WO2019053073A1

WO2019053073A1 - Means and methods to increase plant biomass

Info

Publication number: WO2019053073A1
Application number: PCT/EP2018/074630
Authority: WO
Inventors: Wout Boerjan; Barbara DE MEESTER; Ruben VANHOLME
Original assignee: Vib Vzw; Universiteit Gent
Priority date: 2017-09-13
Filing date: 2018-09-12
Publication date: 2019-03-21

Abstract

The present invention relates to the field of improving the yield of plants, more particularly woody plants such as trees. The present invention provides recombinant plants which are deficient in cinnamoyl-CoA-reductase (CCR) activity which comprise a chimeric gene for vessel-specific expression of CCR.

Description

MEANS AND METHODS TO INCREASE PLANT BIOMASS

Field of the invention

The present invention relates to the field of plant molecular biology, more particularly to the field of agriculture, more particularly to the field of improving the yield of plants. The present invention provides chimeric genes and constructs which can be used to enhance the yield in plants and crops wherein said plants and crops have a non-functional cinnamoyl-coA-reductase gene.

Introduction to the invention Lignocellulose, being the most abundant biomass on earth, has great potential as a renewable feedstock for the bio-based economy. This feedstock can be used for the production of carbon- neutral chemicals and polymers (Isikgor and Becer 2015; Vanholme, Desmet, et al. 2013). Lignocellulosic biomass is mainly composed of secondary thickened cell walls, which primarily consist of cellulose and hemi-cellulose polysaccharides, impregnated with lignins (Cosgrove 2005). The latter are aromatic heteropolymers, mainly composed of p-hydroxyphenyl (H), guaiacyl (G) and syringyl (S) units, derived from the monolignols p-coumaryl, coniferyl and sinapyl alcohol, respectively (Boerjan, Ralph, and Baucher 2003; Vanholme et al. 2010). Lignin provides the plant with the necessary strength and hydrophobicity in order to stand upright and transport water through the vascular system (Weng and Chappie 2010). In addition, it acts as a physical barrier against pathogens and herbivores (Weng and Chappie 2010; Miedes et al. 2014). Unfortunately, lignin is also the major limiting factor in the processing of lignocellulosic biomass for downstream applications (Chen and Dixon 2007; Van Acker et al. 2013; Vanholme, Cesarino, et al. 2013). This aromatic polymer contributes to the recalcitrance of the plant cell wall towards deconstruction by hindering the enzymatic hydrolysis of cell wall polysaccharides into simple sugars (i.e. saccharification) (Pauly and Keegstra 2010; Weng et al. 2008). Therefore, several efforts to reduce the cell wall recalcitrance have been focusing on modifying the lignin content and/or composition in plants (Chen and Dixon 2007; Day et al. 2009; Goujon et al. 2003; Jackson et al. 2008; Leple et al. 2007; Shadle et al. 2007; Voelker et al. 2010; Wilkerson et al. 2014; Eudes et al. 2012; Eudes et al. 2015; Eudes et al. 2016). However, lignin-modified plants that show the highest improvement in saccharification efficiency typically suffer from undesired phenotypes - including biomass and seed yield penalties, a phenomenon also coined LMID, for Lignin Modification Induced Dwarfism (Bonawitz and Chappie 2013; Chen and Dixon 2007; Shadle et al. 2007; Van Acker et al. 2014; Van Acker et al. 2013; Vanholme, Cesarino, et al. 2013). Although the molecular mechanism(s) for LMID are as yet poorly understood, several hypotheses have been postulated to explain this phenomenon. First, the dwarfed phenotype of lignin-modified plants could be caused by the loss of vessel cell wall integrity, which in turn results in the inability of the plant to efficiently transport nutrients and water from the roots to the aerial parts. As a consequence, a collapse of the weakened vessel cells occurs under the negative pressure generated by transpiration, leading to the irregular xylem (irx) phenotype (Bonawitz and Chappie 2013). For example, irregular vessels have been reported for plants perturbed in the expression of the lignin biosynthesis genes PHENYLALANINE AMMONIA-LYASE (PAL), CINNAMATE 4-HYDROXYLASE (C4H), 4- CO UMA RA TE: Co A LIGASE (4CL), HYDROXYCI N NAMOYL-CoA S H I Kl MATE/QU I NATE HYDROXYCI NNAMOYL TRANSFERASE (HCT), p-COUMARATE 3-HYDROXYLASE (C3H), CAFFEOYL SHIKIMATE ESTERASE (CSE), CAFFEOYL-CoA O-METHYL TRANSFERASE (CCoAOMT) and CINNAMOYL-CoA REDUCTASE (CCR) (Jones, Ennos, and Turner 2001 ; Vanholme, Cesarino, et al. 2013; Stout and Chappie 2004; Zhong et al. 1998; Piquemal et al. 1998; Franke, Hemm, et al. 2002; Besseau et al. 2007; Voelker et al. 2010; Huang et al. 2010). Furthermore, a series of dwarfed cellulose and hemi-cellulose biosynthesis mutants also exhibit the irx phenotype (Brown et al. 2005; Turner and Somerville 1997; Taylor et al. 1999; Persson et al. 2007; Li et al. 2012). A second (or additional) cause for the observed yield penalties could be the accumulation of pathway intermediates (or derivatives thereof) that could be toxic for the plant. For example, the dwarfed phenotype of ccrl mutants has been described to be caused by the dramatically increased levels of ferulic acid, which decreases the levels of reactive oxygen species drastically. Since high levels of reactive oxygen species are required for the exit of cell proliferation, ccrl mutants have defective cell cycles leading to dwarfed growth (Xue et al. 2015). A third hypothesis explaining the yield penalty of lignin modified plants could be the depletion of other phenylpropanoid-related metabolites that are essential for normal plant development (Bonawitz and Chappie 2013). Finally, the triggering of an active cell wall integrity pathway, which allows plants to sense cell wall abnormalities, could result into transcriptional responses which in turn cause growth perturbations (Bonawitz and Chappie 2013; Vanholme, Storme, et al. 2012). Such transcriptional control mechanisms of the phenylpropanoid metabolism were proven to be involved in the responses in lignin-modified plants (Anderson et al. 2015; Bonawitz et al. 2014). More specifically, mutation of genes encoding subunits of the transcriptional co- regulatory complex Mediator (Med5A and Med5B) resulted in a (partial) reversion of the growth penalty, reduced lignin abundance and collapsed vessels of c3h1 mutants (Bonawitz et al. 2014).

Efforts have been made to overcome the dwarfed phenotype of lignin mutants, while maintaining the beneficial high sugar yield upon saccharification. Some of these attempts focused on the recovery of the vessel cell integrity in lignin mutants. In these studies, VASCULAR-RELATED NAC DOMAIN 6 (VND6) and VND7 promoter sequences were used to drive the expression of a lignin biosynthesis gene in the respective lignin mutant, thereby aiming at reintroducing lignin biosynthesis specifically in vessel cells. The expression of VND6 has been shown to be restricted to the metaxylem vessels, while VND7 had the highest expression level in protoxylem vessels (Kubo et al. 2005; Zhong et al. 2008; Vargas et al. 2016).

Summary of the invention

In the present invention, we fully overcame the total plant biomass penalty of severely dwarfed ccrl mutants of Arabidopsis thaliana while fully maintaining its high saccharification potential. We used the artificial XYLEM CYSTEIN PROTEASE 1 -SECONDARY WALL NAC BINDING ELEMENT promoter (pSNBE) to drive expression of the CCR1 gene in a ccrl mutant background (McCarthy, Zhong, and Ye 201 1 ). Since pSNBE is bound by both VND6 and VND7, it confers expression in both proto- and metaxylem vessels (Zhong, Lee, and Ye 2010). The resulting ccrl pSNBE:CCR1 lines were fully recovered in vascular integrity and surprisingly even showed a strong increase in total stem biomass as compared to wild-type plants. Subsequent analysis provided evidence for monolignol transport from vessel cells to the cell wall of xylary fibers. To obtain further insight in the extent of the recovery at both the molecular and cell wall level, growth analysis, extensive microscopy, phenolic profiling, cell wall analysis and saccharification assays were performed. These data showed that, despite their biomass recovery, the ccrl pSNBE:CCR1 lines still had a metabolome and overall cell wall composition that was similar to ccrl. Based on our phenolic profiling, we refuted the hypothesis that the accumulation of ferulic acid is the reason for the dwarfed growth of ccrl mutants. Also, the ccrl- 6 pSNBE:CCR1 lines had a fourfold increase in total plant sugar yield when compared to wild type, making them the highest sugar yielding Arabidopsis plants described so far. In addition, we followed the same strategy in poplar plants and also here we see the strong biomass increase.

