) harvesting seed from the crossing of step (i) as described herein above, or optionally from progeny of the cross, such as a selling progeny (e.g.
  • both the first basil plant and the second basil plant in the above described step (i) are cultivated plants according to the present invention.
  • both the first basil plant and the second basil plant in the above described step (i) are plants homozygous for the rpbl gene, which is the single recessive gene conferring downy mildew resistance as provided by the present invention.
  • the resulting seeds harvested in step (ii) are thereby also homozygous for the rbpl gene or locus.
  • Such a process is particularly suitable for producing a basil plant that shows complete resistance against downy mildew.
  • Plants produced by the method are also an embodiment of the invention, e.g. Fl hybrid plants comprising the rpbl gene in homozygous form.
  • the present invention accordingly provides a method of identifying and/or selecting a plant or plant part of the species Ocimum basilicum comprising in its genome a single recessive gene conferring resistance to downy mildew when present in homozygous form, comprising determining whether the plant or plant part comprises one or more SNPs having the resistant nucleotide o
  • the method may further comprise selecting a plant of plant part having one or more of the resistant nucleotide selected from the group consisting of SNP 01, SNP 02, SNP 03, SNP 04, SNP 05 and SNP 06.
  • the resistant nucleotide for SNP 01, SNP 02, SNP 03, SNP 04, SNP 05 and SNP 06 are described herein, e.g. in Table 1. Accordingly, the resistant nucleotide of SNP 01 is a
  • the resistant nucleotide of SNP 02 is a Guanine at nucleotide 200 of SEQ ID NO: 4 or of a sequence comprising at least 90%> sequence identity to SEQ ID NO: 4;
  • the resistant nucleotide of SNP 03 is a Cytosine at nucleotide 105 of SEQ ID NO: 6 or of a sequence comprising at least 90%> sequence identity to SEQ ID NO: 6;
  • the resistant nucleotide of SNP 04 is a Thymine at nucleotide 193 of SEQ ID NO: 8 or of a sequence comprising at least 90%> sequence identity to SEQ ID NO: 8;
  • the resistant nucleotide of SNP 05 is a Cytosine at nucleotide 201 of SEQ ID NO: 10 or of a sequence comprising at least 90%> sequence identity to SEQ ID NO: 10;
  • the invention provides a seed from which any plant of the invention can be grown.
  • a seed of the invention can be any seed of the invention.
  • a seed of the invention can be any seed of the invention.
  • Seeds include for example seeds produced on the plant of the invention after self-pollination or seed produced after cross-pollination, e.g. pollination of a plant of the invention with pollen from another basil plant or pollination of another basil plant with pollen of a plant of the invention.
  • the present invention provides pollen or seed produced by the cultivated plant according to the present invention, wherein the pollen or seed comprises the single recessive gene as defined as defined herein.
  • the present invention provides seed from which the cultivated plant of the present invention can be grown. [0110] In yet a further embodiment, the present invention provides seeds obtained from the methods of producing basil plants as described herein.
  • a plurality of seed is packaged into a container (e.g. a bag, a carton, a can etc.).
  • Containers may be any size.
  • the seeds may be pelleted prior to packing (to form pills or pellets) and/or treated with various compounds, including seed coatings. Plant parts and vegetative reproductions
  • a plant part obtained from (obtainable from) a plant of the invention is provided herein, and a container or a package comprising said plant part.
  • the present invention provides a part from the cultivated plant of the present invention, wherein the part comprises the genetic determinant conferring downy mildew resistance as described in the present invention, preferably wherein the part is selected from the group consisting of a leaf, anther, pistil, stem, petiole, root, ovule, pollen, protoplast, tissue, seed, flower, cotyledon, hypocotyl, embryo and cell.
  • the plant part is a plant cell.
  • the plant part is a non-regenerable cell or a regenerable cell.
  • the plant cell is a somatic cell.
  • a non-regenerable cell is a cell which cannot be regenerated into a whole plant through in vitro culture.
  • the non-regenerable cell may be in a plant or plant part (e.g. leaves) of the invention.
  • the non-regenerable cell may be a cell in a seed, or in the seedcoat of said seed.
  • the plant cell is a reproductive cell, such as an ovule or a cell which is part of a pollen.
  • the pollen cell is the vegetative (non-reproductive) cell, or the sperm cell (Tiezzi, Electron Microsc. Review, 1991) .
  • a reproductive cell is haploid. When it is regenerated into whole a plant, it comprises the haploid genome of the starting plant. If chromosome doubling occurs (e.g. through chemical treatment), a double haploid plant can be regenerated.
  • the plant of the invention comprising the rpbl gene is a haploid or a double haploid basil plant.
  • an in vitro cell culture or tissue culture of basil plants of the invention in which the cell- or tissue culture is derived from a plant part described above, such as, for example and without limitation, a leaf, a pollen, an embryo, cotyledon, hypocotyls, callus, a root, a root tip, an anther, a flower, a seed or a stem, or a part of any of them, or a meristematic cell, a somatic cell, or a reproductive cell.
  • a basil plant regenerated from any of the above-described plant parts, or regenerated from the above-described cell or tissue cultures, said regenerated plant having a downy mildew resistance phenotype (as conferred by the rpbl gene), i.e. retains the rpbl gene (or the introgression fragment comprising the rpbl gene) of the invention.
  • This plant can also be referred to as a vegetative propagation of plants of the invention.
  • a harvested leaf or branch comprising leaves of a plant of the invention and a package comprising a plurality of leaves or a plurality of branches comprising leaves of one or more ⁇ plants of the invention.
  • These leaves or branches thus comprise the rpbl gene of the invention, detectable e.g. by phenotypically testing (for the originally used whole plant and/or regenerated plant) or by linked molecular markers.
  • the invention also provides for a food or feed product comprising or consisting of a plant part described herein.
  • the food or feed product may be fresh or processed, e.g., canned, steamed, boiled, fried, blanched and/or frozen etc. Examples are salad or salad mixtures or other food products comprising a leaf or a part of a leaf of a plant of the invention.
  • plants and parts of basil plants of the invention, and progeny of basil plants of the invention are provided, e.g., grown from seeds, produced by sexual or vegetative reproduction, regenerated from the above-described plant parts, or regenerated from cell or tissue culture, in which the reproduced (seed propagated or vegetatively propagated) plant comprises complete resistance against downy mildew.
  • the present invention provides the cultivated plant grown from the seed as described herein.
  • the present invention provides the basil plant grown from seeds obtained from the method for producing a basil plant as described herein.
  • the invention provides for progeny comprising or retaining the downy mildew resistance phenotype (conferred by the rpbl gene), such as progeny obtained by, e.g., selling one or more times and/or cross-pollinating a plant of the invention with another basil plant of a different variety or breeding line, or with a basil plant of the invention one or more times.
  • the invention provides for progeny that retain the rpbl gene (conferring the complete downy mildew resistance phenotype) of (as found in) NCIMB 42775.
  • the invention provides for a progeny plant comprising the rpbl resistance, such as a progeny plant that is produced from a basil plant comprising the rpbl resistance by one or more methods selected from the group consisting of: selfing, crossing, mutation, double haploid production or transformation. Mutation may be spontaneous mutations or human induced mutations or somaclonal mutations. In one embodiment, plants or seeds of the invention may also be mutated (by e.g. irradiation, chemical mutagenesis, heat treatment, TILLING, etc.) and/or mutated seeds or plants may be selected (e.g. natural variants, somaclonal variants, etc.) in order to change one or more characteristics of the plants.
  • plants of the invention may be transformed and regenerated, whereby one or more chimeric genes are introduced into the plants. Transformation can be carried out using standard methods, such as Agrobacterium tumefaciens mediated transformation or biolistics, followed by selection of the transformed cells and regeneration into plants.
  • a desired trait e.g. genes conferring pest or disease resistance, herbicide, fungicide or insecticide tolerance, etc.
  • Q O be introduced into the plants, or progeny thereof, by transforming a plant of the invention or progeny thereof with a transgene that confers the desired trait, wherein the transformed plant retains the rpbl gene and the downy mildew resistance phenotype conferred by it and contains the desired trait.
  • haploid plants and/or double haploid plants of plant of the invention are encompassed herein, which comprise complete resistance against downy mildew, preferably conferred by the rpbl gene or by the introgression fragment comprising the rpbl gene.
  • Haploid and double haploid (DH) plants can for example be produced by anther or microspore culture and regeneration into a whole plant. For DH production chromosome doubling may be induced using known methods, such as colchicine treatment or the like. So, in one aspect a basil plant is provided, comprising the complete downy mildew resistance phenotype as described, wherein the plant is a double haploid plant.
  • the invention in another embodiment relates to a method for producing basil seed, comprising crossing a plant of the invention with itself or a different basil plant and harvesting the resulting seed.
  • the invention relates to seed produced according to this method and/or a basil plant produced by growing such seed.
  • a plant of the invention may be used as male and/or female parent, in the production of basil seeds, whereby the plants grown from said seeds comprise complete resistance against downy mildew, preferably due to the presence of the rpbl gene.
  • progeny of a basil plant of the invention are provided, wherein the progeny plant is produced by selling, crossing, mutation, double haploid production or transformation and preferably wherein the progeny retain the rpbl resistance gene (and phenotype conferred by it) described herein, i.e. obtainable by crossing a basil plant, grown from seeds deposited under accession number NCIMB 42775, with another basil plant.
  • the resistance gene or locus (or introgression fragment comprising the gene or locus) as present in / found in / as derived from (or as derivable from) seed deposit NCIMB 42775 is retained in the progeny plants.
  • Molecular markers may also be used to aid in the identification of the plants (or plant parts or nucleic acids obtained therefrom) containing the rpbl resistance gene or locus or allele(s). For example, one can develop one or more suitable molecular markers which are closely genetically (and preferably also physically) linked to the rpbl resistance gene, locus or allele. This can be done by crossing a resistant basil plant (comprising the rpbl gene) with a susceptible basil plant and developing a segregating population (e.g. F2 or backcross population) from that cross. The segregating population can then be phenotyped for downy mildew resistance and genotyped using e.g.
  • molecular markers such as SNPs (Single Nucleotide Polymorphisms), AFLPs (Amplified Fragment Length Polymorphisms; see, e.g., EP 534 858), or others, and by software analysis molecular markers which co-segregate with the downy mildew resistance trait in the segregating population can be identified and their order and genetic distance (centimorgan distance, cM) to the rpbl gene or locus can be identified.
  • cM centimorgan distance
  • rpbl gene is flanked on one side by SNP 04 and on the other side by either SNP 01 or SNP 03.
  • the complete resistance to downy mildew is caused by a mutation in the rpbl allele or orthologous allele or homologous allele.
  • a mutant rpbl allele is provided.
  • Mutagenesis techniques such as chemical or UV mutagenesis can be used, or targeted mutagenesis techniques such as Crispr-Cas can be used to induce mutations in a wild type RPB 1 gene which confer complete downy mildew resistance.
  • plants, plant parts and cells according to the invention are not exclusively obtained by means of an essentially biological process as defined by Rule 28(2) EPC.
  • Other embodiments of the invention relate to the following numbered embodiments, which are not to be seen in isolation but can be combined with any of the other embodiments described herein.
  • the herein-below described cell or cells is a non-propagating cell (also described herein as a non-regenerable cell). It is understood that in these embodiments a non-propagating plant cell is a plant cell which is unable to maintain its life by synthesizing carbohydrate and protein from the inorganic substance, such as water, carbon dioxide and mineral salt and so on through photosynthesis.
  • Embodiment 1 An Ocimum basilicum plant cell of the invention i.e. a plant cell of a cultivated plant of the species Ocimum basilicum comprising in its genome a single recessive gene conferring resistance to downy mildew when present in homozygous form.
  • said single recessive gene also described herein as the rpbl resistance gene (or locus or allele(s)), wherein samples of seed comprising the rpbl resistance gene (or locus or allele(s)) have been deposited under deposit number NCIMB 42775.
  • Embodiment 2 The Ocimum basilicum plant cell of embodiment 1, wherein the single recessive gene is comprised in an introgression fragment.
  • Embodiment 3 The Ocimum basilicum plant cell of embodiment 1 or 2, wherein the plant cell is homozygous for the single recessive gene conferring the downy mildew resistance.
  • Embodiment 4 The Ocimum basilicum plant cell of any one of embodiments 1-3, wherein the single recessive gene is as present in, or as obtainable from, or as obtained from, or as comprised in the genome of an Ocimum basilicum plant designated rpbl, of which a representative number of seeds have been deposited under deposit number NCIMB 42775. oU
  • Embodiment 5 The Ocimum basilicum plant cell of embodiment 4, wherein the single recessive gene is in an introgression fragment, wherein said introgression fragment comprises a sequence of a donor plant conferring resistance to downy mildew when present in homozygous form comprising one or more SNPs having the resistant nucleotides selected from the group consisting of SNP 01, SNP 02, SNP 03, SNP_04, SNP_05 and SNP_06.
  • Embodiment 6 The Ocimum basilicum plant cell of any one of embodiments 4 or 5, wherein the introgression fragment comprises one or more nucleotides selected from the list comprising:
  • Cytosine (C) at nucleotide 105 of SEQ ID NO: 6 or of a sequence comprising at least 90%> sequence identity to SEQ ID NO: 6;
  • Thymine at nucleotide 193 of SEQ ID NO: 8 or of a sequence comprising at least 90%> sequence identity to SEQ ID NO : 8 ;
  • Embodiment 7 The Ocimum basilicum plant cell of any one of embodiments 1-6, wherein the single recessive gene is introgressed from a Ocimum basilicum plant designated rpbl, of which representative number of seeds have been deposited with the NCIMB under deposit number NCIMB 42775;
  • the single recessive gene is introgressed from a progeny plant of said Ocimum basilicum plant designated rpbl, wherein said progeny plant comprises said single recessive gene as present in the genome of, or obtainable from, or obtained from, or as comprised in an Ocimum basilicum plant designated rpbl, of which a representative number of seeds have been deposited under deposit number NCIMB 42775.
  • Embodiment 8 The Ocimum basilicum plant cell of any one of embodiments 1-8, wherein said plant cell is from a plant that shows complete resistance against downy mildew when the single recessive gene is present in homozygous form.
  • Embodiment 9 The Ocimum basilicum plant cell of embodiment 8, wherein said complete resistance against downy mildew reflects an average resistance level of at least 7, preferably of at least 8 and most preferably of 9, the average resistance level is determined on a scale of 1 , for no resistance, to 9, for absence of symptoms. o -L
  • Embodiment 10 The Ocimum basilicum plant cell of any one of embodiments 1-9, wherein the downy mildew is caused by the oomycetes Peronospora belbahrii.
  • Embodiment 11 The Ocimum basilicum plant cell of any one of embodiments 1-10, wherein the plant cell is sweet basil plant cell, cinnamon basil plant cell or Thai basil plant cell, preferably sweet basil.
  • Embodiment 12 The Ocimum basilicum plant cell of any one of embodiments 1-11, wherein the plant cell is a non-transgenic plant cell.
  • Embodiment 13 Use of Ocimum basilicum plant which comprises a single recessive gene conferring resistance to downy mildew when present in homozygous form, to cross with another Ocimum basilicum plant and optionally select progeny from said crossing, a representative sample of seeds of a plant comprising said single recessive gene conferring resistance to downy mildew when present in homozygous form having been deposited under Accession Number NCIMB 42775.
  • Embodiment 14 Use of Ocimum basilicum plant deposited under Accession Number NCIMB 42775 to produce a genetic marker profile.
  • Embodiment 15 Use of an Ocimum basilicum plant of the invention i.e. comprising a single recessive gene conferring resistance to downy mildew when present in homozygous form, for basil leaf and/or basil branch production.
  • Embodiment 16 Use of an Ocimum basilicum plant of the invention i.e. comprising a single recessive gene conferring resistance to downy mildew when present in homozygous form, in a method of producing an Ocimum basilicum plant having a desired trait.
  • Embodiment 17. Use of an Ocimum basilicum plant of the invention i.e. comprising a single recessive gene conferring resistance to downy mildew when present in homozygous form, in an Ocimum basilicum breeding program or in an Ocimum basilicum seed production program.
  • Embodiment 18 Use of one or more SNP markers selected from SNP 01, SNP 02, SNP 03, SNP 04, SNP 05 and SNP 6 for detecting and/or selecting an Ocimum basilicum plant or plant part comprising a gene conferring resistance to downy mildew when present in homozygous form.
  • Embodiment 19 A method for selecting or detecting an Ocimum basilicum plant or plant part comprising a gene conferring resistance to downy mildew when present in homozygous form in its genome, said method comprising determining the SNP genotype of the plant or plant part for one or more or all of the SNP markers selected from SNP_01, SNP_02, SNP_03, SNP_04, SNP_05 and SNP_06.
  • Embodiment 20 The method according to embodiment 19, wherein the plant or plant part is a seed, a seed coat, a cell, a tissue, an embryo, a leaf or leaf part, a head or part thereof, DNA isolated from a cell or tissue.
  • the SNP genotype can for example be determined using any genotyping assays, such as a TaqMan assay, a KASP Assay, or other assays.
  • a representative sample of seeds of a basil plant ⁇ Ocimum basilicum) according to the invention i.e. comprising in its genome a genetic determinant comprising a single gene conferring said downy mildew resistance and wherein the plant is homozygous for the gene conferring the downy mildew resistance
  • rpbl a genetic determinant comprising a single gene conferring said downy mildew resistance and wherein the plant is homozygous for the gene conferring the downy mildew resistance
  • plants of the species Ocimum basilicum were developed comprising in their genome a single recessive gene conferring a complete resistance towards the downy mildew species Peronospora belbahrii. These plants were crossed with plants of a cultivated sweet basil variety to combine the complete resistance towards downy mildew with other traits of commercial interest.
  • the oomycetes Peronospora belbahrii was maintained on living plants by bi-weekly transfer of spores to healthy plants of an internal basil breeding line with a susceptible genotype.
  • a field isolate of Peronospora belbahrii was used to establish the downy mildew maintenance population. Inoculum was produced from infested plants of the downy mildew maintenance population. A new field isolate was regularly prepared to ensure that the results obtained with the inoculum are comparable with a naturally occurring Peronospora belbahrii infection. No differences between different Peronospora belbahrii isolates could be observed.
  • Sporulation was induced by keeping infested plants for 24 hours in the dark at a temperature of 15 °C and at 100% relative humidity.
  • Germplasm to be tested for resistance towards downy mildew were sown in seeding trays.
  • the plants were grown for 2.5 to 3 weeks after germination, after which they were inoculated by spraying the plants with the inoculum prepared as described herein above comprising 10 4 spores/ml.
  • the inoculated plants were subsequently kept for 24 hours in the dark under inoculation conditions comprising a temperature of 20-22 °C and a relative humidity of 100%. After inoculation, the plants were kept for 1-2 weeks at normal growing conditions comprising a temperature of 20-22 °C and a 12 hours light/12 hours dark regime.
  • Plants were re- infected with inoculum 1 week after the first inoculation to ensure that all tested plants are indeed infected. Subsequently, sporulation was induced by keeping the plants for 24 hours in the dark under sporulation inducing conditions comprising 15 °C and at 100%) relative humidity. The plants were subsequently scored for downy mildew infestation.
  • a complete resistance against downy mildew is defined as an average resistance level of 7 or higher, e.g. 7, 8 or 9. Intermediate level of resistance against downy mildew is defined as an average resistance level of 5 or 6. No resistance against downy mildew is defined as an average resistance level of 1 ; a low resistance against downy mildew is defined as a an average resistance level of more than 1 but less than 5, e.g. 2, 3, or 4.
  • the resistance score as referred to in the various aspects and/or embodiments of the invention are scored according to the classification as described here above. In another aspect, the resistance score as referred to in the various aspects and/or embodiments of the invention are scored according to test protocol as described herein. Control plants
  • the wild Ocimum basilicum accession as further described herein below was used as a positive control.
  • the average resistance level of this wild Ocimum basilicum accession was found to be 9 (complete resistance).
  • All scorings are given on a scale from 1 (for no resistance) to 9 (for absence of symptoms) using the test protocol with high disease pressure as provided herein.
  • the wild Ocimum basilicum accession as used in the present invention was obtained from a USDA seedbank.
  • the rpbl basil line as deposited in the context of the present invention was obtained by crossing the resistant wild Ocimum basilicum accession with the susceptible Ocimum basilicum sweet basil variety "Adriana” to provide a Fl population, followed by a back-crossing step with the Adriana variety.
  • the thus obtained progeny (BC1 population) was selfed for two generations while selecting the resistant plants for the second selling step to provide the rpbl basil line which combines the good properties of the Adriana variety with the complete resistance to Peronospora belbahrii from the wild Ocimum basilicum accession.
  • plants of the susceptible Fl population were back-crossed with the susceptible Ocimum basilicum sweet basil variety Adriana.
  • Individual plants of the thus obtained BC1 population were selfed to provide different BC1F2 populations.
  • Plants of the different obtained BC1F2 populations were tested for resistance to downy mildew using the test protocol described herein.
  • the individual BC1F2 plants either showed complete resistance (Resistance level 9, absence of symptoms) or showed no resistance (Resistance level 1, >80-100 % of leaf surface affected by downy mildew); see Table 4.
  • Marker development Molecular markers were developed which are linked to the downy mildew resistance- conferring gene of the present invention, which then can be used for selection of downy mildew resistant plants by selecting for plants having the linked molecular markers.
  • Linked markers can be developed using a range of techniques, such as Bulk Segregant Analysis, and a range of markers, such as AFLP markers, RFLP markers, SNP markers, mini-or micro- satellite markers, etc.
  • a segregating population was generated by e.g. crossing a downy mildew resistant plant line according to the present invention with a plant line that is susceptible to downy mildew and developing a segregating population therefrom (e.g. an F2 or F3 population or backcross population).
  • Markers can then be identified which are closely associated (linked) with the downy mildew resistance trait, i.e. co- segregates with the e.g. the recessive gene conferring resistance to downy mildew when present in homozygous form. See for example Wolukau et al. (HortScience February 2009 vol. 44 no. 1 32-34) the ⁇ use of Bulk Segregant Analysis in melon to identify markers linked to a resistance gene.
  • a molecular marker is a DNA sequence or single nucleotide polymorphism (SNP) which is found on the
  • the gene conferring resistance to downy mildew when present in homozygous form according to the present invention can be introduced into other plants of the species Ocimum basilicum lacking said gene conferring resistance to downy mildew by marker assisted breeding methods, using a molecular marker closely linked to the resistance conferring gene according to the present invention.
  • Fl plants were generated by crossing a DM resistant Ocimum basilicum line (Line 505) with a sensitive breeding line Adriana (Line 504).
  • An Fl plant was self-pollinated and F2 seeds were harvested.
  • Four hundred F2 plants were grown to be tested for resistance to downy mildew using the test protocol described herein, together with the sensitive (Line 504) and resistant (Line 505) that were internal controls for the disease test. All plants were cloned to have two identical sets. One set was used to take leaf samples for DNA and RNA isolation. The other set was infected for the disease test and plants were scored twice for visible disease symptoms; see table 5.
  • RNA samples from the 71 resistant plants were pooled as were tissue samples from 71 plants with score 1, 10 sensitive 504 plants and 8 resistant parent 505 plants.
  • RNA was isolated using a plant tissue RNA isolation kit (RNeasy Plant Mini Kit, Qiagen) and sequenced by a service company (GenXPro, world wide web at //genxpro.net/) to identify
  • KASPTM Marker assays
  • the 6 marker assays were used to interrogate a panel of basil lines representing genotypic diverse germplasm to see whether the identified SNPs are specific for the locus with the resistance gene.
  • the SNPs appeared all 6 to have the sensitive call in all lines without the resistance (in total 11 different commercial downy mildew sensitive basil lines were tested).
  • GCTGCCTTCTTAG SEQ ID NO: 1 and 2
  • AAAAGAT SEQ ID NO: 9 and 10.
  • Ocimum basilicum genome sequence is the moment of this writing not available. Therefore, to estimate the relative positions of the marker sequences they were compared to available whole-genome shotgun contigs from a related species, Ocimum tenuiflorum, by Blast alignment at the NCBI website (world wide web at //blast.ncbi.nlm.nih.gov/). The identified contigs in turn, were aligned to Sesamum indicum vl .0. chromosome sequences (world wide web at //ocri-genomics.org/). Marker mHE6, mHEl 3 and mHEl had highest nucleotide homology to sequences on linkage group 5 in a 64k base pair large region (table 8).
  • marker mHE22 is located at one end of the resistance locus and either mHEl or mHEl 3 is located at the other end.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Botany (AREA)
  • Chemical & Material Sciences (AREA)
  • Environmental Sciences (AREA)
  • Developmental Biology & Embryology (AREA)
  • Genetics & Genomics (AREA)
  • Physiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Natural Medicines & Medicinal Plants (AREA)
  • Spectroscopy & Molecular Physics (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • Mycology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