Figures

Figure 1 : Expression pattern conferred by pSNBE. (A) Diagram of the GREEN FLUORESCENT PROTEIN (GFP) and β-GLUCURONIDASE (GUS) reporter genes driven by three copies of the XCP1-SNBE1 sequence coupled to the cauliflower mosaic virus (CaMV) minimal 35S promoter (pSNBE). NLS, nuclear localisation signal. (B) Cross-section of an elongating internode of the primary inflorescence stem showing GUS staining in developing vessels of the protoxylem. (C) Cross-section of a nonelongating internode of the primary inflorescence stem showing GUS staining in developing vessels but not in xylary fibers of the metaxylem or interfascicular fibers. GUS expression analysis in (D) roots, (E) flowers, (F) siliques and (G) rosette leaves, showing GUS staining in the vasculature. Black arrowheads indicate cells with GUS staining, white arrowheads indicate cells lacking GUS staining. For (D) transgenic pSNBE:NLS-GFP-GUS seedlings were grown for 32 days in long day photoperiods. For (B-C,E-G), transgenic pSNBE:NLS-GFP-GUS plants were grown for 6 weeks in short day photoperiods and for 5 weeks in long day photoperiods. Px, protoxylem; Mx, metaxylem; If, interfascicular fibers; Pi, pith; V, vessel; Xf, xylary fiber.

Figure 2: Phenotype of ccrl pSNBE:CCR1 lines. Wild type, ccrl, ccrl pSNBE:CCR1 plants after cultivation for 6 weeks in short day photoperiods followed by (A, B) 1 .5 week or (C, D) 5 weeks in long day photoperiods.

Figure 3: Lignin deposition in inflorescence stems of ccr1-6 pSNBE:CCR1 lines. Transverse stem sections of wild type, ccr1-6 and ccr1-6 pSNBE:CCR1 lines. Wiesner and Maule staining and lignin autofluorescence are shown. If, Interfascicularfibers; Xy, xylem. Scale bars = 100 μm.

Figure 4: Morphology of cell walls of wild-type, ccr1-6 and ccr1-6 pSNBE:CCR1 stems. Transmission electron microscopy (TEM) demonstrating the ultrastructure of the interfascicular fibers and xylem regions. V, xylary vessel. Arrows indicate residual cellular content. Scale bars = 10 m.

Figure 5: Raman microscopy analysis of cell walls of wild type, ccr1-6 and ccr1-6 pSNBE:CCR1 plants. (A) Examples of Raman mapping images taken from the xylem and interfascicular fiber region of wild type, ccr1-6 and ccr1-6 pSNBE:CCR1 lines by integrating the aromatic stretching vibration from 1550-1650 cm^-1. Scale bars = 10 μm. (B) Extracted average spectra in the lignin aromatic region between 1700 cm^-1 and 1550 cm^-1 obtained by a region of interest study in xylary vessels, xylary fibers and interfascicular fibers. A total number of eighteen spectra is shown for each genotype (n=3 x 2 mappings x 3 regions of interest). The marked bands represent: 1657 cm^-1 (C=C stretching of coniferyl alcohol plus C=0 stretching of coniferaldehyde), 1633 cm^-1 (C=C stretching from the propenoic acid side chain of ferulic acid), and 1597 cm^-1 (aromatic ring stretching of lignin).

Figure 6: Summary of phenolic profiling of primary inflorescence stems of wild type, ccr1-6 and ccr1-6 pSNBE:CCR1. A total of 9746 peaks were detected over the different samples (wild type, n=8; ccr1-6, n=6; ccrl pSNBE:CCR1 , n=13). After applying stringent filters 554 peaks were selected for principal component analysis (PCA) and statistics. (A) PCA on the selected peaks revealed that the first principal component (PC1 , 33.5% of variation) explained mainly the difference between genotypes. The second principal component (PC2, 15.4% of the variation) reflects the variation within the genotypes. (B) Further statistical analysis revealed that the peak intensities of 232 compounds were significantly different in ccr1-6 pSNBE:CCR1 when compared to wild type and when compared to ccr1-6. Based on this, the different metabolites were classified into 8 different groups. Per group, the number of peaks, corresponding compounds and annotated compounds are given.

Figure 7: Saccharification efficiency of ccr1-6 pSNBE:CCR1 plants. (A) Cellulose-to-glucose conversions after 192 h of saccharification of senesced inflorescence stems of wild type, ccrl- 6 and ccr1-6 pSNBE:CCR1. (B) Glucose release after 192 h of saccharification per total stem biomass. Samples were saccharified using no pretreatment, acid pretreatment (1 M HCI) or alkali pretreatment (62.5 mM NaOH). Error bars indicate standard error, n=6. Different letters represent significant differences at the 0.01 significance level (Dunnett-Hsu adjusted t-test) per pretreatment. Figure 8: Phenotype of ccr1-6 pSNBE:CCR1 seedlings. Wild type, ccr1-6, ccr1-6 pSNBE:CCR1 plants after cultivation for 15 and 25 days in long day photoperiods. Scale bars = 0.5 cm.

Figure 9: Cellulose-to-glucose conversion during saccharification of the senesced inflorescence stems of wild-type, ccr1-6 and ccr1-6 pSNBE:CCR1 lines. Samples were saccharified using no pretreatment, acid pretreatment (1 M HCI) or alkali pretreatment (62.5 mM NaOH) (n=6). Error bars indicate standard error. For statistical analysis see Supplemental Table S3.

Figure 10: Sequence information of the CCR2 locus of ccr2 and ccr2 ProSNBE:AtCCR1 poplars. Target sequences of the CRISPR/Cas9 construct of wild type and ccr2 or ccr2 ProSNBE:AtCCR1 transgenic lines. Both alleles and the indel patterns are shown. The gRNA (underlined) and protospacer adjacent motif (PAM; bold text) sequences are highlighted for the wild type.

Figure 1 1 : Phenotype of in-vitro grown ccr2 poplars. Wild type and ccr2 after grown for three months on MS medium in long day conditions.

Figure 12: Phenotype of ccr2 poplars grown on soil. Plants were grown for four months in the greenhouse. Figure 13: Lignin characteristics of ccr2 poplars. Transverse stem sections of wild type and ccr2 showing the xylem containing round, open vessels in wild type and collapsed vessels in ccr2. Ethanol treated sections show a red color only in the ccr2 lines. Maule and Wiesner staining shows reduced lignification in the ccr2 lines when compared to wild type. The images shown are representative for all ccr2 lines. Arrowheads indicate collapsed vessels. Scale bars = 50 μm. Figure 14: Expression pattern conferred by ProSNBE in poplar. (A) Diagram of the ProSNBE:GFP:GUS construct: GREEN FLUORESCENT PROTEIN (GFP) and β- GLUCURONIDASE (GUS) reporter genes are driven by three copies of the XCP1-SNBE (SECONDARY WALL NAC BINDING ELEMENT of XYLEM CYSTEINE PROTEASE 1) sequence fused to the Cauliflower Mosaic Virus (CaMV) minimal 35S promoter (ProSNBE). NLS, nuclear localization signal. (B) Cross-section of a stem of 2 meter high poplars showing GUS staining specifically in vessel cells. (C) Cross-section of a stem of 2 meter high poplars showing GUS staining in both vessel cells and ray cells. Figure 15: Growth analysis of ccr2 ProSNBE:AtCCR1 poplars. (A) Growth curves of the wild type, empty vector and ccr2 ProSNBE:AtCCR1 lines. Height was monitored every week for a period of 5 months. Error bars indicate standard error. ^aSignificantly different from the wild type (p-value < 0.05; Dunnett-Hsu adjusted t-test), Significantly different from the empty vector control (p-value < 0.05; Dunnett-Hsu adjusted t-test). (B) Photograph of representative plants grown for 5 months in the greenhouse.

Figure 16: Phenotype of ccr2 ProSNBE:AtCCR1 poplar stems grown for 5 months in the greenhouse. ccr2 ProSNBE:AtCCR1 3 and 10 showed a coloration of the xylem similar to wild type and empty vector control. By contrast, ccr2 ProSNBE:AtCCR1 18 displayed a uniformly red coloration of the xylem, whereas ccr2 ProSNBE:AtCCR1 9 had a patchy pink xylem phenotype (arrows).

Figure 17: Lignin characteristics of ccr2 ProSNBE:AtCCR1 poplars. Maule staining and lignin autofluorescence of the metaxylem of cross-sections of wild type and ccr2 ProSNBE:AtCCR1 stems showing round, open vessels in all lines examined. Maule staining was less intense in ccr2 ProSNBE:AtCCR1 9 and 18 when compared to wild type, indicative of a reduced lignin amount. Scale bars = 100 μm.

Detailed description of the invention

As used herein, each of the following terms has the meaning associated with it in this section. The articles "a" and "an" are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element. "About" as used herein when referring to a measurable value such as an amount, a temporal duration, and the like, is meant to encompass variations of ±20% or ±10%, more preferably ±5%, even more preferably ±1 %, and still more preferably ±0.1 % from the specified value, as such variations are appropriate to perform the disclosed methods. The term "abnormal" when used in the context of organisms, tissues, cells or components thereof, refers to those organisms, tissues, cells or components thereof that differ in at least one observable or detectable characteristic (e.g., age, treatment, time of day, etc.) from those organisms, tissues, cells or components thereof that display the "normal" (expected) respective characteristic. Characteristics which are normal or expected for one cell or tissue type, might be abnormal for a different cell or tissue type. The drawings described are only schematic and are non-limiting. In the drawings, the size of some of the elements may be exaggerated and not drawn on scale for illustrative purposes. Where the term "comprising" is used in the present description and claims, it does not exclude other elements or steps. Furthermore, the terms first, second, third and the like in the description and in the claims, are used for distinguishing between similar elements and not necessarily for describing a sequential or chronological order. It is to be understood that the terms so used are interchangeable under appropriate circumstances and that the embodiments, of the invention described herein are capable of operation in other sequences than described or illustrated herein.

Unless specifically defined herein, all terms used herein have the same meaning as they would to one skilled in the art of the present invention. Practitioners are particularly directed to Sambrook et al., Molecular Cloning: A Laboratory Manual, 4^th ed., Cold Spring Harbor Press, Plainsview, New York (2012); and Ausubel et al., current Protocols in Molecular Biology (Supplement 100), John Wiley & Sons, New York (2012), for definitions and terms of the art. The definitions provided herein should not be construed to have a scope less than understood by a person of ordinary skill in the art.

In the present invention we show that the complementation of plants with a non-functional CCR gene (ccrl mutants) with the CCR1 gene re-expressed specifically in the vessels using the chimeric pSNBE:CCR1 gene construct resulted into plants with a restored vessel integrity. Lignin deposition in ccrl pSNBE:CCR1 lines was not only restored in the vessels, but also the cell walls of the xylary fibers showed increased lignification and restored cell wall integrity (see Fig. 3, Fig. 4 and Fig. 5).

Importantly, when compared to wild type, the ccrl pSNBE:CCR1 plants are fully recovered in height, but also showed an increase in the number of secondary inflorescences and total stem biomass (see Table 1 ). The increase in secondary inflorescences was also observed for ccr1-6 mutants of Arabidopsis (see Table 1 , (Goujon et al. 2003; Van Acker et al. 2013)). Here, experiments with ccr1-6 pSNBE:CCR1 , ccr1-6 and wild type that were not allowed to set seeds, showed that the increase in stem biomass in ccr1-6 pSNBE:CCR1 lines resulted (largely) from their reduction in seed yield (Table 2). In addition, cellulose-to-glucose conversions of ccr1-6 and ccr1-6 pSNBE:CCR1 lines were fourfold higher than those of the wild type, independent of the pretreatment (see Fig. 7A). Given the negative correlation between saccharification and lignin amount, the increase in saccharification yield observed in these lines can be largely attributed to the reduced amount of lignin (see Table 4). In addition, the lignin of ccr1-6 and ccrl- 6 pSNBE:CCR1 is enriched in ferulic acid (Table 4, Fig. 5B). Because the incorporation of ferulic acid into the lignin polymer leads to the production of acid-cleavable functionalities, this lignin monomer theoretically helps to further increase sugar yield after acid pretreatment (Vanholme, Morreel, et al. 2012). On a plant basis and compared to wild type, the total plant sugar yield from the dwarfed ccr1-6 mutants was increased by twofold, while the ccr1-6 pSNBE:CCR1 lines exhibited a fourfold increase (Fig. 7B). The latter is the consequence of the full recovery in height and the increased stem biomass in ccr1-6 pSNBE:CCR1 lines when compared to wild type (Table 1 ). To our knowledge, ccr1-6 pSNBE:CCR1 is the highest sugar yielding Arabidopsis reported so far.

In addition to their high sugar yield, the ccr1-6 pSNBE:CCR1 lines do not suffer from a yield penalty, which makes translation of this research to biomass crops attractive. Hybrid poplar shows great potential as a woody energy crop (Carroll and Somerville 2009), and wood of CCR down-regulated poplar had up to 161 % increased ethanol yield per unit of biomass (Van Acker et al. 2014). However, this strategy resulted in unstable down-regulation of the CCR gene and significant yield penalties in the respective trees. Since we have proven that the yield penalty of low-lignin ccrl mutants can be fully overcome by allowing sufficient lignification to occur in the cell walls of vessels, a similar approach could be used for the yield recovery of poplar.

Accordingly, in a first embodiment, the invention provides a plant having a gene disruption in cinnamoyl-coA reductase and said plant comprises a chimeric gene comprising of (i) a vessel specific plant-expressible promotor, ii) a DNA region which when transcribed codes for a cinnamoyl-coA reductase protein and iii) a 3' end region involved in transcription termination and polyadenylation.

In yet another embodiment, the invention provides a plant having a gene disruption in cinnamoyl-coA reductase and having a loss of cinnamoyl-coA reductase activity in said plant and said plant comprises a chimeric gene comprising of (i) a vessel specific plant-expressible promotor, ii) a DNA region which when transcribed codes for a cinnamoyl-coA reductase protein and iii) a 3' end region involved in transcription termination and polyadenylation.

In yet another embodiment, the invention provides a plant having a gene disruption in cinnamoyl-coA reductase and having no cinnamoyl-coA reductase activity in said plant and said plant comprises a chimeric gene comprising of (i) a vessel specific plant-expressible promotor, ii) a DNA region which when transcribed codes for a cinnamoyl-coA reductase protein and iii) a 3' end region involved in transcription termination and polyadenylation.

In yet another embodiment, the invention provides a plant having a gene disruption in cinnamoyl-coA reductase and having no detectable cinnamoyl-coA gene product (id est cinnamoyl-coA protein) present in said plant and said plant comprises a chimeric gene comprising of (i) a vessel specific plant-expressible promotor, ii) a DNA region which when transcribed codes for a cinnamoyl-coA reductase protein and iii) a 3' end region involved in transcription termination and polyadenylation.

In yet another embodiment, the invention provides a plant having less than 5%, less than 1 % cinnamoyl-coA reductase activity as compared to a wild type plant in said plant and said plant comprises a chimeric gene comprising of (i) a vessel specific plant-expressible promotor, ii) a DNA region which when transcribed codes for a cinnamoyl-coA reductase protein and iii) a 3' end region involved in transcription termination and polyadenylation.

In yet another embodiment, the invention provides a plant having a gene disruption in the cinnamoyl-coA reductase which is involved in the lignin biosynthesis pathway and said plant comprises a chimeric gene comprising of (i) a vessel specific plant-expressible promotor, ii) a DNA region which when transcribed codes for a cinnamoyl-coA reductase protein involved in the lignin biosynthesis pathway and iii) a 3' end region involved in transcription termination and polyadenylation.

In a specific embodiment the plant is not Arabidopsis thaliana. In yet another embodiment the plant is a crop. In a specific embodiment the plant is a cereal. In another specific embodiment the plant is a woody plant.