The present invention relates to a cultivated plant of the species Ocimum basilicum resistant to downy mildew. The present invention further relates to pollen and seed produced by the cultivated plant of the present invention, seed from which the cultivated plant of the present invention can be grown and a part from the cultivated plant according to the present invention. The present invention further relates to a method of producing a plant according to the present invention.

Description

Complete resistance to downy mildew in basil
FIELD OF THE INVENTION
[0001] This invention relates to the field of plant breeding. In particular the present invention relates to a cultivated plant of the species Ocimum basilicum resistant to downy mildew. The present invention further relates to pollen and seed produced by the cultivated plant of the present invention, seed from which the cultivated plant of the present invention can be grown and a part from the cultivated plant according to the present invention. The present invention further relates to a method of producing a plant according to the present invention.
BACKGROUND [0002] Basil plants of the species Ocimum basilicum belong to the family of the Lamiaceae (mints) and are globally grown and used as a culinary herb, but also as ornamental plants. There is much variation within the species Ocimum basilicum which leads to many differences in morphology, growth habit and taste. Accordingly, many distinct Ocimum basilicum varieties have been described, including sweet basil, cinnamon basil and Thai basil (also known as anise basil or licorice basil). Sweet basil is the most commercially relevant cultivated basil plant which is based on its widespread use as a fresh culinary herb or for the production and use as a dried culinary herb. The high variability that can be observed between different Ocimum basilicum plants is reflected by a high genetic complexity that can be explained by the occurrence of allopolyploidy and/or additional chromosomes.
[0003] Other than in the context of the present invention, different species within the genus Ocimum or hybrids between different species in the genus Ocimum may also be called basil. Examples of such other species or hybrids include holy basil {Ocimum tenuiflorum) and lemon basil, which is a hybrid between the different species Ocimum basilicum and Ocimum americanum.
[0004] Cultivated plants of the species Ocimum basilicum have been developed for centuries to improve their characteristics such as plant architecture, growth habit and taste. Particularly common cultivated sweet basil plants are of the so-called Genovese type that are characterized by a typical leaf shape, plant architecture and taste. Sweet basil of the Genovese type is particularly useful as a culinary herb in Italian cuisine. Cultivated Ocimum basilicum plants are available as open pollinated crossbreds but also as hybrid plants which may have advantages such as improved uniformity, vitality and/or disease tolerance. One such example of a cultivated Ocimum basilicum plant with an improved disease resistance is the variety "Nufar Fl " which is a Fl hybrid plant variety resistant against Fusarium wilt.
[0005] Basil downy mildew caused by the oomycetes Peronospora belbarii is a destructive disease that has a major impact on the cultivation of basil. In only a few years, basil downy mildew spread from Switzerland, where it was first noticed in 2001, through Europe into Africa, Asia, South- and North America. Infection with basil downy mildew results in chlorosis and necrosis of the affected leaf tissue, ultimately leading to defoliation and plant death.
[0006] Infestation with basil downy mildew often leads to severe losses in both yield and crop quality. Disease management with conventional or organic fungicides is costly and the efficacy thereof is often very limited. First resistances of the pathogen against the most widely used and effective fungicide mefenoxam meanwhile have been reported in Italy and Israel. Furthermore, fresh basil can be rendered unmarketable due to sporulation that forms during transportation and/or storage as the conditions for preserving fresh basil also facilitate pathogen development on plant parts wherein the infection was undetected when harvested. [0007] Accordingly, there is a urgent need to develop cultivated Ocimum basilicum plants which are resistant to downy mildew infection. The search for sources of downy mildew resistance has focused on basil types other than sweet basil, since these basil types were found to have a higher tolerance to Peronospora belbarii; see e.g. Ben-Nairn et al., Phytopathology (2015) 105:778-785. So far, efforts to improve resistance against downy mildew in particularly sweet basil lead only to unsatisfactory results. Furthermore, it was found that introduction of downy mildew resistance from non-sweet basil into sweet basil, which is the commercially most relevant cultivated basil plant, also leads to the introduction of undesired characteristics such as a changed morphology and/or taste. Most importantly, however, this work has only lead to cultivated basil plants having intermediate resistance, at best. Efforts to introduce Peronospora belbarii resistance from wild basil accessions into cultivated basil plants have been frustrated by genetic incompatibility of the donor plant with Ocimum basilicum cultivated plants, leading to Fl sterility. A further complicating factor is that seed lots of wild basil accessions are often very variable and that resistance genes often are not fixed, particularly if such a resistance gene is recessive. Ben-Nairn et al. (Loc. cit.) describe Fl hybrids of Ocimum species made by crossing
Peronospora belbarii resistant parental accessions with the susceptible sweet basil variety "Peri". [0008] There currently are no cultivated Ocimum basilicum plants available comprising a complete resistance to downy mildew. There is thus a particular need for basil plants with a complete resistance to downy mildew.
[0009] It was surprisingly found that wild Ocimum basilicum plants could be identified having a complete resistance against downy mildew that could be introgressed into cultivated basil. It was further surprisingly found that the resulting cultivated plants of the species Ocimum basilicum did not suffer from the introduction of undesired characteristics such as a changed morphology and/or taste. It was further surprisingly found that the resulting cultivated plants of the species Ocimum basilicum did not show Fl sterility. SUMMARY OF INVENTION
[0010] The present invention relates to a cultivated plant of the species Ocimum basilicum comprising in its genome a single recessive gene conferring resistance to downy mildew when present in homozygous form.
[0011] The present invention further relates to pollen and seed produced by the cultivated plant of the present invention, seed from which the cultivated plant of the present invention can be grown and a part from the cultivated plant according to the present invention wherein the part comprises the single recessive gene as defined herein, preferably wherein the part is selected from the group consisting of a leaf, anther, pistil, stem, petiole, root, ovule, pollen, protoplast, tissue, seed, flower, cotyledon, hypocotyl, embryo and cell.
[0012] In addition the present invention relates to a method of producing a cultivated plant of the species Ocimum basilicum comprising in its genome a single recessive gene conferring downy mildew resistance, said method comprising the step(s) of: (i) crossing a first basil plant and a second basil plant, wherein the first plant is the cultivated plant according to the present invention; (ii) optionally harvesting seed from the crossing of (i) and selecting seed comprising the single recessive gene as defined herein.
BRIEF DESCRIPTION OF THE SEQUENCE LISTING
[0013] SEQ ID NO: 1 shows the DNA sequence of a downy mildew susceptible Ocimum basilicum plant comprising the susceptible type nucleotide for SNP 01. [0014] SEQ ID NO: 2 shows the DNA sequence of a downy mildew resistant Ocimum basilicum plant comprising the resistant type nucleotide for SNP 01.
[0015] SEQ ID NO: 3 shows the DNA sequence of a downy mildew susceptible Ocimum basilicum plant comprising the susceptible type nucleotide for SNP 02.
[0016] SEQ ID NO: 4 shows the DNA sequence of a downy mildew resistant Ocimum basilicum plant comprising the resistant type nucleotide for SNP 02.
[0017] SEQ ID NO: 5 shows the DNA sequence of a downy mildew susceptible Ocimum basilicum plant comprising the susceptible type nucleotide for SNP 03.
[0018] SEQ ID NO: 6 shows the DNA sequence of a downy mildew resistant Ocimum basilicum plant comprising the resistant type nucleotide for SNP 03. [0019] SEQ ID NO: 7 shows the DNA sequence of a downy mildew susceptible Ocimum basilicum plant comprising the susceptible type nucleotide for SNP 04.
[0020] SEQ ID NO: 8 shows the DNA sequence of a downy mildew resistant Ocimum basilicum plant comprising the resistant type nucleotide for SNP 04.
[0021] SEQ ID NO: 9 shows the DNA sequence of a downy mildew susceptible Ocimum basilicum plant comprising the susceptible type nucleotide for SNP 05.
[0022] SEQ ID NO: 10 shows the DNA sequence of a downy mildew resistant Ocimum basilicum plant comprising the resistant type nucleotide for SNP 05.
[0023] SEQ ID NO: 11 shows the DNA sequence of a downy mildew susceptible Ocimum basilicum plant comprising the susceptible type nucleotide for SNP 06.
[0024] SEQ ID NO: 12 shows the DNA sequence of a downy mildew resistant Ocimum basilicum plant comprising the resistant type nucleotide for SNP 06.
SEQ ID NO:
CAAAGACGAA GAAAAAGGGT GGTGGCAAGA AGAAGAAAGC AAAGAAAGGG GACAAATCCG AGGAAGTTGC CGCTGATGCC GATGCTGCGG AATGACAGGA ACTGCCCCTT GCTGCCTCCC TAGATTGTAG AGTGTTCTCC CTCACGAAAC AGCTGATGCG ATGCGGCAAA AAGAAAAACA ATTCAGCTAT TTGAGAAAGA AAAGCCTTGC CTTTTTCTTA TTTGTATTTT AACCATGAAA TGAAATTTTG TTCACCCCCA ATTGTATTTG GCTGCCTTCT TAG
SEQ ID NO: 2
CAAAGACGAA GAAAAAGGGT GGTGGCAAGA AGAAGAAAGC AAAGAAAGGG GACAAATCCG AGGAAGTTGC CGCTGATGCC GACGCTGCGG AATGACAGGA ACTGCCCCTT GCTGCCTCCC TAGATTGTAG AGTGTTCTCC CTCACGAAAC AGCTGATGCG ATGCGGCAAA AAGAAAAACA ATTCAGCTAT TTGAGAAAGA AAAGCCTTGC CTTTTTCTTA TTTGTATTTT AACCATGAAA TGAAATTTTG TTCACCCCCA ATTGTATTTG GCTGCCTTCT TAG
SEQ ID NO: 3
TGTGATCCTA TCCTCTCTTC TCTATCAGCT CTCGGATATT CCCGTGGACA ATGTAGTAAA TATTTCATCA GAGAGCTCTA CCTTTGAATG CATATCATGG CTTGTGCTTA TGTCTTTTCT TCTACCTGAC ATGGATTGAC ATGTCACATG TATGTTTTCT TGATTGATTT TCAATGGAAA CAACCTATGT GCTAGTTATT GTTTACTCTT GGTTTGCATT TGTTGTTGAA CATTTTTTGG ACACTGTCAT TCTTGTATGT CTAATCATGA GAAAAAGAAC CCTACTTGTG TTGGATCTCA TGGTGTGCTA T
SEQ ID NO:
TGTGATCCTA TCCTCTCTTC TCTATCAGCT CTCGGATATT CCCGTGGACA ATGTAGTAAA TATTTCATCA GAGAGCTCTA CCTTTGAATG CATATCATGG CTTGTGCTTA TGTCTTTTCT TCTACCTGAC ATGGATTGAC ATGTCACATG TATGTTTTCT TGATTGATTT TCAATGGAAA CAACCTATGT GCTAGTTATG GTTTACTCTT GGTTTGCATT TGTTGTTGAA CATTTTTTGG ACACTGTCAT TCTTGTATGT CTAATCATGA GAAAAAGAAC CCTACTTGTG TTGGATCTCA TGGTGTGCTA T SEQ ID NO: 5
CGCCTGGCGC GCCGCGGCGG CGTGAAGCGG ATCAGCGGTC TGATCTACGA
GGAGACTCGC GGCGTGCTGA AAATCTTCCT GGAGAACGTC ATCCGCGACG CCGTGACTTA CACCGAGCAC GCTCGCCGGA AGACCGTGAC GGCGATGGAC
GTCGTGTATG CGCTCAAGAG GCAGGGCCGC ACTCTGTACG GGTTCGGCGG
CTGAGTAATT AGGCGTTAGG GTTTCGTTAG ATGTATTTCG TTTTTTGTTT
TGGTTTCTGC GATTGAAGCT GGTAATGCTA GCTGTTTCGA ATCGTTGTAT GCTTG
SEQ ID NO: 6
CGCCTGGCGC GCCGCGGCGG CGTGAAGCGG ATCAGCGGTC TGATCTACGA
GGAGACTCGC GGCGTGCTGA AAATCTTCCT GGAGAACGTC ATCCGCGACG
CCGTCACTTA CACCGAGCAC GCTCGCCGGA AGACCGTGAC GGCGATGGAC GTCGTGTATG CGCTCAAGAG GCAGGGCCGC ACTCTGTACG GGTTCGGCGG
CTGAGTAATT AGGCGTTAGG GTTTCGTTAG ATGTATTTCG TTTTTTGTTT
TGGTTTCTGC GATTGAAGCT GGTAATGCTA GCTGTTTCGA ATCGTTGTAT GCTTG SEQ ID NO: 7
AACAACGAGA GCACGAGGGA CGTTGCTGCT GCTGCAAAGA TTGGCACGAT
TCTCGCACAA AGACTGCTGC TTAAAGACAT ACCAGCTGTT ACAGTGTTCT
TCAAGAGGGA TCAGAAGTAC CACGGCAAGG TTAAAGCGGT GGTCGATTCG
TTGACGAAGG GAGGTGTGAA GTTGATATGA ATATGCAGTT GGATCTTGCA TCCCATGCTG GTTATGAATC TGTTTTTGTT TCATTCATGT GCTAAAATTT
GTCAAAGAGA ACATCAGTTT GCTAGAAATG CTTAGTTCTT GTCCTTCAGA
TTATGATTGA TGGACTGGCT TTGTAGTTTT GGCTGTTTTT TTTTAACTTG
AAACGATGAA TAATTGAATA GGCCAAACTT TCATTTACAA GAT SEQ ID NO: 8
AACAACGAGA GCACGAGGGA CGTTGCTGCT GCTGCAAAGA TTGGCACGAT TCTCGCACAA AGACTGCTGC TTAAAGACAT ACCAGCTGTT ACAGTGTTCT TCAAGAGGGA TCAGAAGTAC CACGGCAAGG TTAAAGCGGT GGTCGATTCG TTGACGAAGG GAGGTGTGAA GTTGATATGA ATATGCAGTT GGTTCTTGCA TCCCATGCTG GTTATGAATC TGTTTTTGTT TCATTCATGT GCTAAAATTT GTCAAAGAGA ACATCAGTTT GCTAGAAATG CTTAGTTCTT GTCCTTCAGA TTATGATTGA TGGACTGGCT TTGTAGTTTT GGCTGTTTTT TTTTAACTTG AAACGATGAA TAATTGAATA GGCCAAACTT TCATTTACAA GAT SEQ ID NO: 9
CCTTCTTGAA ACCGGTTTGG ATCGTCACAC GCTTTCGATT CTTATAACTC TCTGTGATAT GGGTATCAAC CCCGAATCGT TGGCTGCTGT TGTTAAGGAG CTACGCCGGG AACTGCCGCC GCCATCTTCG GCCACAGATA CAGTTCAACA ACCAGGGCTG TGAAATCATG GCAGCTCGAT GCGGCGAGGT AGAAGATGAT TTGGAAGCAA AGGTTGATGC AGAAATTTCT TTTGGCAATT GTTTGAAGCT TGATGTATTA CAGTATACAA TTAAAGGAGA GGTTTTTTCT GCCTCAGCCA CTTTCTAATA TTTTGGATTA TTTGCAAGCT CTCCAAATTG TATCAGGTTA TATTTGATAT AGAAGTGTTT GTTGCATTCA TGTTTAGTGC CATAAAAAGA T
SEQ ID NO: 10
CCTTCTTGAA ACCGGTTTGG ATCGTCACAC GCTTTCGATT CTTATAACTC TCTGTGATAT GGGTATCAAC CCCGAATCGT TGGCTGCTGT TGTTAAGGAG CTACGCCGGG AACTGCCGCC GCCATCTTCG GCCACAGATA CAGTTCAACA ACCAGGGCTG TGAAATCATG GCAGCTCGAT GCGGCGAGGT AGAAGATGAT CTGGAAGCAA AGGTTGATGC AGAAATTTCT TTTGGCAATT GTTTGAAGCT TGATGTATTA CAGTATACAA TTAAAGGAGA GGTTTTTTCT GCCTCAGCCA CTTTCTAATA TTTTGGATTA TTTGCAAGCT CTCCAAATTG TATCAGGTTA
TATTTGATAT AGAAGTGTTT GTTGCATTCA TGTTTAGTGC CATAAAAAGA T SEQ I D NO : 1 1
GTTGAGTCCG ATGAGGGCGG AGATGGTGAC GCTCGGAGGC CGAATTCGGA
ACGTTATGAT GTTGGCCGGC GATAGGGATC GGACGGCGGA GTGTGCGCCG
TTGCTGCGGG AGCAGTTGAA GTCGTTGATC GTGCGGTCGA GTTTTGTTGG
AGGGGAAAGA TCGAAAAGAA GAAGGATGTT TGAGCAGAGA TTTATGGGAT AATATTTATA ACCCTACTCA TGCTGATAAT TAAGAAGTTT TTGATTATTT
TTTTTTAAAT TGTGTGTTTG GGAGTTTAGT TGTGATTGGG GTGTAATTAT
GTAAATTCCA AATGTATGGG TTGAATGGGA AAGATGATTT ATCTGTCAAT
TTTTGACCTG AAAGATTGGT GGTCAATTCA GGACCCGAAA GATCGTCAAA A
SEQ I D NO : 1 2
GTTGAGTCCG ATGAGGGCGG AGATGGTGAC GCTCGGAGGC CGAATTCGGA
ACGTTATGAT GTTGGCCGGC GATAGGGATC GGACGGCGGA GTGTGCGCCG
TTGCTGCGGG AGCAGTTGAA GTCGTTGATC GTGCGGTCGA GTTTTGTTGG AGGGGAAAGA TCGAAAAGAA GAAGGATGTT TGAGCAGAGA TTTATGGGAT
GATATTTATA ACCCTACTCA TGCTGATAAT TAAGAAGTTT TTGATTATTT
TTTTTTAAAT TGTGTGTTTG GGAGTTTAGT TGTGATTGGG GTGTAATTAT
GTAAATTCCA AATGTATGGG TTGAATGGGA AAGATGATTT ATCTGTCAAT
TTTTGACCTG AAAGATTGGT GGTCAATTCA GGACCCGAAA GATCGTCAAA A
BRIEF DESCRIPTION OF THE FIGURES
[0025] Figure 1 : Example of a downy mildew susceptible Ocimum basilicum sweet basil plant of the "Adriana" variety. [0026] Figure 2: Example of a rpbl plant; a cultivated plant of the species Ocimum basilicum comprising complete resistance to downy mildew.
DETAILED DESCRIPTION OF THE INVENTION
General definitions
[0027] The term "genome" relates to the genetic material of an organism. It consists of DNA. The genome includes both the genes and the non-coding sequences of the DNA.
[0028] The term "genetic determinant" relates to the genetic information in the genome of the plant that causes a particular trait of a plant. Accordingly, a genetic determinant comprises the genetic information (gene or locus or introgression) that confers a certain trait. In general, a genetic determinant may comprise a single gene (or one Quantitative Trait Locus (QTL)) or more than one gene. In the present invention, the genetic determinant comprises a single gene.
[0029] The term " single recessive gene conferring downy mildew resistance " relates to the genetic information, in the form of a single recessive gene, in the genome of the plant that causes the trait of downy mildew resistance in the plants of the invention, i.e. the resistance towards downy mildew. In the present invention, accordingly, the genetic determinant comprises a single gene (or one Quantitative Trait Locus (QTL)).
[0030] An allelism test is a test known in the art that can be used to identify whether two genes conferring the same trait are located at the same locus.
[0031 ] The word "trait" in the context of this application refers to the phenotype of the plant. When a plant shows the traits of the invention, its genome comprises the genetic determinants causing the traits of the invention. The plant, thus, has the genetic determinants of the invention. It is understood that when referring to a plant comprising the trait of the plant of the invention, reference is made to a basil plant comprising the trait of downy mildew resistance.
[0032] A genetic determinant can be inherited in a recessive manner, an intermediate manner, or in a dominant manner. Selection for the phenotypic trait is easier when intermediate or dominant inheritance is involved, as a larger part of the progeny of a cross reveals the trait. A genetic determinant can also comprise a combination of recessive and/or intermediate and/or dominant genes or QTLs. In the present invention, the genetic determinant comprises a single recessive gene.
[0033] Selection for a genetic determinant can be done on phenotype (the trait that can be observed). Selection can also be done by using one or more molecular markers that are genetically linked to the resistance gene. The use of molecular markers in breeding (also referred to as "marker assisted selection") requires a smaller population for screening (when compared to phenotypical selection), and can be done in a very early stage. A further advantage of molecular marker-assisted selection is the possibility to distinguish between heterozygous plants having one copy of the rpbl gene and homozygous plants having no copies of the rpbl gene of the present invention, which both show the same susceptible phenotype. The skilled person will understand that the identification of molecular markers requires a large mapping population. For example, one can develop one or more suitable molecular markers which are closely genetically (and preferably also physically) linked to the resistance conferring gene. This can be done by crossing a downy mildew resistant plant line according to the present invention with a plant line that is susceptible to downy mildew and developing a segregating population (e.g. F2 or backcross population) from that cross. The segregating population can then be phenotyped for the downy mildew resistance trait and genotyped using e.g. molecular markers such as SNPs (Single Nucleotide Polymorphisms), AFLPs (Amplified Fragment Length Polymorphisms; see, e.g., EP 534 858), or others, and by software analysis molecular markers which co-segregate with the downy mildew resistance trait in the segregating population can be identified and their order and genetic distance (centimorgan distance, cM) to the downy mildew resistance-conferring gene, locus or allele can be identified.
[0034] A "plant line" or "breeding line" refers to a plant and its progeny. As used herein, the term "inbred line" refers to a plant line which has been repeatedly selfed and is nearly homozygous for every o