In yet another specific embodiment the invention provides a seed or a plant cell derived from a plant of the invention. In yet another embodiment the invention provides a method to increase the plant yield comprising transforming a plant with a non-functional cinnamoyl-coA-reductase with a chimeric gene comprising of (i) a vessel specific plant-expressible promotor, ii) a DNA region which when transcribed codes for a cinnamoyl-coA reductase protein involved in the lignin biosynthesis pathway and iii) a 3' end region involved in transcription termination and polyadenylation. In yet another embodiment the invention provides a method to increase the plant yield comprising transforming a plant with a non-functional cinnamoyl-coA-reductase with a chimeric gene comprising of (i) a vessel specific plant-expressible promotor, ii) a DNA region which when transcribed codes for a cinnamoyl-coA reductase protein and iii) a 3' end region involved in transcription termination and polyadenylation. In yet another embodiment the invention provides a method to increase the plant yield comprising i) generating a plant which as a gene disruption in the cinnamoyl-coA-reductase and ii) transforming said plant with a non-functional cinnamoyl-coA-reductase with a chimeric gene comprising of (i) a vessel specific plant-expressible promotor, ii) a DNA region which when transcribed codes for a cinnamoyl-coA reductase protein and iii) a 3' end region involved in transcription termination and polyadenylation.

The enzyme CINNAMOYL-COA REDUCTASE (EC 1.2.1 .44), systematically named cinnamaldehyde:NADP+ oxidoreductase (CoA-cinnamoylating) but commonly referred to by the acronym CCR, is an enzyme that catalyzes the reduction of a substituted cinnamoyl-CoA to its corresponding cinnamaldehyde, utilizing NADPH and H⁺ and releasing free CoA and NADP⁺ in the process. Common biologically relevant cinnamoyl-CoA substrates for CCR include p- coumaroyl-CoA and feruloyl-CoA, which are converted into p-coumaraldehyde and coniferaldehyde, respectively, though most CCRs show activity toward a variety of other substituted cinnamoyl-CoA's as well. Catalyzing the first committed step in monolignol biosynthesis, this enzyme plays a critical role in lignin formation, a process important in plants both for structural development and defense response.

For ease of reference and avoidance of doubt a representative of the CCR gene (full length coding sequence) is represented by SEQ ID NO: 1 (as derived from Arabidopsis thaliana, AT1 G15950 (TAIR accession, www.arabidopsis.org)

A "chimeric gene" or "chimeric construct" is a recombinant nucleic acid sequence in which a promoter or regulatory nucleic acid sequence is operatively linked to, or associated with, a nucleic acid sequence that codes for an mRNA, such that the regulatory nucleic acid sequence is able to regulate transcription or expression of the associated nucleic acid coding sequence. The regulatory nucleic acid sequence of the chimeric gene is not operatively linked to the associated nucleic acid sequence as found in nature.

A functional plant orthologue (or a functional plant orthologous gene) of SEQ ID NO: 1 is a plant orthologous gene of CCR which encodes a protein with the same enzymatic properties of CCR. Several examples of plant orthologues of CCR are depicted in Example 9.

Functional orthologues CCR genes can be isolated from the (publicly) available sequence databases. The "sequence identity" of two related nucleotide or amino acid sequences, expressed as a percentage, refers to the number of positions in the two optimally aligned sequences which have identical residues (x100) divided by the number of positions compared. A gap, i.e., a position in an alignment where a residue is present in one sequence but not in the other is regarded as a position with non-identical residues. The alignment of the two sequences is performed by the Needleman and Wunsch algorithm (Needleman and Wunsch (1970) J Mol Biol. 48: 443-453). The computer-assisted sequence alignment above, can be conveniently performed using standard software program such as GAP which is part of the Wisconsin Package Version 10.1 (Genetics Computer Group, Madison, Wisconsin, USA) using the default scoring matrix with a gap creation penalty of 50 and a gap extension penalty of 3. Sequences are indicated as "essentially similar" when such amino acid sequences have a sequence identity of at least about 75%, particularly at least about 80 %, more particularly at least about 85%, quite particularly about 90%, especially about 95%, more especially about 100%, quite especially are identical. Alternatively the skilled person can isolate orthologous plant COSY genes through methods of genetic hybridization. Such methods are well known to the skilled (plant) molecular biologist.

In yet another embodiment the invention provides a recombinant vector comprising the chimeric gene constructs as described herein before.

The chimeric gene or chimeric genes to be expressed are preferably cloned into a vector, which is suitable for transforming Agrobacterium tumefaciens, for example pBin19 (Bevan et al (1984) Nucl. Acids Res. 12-871 1 ). Agrobacteria transformed by such a vector can then be used in known manner for the transformation of plants, such as plants used as a model, like Arabidopsis (Arabidopsis thaliana is within the scope of the present invention not considered as a crop plant), or crop plants such as, by way of example, tobacco plants, for example by immersing bruised leaves or chopped leaves in an agrobacterial solution and then culturing them in suitable media. The transformation of plants by means of Agrobacterium tumefaciens is described, for example, by Hofgen and Willmitzer in Nucl. Acid Res. (1988) 16, 9877 or is known inter alia from F.F. White, Vectors for Gene Transfer in Higher Plants; in Transgenic Plants, Vol. 1 , Engineering and Utilization, eds. S.D. Kung and R. Wu, Academic Press, 1993, pp. 15-38. The term "expression cassette" refers to any recombinant expression system for the purpose of expressing a nucleic acid sequence of the invention in vitro or in vivo, constitutively or inducibly, in any cell, including, in addition to plant cells, prokaryotic, yeast, fungal, insect or mammalian cells. The term includes linear and circular expression systems. The term includes all vectors. The cassettes can remain episomal or integrate into the host cell genome. The expression cassettes can have the ability to self-replicate or not (i.e., drive only transient expression in a cell). The term includes recombinant expression cassettes that contain only the minimum elements needed for transcription of the recombinant nucleic acid. Preferably the vectors comprising the chimeric gene (or genes) of the invention comprise a selectable marker or reporter gene. A "Selectable marker", "selectable marker gene" or "reporter gene" includes any gene that confers a phenotype on a cell in which it is expressed to facilitate the identification and/or selection of cells that are transfected or transformed with a chimeric gene construct or vector comprising a chimeric gene construct of the invention. These marker genes enable the identification of a successful transfer of the nucleic acid molecules via a series of different principles. Suitable markers may be selected from markers that confer antibiotic or herbicide resistance, that introduce a new metabolic trait or that allow visual selection. Examples of selectable marker genes include genes conferring resistance to antibiotics (such as nptll that phosphorylates neomycin and kanamycin, or hpt, phosphorylating hygromycin, or genes conferring resistance to, for example, bleomycin, streptomycin, tetracyclin, chloramphenicol, ampicillin, gentamycin, geneticin (G418), spectinomycin or blasticidin), to herbicides (for example bar which provides resistance to Basta^®; aroA or gox providing resistance against glyphosate, or the genes conferring resistance to, for example, imidazolinone, phosphinothricin or sulfonylurea), or genes that provide a metabolic trait (such as manA that allows plants to use mannose as sole carbon source or xylose isomerase for the utilisation of xylose, or antinutritive markers such as the resistance to 2-deoxyglucose). Expression of visual marker genes results in the formation of colour (for example β-glucuronidase, GUS or β- galactosidase with its coloured substrates, for example X-Gal), luminescence (such as the luciferin/luciferase system) or fluorescence (Green Fluorescent Protein, GFP, and derivatives thereof). This list represents only a small number of possible markers. The skilled worker is familiar with such markers. Different markers are preferred, depending on the plant and the selection method. It is known that upon stable or transient integration of nucleic acids into plant cells, only a minority of the cells takes up the foreign DNA and, if desired, integrates it into its genome, depending on the expression vector used and the transfection technique used. To identify and select these integrants, a gene coding for a selectable marker (such as the ones described above) is usually introduced into the host cells together with the gene of interest. These markers can for example be used in mutants in which these genes are not functional by, for example, deletion by conventional methods. Furthermore, nucleic acid molecules encoding a selectable marker can be introduced into a host cell on the same vector that comprises the sequence encoding the polypeptides of the invention or used in the methods of the invention, or else in a separate vector. Cells which have been stably transfected with the introduced nucleic acid can be identified for example by selection (for example, cells which have integrated the selectable marker survive whereas the other cells die). Since the marker genes, particularly genes for resistance to antibiotics and herbicides, are no longer required or are undesired in the transgenic host cell once the nucleic acids have been introduced successfully, the process according to the invention for introducing the nucleic acids advantageously employs techniques which enable the removal or excision of these marker genes. One such a method is what is known as co-transformation. The co- transformation method employs two vectors simultaneously for the transformation, one vector bearing the nucleic acid according to the invention and a second bearing the marker gene(s). A large proportion of transformants receives or, in the case of plants, comprises (up to 40% or more of the transformants), both vectors. In case of transformation with Agrobacteria, the transformants usually receive only a part of the vector, i.e. the sequence flanked by the T- DNA, which usually represents the expression cassette. The marker genes can subsequently be removed from the transformed plant by performing crosses. In another method, marker genes integrated into a transposon are used for the transformation together with desired nucleic acid (known as the Ac/Ds technology). The transformants can be crossed with a transposase source or the transformants are transformed with a nucleic acid construct conferring expression of a transposase, transiently or stable. In some cases (approx. 10%), the transposon jumps out of the genome of the host cell once transformation has taken place successfully and is lost. In a further number of cases, the transposon jumps to a different location. In these cases the marker gene must be eliminated by performing crosses. In microbiology, techniques were developed which make possible, or facilitate, the detection of such events. A further advantageous method relies on what is known as recombination systems; whose advantage is that elimination by crossing can be dispensed with. The best-known system of this type is what is known as the Cre/lox system. Cre1 is a recombinase that removes the sequences located between the loxP sequences. If the marker gene is integrated between the loxP sequences, it is removed once transformation has taken place successfully, by expression of the recombinase. Further recombination systems are the HIN/HIX, FLP/FRT and REP/STB system (Tribble et al., J. Biol. Chem., 275, 2000: 22255-22267; Velmurugan et al., J. Cell Biol., 149, 2000: 553-566). A site- specific integration into the plant genome of the nucleic acid sequences according to the invention is possible.

For the purposes of the invention, "transgenic", "transgene" or "recombinant" means with regard to, for example, a nucleic acid sequence, an expression cassette, chimeric gene construct or a vector comprising the nucleic acid sequence or an organism transformed with the nucleic acid sequences, expression cassettes or vectors according to the invention.

In yet another particular embodiment the invention provides a plant, plant cell or plant seed comprising a chimeric gene construct or chimeric gene constructs described herein before or comprising a recombinant vector comprising a chimeric gene construct of the invention.

The term "plant yield" as used herein generally refers to a measurable product from a plant, particularly a crop. Yield and yield increase (in comparison to a non-transformed starting plant or mutant plant or wild-type plant) can be measured in a number of ways, and it is understood that a skilled person will be able to apply the correct meaning in view of the particular embodiments, the particular crop concerned and the specific purpose or application concerned. The terms "improved yield" or "increased yield" can be used interchangeable. As used herein, the term "improved yield" or the term "increased yield" means any improvement in the yield of any measured plant product, such as grain, fruit, leaf, root, or fiber. In accordance with the invention, changes in different phenotypic traits may improve yield. For example, and without limitation, parameters such as floral organ development, root initiation, root biomass, seed number, seed weight, harvest index, leaf formation, phototropism, apical dominance, and fruit development, are suitable measurements of improved yield. Increased yield includes higherfruit yields, higher seed yields, higher fresh matter production, and/or higher dry matter production. Any increase in yield is an improved yield in accordance with the invention. For example, the improvement in yield can comprise a 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or greater increase in any measured parameter. The increased or improved yield can be achieved in the absence or presence of stress conditions. For example, enhanced or increased "yield" refers to one or more yield parameters selected from the group consisting of biomass yield, dry biomass yield, aerial dry biomass yield, underground dry biomass yield, fresh-weight biomass yield, aerial fresh-weight biomass yield, underground fresh-weight biomass yield; enhanced yield of harvestable parts, either dry or fresh-weight or both, either aerial or underground or both; enhanced yield of crop fruit, either dry or fresh-weight or both, either aerial or underground or both; and enhanced yield of seeds, either dry or fresh-weight or both, either aerial or underground or both. "Crop yield" is defined herein as the number of bushels of relevant agricultural product (such as grain, forage, or seed) harvested per acre. Crop yield is impacted by abiotic stresses, such as drought, heat, salinity, and cold stress, and by the size (biomass) of the plant. The yield of a plant can depend on the specific plant/crop of interest as well as its intended application (such as food production, feed production, processed food production, biofuel, biogas or alcohol production, or the like) of interest in each particular case. Thus, in one embodiment, yield can be calculated as harvest index (expressed as a ratio of the weight of the respective harvestable parts divided by the total biomass), harvestable parts weight per area (acre, square meter, or the like); and the like. The harvest index is the ratio of yield biomass to the total cumulative biomass at harvest. Harvest index is relatively stable under many environmental conditions, and so a robust correlation between plant size and grain yield is possible. Measurements of plant size in early development, under standardized conditions in a growth chamber or greenhouse, are standard practices to measure potential yield advantages conferred by the presence of a transgene. Accordingly, the yield of a plant can be increased by improving one or more of the yield-related phenotypes or traits. Such yield-related phenotypes or traits of a plant the improvement of which results in increased yield comprise, without limitation, the increase of the intrinsic yield capacity of a plant, improved nutrient use efficiency, and/or increased stress tolerance. For example, yield refers to biomass yield, e.g. to dry weight biomass yield and/or fresh-weight biomass yield. Biomass yield refers to the aerial or underground parts of a plant, depending on the specific circumstances (test conditions, specific crop of interest, application of interest, and the like). In one embodiment, biomass yield refers to the aerial and underground parts. Biomass yield may be calculated as fresh-weight, dry weight or a moisture adjusted basis. Biomass yield may be calculated on a per plant basis or in relation to a specific area (e.g. biomass yield per acre/square meter/or the like). "Yield" can also refer to seed yield which can be measured by one or more of the following parameters: number of seeds or number of filled seeds (per plant or per area (acre/square meter/or the like)); seed filling rate (ratio between number of filled seeds and total number of seeds); number of flowers per plant; seed biomass or total seeds weight (per plant or per area (acre/square meter/or the like); thousand kernel weight (TKW; extrapolated from the number of filled seeds counted and their total weight; an increase in TKW may be caused by an increased seed size, an increased seed weight, an increased embryo size, and/or an increased endosperm). Other parameters allowing to measure seed yield are also known in the art. Seed yield may be determined on a dry weight or on a fresh weight basis, or typically on a moisture adjusted basis, e.g. at 15.5 percent moisture. For example, the term "increased yield" means that a plant, exhibits an increased growth rate, e.g. in the absence or presence of abiotic environmental stress, compared to the corresponding wild-type plant. An increased growth rate may be reflected inter alia by or confers an increased biomass production of the whole plant, or an increased biomass production of the aerial parts of a plant, or by an increased biomass production of the underground parts of a plant, or by an increased biomass production of parts of a plant, like stems, leaves, blossoms, fruits, and/or seeds. A prolonged growth comprises survival and/or continued growth of the plant, at the moment when the non-transformed wild type organism shows visual symptoms of deficiency and/or death. When the plant of the invention is a soy plant, increased yield for soy plants means increased seed yield, in particularfor soy varieties used forfeed orfood. Increased seed yield of soy refers for example to an increased kernel size or weight, an increased kernel per pod, or increased pods per plant. For example when the plant of the invention is a cotton plant, increased yield for cotton plants means increased lint yield. Increased lint yield of cotton refers in one embodiment to an increased length of lint. Said increased yield can typically be achieved by enhancing or improving, one or more yield-related traits of the plant. Such yield- related traits of a plant comprise, without limitation, the increase of the intrinsic yield capacity of a plant, improved nutrient use efficiency, and/or increased stress tolerance, in particular increased abiotic stress tolerance. Intrinsic yield capacity of a plant can be, for example, manifested by improving the specific (intrinsic) seed yield (e.g. in terms of increased seed/grain size, increased ear number, increased seed number per ear, improvement of seed filling, improvement of seed composition, embryo and/or endosperm improvements, or the like); modification and improvement of inherent growth and development mechanisms of a plant (such as plant height, plant growth rate, pod number, pod position on the plant, number of internodes, incidence of pod shatter, efficiency of nodulation and nitrogen fixation, efficiency of carbon assimilation, improvement of seedling vigour/early vigour, enhanced efficiency of germination (under stressed or non-stressed conditions), improvement in plant architecture, cell cycle modifications, photosynthesis modifications, various signaling pathway modifications, modification of transcriptional regulation, modification of translational regulation, modification of enzyme activities, and the like); and/or the like

Any method known in the art to eliminate the activity of a plant CCR gene can be used to generate a plant having a non-functional plant CCR gene. In accordance with the present invention, the expression of the plant CCR gene is inhibited if the transcript or protein level of the CCR is statistically lower than the transcript or protein level of the same CCR in a plant that has not been genetically modified or mutagenized to inhibit the expression of that CCR. In particular embodiments of the invention, the transcript or protein level of the CCR in a modified plant according to the invention is less than 99%, less than 95%, less than 90%, less than 85%, less than 80%, less than 75%, less than 70%, less than 60%, or less than 50% of the protein level of the same CCR in a plant that is not a mutant or that has not been genetically modified to inhibit the expression of that CCR. The expression level of the CCR may be measured directly, for example, by assaying for the level of CCR expressed in the cell or plant, or indirectly, for example, by measuring the CCR activity in the cell or plant. The activity of a CCR protein is "eliminated" according to the invention when it is not detectable by at least one assay method. Methods for assessing CCR activity are known in the art and include measuring levels of CCR, which can be recovered and assayed from cell extracts.