characteristic. Thus, an "inbred line" or "parent line" refers to a plant which has undergone several generations (e.g. at least 5, 6, 7 or more) of inbreeding, resulting in a plant line with a high uniformity.
[0035] The term "allele(s)" means any of one or more alternative forms of a gene at a particular locus, all of which alleles relate to one trait or characteristic at a specific locus. In a diploid cell of an organism, alleles of a given gene are located at a specific location, or locus (loci plural) on a chromosome. One allele is present on each chromosome of the pair of homologous chromosomes. A diploid plant species may comprise a large number of different alleles at a particular locus. These may be identical alleles of the gene (homozygous) or two different alleles (heterozygous).
[0036] The term "locus" (plural loci) means a specific place or places or a site on a chromosome where for example a gene or genetic marker is found. The downy mildew locus (or loci) is thus the location(s) in the genome of a basil plant where the downy mildew resistance-conferring gene is found.
[0037] The term "gene" means a (genomic) DNA sequence comprising a region (transcribed region), which is transcribed into a messenger RNA molecule (mRNA) in a cell, and an operably linked regulatory region (e.g. a promoter). A gene may thus comprise several operably linked sequences, such as a promoter, a 5' leader sequence comprising e.g. sequences involved in translation initiation, a (protein) coding region (cDNA or genomic DNA) and a 3' non-translated sequence comprising e.g. transcription termination sites. Different alleles of a gene are thus different alternative forms of the gene, which may be in the form of e.g. differences in one or more nucleotides of the genomic DNA sequence (e.g. in the promoter sequence, the exon sequences, intron sequences, etc.), mRNA and/or amino acid sequence of the encoded protein. A gene may be an endogenous gene (in the species of origin) or a chimeric gene (e.g. a transgene or cis-gene).
[0038] "Transgene" or "chimeric gene" refers to a genetic locus comprising a DNA sequence, such as a recombinant gene, which has been introduced into the genome of a plant by transformation, such as Agrobacterium mediated transformation. A plant comprising a transgene stably integrated into its genome is referred to as "transgenic plant".
[0039] "Expression of a gene" refers to the process wherein a DNA region, which is operably linked to appropriate regulatory regions, particularly a promoter, is transcribed into an RNA, which is biologically active, i.e. which is capable of being translated into a biologically active protein or peptide (or active peptide fragment) or which is active itself (e.g. in posttranscriptional gene silencing or RNAi). The coding sequence may be in sense-orientation and encodes a desired, biologically active protein or peptide, or an active peptide fragment.
[0040] A "quantitative trait locus", or "QTL" is a chromosomal locus that encodes for one or more alleles that affect the expressivity of a continuously distributed (quantitative) phenotype. [0041] "Physical distance" between loci (e.g. between molecular markers and/or between phenotypic markers) on the same chromosome is the actually physical distance expressed in bases or base pairs (bp), kilo bases or kilo base pairs (kb) or megabases or mega base pairs (Mb).
[0042] "Genetic distance" between loci (e.g. between molecular markers and/or between phenotypic markers) on the same chromosome is measured by frequency of crossing-over, or recombination frequency (RF) and is indicated in centimorgans (cM). One cM corresponds to a recombination frequency of 1%. If no recombinants can be found, the RF is zero and the loci are either extremely close together physically or they are identical. The further apart two loci are, the higher the RF. [0043] "Wild type allele" (WT) refers herein to a version of a gene encoding a fully functional protein (wild type protein).
[0044] "Mutant allele" refers herein to an allele comprising one or more mutations in the coding sequence (mRNA, cDNA or genomic sequence) compared to the wild type allele. Such mutation(s) (e.g. insertion, inversion, deletion and/or replacement of one or more nucleotide(s)) may lead to the encoded protein having reduced in vitro and/or in vivo functionality (reduced function) or no in vitro and/or in vivo functionality (loss-of-function), e.g. due to the protein e.g. being truncated or having an amino acid sequence wherein one or more amino acids are deleted, inserted or replaced. Such changes may lead to the protein having a different 3D conformation, being targeted to a different sub-cellular compartment, having a modified catalytic domain, having a modified binding activity to nucleic acids or proteins, etc. Mutant alleles can be either "natural mutant" alleles, which are mutant alleles found in nature (e.g. produced spontaneously without human application of mutagens) or "induced mutant" alleles, which are induced by human intervention, e.g. by mutagenesis.
[0045] "Wild type plant" or "susceptible plant" refers herein to a Ocimum basilicum plant comprising (conferring) no resistance against basil downy mildew. Such plants are for example suitable controls in phenotypic assays. Preferably wild type plants are "cultivated Ocimum Basilicum plants" or "cultivated basil plants". For example, the variety "Adriana" is a commercial cultivated basil plant susceptible to downy mildew. Another example of a susceptible cultivated basil plant is the variety "Bavires", while other varieties only show intermediate resistance to downy mildew. No cultivated basil plants conferring a complete resistance to basil downy mildew are known. [0046] "Introgression fragment" or "introgression segment" or "introgression region" refers to a chromosome fragment (or chromosome part or region) which has been introduced into another plant of the same or related species by crossing or traditional breeding techniques, such as backcrossing, i.e. the introgressed fragment is the result of breeding methods referred to by the verb "to introgress" (such as backcrossing). In an Ocimum basilicum plant, wild or primitive Ocimum basilicum accessions or wild relatives of Ocimum basilicum plants can be used to introgress fragments of the wild genome into the genome of a cultivated Ocimum basilicum plant. Such a cultivated basil plant thus has a "genome of cultivated Ocimum basilicum plant", but comprises in the genome a fragment of a wild or primitive Ocimum basilicum or of a wild relative of Ocimum basilicum plant, e.g. an introgression fragment of a related wild Ocimum basilicum genome. It is understood that the term "introgression fragment" never includes a whole chromosome, but only a part of a chromosome. The introgression fragment can be large, e.g. even three quarter or half of a chromosome, but is preferably smaller, such as about 15 Mb or less, such as about 10 Mb or less, about 9 Mb or less, about 8 Mb or less, about 7 Mb or less, about 6 Mb or less, about 5 Mb or less, about 4 Mb or less, about 3 Mb or less, about 2.5 Mb or 2 Mb or less, about 1 Mb (equals 1,000,000 base pairs) or less, or about 0.5 Mb (equals 500,000 base pairs) or less, such as about 200,000 bp (equals 200 kilo base pairs) or less, about 100,000 bp (100 kb) or less, about 50,000 bp (50 kb) or less, about 25,000 bp (25 kb) or less.
[0047] The term "isogenic plant" refers to two plants which are genetically identical except for the genetic determinant for the downy mildew resistance trait. In order to investigate the impact of the downy mildew resistance trait, one can cross a plant line (or variety) of interest with a plant comprising the genetic determinants for the downy mildew resistance trait and select for progeny expressing the desired trait. Optionally one may have to self the progeny one or more times to be able to determine the genetic determinants for the downy mildew resistance trait in the plant phenotype. Said progeny can then be backcrossed (at least 2 times, e.g. 3, 4, or preferably 5 or 6 times) with the plant line (or variety) of interest while selecting for progeny having the same phenotype as the plant line (or variety) of interest and expressing the genetic determinants for the downy mildew resistance trait. The impact of the genetic determinants for the downy mildew resistance trait can then be compared between the plant line (variety) of interest and its isogenic line not comprising the genetic determinants for the downy mildew resistance trait.
[0048] The term "nucleic acid sequence" or "nucleic acid molecule" or polynucleotide are used interchangeably and refer to a DNA or RNA molecule in single or double stranded form, particularly a DNA encoding a protein or protein fragment according to the invention. An "isolated nucleic acid sequence" refers to a nucleic acid sequence which is no longer in the natural environment from which it was isolated, e.g. the nucleic acid sequence in a bacterial host cell or in the plant nuclear or plastid genome. [0049] The terms "protein", "peptide sequence", "amino acid sequence" or "polypeptide" are used interchangeably and refer to molecules consisting of a chain of amino acids, without reference to a specific mode of action, size, 3 -dimensional structure or origin. A "fragment" or "portion" of a protein may thus still be referred to as a "protein". An "isolated protein" is used to refer to a protein which is no longer in its natural environment, for example in vitro or in a recombinant bacterial or plant host cell. [0050] An "active protein" or "functional protein" is a protein which has protein activity as measurable in vitro, e.g. by an in vitro activity assay, and/or in vivo, e.g. by the phenotype conferred by the protein. A "wild type" protein is a fully functional protein, as present in the wild type plant. A "mutant protein" is herein a protein comprising one or more mutations in the nucleic acid sequence encoding the protein, whereby the mutation results in (the mutant nucleic acid molecule encoding) a protein having altered activity.
[0051] "Functional derivatives" of a protein as described herein are fragments, variants, analogues, or chemical derivatives of the protein which retain at least a portion of the activity or immunological cross reactivity with an antibody specific for the mutant protein. [0052] A fragment of a mutant protein refers to any subset of the molecule.
[0053] Variant peptides may be made by direct chemical synthesis, for example, using methods well known in the art.
[0054] An analogue of a mutant protein refers to a non-natural protein substantially similar to either the entire protein or a fragment thereof. [0055] A "mutation" in a nucleic acid molecule is a change of one or more nucleotides compared to the wild type sequence, e.g. by replacement, deletion or insertion of one or more nucleotides. A "point mutation" is the replacement of a single nucleotide, or the insertion or deletion of a single nucleotide.
[0056] A "mutation" in an amino acid molecule making up a protein is a change of one or more amino acids compared to the wild type sequence, e.g. by replacement, deletion or insertion of one or more amino acids.
[0057] As used herein, the term "operably linked" refers to a linkage of polynucleotide elements in a functional relationship. A nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence. For instance, a promoter, or rather a transcription regulatory sequence, is operably linked to a coding sequence if it affects the transcription of the coding sequence. Operably linked means that the nucleic acid sequences being linked are typically contiguous.
[0058] Sequence identity" and "sequence similarity" can be determined by alignment of two peptide or two nucleotide sequences using global or local alignment algorithms. Sequences may then be referred to as "substantially identical" or "essentially similar" when they are optimally aligned by for example the programs GAP or BESTFIT or the Emboss program "Needle" (using default parameters, see below) share at least a certain minimal percentage of sequence identity (as defined further below). These programs use the Needleman and Wunsch global alignment algorithm to align two sequences over their entire length, maximizing the number of matches and minimizing the number of gaps. Generally, the default parameters are used, with a gap creation penalty = 10 and gap extension penalty = 0.5 (both for J.
nucleotide and protein alignments). For nucleotides the default scoring matrix used is DNAFULL and for proteins the default scoring matrix is Blosum62 (Henikoff & Henikoff, 1992, PNAS 89, 10915- 10919). Sequence alignments and scores for percentage sequence identity may for example be determined using computer programs, such as EMBOSS, (as available on the Internet by ebi.ac.uk at http://www.ebi.ac.uk under /Tools/psa/emboss needle/). Alternatively sequence similarity or identity may be determined by searching against databases such as FASTA, BLAST, etc., but hits should be retrieved and aligned pairwise to compare sequence identity. Two proteins or two protein domains, or two nucleic acid sequences have "substantial sequence identity" if the percentage sequence identity is at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or more, preferably 90%, 95%, 98%, 99% or more (as determined by Emboss "needle" using default parameters, i.e. gap creation penalty = 10, gap extension penalty = 0.5, using scoring matrix DNAFULL for nucleic acids an Blosum62 for proteins). Such sequences are also referred to as 'variants' herein, e.g. other variants of alleles conferring complete resistance to downy mildew and proteins than the specific nucleic acid and amino acid sequences disclosed herein (as available in the deposit) can be identified, which have the same effect on susceptibility towards downy mildew as the plants of the invention such as rpbl.
[0059] The term "hybridisation" as used herein is generally used to mean hybridisation of nucleic acids at appropriate conditions of stringency (stringent hybridisation conditions) as would be readily evident to those skilled in the art depending upon the nature of the probe sequence and target sequences. Conditions of hybridisation and washing are well - known in the art, and the adjustment of conditions depending upon the desired stringency by varying incubation time, temperature and/or ionic strength of the solution are readily accomplished. See, for example, Sambrook, J. et al., Molecular Cloning: A Laboratory Manual, 2nd edition, Cold Spring Harbor Press, Cold Spring Harbor, New York, 1989. The choice of conditions is dictated by the length of the sequences being hybridised, in particular, the length of the probe sequence, the relative G-C content of the nucleic acids and the amount of mismatches to be permitted. Low stringency conditions are preferred when partial hybridisation between strands that have lesser degrees of complementarity is desired. When perfect or near perfect complementarity is desired, high stringency conditions are preferred. For typical high stringency conditions, the hybridisation solution contains 6X S.S.C., 0.01 M EDTA, IX Denhardt's solution and 0.5% SOS. hybridisation is carried out at about 68°C for about 3 to 4 hours for fragments of cloned DNA and for about 12 to about 16 hours for total eukaryotic DNA. For lower stringencies the temperature of hybridisation is reduced to about 42°C below the melting temperature (TM) of the duplex. The TM is known to be a function of the G-C content and duplex length as well as the ionic strength of the solution.
[0060] As used herein, the phrase "hybridizes" to a DNA or RNA molecule means that the molecule that hybridizes, e.g., oligonucleotide, polynucleotide, or any nucleotide sequence (in sense or antisense orientation) recognizes and hybridizes to a sequence in another nucleic acid molecule that is of approximately the same size and has enough sequence similarity thereto to effect hybridisation under J. o
appropriate conditions. For example, a 100 nucleotide long molecule from the 3' coding or non-coding region of a gene will recognize and hybridize to an approximately 100 nucleotide portion of a nucleotide sequence within the 3' coding or non-coding region of that gene or any other plant gene so long as there is about 70% or more sequence similarity between the two sequences. It is to be understood that the size of the corresponding portion will allow for some mismatches in hybridisation such that the
corresponding portion may be smaller or larger than the molecule which hybridizes to it, for example 20-30%) larger or smaller, preferably no more than about 12-15 % larger or smaller.
[0061] As used herein, the phrase "a sequence comprising at least 70% sequence identity" or "a sequence comprising at least 70% amino acid sequence identity" or "a sequence comprising at least 70% nucleotide sequence identity" means a sequence having at least 70% e.g. at least 72%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or even at least 99.1% e.g. at least 99.2%, 99.4%, 99.5%, or even 99.7%) or 99.8%) or 99.9% sequence identity when compared with the reference sequence that is indicated. Sequence identity can be determined according the methods described herein.
[0062] A "fragment" of the gene or DNA sequence refers to any subset of the molecule, e.g., a shorter polynucleotide or oligonucleotide. In one aspect the fragment comprises the mutation as defined by the invention.
[0063] A "variant" refers to a molecule substantially similar to either the entire gene or a fragment thereof, such as a nucleotide substitution variant having one or more substituted nucleotides, but which maintains the ability to hybridize with the particular gene or to encode mRNA transcript which hybridizes with the native DNA. Preferably the variant comprises the genetic determinant s) as defined by the invention i.e. as present in the plant deposited under NCIMB 42775.
[0064] A "variant" or "orthologous" or "ortholog" sequence of a genetic determinant, which in the context of the present invention is a single recessive gene, refers to a resistance conferring genetic determinant, or an introgression fragment comprising a genetic determinant, which is derived from different wild basil plant or wild relative of basil plant than the genetic determinant present in NCIMB 42775, but which variant comprises one or both of the genetic determinants of the plant of the current invention, i.e. a variant of the single recessive gene of the invention, and wherein the variant genomic sequence and/or amino acid sequence encoded by the gene comprises substantial sequence identity to the genetic determinant(s) in NCIMB 42775, i.e. at least 85%, 90%, 92%, 95%, 98%, 99% sequence identity or more.
[0065] A "homologue" refers to a fragment or variant sequence from a different plant family, genus or species. Preferably the homologue comprises the gene or locus as defined by the invention i.e. as present in the plant deposited under NCIMB 42775, wherein the homologous genomic sequence and/or amino acid sequence encoded by the homologous gene comprises substantial sequence identity to the , ,