In other embodiments of the invention, the activity of CCR is reduced, or is at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% reduced or eliminated by transforming a plant cell with an expression cassette comprising a polynucleotide encoding a polypeptide that inhibits the activity of CCR. The activity of a plant CCR is inhibited according to the present invention if the activity of that CCR in the transformed plant or cell is statistically lower than the activity of that CCR in a plant that has not been genetically modified to inhibit the activity of at least one CCR. In particular embodiments of the invention, the CCR activity of a modified plant according to the invention is less than 95%, less than 90%, less than 85%, less than 80%, less than 75%, less than 70%, less than 60%, or less than 50% of that CCR activity in an appropriate control plant that has not been genetically modified to inhibit the expression or activity of the CCR.

In other embodiments, the activity of a CCR protein may be reduced or eliminated by disrupting the gene (or genes) encoding CCR. The disruption inhibits expression or activity of the CCR protein compared to a corresponding control plant cell lacking the disruption. In one embodiment, the endogenous CCR gene comprises two or more endogenous CCR genes. Similarly, in another embodiment, in particular plants the endogenous CCR gene comprises three or more endogenous CCR genes. In another embodiment, the disruption step comprises insertion of one or more transposons, where the one or more transposons are inserted into the endogenous CCR gene. In yet another embodiment, the disruption comprises one or more point mutations in the endogenous CCR gene. The disruption can be a homozygous disruption in the CCR gene. Alternatively, the disruption is a heterozygous disruption in the CCR gene. In certain embodiments, when more than one CCR gene is involved, there is more than one disruption, which can include homozygous disruptions, heterozygous disruptions or a combination of homozygous disruptions and heterozygous disruptions.

Detection of expression products is performed either qualitatively (by detecting presence or absence of one or more product of interest) or quantitatively (by monitoring the level of expression of one or more product of interest). In one embodiment, the expression product is an RNA expression product. Aspects of the invention optionally include monitoring an expression level of a nucleic acid, polypeptide as noted herein for detection of CCR or measuring the amount of yield increase in a plant or in a population of plants.

Thus, many methods may be used to reduce or eliminate the activity of a CCR gene. More than one method may be used to reduce the activity of a single plant CCR gene. In addition, combinations of methods may be employed to reduce or eliminate the activity of two or more different CCR gene combinations. Non-limiting examples of methods of reducing or eliminating the expression of a plant CCR are given below.

In some embodiments of the present invention, a polynucleotide is introduced into a plant that upon introduction or expression, inhibits the expression of a CCR gene of the invention. The term "expression" as used herein refers to the biosynthesis of a gene product, including the transcription and/or translation of said gene product. For example, for the purposes of the present invention, an expression cassette capable of expressing a polynucleotide that inhibits the expression of a CCR polypeptide is an expression cassette capable of producing an RNA molecule that inhibits the transcription and/or translation of a CCR polypeptide of the invention. The "expression" or "production" of a protein or polypeptide from a DNA molecule refers to the transcription and translation of the coding sequence to produce the protein or polypeptide, while the "expression" or "production" of a protein or polypeptide from an RNA molecule refers to the translation of the RNA coding sequence to produce the protein or polypeptide. Further, "expression" of a gene can refer to the transcription of the gene into a non-protein coding transcript.

As used herein, "polynucleotide" includes reference to a deoxyribopolynucleotide, ribopolynucleotide or analogs thereof that have the essential nature of a natural ribonucleotide in that they hybridize, under stringent hybridization conditions, to substantially the same nucleotide sequence as naturally occurring nucleotides and/or allow translation into the same amino acid(s) as the naturally occurring nucleotide(s). A polynucleotide can be full-length or a subsequence of a native or heterologous structural or regulatory gene. Unless otherwise indicated, the term includes reference to the specified sequence as well as the complementary sequence thereof. Thus, DNAs or RNAs with backbones modified for stability or for other reasons are "polynucleotides" as that term is intended herein. Moreover, DNAs or RNAs comprising unusual bases, such as inosine, or modified bases, such as tritylated bases, to name just two examples, are polynucleotides as the term is used herein. It will be appreciated that a great variety of modifications have been made to DNA and RNA that serve many useful purposes known to those of skill in the art. The term polynucleotide as it is employed herein embraces such chemically, enzymatically or metabolically modified forms of polynucleotides, as well as the chemical forms of DNA and RNA characteristic of viruses and cells, including inter alia, simple and complex cells.

As used herein, "nucleic acid" includes reference to a deoxyribonucleotide or ribonucleotide polymer in either single- or double-stranded form, and unless otherwise limited, encompasses known analogues having the essential nature of natural nucleotides in that they hybridize to single-stranded nucleic acids in a manner similar to naturally occurring nucleotides (e.g. peptide nucleic acids).

By "encoding" or "encoded," with respect to a specified nucleic acid, is meant comprising the information for transcription into an RNA and in some embodiments, translation into the specified protein. A nucleic acid encoding a protein may comprise non-translated sequences (e.g., introns) within translated regions of the nucleic acid, or may lack such intervening non-translated sequences (e.g., as in cDNA). The information by which a protein is encoded is specified by the use of codons. Typically, the amino acid sequence is encoded by the nucleic acid using the "universal" genetic code.

Examples of polynucleotides that inhibit the expression of a CCCR polypeptide are given below. In some embodiments of the invention, inhibition of the expression of a CCR polypeptide may be obtained by sense suppression or cosuppression. For cosuppression, an expression cassette is designed to express an RNA molecule corresponding to all or part of a messenger RNA encoding a CCR polypeptide in the "sense" orientation. Overexpression of the RNA molecule can result in reduced expression of the native gene. Accordingly, multiple plant lines transformed with the cosuppression expression cassette are screened to identify those that show the greatest inhibition of a CCR polypeptide expression.

The polynucleotide used for cosuppression may correspond to all or part of the sequence encoding the CCR polypeptide, all or part of the 5' and/or 3' untranslated region of a CCR polypeptide transcript or all or part of both the coding sequence and the untranslated regions of a transcript encoding a CCR polypeptide. A polynucleotide used for cosuppression or other gene silencing methods may share 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91 %, 90%, 89%, 88%, 87%, 85%, 80%, or less sequence identity with the target sequence. When portions of the polynucleotides are used to disrupt the expression of the target gene, generally, sequences of at least 15, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 200, 300, 400, 450, 500, 550, 600, 650, 700, 750, 800, 900, or 1000 contiguous nucleotides or greater may be used. In some embodiments where the polynucleotide comprises all or part of the coding region for the CCR polypeptide, the expression cassette is designed to eliminate the start codon of the polynucleotide so that no protein product will be translated.