14 genetic determinant(s) in NCIMB 42775, i.e. at least 60%, 65%, 70%, 75%, 85%, 90%, 92%, 95%, 98%o, 99% sequence identity or more.
[0066] An "analogue" refers to a non-natural molecule substantially similar to or functioning in relation to either the entire molecule, a variant or a fragment thereof. Preferably the analogue comprises the gene or locus as defined by the invention i.e. as present in the plant deposited under NCIMB 42775.
[0067] As used herein, the term "plant" includes the whole plant or any parts or derivatives thereof, such as plant organs (e.g., harvested or non-harvested flowers, leaves, etc.), plant cells, plant protoplasts, plant cell or tissue cultures from which whole plants can be regenerated, regenerable or non-regenerable plant cells, plant calli, plant cell clumps, and plant cells that are intact in plants, or parts of plants, such as embryos, pollen, ovules, ovaries (e.g., harvested tissues or organs), flowers, leaves, seeds, tubers, clonally propagated plants, roots, stems, cotyledons, hypocotyls, root tips and the like. Also any developmental stage is included, such as seedlings, immature and mature, etc. Preferably the plant part or derivative comprises the gene or locus as defined by the current invention.
[0068] A "plant line" or "breeding line" refers to a plant and its progeny. [0069] "Plant variety" is a group of plants within the same botanical taxon of the lowest grade known, which (irrespective of whether the conditions for the recognition of plant breeder's rights are fulfilled or not) can be defined on the basis of the expression of characteristics that result from a certain genotype or a combination of genotypes, can be distinguished from any other group of plants by the expression of at least one of those characteristics, and can be regarded as an entity, because it can be multiplied without any change. Therefore, the term "plant variety" cannot be used to denote a group of plants, even if they are of the same kind, if they are all characterized by the presence of 1 locus or gene (or a series of phenotypical characteristics due to this single locus or gene), but which can otherwise differ from one another enormously as regards the other loci or genes. "Fl , F2, etc." refers to the consecutive related generations following a cross between two parent plants or parent lines. The plants grown from the seeds produced by crossing two plants or lines is called the Fl generation. Selfing the Fl plants results in the F2 generation, etc. "Fl hybrid" plant (or Fl seed, or hybrid) is the generation obtained from crossing two inbred parent lines. "Selfing", accordingly, refers to the self-pollination of a plant, i.e. to the union of gametes from the same plant.
[0070] "Backcrossing" refers to a breeding method by which a (single) trait, such as downy mildew resistance, can be transferred from one genetic background (also referred to as "donor"; generally but not necessarily this is an inferior genetic background) into another genetic background (also referred to as "recurrent parent"; generally but not necessarily this is a superior genetic background). An offspring of a cross (e.g. an Fl plant obtained by crossing a wild basil or wild relative of basil with a cultivated basil plant; or an F2 plant or F3 plant, etc., obtained by selfing the Fl) is "backcrossed" to the parent with the superior genetic background, e.g. to the cultivated parent. After repeated backcrossing, the trait 15
of the donor genetic background, e.g. the gene conferring downy mildew resistance, will have been incorporated into the recurrent genetic background. The terms "gene converted" or "conversion plant" or "single locus conversion" in this context refer to plants which are developed by backcrossing wherein essentially all of the desired morphological and/or physiological characteristics of the recurrent parent are recovered in addition to the one or more genes transferred from the donor parent. The plants grown from the seeds produced by backcrossing of the Fl plants with the cultivated parent plant line is referred to as the "BC1 generation". Plants from the BC1 population may be selfed resulting in the BC1F2 generation, or backcrossed again with the cultivated parent plant line to provide the BC2 generation. An "Ml population" is a plurality of mutagenized seeds / plants of a certain cultivated plant line. "M2, M3, M4, etc." refers to the consecutive generations obtained following selfing of a first mutagenized seed / plant (Ml).
[0071] "Basil plants" or "Ocimum basilicum plants" are plants of the species Ocimum basilicum, i.e. any plant of the species Ocimum basilicum, including wild basil plants and cultivated basil plants. The term "basil plants" as used herein thus comprises "cultivated plants of the species Ocimum basilicum", also named herein as "cultivated basil plants" or "Ocimum basilicum cultivars" or "basil cultivars", which are basil plants cultivated by humans and having good agronomic characteristics. Cultivated plants include for example varieties and breeding lines of a species. In the context of the present invention, accordingly, the terms "cultivated plants" and "cultivars" are used interchangeably. The term "cultivated plants" as used herein does not comprise "wild plants". Wild plants are plants which generally have much poorer yields and poorer agronomic characteristics than cultivated plants and e.g. grow naturally in wild populations. "Wild plants" include for example ecotypes, PI (Plant Introduction) lines, landraces and wild accessions of a species.
[0072] Wild relatives of Ocimum basilicum are "wild plants" of the genus Ocimum other than Ocimum basilicum including, but not limited to, Ocimum americanum (such as O. americanum var. americanum and O. americanum var. pilosum), Ocimum kilimandscharium, Ocimum tenuiflorum, Ocimum gratissimum and Ocimum minimum.
[0073] The cultivated Ocimum basilicum plants of the present invention may, be any cultivated basil, any commercial variety of basil, any basil breeding line or other, it may be open pollinated or hybrid, or reproduced vegetatively. [0074] It is understood that in order to make crosses between two Ocimum species resulting in fertile progeny, the male and the female plant should have the same ploidy, e.g. 2n x 2n or 4n x 4n. Optionally the ploidy of a diploid can be doubled using methods known in the art, e.g. using colchicine.
[0075] The term "food" is any substance consumed to provide nutritional support for the body. It is usually of plant or animal origin, and contains essential nutrients, such as carbohydrates, fats, proteins, vitamins, or minerals. The substance is ingested by an organism and assimilated by the organism's cells lb
in an effort to produce energy, maintain life, or stimulate growth. The term food includes both substance consumed to provide nutritional support for the human and animal body.
[0076] "Vegetative propagation" or "clonal propagation" refers to propagation of plants from vegetative tissue, e.g. by propagating plants from cuttings or by in vitro propagation. In vitro propagation involves in vitro cell or tissue culture and regeneration of a whole plant from the in vitro culture. Clones (i.e. genetically identical vegetative propagations) of the original plant can thus be generated by in vitro culture. "Cell culture" or "tissue culture" refers to the in vitro culture of cells or tissues of a plant. "Regeneration" refers to the development of a plant from cell culture or tissue culture or vegetative propagation. "Non-propagating cell" refers to a cell which cannot be regenerated into a whole plant.
[0077] "Average" refers herein to the arithmetic mean.
[0078] It is understood that comparisons between different plant lines involves growing a number of plants of a line (or variety) (e.g. at least 5 plants, preferably at least 10 plants per line) under the same conditions as the plants of one or more control plant lines (preferably wild type plants) and the determination of statistically significant differences between the plant lines when grown under the same environmental conditions. Preferably the plants are of the same line or variety.
[0079] The term "downy mildew" as used herein refers to the plant disease caused by oomycetes of the genus Peronospora. In basil, downy mildew is caused by the oomycetes Peronospora belbahrii; see Thines et al. Mycological Research 113 (2009) 532-540. Downy mildew infection in basil results in chlorosis and necrosis of affected leaf tissue, which allows detection of the pathogen by visible inspection. Sporulation is induced under favorable weather conditions, which is visible by the formation of brown sporangia on the underside of the affected leaves. The Peronospora belbahrii pathogen can be readily isolated from infected basil plants grown in the field. In literature no difference between different isolates has been described. [0080] The term "plant resistant to downy mildew" or "plant resistant to Peronospora belbahrii" or a "plant comprising complete resistant to downy mildew" as used herein refers to plants having no downy mildew symptoms on adult leaves or (significantly) less downy mildew symptoms on adult leaves when compared to intermediate level control plants, such as defined herein. Downy mildew resistance can, for example, be assessed using a downy mildew resistance assay or alternatively in the field, tunnel or greenhouse in growing areas where natural downy mildew infection occurs. Various downy mildew resistance assays are possible, e.g. as described in the downy mildew test in the
Examples of this document. In general a downy mildew resistance assay may, for example, involve artificial inoculation of the leaves of a plurality of plants when the plants are at least 2 weeks old (e.g. 2 weeks old, 3 weeks old, 4 weeks old, 5 weeks old, 6 weeks old, 7 weeks old, 8 weeks old or more), optionally followed by a second inoculation of the leaves e.g. 1 week later, 2 week later, or 3 weeks later, incubating the plants and control plants for a suitable period of time and under suitable conditions, induce sporulation under suitable conditions and evaluating symptoms one or more times post inoculation (e.g. 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 15 days, 20 days or 30 days post inoculation). The susceptible control should be severely symptomatic for the test to be successful (e.g. at least 30%, preferably at least 40%, or 50%, or more than 60% (»50%) of the leaf area showing leaf necrosis). Preferably at least 20 e.g. at least 30, 40, 50, 60, 70, 100, 125, 150, 175, or even more than 200 plants per genotype are included in each replicate and preferably several replicates are carried out. In one aspect, when testing resistance, a line or variety is considered resistant if at least 90%, 95% or 100%) of the plants of the line or variety shows less than 25% of leaf area showing leaf necrosis (e.g. 20%), 15%), 10%), 5%o, or even less than 5% or more preferably absence of symptoms (0%)), while at least 50%), 60%, 70%, 80%, 90% or more plants of the susceptible control line or variety shows more than 25% of leaf area showing leaf necrosis (e.g. 30%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%o, 90%), 95%o, or even more than 95% or more preferably no resistance (100%))). In another aspect, a plant is considered to be resistant to downy mildew when it scores a 7 or higher e.g. 7, 8, or 9, in the downy mildew resistance test protocol as defined in the Examples of this document, while the susceptible control has a score of 1. A plant is considered to have an intermediate level of resistance when it scores a 5 or 6 in the downy mildew resistance test protocol as defined in the Examples of this document. A plant is considered to have a low level of resistance when it scores a 4, 3 or 2 in the downy mildew resistance test protocol as defined in the Examples of this document. A plant is considered to have no resistance when it scores a 1 in the downy mildew resistance test protocol as defined in the Examples of this document.
[0081 ] In this document and in its claims, the verb "to comprise" and its conjugations is used in its non- limiting sense to mean that items following the word are included, but items not specifically mentioned are not excluded. In addition, reference to an element by the indefinite article "a" or "an" does not exclude the possibility that more than one of the element is present, unless the context clearly requires that there be one and only one of the elements. The indefinite article "a" or "an" thus usually means "at least one". It is further understood that, when referring to "sequences" herein, generally the actual physical molecules with a certain sequence of subunits (e.g. amino acids or nucleic acids) are referred to. Plants and methods of the invention
[0082] The present invention provides a cultivated plant of the species Ocimum basilicum comprising in its genome a single recessive gene conferring resistance to downy mildew when present in homozygous form.
[0083] The single recessive gene is designated herein as rpbl which stands for resistance to Perenospora balbahrii 1. The rpbl gene of the present invention was first identified in a wild donor lo
plant of the species Ocimum basilicum. The inventors succeeded in developing a cultivated Ocimum basilicum plant resistant to downy mildew by introgressing the rpbl gene from the donor plant into a non-resistant basil line, especially into a cultivated basil line, e.g. a sweet basil line. In one embodiment, accordingly, the single recessive gene conferring said downy mildew resistance is comprised in an introgression fragment. In one aspect the single recessive gene conferring said downy mildew resistance may also be comprised in a complete chromosome that is inherited by the cultivated Ocimum basilicum plant of the present invention from the wild donor plant. In one aspect, the cultivated plant comprises a recombinant chromosome, said chromosome comprises the introgression fragment which comprises rpbl gene. Preferably, the introgression fragment contains genes and molecular markers that facilitate the distinction between plants comprising the rpbl gene and plants not comprising the rpbl gene. In one aspect the introgression fragment comprises molecular markers, e.g. single nucleotide polymorphisms (SNPs), linked to the rpbl allele of the donor, which are polymorphic between cultivated basil and the wild donor and thereby allow the introgression fragment to be identified. In one aspect the markers are closely linked to the rpbl allele, e.g. within 5cM, 4cM, 3cM, 2cM, lcM or less. In a preferred aspect a marker is an in-gene marker, i.e. within the rpbl allele.
[0084] The single, recessive rpbl gene, which is effective against Perenospora balbahrii infection in basil, is of great advantage in generating complete downy mildew resistant basil varieties. To date, only cultivated basil plant varieties having an intermediate level of resistance against downy mildew have been described. Therefore, the products described herein (e.g. plants, plant parts, progeny plants, etc.) provide a significant improvement over the prior art.
[0085] From the inheritance pattern observed when breeding the resistant plant of the present invention it can be concluded that the resistance trait of the present invention is inherited by a single recessive gene. Only plants that are homozygous for the rpbl gene of the present invention were found to show complete resistance to downy mildew. Preferably, the cultivated plant of the present invention, is homozygous for the single recessive gene conferring the downy mildew resistance. Plants heterozygous for the single recessive gene conferring the downy mildew resistance as provided by the present invention are particularly useful for breeding methods, for instance by selling the heterozygous plant to provide offspring that is at least partially homozygous for the single recessive gene conferring the downy mildew resistance. [0086] A representative sample of seeds of a basil line comprising the rpbl gene in homozygous form has been deposited under Accession number NCIMB 42775. Thus in one embodiment of the present invention, the single recessive gene provided by the present invention is as present in, or as obtainable from, or as obtained from, or as comprised in the genome of an Ocimum basilicum plant designated rpbl, of which a representative number of seeds have been deposited with the NCIMB under deposit number NCIMB 42775, or progeny of the deposited plants. J-
[0087] In one aspect, in the plant according to the present invention, the rpbl gene is comprised in an introgression fragment, whereby said introgression fragment is detectable by one or more SNP nucleotides linked to the rpbl gene. Accordingly, Single Nucleotide Polymorphisms (SNPs) were identified on the introgression fragment which are closely linked to rpbl allele conferring the downy mildew resistance trait. In one embodiment of the present invention, the single recessive gene is in an introgression fragment, wherein said introgression fragment comprises a sequence of a donor plant conferring resistance to downy mildew when present in homozygous form comprising one or more (or all) SNPs having the resistant nucleotides selected from the group consisting of SNP 01, SNP 02, SNP 03, SNP 04, SNP 05 and SNP 06 as described herein, e.g. in Table 6. In one aspect, the downy mildew resistance SNP nucleotide for SNP 01, SNP 02, SNP 03, SNP 04, SNP 05 and/or SNP 06 is the SNP nucleotide of the introgression fragment comprising the rpbl gene, i.e. a Cytosine (C) at nucleotide 83 of SEQ ID NO: 2 (SNP l), a Guanine (G) at nucleotide 200 of SEQ ID NO: 4 (SNP 2), a Cytosine (C) at nucleotide 105 of SEQ ID NO: 6 (SNP 3), a Thymine (T) at nucleotide 193 of SEQ ID NO: 8 (SNP 4), a Cytosine (C) at nucleotide 201 of SEQ ID NO: 10 (SNP 5) and/or a Guanine (G) at nucleotide 201 of SEQ ID NO: 12 (SNP 6).
[0088] Preferably, the introgression fragment comprises one or more nucleotides selected from the list comprising:
a Cytosine at nucleotide 83 of SEQ ID NO: 2 or of a sequence comprising at least 90% sequence identity to SEQ ID NO: 2;
a Guanine at nucleotide 200 of SEQ ID NO: 4 or of a sequence comprising at least 90% sequence identity to SEQ ID NO: 4;
a Cytosine at nucleotide 105 of SEQ ID NO: 6 or of a sequence comprising at least 90%> sequence identity to SEQ ID NO: 6;
a Thymine at nucleotide 193 of SEQ ID NO: 8 or of a sequence comprising at least 90%> sequence identity to SEQ ID NO : 8 ;
a Cytosine at nucleotide 201 of SEQ ID NO: 10 or of a sequence comprising at least 90%> sequence identity to SEQ ID NO: 10; and
a Guanine at nucleotide 201 of SEQ ID NO: 12 or of a sequence comprising at least 90%> sequence identity to SEQ ID NO: 12. [0089] The SNP nucleotides of plants having the downy mildew resistance trait, i.e. the resistant SNP nucleotides, are present in homozygous form for SNP l to SNP 6 in the seeds deposited under deposit number NCIMB 42775.
[0090] The SNPs can be used to test the presence of an introgression fragment comprising rpbl gene in a plant cell, plant tissue, plant part, and/or in marker assisted selection (MAS) to transfer the rpbl gene into other basil lines or varieties. The SNPs can also be used to select plants comprising smaller introgressions fragments than the fragments present in the deposited seeds, whereby the smaller u
sub-fragments retain the rpbl gene. Alternatively, the SNPs can be used to identify other donors which comprise the rpbl gene and to introgress said gene into (cultivated) plants of the species Ocimum basilicum.
[0091] The present invention, therefore, relates in one aspect to cultivated plants of the species Ocimum basilicum (or plant parts) comprising in its genome an introgression fragment of a donor plant showing resistance to downy mildew, wherein the introgression fragment comprises a sequence of the donor plant comprising the rpbl gene in-between SNP 01 and SNP 02, or in-between SNP 01 and SNP 03, or in-between SNP 01 and SNP 04, or in-between SNP 01 and SNP 05, or in-between SNP 01 and SNP 06, or in-between SNP 02 and SNP 03, or in-between SNP 02 and SNP 04, or in- between SNP 02 and SNP 05, or in-between SNP 02 and SNP 06, or in-between SNP 03 and SNP 04, or in-between SNP 03 and SNP 05, or in-between SNP 03 and SNP 06, or in-between SNP 04 and SNP 05, or in-between SNP 04 and SNP 06, or in-between SNP 05 and SNP 06. The rpbl gene is present on the introgression fragment, as can be determined, inter alia, by performing the downy mildew disease resistance test as described herein. [0092] When referring herein to the introgression fragment comprising the donor sequence (and the resistance gene) "in-between" two SNPs (Single Nucleotide Polymorphisms), this encompasses in one aspect that one or both of the two SNPs themselves are also from the downy mildew resistant donor, i.e. have the donor ("resistant") nucleotide. Thus, SNP 01, SNP 02, SNP 03, SNP 04, SNP 05 and SNP 06 may all have the donor nucleotide. Or only 5 different SNPs selected from the group consisting of SNP 01, SNP 02, SNP 03, SNP 04, SNP 05 and SNP 06 may have the downy mildew resistant donor nucleotide; or only 4 different SNPs selected from the group consisting of SNP 01, SNP 02, SNP 03, SNP 04, SNP 05 and SNP 06 may have the downy mildew resistant donor nucleotide; or only 3 different SNPs selected from the group consisting of SNP 01, SNP 02, SNP 03, SNP 04, SNP 05 and SNP 06 may have the downy mildew resistant donor nucleotide; or only 2 different SNPs selected from the group consisting of SNP 01, SNP 02, SNP 03, SNP 04, SNP 05 and SNP 06 may have the downy mildew resistant donor nucleotide; or only a single SNP selected from the group consisting of SNP 01, SNP 02, SNP 03, SNP 04, SNP 05 and SNP 06 may have the downy mildew resistant donor nucleotide. The SNPs that do not have the resistant donor nucleotide thus have another genotype, e.g. the recipient (susceptible) nucleotide. The recipient nucleotide for a SNP may be any of the other 3 nucleotides, i.e. for SNP 01 the recipient nucleotide may be Adenine, Guanine or Thymine.
[0093] The reason that not all of the SNPs provided herein need to have the resistant nucleotide is that the introgression fragment comprising the rpbl gene from the donor may be smaller than the fragment introgressed e.g. in the deposited seeds, but the fragment still comprises the rpbl gene. Still, a plant can be recognized to contain the introgression fragment (comprising the rpbl gene) by the phenotype, and/or by transferring the fragment to a recipient plant and thereby transferring the downy mildew resistance phenotype, or by sequencing the region between the SNP markers to identify the donor fragment, or other methods known to the skilled person, such as saturating the region with more SNP markers, allelism tests, identifying the causal gene, etc.
[0094] In one aspect a downy mildew resistant plant of the invention comprises an introgression fragment conferring downy mildew resistance that has the same nucleotide sequence as the introgression fragment found in seeds deposited under NCIMB 42775, or a smaller fragment thereof retaining the rpbl gene. An introgression fragment from one specific, unique donor accession can be easily identified and distinguished in a plant not only by the genotype of the SNP markers (described above) but also by its nucleotide sequence. For example, by whole genome sequencing the genome of the deposit one can identify the introgression fragment as present in the deposit or as derived from the deposit (e.g. in progeny). In this way, for any basil plant comprising complete resistance the presence of the specific introgression fragment as present in the seed deposit (or a shorter fragment derived therefrom) can be determined, e.g. by whole genome sequencing of the resistant basil plant and of the seed deposit and identifying the introgression fragment. This has, for example, been done in tomato, where genome sequences of tomato inbreeding lines and hybrids identified introgression fragments on chromosome 6 and chromosome 9 of specific wild accessions. See Lin et al., Nature Genetics published October 12, 2014, doi: 10.1038/ng.3117, page 5, Figure 4.
[0095] Thus in one aspect, the one or more SNP nucleotides of the basil plant comprising the introgression fragment comprising the rpbl gene is one or more of the resistant nucleotides, i.e. at least one SNP has the nucleotide as indicated in Table 1 , below. Although the introgression fragment comprising the rpbl gene must be in homozygous form to confer resistance to downy mildew, the present invention is also directed to plants comprising the rpbl gene of the present invention in heterozygous form since, e.g. such heterozygous plants can be used for breeding to generate offspring that is homozygous for the rpbl gene by selfing.
[0096] Table 1
SNP (Single Nucleotide Polymorphism) Resistant SNP
nucleotide
SNP 01 refers to nucleotide 83 of SEQ ID NO:2 (or of a sequence C
comprising at least 90%, or at least 95%, 96%, 97%, 98% or 99%
sequence identity to SEQ ID NO: 2)
SNP 02 refers to nucleotide 200 of SEQ ID NO:4 (or of a sequence G
comprising at least 90%, or at least 95%, 96%, 97%, 98% or 99%
sequence identity to SEQ ID NO: 4)
SNP 03 refers nucleotide 105 of SEQ ID NO:6 (or of a sequence C
comprising at least 90%, or at least 95%, 96%, 97%, 98% or 99%
sequence identity to SEQ ID NO: 6)
SNP 04 refers nucleotide 193 of SEQ ID NO: 8 (or of a sequence T
comprising at least 90%, or at least 95%, 96%, 97%, 98% or 99%
sequence identity to SEQ ID NO: 8) SNP 05 refers nucleotide 201 of SEQ ID NO: 10 (or of a sequence C
comprising at least 90%, or at least 95%, 96%, 97%, 98% or 99%
sequence identity to SEQ ID NO: 10)
SNP 06 refers nucleotide 201 of SEQ ID NO: 12 (or of a sequence G
comprising at least 90%, or at least 95%, 96%, 97%, 98% or 99%
sequence identity to SEQ ID NO: 12)
[0097] The rpbl resistance gene, or the introgression fragment on which it is located, or a sub- fragment thereof comprising the gene, can be transferred from a plant grown from a seed deposited under accession number NCIMB 42775 to another basil plant by various methods known to the skilled person. Alternatively, the donor of the rpbl resistance gene can be a progeny of said plant, or a plant grown from a cell culture derived from a plant grown from a seed deposited under accession number NCIMB 42775. The transferred gene can confer recessive resistance to downy mildew, particularly resistance to Peronospora belbahrii infection, in the recipient plant.
[0098] In one embodiment, accordingly, the single recessive gene is introgressed from a Ocimum basilicum plant designated rpbl, of which representative number of seeds have been deposited with the NCIMB under deposit number NCIMB 42775; or the single recessive gene is introgressed from a progeny plant of said Ocimum basilicum plant designated rpbl, wherein said progeny plant comprises said single recessive gene as present in the genome of, or obtainable from, or obtained from, or as comprised in an Ocimum basilicum plant designated rpbl, of which a representative number of seeds have been deposited with the NCIMB under deposit number NCIMB 42775. The fragment can also be identified by one or more molecular markers (e.g. SNP markers, AFLP markers, RFLP markers, etc.), especially molecular markers which are polymorphic between the recipient plant and the donor plant of the introgression fragment. The fragment can also be identified by whole genome sequencing.
[0099] The present invention thus provides a cultivated plant that shows complete resistance against downy mildew when the single recessive gene is present in homozygous form. Said complete resistance against downy mildew preferably reflects an average resistance level of at least 7. The resistance level is determined on a scale of 1 for no resistance (fully susceptible) to 9 for absence of symptoms. The resistance level is preferably determined using the procedure as described herein. Accordingly, a resistance level of 1 stands for no resistance (fully susceptible) leading to heavy infection and a resistance level of 9 stands for absence of symptoms. A plant having a complete resistance level is defined herein as a resistance level of 7 or 8 or 9, preferably a resistance level of 8 or 9, most preferably a resistance level of 9. A plurality of plants of the present invention having a complete resistance level accordingly shows an average resistance level of at least 7, more preferably shows an average resistance level of at least 8. Most preferably, a plurality of plants of the present invention shows an average resistance level of 9, wherein said plant shows absence of downy mildew symptoms upon infestation. In basil plants, downy mildew is generally caused by infection with the oomycetes Peronospora belbahrii. In the context of the present invention, accordingly, the downy mildew is preferably caused by the oomycetes Peronospora belbahrii.
[0100] Tests or assays for the presence of mildew against downy mildew in a basil plant comprise using qualitative disease resistance assays under controlled environment conditions and preferably allow the distinction between no resistance (fully susceptible) plants, plants having a low level of resistance, plants having an intermediate level of resistance and plants having complete resistance. The skilled person is familiar with applying different protocols for assays. In short, seedlings of a plurality of plants of the plant genotype to be tested (e.g. at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more plants) are inoculated with the Peronospora belbahrii inoculum to be tested. The seedlings are incubated under conditions which are favorable to the pathogen. Several days after incubation and preferably after inducing sporulation, the plants are assessed for infection symptoms, such as sporulation on the cotyledons and/or leaves (e.g. first true leaf). In this assessment, each plant is categorized according to the proportion of the leaf surface that is affected by downy mildew. Preferably, the downy mildew resistance is classified according to the following scheme.
Figure imgf000024_0001
[0101] Preferably, also one or more control plants (e.g. a susceptible line or variety, a resistant line or variety) should be included in the assay using the same treatment(s) and environmental conditions, to ensure that the assay works as intended. A susceptible control plant should preferably show a resistance level of 1. [0102] Preferably, the cultivated plant of the present invention is selected from the group consisting of sweet basil, cinnamon basil and Thai basil. Sweet basil is the most common Ocimum basilicum type which is also commercially most relevant. Cinnamon basil is a specific Ocimum basilicum type that is particularly characterized by its strong scent of cinnamate. Thai basil, which is also known as anise basil or licorice basil, is a basil type that is characterized by its silvery leaves and a strong scent of anethole. Most preferably, the plant of the present invention is sweet basil. The plant of the present invention may be grown for food or feed purposes. The plant may be an inbred, a hybrid, a Fl hybrid, a land race, a double haploid, a transgenic plant, a mutant plant, a single locus converted plant comprising the rpbl gene, etc. In one embodiment, the basil plant of the present invention is a hybrid plant.
[0103] The rpbl gene, and/or the introgression fragment comprising the gene (or a sub-fragment thereof), can be easily transferred into any basil plant. In other words, the rpbl gene can be introduced into any other basil plant by introgression from a plant grown from seeds of which a representative „ ,
24
sample was deposited under NCIMB 42775, or any basil plant derived therefrom and comprising the rpbl gene. The deposited seeds are therefore a source of the rpbl resistance gene of the invention, as are basil plants not directly obtained from the deposit, but for example indirectly obtained (e.g. later released commercial varieties) and which contain rpbl gene of the invention. Other sources of the rpbl gene may be identified, e.g. in wild basil or wild relatives of basil and e.g. an allelism test may be used to determine whether another recessive gene, conferring the same resistance phenotype as the plant of the invention, is the same gene or a different gene. Alternative methods to determine whether another gene is the same gene include the development of molecular markers linked to the rpbl gene of the invention, e.g. the use of the marker provided herein, and analyzing whether the markers also occur in plants comprising the other gene. Or whole genome sequencing or gene mapping can be used to identify the rpbl gene, and/or the introgression fragment comprising the gene, in rpbl plants and compare it to the gene in another plant, and/or to the genomic sequence of another plant. Preferably, the cultivated plant of the present invention is a non-transgenic plant.
[0104] In a further embodiment, the present invention provides a method of producing a basil plant of the species Ocimum basilicum comprising in its genome a single recessive gene conferring downy mildew resistance, said method comprising the step of (i) crossing a first basil plant and a second basil plant, wherein the first basil plant is the cultivated plant according to the present invention. Said method of producing a basil plant optionally comprises a further step of (ii) harvesting seed from the crossing of step (i) as described herein above, or optionally from progeny of the cross, such as a selling progeny (e.g. F2 or F3 or further generation) or a backcross progeny (BC1, BC2, or further generation), and selecting seed comprising the single recessive gene conferring downy mildew resistance as described in the present invention. Selections (or identification) in step (ii) may be made based on the phenotype (i.e. using a downy mildew resistance assay) and/or based on molecular methods, such as detection of molecular markers linked to the rpbl gene or locus. [0105] Preferably, both the first basil plant and the second basil plant in the above described step (i) are cultivated plants according to the present invention. In one aspect, both the first basil plant and the second basil plant in the above described step (i) are plants homozygous for the rpbl gene, which is the single recessive gene conferring downy mildew resistance as provided by the present invention. The resulting seeds harvested in step (ii) are thereby also homozygous for the rbpl gene or locus. Such a process is particularly suitable for producing a basil plant that shows complete resistance against downy mildew. Plants produced by the method are also an embodiment of the invention, e.g. Fl hybrid plants comprising the rpbl gene in homozygous form.
[0106] In a further embodiment, the present invention accordingly provides a method of identifying and/or selecting a plant or plant part of the species Ocimum basilicum comprising in its genome a single recessive gene conferring resistance to downy mildew when present in homozygous form, comprising determining whether the plant or plant part comprises one or more SNPs having the resistant nucleotide o
25
selected from the group consisting of SNP 01, SNP 02, SNP 03, SNP 04, SNP 05 and SNP 06. In a subsequent step, the method may further comprise selecting a plant of plant part having one or more of the resistant nucleotide selected from the group consisting of SNP 01, SNP 02, SNP 03, SNP 04, SNP 05 and SNP 06. The resistant nucleotide for SNP 01, SNP 02, SNP 03, SNP 04, SNP 05 and SNP 06 are described herein, e.g. in Table 1. Accordingly, the resistant nucleotide of SNP 01 is a
Cytosine at nucleotide 83 of SEQ ID NO: 2 or of a sequence comprising at least 90% sequence identity to SEQ ID NO: 2; the resistant nucleotide of SNP 02 is a Guanine at nucleotide 200 of SEQ ID NO: 4 or of a sequence comprising at least 90%> sequence identity to SEQ ID NO: 4; the resistant nucleotide of SNP 03 is a Cytosine at nucleotide 105 of SEQ ID NO: 6 or of a sequence comprising at least 90%> sequence identity to SEQ ID NO: 6; the resistant nucleotide of SNP 04 is a Thymine at nucleotide 193 of SEQ ID NO: 8 or of a sequence comprising at least 90%> sequence identity to SEQ ID NO: 8; the resistant nucleotide of SNP 05 is a Cytosine at nucleotide 201 of SEQ ID NO: 10 or of a sequence comprising at least 90%> sequence identity to SEQ ID NO: 10; and the resistant nucleotide of SNP 06 is a Guanine at nucleotide 201 of SEQ ID NO: 12 or of a sequence comprising at least 90%> sequence identity to SEQ ID NO: 12.
Seeds
[0107] The invention provides a seed from which any plant of the invention can be grown.
Furthermore, the invention provides a plurality of such seed. A seed of the invention can be
distinguished from other seeds due to the presence of the rpbl gene, either phenotypically (based on plants having the rpbl resistance phenotype) and/or using molecular methods such as polymorphic markers linked to the allele or sequencing. Seeds include for example seeds produced on the plant of the invention after self-pollination or seed produced after cross-pollination, e.g. pollination of a plant of the invention with pollen from another basil plant or pollination of another basil plant with pollen of a plant of the invention. [0108] Particularly, the present invention provides pollen or seed produced by the cultivated plant according to the present invention, wherein the pollen or seed comprises the single recessive gene as defined as defined herein.
[0109] In a further embodiment, the present invention provides seed from which the cultivated plant of the present invention can be grown. [0110] In yet a further embodiment, the present invention provides seeds obtained from the methods of producing basil plants as described herein.