Cosuppression may be used to inhibit the expression of plant genes to produce plants having undetectable protein levels for the proteins encoded by these genes. See, for example, Broin, et al (2002) Plant Cell 14:1417-1432. Cosuppression may also be used to inhibit the expression of multiple proteins in the same plant. See, for example, US5,942,657. Methods for using cosuppression to inhibit the expression of endogenous genes in plants are described in US5,034,323, US5,283,184 and US5,942,657, each of which is herein incorporated by reference. The efficiency of cosuppression may be increased by including a poly-dT region in the expression cassette at a position 3' to the sense sequence and 5' of the polyadenylation signal. Typically, such a nucleotide sequence has substantial sequence identity to the sequence of the transcript of the endogenous gene, optimally greater than about 65% sequence identity, more optimally greater than about 85% sequence identity, most optimally greater than about 95% sequence identity. See, US5,283,184 and US5,034,323, herein incorporated by reference. In some embodiments of the invention, inhibition of the expression of the CCR polypeptide may be obtained by antisense suppression. For antisense suppression, the expression cassette is designed to express an RNA molecule complementary to all or part of a messenger RNA encoding the CCR polypeptide. Overexpression of the antisense RNA molecule can result in reduced expression of the native gene. Accordingly, multiple plant lines transformed with the antisense suppression expression cassette are screened to identify those that show the greatest inhibition of the CCR polypeptide expression.

The polynucleotide for use in antisense suppression may correspond to all or part of the complement of the sequence encoding the CCR polypeptide, all or part of the complement of the 5' and/or 3' untranslated region of the CCR transcript or all or part of the complement of both the coding sequence and the untranslated regions of a transcript encoding the CCR polypeptide. In addition, the antisense polynucleotide may be fully complementary (i.e. 100% identical to the complement of the target sequence) or partially complementary (i.e. less than 100%, including but not limited to 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91 %, 90%, 89%, 88%, 87%, 85%, 80%, identical to the complement of the target sequence, which in some embodiments is SEQ ID NO: 1 , 2, 3, 4, 5, 6 or a plant orthologous gene sequence thereof) to the target sequence. Antisense suppression may be used to inhibit the expression of multiple proteins in the same plant. See, for example, US5942657. Furthermore, portions of the antisense nucleotides may be used to disrupt the expression of the target gene. Generally, sequences of at least 50 nucleotides, 100 nucleotides, 200 nucleotides, 300, 400, 450, 500, 550 or greater may be used. Methods for using antisense suppression to inhibit the expression of endogenous genes in plants are described, for example, in US5759829, which is herein incorporated by reference. Efficiency of antisense suppression may be increased by including a poly-dT region in the expression cassette at a position 3' to the antisense sequence and 5' of the polyadenylation signal.

In some embodiments of the invention, inhibition of the expression of a CCR polypeptide may be obtained by double-stranded RNA (dsRNA) interference. For dsRNA interference, a sense RNA molecule like that described above for cosuppression and an antisense RNA molecule that is fully or partially complementary to the sense RNA molecule are expressed in the same cell, resulting in inhibition of the expression of the corresponding endogenous messenger RNA. Expression of the sense and antisense molecules can be accomplished by designing the expression cassette to comprise both a sense sequence and an antisense sequence. Alternatively, separate expression cassettes may be used for the sense and antisense sequences. Multiple plant lines transformed with the dsRNA interference expression cassette or expression cassettes are then screened to identify plant lines that show the greatest inhibition of a CCR polypeptide expression. Methods for using dsRNA interference to inhibit the expression of endogenous plant genes are described in WO9949029, WO9953050, W09961631 and WO0049035, each of which is herein incorporated by reference.

In some embodiments of the invention, inhibition of the expression of a CCR polypeptide may be obtained by hairpin RNA (hpRNA) interference or intron-containing hairpin RNA (ihpRNA) interference. These methods are highly efficient at inhibiting the expression of endogenous genes. See, Waterhouse and Helliwell, (2003) Nat. Rev. Genet. 4:29-38 and the references cited therein. For hpRNA interference, the expression cassette is designed to express an RNA molecule that hybridizes with itself to form a hairpin structure that comprises a single-stranded loop region and a base-paired stem. The base-paired stem region comprises a sense sequence corresponding to all or part of the endogenous messenger RNA encoding the gene whose expression is to be inhibited, and an antisense sequence that is fully or partially complementary to the sense sequence. The antisense sequence may be located "upstream" of the sense sequence (i.e. the antisense sequence may be closer to the promoter driving expression of the hairpin RNA than the sense sequence). The base-paired stem region may correspond to a portion of a promoter sequence controlling expression of the gene to be inhibited. A polynucleotide designed to express an RNA molecule having a hairpin structure comprises a first nucleotide sequence and a second nucleotide sequence that is the complement of the first nucleotide sequence, and wherein the second nucleotide sequence is in an inverted orientation relative to the first nucleotide sequence. Thus, the base-paired stem region of the molecule generally determines the specificity of the RNA interference. The sense sequence and the antisense sequence are generally of similar lengths but may differ in length. Thus, these sequences may be portions or fragments of at least 10, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 50, 70, 90, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320, 340, 360, 380, 400, 500, 600, 700, 800, 900 nucleotides in length, or at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 kb in length. The loop region of the expression cassette may vary in length. Thus, the loop region may be at least 10, 20, 30, 40, 50, 75, 100, 200, 300, 400, 500, 600, 700, 800, 900 nucleotides in length, or at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 kb in length. hpRNA molecules are highly efficient at inhibiting the expression of endogenous genes and the RNA interference they induce is inherited by subsequent generations of plants. See, for example, Waterhouse and Helliwell, (2003) Nat. Rev. Genet. 4:29-38. A transient assay for the efficiency of hpRNA constructs to silence gene expression in vivo has been described by Panstruga, et al. (2003) Mol. Biol. Rep. 30: 135-140, herein incorporated by reference. For ihpRNA, the interfering molecules have the same general structure as for hpRNA, but the RNA molecule additionally comprises an intron in the loop of the hairpin that is capable of being spliced in the cell in which the ihpRNA is expressed. The use of an intron minimizes the size of the loop in the hairpin RNA molecule following splicing, and this increases the efficiency of interference. See, for example, Smith et al (2000) Nature 407:319-320. In fact, Smith et al, show 100% suppression of endogenous gene expression using ihpRNA-mediated interference. In some embodiments, the intron is the ADHI intron 1. Methods for using ihpRNA interference to inhibit the expression of endogenous plant genes are described, for example, in Smith et al, (2000) Nature 407:319-320; Waterhouse and Helliwell, (2003) Nat. Rev. Genet. 4:29-38; Helliwell and Waterhouse, (2003) Methods 30:289- 295 and US2003180945, each of which is herein incorporated by reference.

The expression cassette for hpRNA interference may also be designed such that the sense sequence and the antisense sequence do not correspond to an endogenous RNA. In this embodiment, the sense and antisense sequence flank a loop sequence that comprises a nucleotide sequence corresponding to all or part of the endogenous messenger RNA of the target gene. Thus, it is the loop region that determines the specificity of the RNA interference. See, for example, WO0200904 herein incorporated by reference.

Amplicon expression cassettes comprise a plant virus-derived sequence that contains all or part of the target gene but generally not all of the genes of the native virus. The viral sequences present in the transcription product of the expression cassette allow the transcription product to direct its own replication. The transcripts produced by the amplicon may be either sense or antisense relative to the target sequence (i.e., the messenger RNA for the CCR polypeptide). Methods of using amplicons to inhibit the expression of endogenous plant genes are described, for example, in US6635805, which is herein incorporated by reference.

In some embodiments, the polynucleotide expressed by the expression cassette of the invention is catalytic RNA or has ribozyme activity specific for the messenger RNA of the CCR polypeptide. Thus, the polynucleotide causes the degradation of the endogenous messenger RNA, resulting in reduced expression of the CCR polypeptide. This method is described, for example, in US4987071 , herein incorporated by reference. In some embodiments of the invention, inhibition of the expression of a CCR polypeptide may be obtained by RNA interference by expression of a polynucleotide encoding a micro RNA (miRNA). miRNAs are regulatory agents consisting of about 22 ribonucleotides. miRNA are highly efficient at inhibiting the expression of endogenous genes. See, for example Javier et al (2003) Nature 425 :257-263, herein incorporated by reference.

For miRNA interference, the expression cassette is designed to express an RNA molecule that is modeled on an endogenous pre-miRNA gene wherein the endogenous miRNA and miRNA* sequence are replaced by sequences targeting the CCR mRNA. The miRNA gene encodes an RNA that forms a hairpin structure containing a 22-nucleotide sequence that is complementary to another endogenous gene (target sequence). For suppression of the CCR, the 22-nucleotide sequence is selected from a CCR transcript sequence and contains 22 nucleotides of said CCR in sense orientation (the miRNA* sequence) and 21 nucleotides of a corresponding antisense sequence that is complementary to the sense sequence and complementary to the target mRNA (the miRNA sequence). No perfect complementarity between the miRNA and its target is required, but some mismatches are allowed. Up to 4 mismatches between the miRNA and miRNA* sequence are also allowed. miRNA molecules are highly efficient at inhibiting the expression of endogenous genes, and the RNA interference they induce is inherited by subsequent generations of plants.