[0111] In one aspect, a plurality of seed is packaged into a container (e.g. a bag, a carton, a can etc.). Containers may be any size. The seeds may be pelleted prior to packing (to form pills or pellets) and/or treated with various compounds, including seed coatings. Plant parts and vegetative reproductions
[0112] In a further aspect a plant part, obtained from (obtainable from) a plant of the invention is provided herein, and a container or a package comprising said plant part.
[0113] Particularly, the present invention provides a part from the cultivated plant of the present invention, wherein the part comprises the genetic determinant conferring downy mildew resistance as described in the present invention, preferably wherein the part is selected from the group consisting of a leaf, anther, pistil, stem, petiole, root, ovule, pollen, protoplast, tissue, seed, flower, cotyledon, hypocotyl, embryo and cell. The various stages of development of aforementioned plant parts are comprised in the invention. [0114] In a further aspect, the plant part is a plant cell. In still a further aspect, the plant part is a non-regenerable cell or a regenerable cell. In another aspect the plant cell is a somatic cell.
[0115] A non-regenerable cell is a cell which cannot be regenerated into a whole plant through in vitro culture. The non-regenerable cell may be in a plant or plant part (e.g. leaves) of the invention. The non-regenerable cell may be a cell in a seed, or in the seedcoat of said seed. Mature plant organs, including a mature leaf, a mature stem or a mature root, contain at least one non-regenerable cell.
[0116] In a further aspect the plant cell is a reproductive cell, such as an ovule or a cell which is part of a pollen. In an aspect, the pollen cell is the vegetative (non-reproductive) cell, or the sperm cell (Tiezzi, Electron Microsc. Review, 1991) . Such a reproductive cell is haploid. When it is regenerated into whole a plant, it comprises the haploid genome of the starting plant. If chromosome doubling occurs (e.g. through chemical treatment), a double haploid plant can be regenerated. In one aspect the plant of the invention comprising the rpbl gene is a haploid or a double haploid basil plant.
[0117] Moreover, there is provided an in vitro cell culture or tissue culture of basil plants of the invention in which the cell- or tissue culture is derived from a plant part described above, such as, for example and without limitation, a leaf, a pollen, an embryo, cotyledon, hypocotyls, callus, a root, a root tip, an anther, a flower, a seed or a stem, or a part of any of them, or a meristematic cell, a somatic cell, or a reproductive cell.
[0118] Also provided is a basil plant regenerated from any of the above-described plant parts, or regenerated from the above-described cell or tissue cultures, said regenerated plant having a downy mildew resistance phenotype (as conferred by the rpbl gene), i.e. retains the rpbl gene (or the introgression fragment comprising the rpbl gene) of the invention. This plant can also be referred to as a vegetative propagation of plants of the invention.
[0119] Also provided is a harvested leaf or branch comprising leaves of a plant of the invention and a package comprising a plurality of leaves or a plurality of branches comprising leaves of one or more ^ plants of the invention. These leaves or branches thus comprise the rpbl gene of the invention, detectable e.g. by phenotypically testing (for the originally used whole plant and/or regenerated plant) or by linked molecular markers.
[0120] The invention also provides for a food or feed product comprising or consisting of a plant part described herein. The food or feed product may be fresh or processed, e.g., canned, steamed, boiled, fried, blanched and/or frozen etc. Examples are salad or salad mixtures or other food products comprising a leaf or a part of a leaf of a plant of the invention.
Plants and Progeny
[0121] In another embodiment, plants and parts of basil plants of the invention, and progeny of basil plants of the invention are provided, e.g., grown from seeds, produced by sexual or vegetative reproduction, regenerated from the above-described plant parts, or regenerated from cell or tissue culture, in which the reproduced (seed propagated or vegetatively propagated) plant comprises complete resistance against downy mildew.
[0122] In a further embodiment, the present invention provides the cultivated plant grown from the seed as described herein.
[0123] In yet a further embodiment, the present invention provides the basil plant grown from seeds obtained from the method for producing a basil plant as described herein.
[0124] Furthermore, the invention provides for progeny comprising or retaining the downy mildew resistance phenotype (conferred by the rpbl gene), such as progeny obtained by, e.g., selling one or more times and/or cross-pollinating a plant of the invention with another basil plant of a different variety or breeding line, or with a basil plant of the invention one or more times. In particular, the invention provides for progeny that retain the rpbl gene (conferring the complete downy mildew resistance phenotype) of (as found in) NCIMB 42775. In one aspect the invention provides for a progeny plant comprising the rpbl resistance, such as a progeny plant that is produced from a basil plant comprising the rpbl resistance by one or more methods selected from the group consisting of: selfing, crossing, mutation, double haploid production or transformation. Mutation may be spontaneous mutations or human induced mutations or somaclonal mutations. In one embodiment, plants or seeds of the invention may also be mutated (by e.g. irradiation, chemical mutagenesis, heat treatment, TILLING, etc.) and/or mutated seeds or plants may be selected (e.g. natural variants, somaclonal variants, etc.) in order to change one or more characteristics of the plants. Similarly, plants of the invention may be transformed and regenerated, whereby one or more chimeric genes are introduced into the plants. Transformation can be carried out using standard methods, such as Agrobacterium tumefaciens mediated transformation or biolistics, followed by selection of the transformed cells and regeneration into plants. A desired trait (e.g. genes conferring pest or disease resistance, herbicide, fungicide or insecticide tolerance, etc.) can Q O be introduced into the plants, or progeny thereof, by transforming a plant of the invention or progeny thereof with a transgene that confers the desired trait, wherein the transformed plant retains the rpbl gene and the downy mildew resistance phenotype conferred by it and contains the desired trait.
[0125] In one aspect haploid plants and/or double haploid plants of plant of the invention are encompassed herein, which comprise complete resistance against downy mildew, preferably conferred by the rpbl gene or by the introgression fragment comprising the rpbl gene. Haploid and double haploid (DH) plants can for example be produced by anther or microspore culture and regeneration into a whole plant. For DH production chromosome doubling may be induced using known methods, such as colchicine treatment or the like. So, in one aspect a basil plant is provided, comprising the complete downy mildew resistance phenotype as described, wherein the plant is a double haploid plant.
[0126] In another embodiment the invention relates to a method for producing basil seed, comprising crossing a plant of the invention with itself or a different basil plant and harvesting the resulting seed. In a further embodiment the invention relates to seed produced according to this method and/or a basil plant produced by growing such seed. Thus, a plant of the invention may be used as male and/or female parent, in the production of basil seeds, whereby the plants grown from said seeds comprise complete resistance against downy mildew, preferably due to the presence of the rpbl gene.
[0127] Thus, in one aspect progeny of a basil plant of the invention are provided, wherein the progeny plant is produced by selling, crossing, mutation, double haploid production or transformation and preferably wherein the progeny retain the rpbl resistance gene (and phenotype conferred by it) described herein, i.e. obtainable by crossing a basil plant, grown from seeds deposited under accession number NCIMB 42775, with another basil plant. In other words, the resistance gene or locus (or introgression fragment comprising the gene or locus) as present in / found in / as derived from (or as derivable from) seed deposit NCIMB 42775 is retained in the progeny plants.
[0128] Molecular markers may also be used to aid in the identification of the plants (or plant parts or nucleic acids obtained therefrom) containing the rpbl resistance gene or locus or allele(s). For example, one can develop one or more suitable molecular markers which are closely genetically (and preferably also physically) linked to the rpbl resistance gene, locus or allele. This can be done by crossing a resistant basil plant (comprising the rpbl gene) with a susceptible basil plant and developing a segregating population (e.g. F2 or backcross population) from that cross. The segregating population can then be phenotyped for downy mildew resistance and genotyped using e.g. molecular markers such as SNPs (Single Nucleotide Polymorphisms), AFLPs (Amplified Fragment Length Polymorphisms; see, e.g., EP 534 858), or others, and by software analysis molecular markers which co-segregate with the downy mildew resistance trait in the segregating population can be identified and their order and genetic distance (centimorgan distance, cM) to the rpbl gene or locus can be identified. Molecular markers which are closely linked to rpbl resistance locus, e.g. markers at a 5 cM distance or less, can then be used in detecting and/or selecting plants (e.g. plants of the invention or progeny of a plant of the invention) or plant parts comprising or retaining the introgression fragment comprising the rpbl gene or locus. Such closely linked molecular markers can replace phenotypic selection (or be used in addition to phenotypic selection) in breeding programs, i.e. in Marker Assisted Selection (MAS). Preferably, linked markers are used in MAS. More preferably, flanking markers are used in MAS, i.e. one marker on either side of the rpbl gene or locus. In one aspect the rpbl gene is flanked on one side by SNP 04 and on the other side by either SNP 01 or SNP 03.
In one aspect, the complete resistance to downy mildew is caused by a mutation in the rpbl allele or orthologous allele or homologous allele. Thus in one aspect a mutant rpbl allele is provided.
Mutagenesis techniques such as chemical or UV mutagenesis can be used, or targeted mutagenesis techniques such as Crispr-Cas can be used to induce mutations in a wild type RPB 1 gene which confer complete downy mildew resistance.
In one aspect plants, plant parts and cells according to the invention are not exclusively obtained by means of an essentially biological process as defined by Rule 28(2) EPC. [0129] Other embodiments of the invention relate to the following numbered embodiments, which are not to be seen in isolation but can be combined with any of the other embodiments described herein. Preferably, the herein-below described cell or cells is a non-propagating cell (also described herein as a non-regenerable cell). It is understood that in these embodiments a non-propagating plant cell is a plant cell which is unable to maintain its life by synthesizing carbohydrate and protein from the inorganic substance, such as water, carbon dioxide and mineral salt and so on through photosynthesis.
Embodiment 1. An Ocimum basilicum plant cell of the invention i.e. a plant cell of a cultivated plant of the species Ocimum basilicum comprising in its genome a single recessive gene conferring resistance to downy mildew when present in homozygous form. In one aspect, said single recessive gene, also described herein as the rpbl resistance gene (or locus or allele(s)), wherein samples of seed comprising the rpbl resistance gene (or locus or allele(s)) have been deposited under deposit number NCIMB 42775.
Embodiment 2. The Ocimum basilicum plant cell of embodiment 1, wherein the single recessive gene is comprised in an introgression fragment.
Embodiment 3. The Ocimum basilicum plant cell of embodiment 1 or 2, wherein the plant cell is homozygous for the single recessive gene conferring the downy mildew resistance.
Embodiment 4. The Ocimum basilicum plant cell of any one of embodiments 1-3, wherein the single recessive gene is as present in, or as obtainable from, or as obtained from, or as comprised in the genome of an Ocimum basilicum plant designated rpbl, of which a representative number of seeds have been deposited under deposit number NCIMB 42775. oU
Embodiment 5. The Ocimum basilicum plant cell of embodiment 4, wherein the single recessive gene is in an introgression fragment, wherein said introgression fragment comprises a sequence of a donor plant conferring resistance to downy mildew when present in homozygous form comprising one or more SNPs having the resistant nucleotides selected from the group consisting of SNP 01, SNP 02, SNP 03, SNP_04, SNP_05 and SNP_06.
Embodiment 6. The Ocimum basilicum plant cell of any one of embodiments 4 or 5, wherein the introgression fragment comprises one or more nucleotides selected from the list comprising:
a Cytosine at nucleotide 83 of SEQ ID NO: 2 or of a sequence comprising at least 90% sequence identity to SEQ ID NO: 2;
a Guanine at nucleotide 200 of SEQ ID NO: 4 or of a sequence comprising at least 90% sequence identity to SEQ ID NO: 4;
a Cytosine (C) at nucleotide 105 of SEQ ID NO: 6 or of a sequence comprising at least 90%> sequence identity to SEQ ID NO: 6;
a Thymine at nucleotide 193 of SEQ ID NO: 8 or of a sequence comprising at least 90%> sequence identity to SEQ ID NO : 8 ;
a Cytosine at nucleotide 201 of SEQ ID NO: 10 or of a sequence comprising at least 90%> sequence identity to SEQ ID NO: 10; and
a Guanine at nucleotide 201 of SEQ ID NO: 12 or of a sequence comprising at least 90%> sequence identity to SEQ ID NO: 12. Embodiment 7. The Ocimum basilicum plant cell of any one of embodiments 1-6, wherein the single recessive gene is introgressed from a Ocimum basilicum plant designated rpbl, of which representative number of seeds have been deposited with the NCIMB under deposit number NCIMB 42775;
or wherein the single recessive gene is introgressed from a progeny plant of said Ocimum basilicum plant designated rpbl, wherein said progeny plant comprises said single recessive gene as present in the genome of, or obtainable from, or obtained from, or as comprised in an Ocimum basilicum plant designated rpbl, of which a representative number of seeds have been deposited under deposit number NCIMB 42775.
Embodiment 8. The Ocimum basilicum plant cell of any one of embodiments 1-8, wherein said plant cell is from a plant that shows complete resistance against downy mildew when the single recessive gene is present in homozygous form.
Embodiment 9. The Ocimum basilicum plant cell of embodiment 8, wherein said complete resistance against downy mildew reflects an average resistance level of at least 7, preferably of at least 8 and most preferably of 9, the average resistance level is determined on a scale of 1 , for no resistance, to 9, for absence of symptoms. o -L
Embodiment 10. The Ocimum basilicum plant cell of any one of embodiments 1-9, wherein the downy mildew is caused by the oomycetes Peronospora belbahrii.
Embodiment 11. The Ocimum basilicum plant cell of any one of embodiments 1-10, wherein the plant cell is sweet basil plant cell, cinnamon basil plant cell or Thai basil plant cell, preferably sweet basil. Embodiment 12. The Ocimum basilicum plant cell of any one of embodiments 1-11, wherein the plant cell is a non-transgenic plant cell.
Embodiment 13. Use of Ocimum basilicum plant which comprises a single recessive gene conferring resistance to downy mildew when present in homozygous form, to cross with another Ocimum basilicum plant and optionally select progeny from said crossing, a representative sample of seeds of a plant comprising said single recessive gene conferring resistance to downy mildew when present in homozygous form having been deposited under Accession Number NCIMB 42775.
Embodiment 14. Use of Ocimum basilicum plant deposited under Accession Number NCIMB 42775 to produce a genetic marker profile.
Embodiment 15. Use of an Ocimum basilicum plant of the invention i.e. comprising a single recessive gene conferring resistance to downy mildew when present in homozygous form, for basil leaf and/or basil branch production.
Embodiment 16. Use of an Ocimum basilicum plant of the invention i.e. comprising a single recessive gene conferring resistance to downy mildew when present in homozygous form, in a method of producing an Ocimum basilicum plant having a desired trait. Embodiment 17. Use of an Ocimum basilicum plant of the invention i.e. comprising a single recessive gene conferring resistance to downy mildew when present in homozygous form, in an Ocimum basilicum breeding program or in an Ocimum basilicum seed production program.
Embodiment 18. Use of one or more SNP markers selected from SNP 01, SNP 02, SNP 03, SNP 04, SNP 05 and SNP 6 for detecting and/or selecting an Ocimum basilicum plant or plant part comprising a gene conferring resistance to downy mildew when present in homozygous form.
Embodiment 19. A method for selecting or detecting an Ocimum basilicum plant or plant part comprising a gene conferring resistance to downy mildew when present in homozygous form in its genome, said method comprising determining the SNP genotype of the plant or plant part for one or more or all of the SNP markers selected from SNP_01, SNP_02, SNP_03, SNP_04, SNP_05 and SNP_06. Embodiment 20. The method according to embodiment 19, wherein the plant or plant part is a seed, a seed coat, a cell, a tissue, an embryo, a leaf or leaf part, a head or part thereof, DNA isolated from a cell or tissue. The SNP genotype can for example be determined using any genotyping assays, such as a TaqMan assay, a KASP Assay, or other assays.
Seed Deposits
[0130] A representative sample of seeds of a basil plant {Ocimum basilicum) according to the invention (i.e. comprising in its genome a genetic determinant comprising a single gene conferring said downy mildew resistance and wherein the plant is homozygous for the gene conferring the downy mildew resistance) designated rpbl, was deposited by HILD samen gmbh and accepted for deposit on 29 June 2017 at the NCIMB Ltd. (Ferguson Building, Craibstone Estate, Bucksburn Aberdeen, Scotland AB21 9YA, UK) according to the Budapest Treaty, under the Expert Solution (EPC 2000, Rule 32(1)). Seeds were given the following deposit number: NCIMB 42775.
[0131] The Applicant requests that samples of the biological material and any material derived therefrom be only released to a designated Expert in accordance with Rule 32(1) EPC or related legislation of countries or treaties having similar rules and regulation, until the mention of the grant of the patent, or for 20 years from the date of filing if the application is refused, withdrawn or deemed to be withdrawn.
[0132] Access to the deposit will be available during the pendency of this application to persons determined by the Director of the U.S. Patent Office to be entitled thereto upon request. Subject to 37 C.F.R. § 1.808(b), all restrictions imposed by the depositor on the availability to the public of the deposited material will be irrevocably removed upon the granting of the patent. The deposit will be maintained for a period of 30 years, or 5 years after the most recent request, or for the enforceable life of the patent whichever is longer, and will be replaced if it ever becomes nonviable during that period. Applicant does not waive any rights granted under this patent on this application or under the Plant Variety Protection Act (7 USC 2321 et seq.).
EXAMPLES
General methods
[0133] In the germplasm of the basil breeding program, plants of the species Ocimum basilicum were developed comprising in their genome a single recessive gene conferring a complete resistance towards the downy mildew species Peronospora belbahrii. These plants were crossed with plants of a cultivated sweet basil variety to combine the complete resistance towards downy mildew with other traits of commercial interest.
Disease resistance test Preparation of inoculum
[0134] The oomycetes Peronospora belbahrii was maintained on living plants by bi-weekly transfer of spores to healthy plants of an internal basil breeding line with a susceptible genotype. A field isolate of Peronospora belbahrii was used to establish the downy mildew maintenance population. Inoculum was produced from infested plants of the downy mildew maintenance population. A new field isolate was regularly prepared to ensure that the results obtained with the inoculum are comparable with a naturally occurring Peronospora belbahrii infection. No differences between different Peronospora belbahrii isolates could be observed. Sporulation was induced by keeping infested plants for 24 hours in the dark at a temperature of 15 °C and at 100% relative humidity. Leaves showing sporulation were collected and stirred for 1-2 minutes in cold water. The thus obtained liquid was filtered through a nylon mesh to provide a spore-containing solution. The concentration of spores in the spore-containing solution was determined by counting the spores using a Fuchs-Rosenthal counting chamber. Before use as inoculum, the concentration of spores in the spore-containing solution was adjusted to 104 spores/ml by the addition of cold water. Test protocol
[0135] Germplasm to be tested for resistance towards downy mildew were sown in seeding trays. The plants were grown for 2.5 to 3 weeks after germination, after which they were inoculated by spraying the plants with the inoculum prepared as described herein above comprising 104 spores/ml. The inoculated plants were subsequently kept for 24 hours in the dark under inoculation conditions comprising a temperature of 20-22 °C and a relative humidity of 100%. After inoculation, the plants were kept for 1-2 weeks at normal growing conditions comprising a temperature of 20-22 °C and a 12 hours light/12 hours dark regime. Plants were re- infected with inoculum 1 week after the first inoculation to ensure that all tested plants are indeed infected. Subsequently, sporulation was induced by keeping the plants for 24 hours in the dark under sporulation inducing conditions comprising 15 °C and at 100%) relative humidity. The plants were subsequently scored for downy mildew infestation.
[0136] Scoring of the individual plants was realized using a scale from 1 -9, where 1 stands for no resistance (fully susceptible) leading to heavy infection and 9 stands for absence of symptoms. A plant having a complete resistance level is defined as a resistance level of 7or 9, preferably 8 or 9, preferably a resistance level of 9. [0137] Downy mildew resistance was classified according to the following scheme:
Resistance level 1 2 3 4 5 6 7 8 9
% of leaf >80- >60- >40- >25- >15- >10- >5- >0-5 0
surface affected 100 80 60 40 25 15 10 (Absence of by downy symptoms) mildew „ ,
34
[0138] A complete resistance against downy mildew is defined as an average resistance level of 7 or higher, e.g. 7, 8 or 9. Intermediate level of resistance against downy mildew is defined as an average resistance level of 5 or 6. No resistance against downy mildew is defined as an average resistance level of 1 ; a low resistance against downy mildew is defined as a an average resistance level of more than 1 but less than 5, e.g. 2, 3, or 4.
[0139] In one aspect of the invention, the resistance score as referred to in the various aspects and/or embodiments of the invention are scored according to the classification as described here above. In another aspect, the resistance score as referred to in the various aspects and/or embodiments of the invention are scored according to test protocol as described herein. Control plants
[0140] As negative control the commonly available Ocimum basilicum variety "Bavires" was used. The average resistance level of the Bavires variety was found to be 1 (no resistance). In addition thereto, the Ocimum basilicum variety "Eleonora" (Enza) was tested for downy mildew resistance. It is reported that Eleonora shows "intermediate resistance" against downy mildew. The average resistance level of the Eleonora variety was found to be below 2 (low resistance). No Ocimum basilicum variety as a positive control could be included in the test protocol since no cultivated Ocimum basilicum plants having complete resistance against downy mildew were known. Alternatively, the wild Ocimum basilicum accession as further described herein below was used as a positive control. The average resistance level of this wild Ocimum basilicum accession was found to be 9 (complete resistance). [0141] All scorings are given on a scale from 1 (for no resistance) to 9 (for absence of symptoms) using the test protocol with high disease pressure as provided herein.
Transfer of a genetic determinant conferring resistance to downy mildew from wild basil to cultivated basil plants
[0142] The wild Ocimum basilicum accession as used in the present invention was obtained from a USDA seedbank. The rpbl basil line as deposited in the context of the present invention was obtained by crossing the resistant wild Ocimum basilicum accession with the susceptible Ocimum basilicum sweet basil variety "Adriana" to provide a Fl population, followed by a back-crossing step with the Adriana variety. The thus obtained progeny (BC1 population) was selfed for two generations while selecting the resistant plants for the second selling step to provide the rpbl basil line which combines the good properties of the Adriana variety with the complete resistance to Peronospora belbahrii from the wild Ocimum basilicum accession. All plants of the rpbl basil line tested for resistance to downy mildew using the test protocol described herein showed complete resistance (Resistance level 9, absence of symptoms). The susceptible Ocimum basilicum sweet basil variety "Adriana" showed no resistance (Resistance level 1, >80-100 % of leaf surface affected by downy mildew) using the test protocol n
do
described herein. The characteristics of the wild Ocimum basilicum accession used as donor plant and of the Ocimum basilicum sweet basil variety "Adriana" used as the recipient plant were very different; see Table 2.
Table 2 Comparison between selected properties of the wild Ocimum basilicum accession used as donor plant and the Ocimum basilicum sweet basil variety "Adriana".
Figure imgf000036_0001
Confirmation of monogenic recessive inheritance pattern
[0143] It is reported that, allthough Ocimum basilicum plants are tetraploid, traits in Ocimum basilicum plants are inherited in a diploid manner (Phippen and Simon, Journal of Heredity
2000:91(4)289-296). The inheritance pattern observed when breeding the resistant rpbl basil line suggests that the resistance trait of the present invention is inherited by a single recessive gene. This finding was confirmed by selfing the Fl population obtained by crossing resistant wild Ocimum basilicum accession with the susceptible Ocimum basilicum sweet basil variety Adriana. The thus obtained F2 populations were tested for resistance to downy mildew using the test protocol described herein. The individual F2 plants either showed complete resistance (Resistance level 9, absence of symptoms) or showed no resistance (Resistance level 1, >80-100 % of leaf surface affected by downy mildew); see Table 3.
Table 3 Resistance to Peronospora belbahrii in 3 independent F2 populations
Plant number Resistant Susceptible
(Resistance score 9) (Resistance score 1)
Non-resistant control 0 100
F2 population 1 64 186
F2 population 2 44 177
F2 population 3 62 172 n
do
[0144] The segregation between resistant plants and susceptible plants as shown in Table 3 corresponds with a 1 :3 distribution associated with a monogenic recessive inheritance.
[0145] In addition thereto, plants of the susceptible Fl population were back-crossed with the susceptible Ocimum basilicum sweet basil variety Adriana. Individual plants of the thus obtained BC1 population were selfed to provide different BC1F2 populations. Plants of the different obtained BC1F2 populations were tested for resistance to downy mildew using the test protocol described herein. The individual BC1F2 plants either showed complete resistance (Resistance level 9, absence of symptoms) or showed no resistance (Resistance level 1, >80-100 % of leaf surface affected by downy mildew); see Table 4.
Table 4 Resistance to Peronospora belbahrii in 6 independent BC1F2 populations
Figure imgf000037_0001
[0146] The segregation between resistant plants and susceptible plants as shown in Table 3 corresponds with a 1 :3 distribution associated with a monogenic recessive inheritance.
Marker development [0147] Molecular markers were developed which are linked to the downy mildew resistance- conferring gene of the present invention, which then can be used for selection of downy mildew resistant plants by selecting for plants having the linked molecular markers. Linked markers can be developed using a range of techniques, such as Bulk Segregant Analysis, and a range of markers, such as AFLP markers, RFLP markers, SNP markers, mini-or micro- satellite markers, etc. For marker development a segregating population was generated by e.g. crossing a downy mildew resistant plant line according to the present invention with a plant line that is susceptible to downy mildew and developing a segregating population therefrom (e.g. an F2 or F3 population or backcross population). Markers can then be identified which are closely associated (linked) with the downy mildew resistance trait, i.e. co- segregates with the e.g. the recessive gene conferring resistance to downy mildew when present in homozygous form. See for example Wolukau et al. (HortScience February 2009 vol. 44 no. 1 32-34) the ^ use of Bulk Segregant Analysis in melon to identify markers linked to a resistance gene. A molecular marker is a DNA sequence or single nucleotide polymorphism (SNP) which is found on the
chromosome close to e.g. the causal gene conferring resistance to downy mildew when present in homozygous form (e.g. within a genetic distance of 5 cM or less) and which is different from the DNA sequence or SNP found close to the corresponding (wild type) gene that is present in cultivated plants of the species Ocimum basilicum that are susceptible to downy mildew. Thus, in one embodiment the gene conferring resistance to downy mildew when present in homozygous form according to the present invention can be introduced into other plants of the species Ocimum basilicum lacking said gene conferring resistance to downy mildew by marker assisted breeding methods, using a molecular marker closely linked to the resistance conferring gene according to the present invention.
Specifically, Fl plants were generated by crossing a DM resistant Ocimum basilicum line (Line 505) with a sensitive breeding line Adriana (Line 504). An Fl plant was self-pollinated and F2 seeds were harvested. Four hundred F2 plants were grown to be tested for resistance to downy mildew using the test protocol described herein, together with the sensitive (Line 504) and resistant (Line 505) that were internal controls for the disease test. All plants were cloned to have two identical sets. One set was used to take leaf samples for DNA and RNA isolation. The other set was infected for the disease test and plants were scored twice for visible disease symptoms; see table 5.
Table 5 Disease symptom scores in percentage of leaf surface affected by downy mildew
Figure imgf000038_0001
Based on the outcome of the disease test tissue samples from the 71 resistant plants were pooled as were tissue samples from 71 plants with score 1, 10 sensitive 504 plants and 8 resistant parent 505 plants. RNA was isolated using a plant tissue RNA isolation kit (RNeasy Plant Mini Kit, Qiagen) and sequenced by a service company (GenXPro, world wide web at //genxpro.net/) to identify
polymorphisms in the gene transcripts by MACE (Massive Analysis of cDNA Ends = MACE = 3' mRNA-Seq ) sequencing. About 14.500 SNPs were identified in the RNA between the two parent lines. From these 64 were selected because they had the same nucleotide homozygously in the resistant parent and in the resistant F2 pool, another nucleotide homozygously in the sensitive line, and heterozygous and sensitive scores in the RNA sequences of the sensitive F2 pool. O Q
C O
Marker assays (KASP™, LCG) were generated for these 64 SNPs to analyse the genotypes of the 383 F2 plants (the 400 F2s from the disease test without the 17 plants that could not be scored ("?")) and the parent lines. Three SNPs, HE6, HE9 and HE28 had each the same homozygous nucleotide in all resistant lines, the other nucleotide in the sensitive parent, and either heterozygous or sensitive call for the nucleotide in the sensitive F2 plants; see Table 5, wherein markers in bold are fully linked to the trait in the tested population of 72 resistant F2s, 311 sensitive F2s and plants from the parent lines.
Table 6 Percentage genotypes* in the different resistance groups.
Figure imgf000039_0001
The 6 marker assays were used to interrogate a panel of basil lines representing genotypic diverse germplasm to see whether the identified SNPs are specific for the locus with the resistance gene. The SNPs appeared all 6 to have the sensitive call in all lines without the resistance (in total 11 different commercial downy mildew sensitive basil lines were tested).
Table 7 Identified SNP marker data associated with the downy mildew resistance conferring gene of the present invention
Marker DNA sequences with Single nucleotide Nucleotide Nucleotide UID resistant sensitive sequence [resistant/sensitive]
SNP_01 mHEl CAAAGACGAAGAAAAAGGGTGGTGGCAAGAAGAAGAA C T
AGCAAAGAAAGGGGACAAATCCGAGGAAGTTGCCGCTG
ATGCCGA[C/T]GCTGCGGAATGACAGGAACTGCCCCTTG
CTGCCTCCCTAGATTGTAGAGTGTTCTCCCTCACGAAACA
GCTGATGCGATGCGGCAAAAAGAAAAACAATTCAGCTAT
TTGAGAAAGAAAAGCCTTGCCTTTTTCTTATTTGTATTTT
AACCATGAAATGAAATTTTGTTCACCCCCAATTGTATTTG
GCTGCCTTCTTAG (SEQ ID NO: 1 and 2)
SNP_02 mHE6 TGTGATCCTATCCTCTCTTCTCTATCAGCTCTCGGATATTC G T
CCGTGGACAATGTAGTAAATATTTCATCAGAGAGCTCTA
CCTTTGAATGCATATCATGGCTTGTGCTTATGTCTTTTCTT
CTACCTGACATGGATTGACATGTCACATGTATGTTTTCTT
GATTGATTTTCAATGGAAACAACCTATGTGCTAGTTAT[G/
T]GTTTACTCTTGGTTTGCATTTGTTGTTGAACATTTTTTG
GACACTGTCATTCTTGTATGTCTAATCATGAGAAAAAGA ACCCTACTTGTGTTGGATCTCATGGTGTGCTAT (SEQ ID
NO: 3 and 4)
SNP_03 mHE13 CGCCTGGCGCGCCGCGGCGGCGTGAAGCGGATCAGCGG c G
TCTGATCTACGAGGAGACTCGCGGCGTGCTGAAAATCTT
CCTGGAGAACGTCATCCGCGACGCCGT[C/G]ACTTACAC
CGAGCACGCTCGCCGGAAGACCGTGACGGCGATGGACG
TCGTGTATGCGCTCAAGAGGCAGGGCCGCACTCTGTACG
GGTTCGGCGGCTGAGTAATTAGGCGTTAGGGTTTCGTTA
GATGTATTTCGTTTTTTGTTTTGGTTTCTGCGATTGAAGCT
GGTAATGCTAGCTGTTTCGAATCGTTGTATGCTTG (SEQ
ID NO: 5 and 6)
SNP_04 mHE22 AACAACGAGAGCACGAGGGACGTTGCTGCTGCTGCAAA T A
GATTGGCACGATTCTCGCACAAAGACTGCTGCTTAAAGA
CATACCAGCTGTTACAGTGTTCTTCAAGAGGGATCAGAA
GTACCACGGCAAGGTTAAAGCGGTGGTCGATTCGTTGAC
GAAGGGAGGTGTGAAGTTGATATGAATATGCAGTTGG[T/
A]TCTTGCATCCCATGCTGGTTATGAATCTGTTTTTGTTTC
ATTCATGTGCTAAAATTTGTCAAAGAGAACATCAGTTTG
CTAGAAATGCTTAGTTCTTGTCCTTCAGATTATGATTGAT
GGACTGGCTTTGTAGTTTTGGCTGTTTTTTTTTAACTTGA
AACGATGAATAATTGAATAGGCCAAACTTTCATTTACAA
GAT (SEQ ID NO: 7 and 8)
SNP_05 mHE28 CCTTCTTGAAACCGGTTTGGATCGTCACACGCTTTCGATT c T
CTTATAACTCTCTGTGATATGGGTATCAACCCCGAATCGT
TGGCTGCTGTTGTTAAGGAGCTACGCCGGGAACTGCCGC
CGCCATCTTCGGCCACAGATACAGTTCAACAACCAGGGC
TGTGAAATCATGGCAGCTCGATGCGGCGAGGTAGAAGAT
GAT[C/T]TGGAAGCAAAGGTTGATGCAGAAATTTCTTTTG
GCAATTGTTTGAAGCTTGATGTATTACAGTATACAATTAA
AGGAGAGGTTTTTTCTGCCTCAGCCACTTTCTAATATTTT
GGATTATTTGCAAGCTCTCCAAATTGTATCAGGTTATATT
TGATATAGAAGTGTTTGTTGCATTCATGTTTAGTGCCATA
AAAAGAT (SEQ ID NO: 9 and 10)
SNP_06 mHE9 GTTGAGTCCGATGAGGGCGGAGATGGTGACGCTCGGAG G A
GCCGAATTCGGAACGTTATGATGTTGGCCGGCGATAGGG
ATCGGACGGCGGAGTGTGCGCCGTTGCTGCGGGAGCAGT
TGAAGTCGTTGATCGTGCGGTCGAGTTTTGTTGGAGGGG
AAAGATCGAAAAGAAGAAGGATGTTTGAGCAGAGATTT
ATGGGAT[G/A]ATATTTATAACCCTACTCATGCTGATAAT
TAAGAAGTTTTTGATTATTTTTTTTTAAATTGTGTGTTTGG
GAGTTTAGTTGTGATTGGGGTGTAATTATGTAAATTCCAA
ATGTATGGGTTGAATGGGAAAGATGATTTATCTGTCAAT
TTTTGACCTGAAAGATTGGTGGTCAATTCAGGACCCGAA
AGATCGTCAAAA (SEQ ID NO: 1 1 and 12)
The Ocimum basilicum genome sequence is the moment of this writing not available. Therefore, to estimate the relative positions of the marker sequences they were compared to available whole-genome shotgun contigs from a related species, Ocimum tenuiflorum, by Blast alignment at the NCBI website (world wide web at //blast.ncbi.nlm.nih.gov/). The identified contigs in turn, were aligned to Sesamum indicum vl .0. chromosome sequences (world wide web at //ocri-genomics.org/). Marker mHE6, mHEl 3 and mHEl had highest nucleotide homology to sequences on linkage group 5 in a 64k base pair large region (table 8). Marker sequences mHE28, mHE9 and mHE22 aligned together on linkage group 4 in a 138k base pair region. The genes around the marker sequences on both S. indicum linkage groups mapped all to chromosome 8 from Vitis vinifera after alignment using the nblast tool at the Sinbase website (world wide web at //ocri-genomics.org/Sinbase/blast/blasthtml). The clustering of the marker locations on S. indicum linkage groups 5 and 4, and V. vinifera chromosome 8 indicate, based on the principles of evolutionary conserveness, that these also cluster together in the Basil genome, which corresponds with the linkage data to the resistance gene (table 6). Based on the relative locations (table ,„
40
8) and the recombination frequency (table 6), it can be assumed that marker mHE22 is located at one end of the resistance locus and either mHEl or mHEl 3 is located at the other end.
Table 8 Location of homology between marker sequence on S. indicum linkage groups or V. vinifera chromosome 8.
Figure imgf000041_0001

Claims

1. A cultivated plant of the species Ocimum basilicum comprising in its genome a single recessive gene conferring resistance to downy mildew when present in homozygous form.
2. The cultivated plant of claim 1, wherein the single recessive gene is comprised in an introgression fragment.
3. The cultivated plant of any of the preceding claims, wherein the plant is homozygous for the single recessive gene conferring the downy mildew resistance.
4. The cultivated plant of any of the preceding claims, wherein the single recessive gene is as present in, or as obtainable from, or as obtained from, or as comprised in the genome of an Ocimum basilicum plant designated rpbl, of which a representative number of seeds have been deposited under deposit number NCIMB 42775.
5. The cultivated plant of claim 4, wherein the single recessive gene is in an introgression fragment, wherein said introgression fragment comprises a sequence of a donor plant conferring resistance to downy mildew when present in homozygous form comprising one or more SNPs having the resistant nucleotides selected from the group consisting of SNP O 1 , SNP 02, SNP 03 , SNP 04,
SNP_05 and SNP_06.
6. The plant of claim 4 or 5, wherein the introgression fragment comprises one or more nucleotides selected from the list comprising:
a Cytosine at nucleotide 83 of SEQ ID NO: 2 or of a sequence comprising at least 90% sequence identity to SEQ ID NO: 2;
a Guanine at nucleotide 200 of SEQ ID NO: 4 or of a sequence comprising at least 90% sequence identity to SEQ ID NO: 4;
a Cytosine at nucleotide 105 of SEQ ID NO: 6 or of a sequence comprising at least 90%> sequence identity to SEQ ID NO: 6;
a Thymine at nucleotide 193 of SEQ ID NO: 8 or of a sequence comprising at least 90%> sequence identity to SEQ ID NO: 8;
a Cytosine at nucleotide 201 of SEQ ID NO: 10 or of a sequence comprising at least 90%> sequence identity to SEQ ID NO: 10; and
a Guanine at nucleotide 201 of SEQ ID NO: 12 or of a sequence comprising at least 90%> sequence identity to SEQ ID NO: 12.
7. The cultivated plant of any of the preceding claims wherein the single recessive gene is introgressed from a Ocimum basilicum plant designated rpbl, of which representative number of seeds have been deposited with the NCIMB under deposit number NCIMB 42775;
or wherein the single recessive gene is introgressed from a progeny plant of said Ocimum basilicum plant designated rpbl, wherein said progeny plant comprises said single recessive gene as present in the genome of, or obtainable from, or obtained from, or as comprised in an Ocimum basilicum plant designated rpbl, of which a representative number of seeds have been deposited under deposit number NCIMB 42775.
8. The cultivated plant of any of the preceding claims, wherein said plant shows complete resistance against downy mildew when the single recessive gene is present in homozygous form.
9. The cultivated plant of claim 8, wherein said complete resistance against downy mildew reflects an average resistance level of at least 7, preferably of at least 8 and most preferably of 9, the average resistance level is determined on a scale of 1, for no resistance, to 9, for absence of symptoms.
10. The cultivated plant of any of the preceding claims, wherein the downy mildew is caused by the oomycetes Peronospora belbahrii.
11. The cultivated plant of any of the preceding claims, wherein the plant is sweet basil, cinnamon basil or Thai basil, preferably sweet basil.
12. The cultivated plant of any of the preceding claims, wherein the plant is a non-transgenic plant.
13. Pollen or seed produced by the cultivated plant according to any of the preceding claims, wherein the pollen or seed comprises the single recessive gene as defined in anyone of claims 1 to 7.
14. A seed from which the cultivated plant according to any one of claims 1 to 13 can be grown.
15. The cultivated plant grown from the seed of claim 15.
16. A part from the cultivated plant of any one of claims 1 to 12 or 15, wherein the part comprises said single recessive gene, preferably wherein the part is selected from the group consisting of a leaf, anther, pistil, stem, petiole, root, ovule, pollen, protoplast, tissue, seed, flower, cotyledon, hypocotyl, embryo and cell.
17. A method of producing a basil plant of the species Ocimum basilicum comprising in its genome a single recessive gene conferring downy mildew resistance, said method comprising the step(s) of:
(i) crossing a first basil plant and a second basil plant, wherein the first basil plant is the cultivated plant according to anyone of claims 1 to 12 or 15;
(ii) optionally harvesting seed from the crossing of (i) and selecting seed comprising the single recessive gene as defined in anyone of claims 1 to 7.
18. The method of claim 15, wherein in step (i) both the first basil plant and the second basil plant are cultivated plants according to any one of claims 1 to 12 or 15.
19. The basil seeds obtained from the method of claim 17 or 18.
20. A basil plant grown from the seeds of claim 19.
21. A method of identifying and/or selecting a plant or plant part of the species Ocimum basilicum comprising in its genome a single recessive gene conferring resistance to downy mildew when present in homozygous form, comprising determining whether the plant or plant part comprises one or more SNPs having the resistant nucleotide selected from the group consisting of SNP 01, SNP_02, SNP_03, SNP_04, SNP_05 and SNP_06.
22. The method of claim 21 wherein
the resistant nucleotide of SNP 01 is a Cytosine at nucleotide 83 of SEQ ID NO: 2 or of a sequence comprising at least 90% sequence identity to SEQ ID NO: 2;
the resistant nucleotide of SNP 02 is a Guanine at nucleotide 200 of SEQ ID NO: 4 or of a sequence comprising at least 90% sequence identity to SEQ ID NO: 4;
the resistant nucleotide of SNP 03 is a Cytosine at nucleotide 105 of SEQ ID NO: 6 or of a sequence comprising at least 90%> sequence identity to SEQ ID NO: 6;
the resistant nucleotide of SNP 04 is a Thymine at nucleotide 193 of SEQ ID NO: 8 or of a sequence comprising at least 90%> sequence identity to SEQ ID NO: 8;
the resistant nucleotide of SNP 05 is a Cytosine at nucleotide 201 of SEQ ID NO: 10 or of a sequence comprising at least 90%> sequence identity to SEQ ID NO: 10; and
the resistant nucleotide of SNP 06 is a Guanine at nucleotide 201 of SEQ ID NO: 12 or of a sequence comprising at least 90%> sequence identity to SEQ ID NO: 12.
PCT/EP2018/076661 2017-10-04 2018-10-01 Complete resistance to downy mildew in basil WO2019068647A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP17194783.1 2017-10-04
EP17194783 2017-10-04

Publications (1)

Publication Number Publication Date
WO2019068647A1 true WO2019068647A1 (en) 2019-04-11

Family

ID=60019821

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2018/076661 WO2019068647A1 (en) 2017-10-04 2018-10-01 Complete resistance to downy mildew in basil

Country Status (1)

Country Link
WO (1) WO2019068647A1 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3568003A4 (en) * 2017-01-16 2019-11-20 Bar-Ilan University Mildew resistant basil plants
CN111534627A (en) * 2020-04-24 2020-08-14 上海交通大学 QTL locus related to grape downy mildew resistance, SNP molecular marker and application
CN112322781A (en) * 2021-01-05 2021-02-05 中国中药有限公司 SNP molecular marker for identifying liquorice produced in Gansu province and method and application thereof

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0534858A1 (en) 1991-09-24 1993-03-31 Keygene N.V. Selective restriction fragment amplification : a general method for DNA fingerprinting
US20150216134A1 (en) * 2014-02-05 2015-08-06 Enza Zaden Beheer B.V. Basil varieties 'elidia', 'keira', and 'eleonora'
WO2018170436A1 (en) * 2017-03-16 2018-09-20 Jacobs Farm Del Cabo Basil with high tolerance to downy mildew

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0534858A1 (en) 1991-09-24 1993-03-31 Keygene N.V. Selective restriction fragment amplification : a general method for DNA fingerprinting
US20150216134A1 (en) * 2014-02-05 2015-08-06 Enza Zaden Beheer B.V. Basil varieties 'elidia', 'keira', and 'eleonora'
WO2018170436A1 (en) * 2017-03-16 2018-09-20 Jacobs Farm Del Cabo Basil with high tolerance to downy mildew

Non-Patent Citations (12)

* Cited by examiner, † Cited by third party
Title
BEN-NAIM ET AL., PHYTOPATHOLOGY, vol. 105, 2015, pages 778 - 785
HENIKOFF; HENIKOFF, PNAS, vol. 89, 1992, pages 10915 - 10919
LIN ET AL., NATURE GENETICS, 12 October 2014 (2014-10-12), pages 5
PHIPPEN; SIMON, JOURNAL OF HEREDITY, vol. 91, no. 4, 2000, pages 289 - 296
PYNE ROBERT M ET AL: "A Rapid Screening Approach to Identify Resistance to Basil Downy Mildew (Peronospora belbahrii)", HORTSCIENCE,, vol. 49, no. 8, 1 August 2014 (2014-08-01), pages 1041 - 1045, XP002780894 *
PYNE ROBERT M ET AL: "Inheritance of Resistance to Downy Mildew in Sweet Basil", JOURNAL OF THE AMERICAN SOCIETY FOR HORTICULTURAL SCIENCE,, vol. 140, no. 5, 1 September 2015 (2015-09-01), pages 396 - 403, XP002780893 *
ROXANA DJALALI FARAHANI-KOFOET ET AL: "Selecting basil genotypes with resistance against downy mildew", SCIENTIA HORTICULTURAE, vol. 179, 1 November 2014 (2014-11-01), AMSTERDAM, NL, pages 248 - 255, XP055517817, ISSN: 0304-4238, DOI: 10.1016/j.scienta.2014.09.036 *
SAMBROOK, J. ET AL.: "Molecular Cloning: A Laboratory Manual", 1989, COLD SPRING HARBOR PRESS
THINES ET AL., MYCOLOGICAL RESEARCH, vol. 113, 2009, pages 532 - 540
TIEZZI, ELECTRON MICROSC. REVIEW, 1991
WOLUKAU ET AL., HORTSCIENCE, vol. 44, no. 1, February 2009 (2009-02-01), pages 32 - 34
YARIV BEN-NAIM ET AL: "Resistance Against Basil Downy Mildew in Ocimum Species", PHYTOPATHOLOGY, vol. 105, no. 6, 1 June 2015 (2015-06-01), US, pages 778 - 785, XP055473469, ISSN: 0031-949X, DOI: 10.1094/PHYTO-11-14-0295-R *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3568003A4 (en) * 2017-01-16 2019-11-20 Bar-Ilan University Mildew resistant basil plants
CN111534627A (en) * 2020-04-24 2020-08-14 上海交通大学 QTL locus related to grape downy mildew resistance, SNP molecular marker and application
CN111534627B (en) * 2020-04-24 2022-08-16 上海交通大学 QTL locus related to grape downy mildew resistance, SNP molecular marker and application
CN112322781A (en) * 2021-01-05 2021-02-05 中国中药有限公司 SNP molecular marker for identifying liquorice produced in Gansu province and method and application thereof
CN112322781B (en) * 2021-01-05 2021-04-20 中国中药有限公司 SNP molecular marker for identifying liquorice produced in Gansu province and method and application thereof

Similar Documents

Publication Publication Date Title
US10226014B2 (en) Peronospora resistance in spinacia sp
AU2014320398A1 (en) Spinach plants that are resistant to downy mildew
US10226015B2 (en) Peronospora resistance in Spinacia sp
US10306850B2 (en) Yield QTLs in cucumber plants
US20170238493A1 (en) Yield qtls in cucumber plants
US20200367460A1 (en) Spinach plants resistant to at least peronospora farinosa races 8 and 10 to 16
AU2016335065B2 (en) Watermelon plants with cucumber vein yellowing virus (CVYV) resistance
WO2019068647A1 (en) Complete resistance to downy mildew in basil
US12052971B2 (en) Solanaceous plant capable of stenospermocarpic fruit formation
CN111655026A (en) Spinach plants resistant to at least peronospora farinosa 8, 9, 11, 13 and 16 races
US20240292805A1 (en) Solanum lycopersicum plants having improved tobamovirus resistance
US20230232762A1 (en) Capsicum annuum plants having improved thrips resistance
US20230189732A1 (en) Didymella bryoniae internal fruit rot resistance in cucumis sativus plants
US20240206414A1 (en) Introgression of tolcndv-es resistance conferring qtls in cucumis sativus plants
WO2018091438A1 (en) Multibranching artichoke plant

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18778503

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18778503

Country of ref document: EP

Kind code of ref document: A1