In some embodiments, polypeptides or polynucleotide encoding polypeptides can be introduced into a plant, wherein the polypeptide is capable of inhibiting the activity of a CCR polypeptide. The terms "polypeptide," "peptide" and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical analogue of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers.

The terms "residue" or "amino acid residue" or "amino acid" are used interchangeably herein to refer to an amino acid that is incorporated into a protein, polypeptide, or peptide (collectively "protein"). The amino acid may be a naturally occurring amino acid and, unless otherwise limited, may encompass known analogs of natural amino acids that can function in a similar manner as naturally occurring amino acids.

Significant advances have been made in the last few years towards development of methods and compositions to target and cleave genomic DNA by site specific nucleases (e.g., Zinc Finger Nucleases (ZFNs), Meganucleases, Transcription Activator-Like Effector Nucleases (TALENS) and Clustered Regularly Interspaced Short Palindromic Repeats/CRISPR-associated nuclease (CRISPR/Cas) with an engineered crRNA/tracr RNA), to induce targeted mutagenesis, induce targeted deletions of cellular DNA sequences, and facilitate targeted recombination of an exogenous donor DNA polynucleotide within a predetermined genomic locus. See, for example, U.S. Patent Publication No. 20030232410; 20050208489; 20050026157; 20050064474; and 20060188987, and International Patent Publication No. WO 2007/014275, the disclosures of which are incorporated by reference in their entireties for all purposes. U.S. Patent Publication No. 20080182332 describes use of non-canonical zinc finger nucleases (ZFNs) for targeted modification of plant genomes and U.S. Patent Publication No. 20090205083 describes ZFN- mediated targeted modification of a plant EPSPs genomic locus. Current methods for targeted insertion of exogenous DNA typically involve co-transformation of plant tissue with a donor DNA polynucleotide containing at least one transgene and a site specific nuclease (e.g., ZFN) which is designed to bind and cleave a specific genomic locus of an actively transcribed coding sequence. This causes the donor DNA polynucleotide to stably insert within the cleaved genomic locus resulting in targeted gene addition at a specified genomic locus comprising an actively transcribed coding sequence.

As used herein the term "zinc fingers," defines regions of amino acid sequence within a DNA binding protein binding domain whose structure is stabilized through coordination of a zinc ion.

A "zinc finger DNA binding protein" (or binding domain) is a protein, or a domain within a larger protein, that binds DNA in a sequence-specific manner through one or more zinc fingers, which are regions of amino acid sequence within the binding domain whose structure is stabilized through coordination of a zinc ion. The term zinc finger DNA binding protein is often abbreviated as zinc finger protein or ZFP. Zinc finger binding domains can be "engineered" to bind to a predetermined nucleotide sequence. Non-limiting examples of methods for engineering zinc finger proteins are design and selection. A designed zinc finger protein is a protein not occurring in nature whose design/composition results principally from rational criteria. Rational criteria for design include application of substitution rules and computerized algorithms for processing information in a database storing information of existing ZFP designs and binding data. See, for example, U.S. Pat. Nos. 6,140,081 ; 6,453,242; 6,534,261 and 6,794,136; see also WO 98/53058; WO 98/53059; WO 98/53060; WO 02/016536 and WO 03/016496. A "TALE DNA binding domain" or "TALE" is a polypeptide comprising one or more TALE repeat domains/units. The repeat domains are involved in binding of the TALE to its cognate target DNA sequence. A single "repeat unit" (also referred to as a "repeat") is typically 33-35 amino acids in length and exhibits at least some sequence homology with other TALE repeat sequences within a naturally occurring TALE protein. See, e.g., U.S. Patent Publication No. 201 10301073, incorporated by reference herein in its entirety. The CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)/Cas (CRISPR Associated) nuclease system. Briefly, a "CRISPR DNA binding domain" is a short stranded RNA molecule that acting in concert with the CAS enzyme can selectively recognize, bind, and cleave genomic DNA. The CRISPR/Cas system can be engineered to create a double-stranded break (DSB) at a desired target in a genome, and repair of the DSB can be influenced by the use of repair inhibitors to cause an increase in error prone repair. See, e.g., Jinek et al (2012) Science 337, p. 816-821 , Jinek et al, (2013), eLife 2:e00471 , and David Segal, (2013) eLife 2:e00563).

Zinc finger, CRISPR and TALE binding domains can be "engineered" to bind to a predetermined nucleotide sequence, for example via engineering (altering one or more amino acids) of the recognition helix region of a naturally occurring zinc finger. Similarly, TALEs can be "engineered" to bind to a predetermined nucleotide sequence, for example by engineering of the amino acids involved in DNA binding (the repeat variable di-residue or RVD region). Therefore, engineered DNA binding proteins (zinc fingers or TALEs) are proteins that are non-naturally occurring. Non- limiting examples of methods for engineering DNA-binding proteins are design and selection. A designed DNA binding protein is a protein not occurring in nature whose design/composition results principally from rational criteria. Rational criteria for design include application of substitution rules and computerized algorithms for processing information in a database storing information of existing ZFP and/or TALE designs and binding data. See, for example, U.S. Pat. Nos. 6,140,081 ; 6,453,242; and 6,534,261 ; see also WO 98/53058; WO 98/53059; WO 98/53060; WO 02/016536 and WO 03/016496 and U.S. Publication Nos. 201 10301073, 201 10239315 and 201 19145940.

A "selected" zinc finger protein, CRISPR or TALE is a protein not found in nature whose production results primarily from an empirical process such as phage display, interaction trap or hybrid selection. See e.g., U.S. Pat. No. 5,789,538; U.S. Pat. No. 5,925,523; U.S. Pat. No. 6,007,988; U.S. Pat. No. 6,013,453; U.S. Pat. No. 6,200,759; WO 95/19431 ; WO 96/06166; WO 98/53057; WO 98/5431 1 ; WO 00/27878; WO 01/60970 WO 01/88197 and WO 02/099084 and U.S. Publication Nos. 201 10301073, 201 10239315 and 201 19145940.

In one embodiment, the polynucleotide encodes a zinc finger protein that binds to a gene encoding a CCR polypeptide, resulting in reduced expression of the gene. In particular embodiments, the zinc finger protein binds to a regulatory region of a CCR. In other embodiments, the zinc finger protein binds to a messenger RNA encoding a CCR polypeptide and prevents its translation. Methods of selecting sites for targeting by zinc finger proteins have been described, for example, in US6453242, and methods for using zinc finger proteins to inhibit the expression of genes in plants are described, for example, in US2003/0037355, each of which is herein incorporated by reference. In another embodiment, the polynucleotide encoded a TALE protein that binds to a gene encoding a CCR polypeptide, resulting in reduced expression of the gene. In particular embodiments, the TALE protein binds to a regulatory region of a CCR. In other embodiments, the TALE protein binds to a messenger RNA encoding a CCR polypeptide and prevents its translation. Methods of selecting sites for targeting by zinc finger proteins have been described in e.g. Moscou MJ, Bogdanove AJ (2009) (A simple cipher governs DNA recognition by TAL effectors. Science 326:1501 ) and Morbitzer R, Romer P, Boch J, Lahaye T (2010) (Regulation of selected genome loci using de novo-engineered transcription activator-like effector (TALE)- type transcription factors. Proc Natl Acad Sci USA 107:21617-21622.)

In some embodiments of the invention, the polynucleotide encodes an antibody that binds to at least one CCR polypeptide and reduces the activity of the CCR polypeptide. In another embodiment, the binding of the antibody results in increased turnover of the antibody-CCR complex by cellular quality control mechanisms. The expression of antibodies in plant cells and the inhibition of molecular pathways by expression and binding of antibodies to proteins in plant cells are well known in the art. See, for example, Conrad and Sonnewald, (2003) Nature Biotech. 21 :35-36, incorporated herein by reference.

In some embodiments of the present invention, the activity of CCR is reduced or eliminated by disrupting the gene encoding the CCR polypeptide. The gene encoding the CCR polypeptide may be disrupted by any method known in the art. For example, in one embodiment, the gene is disrupted by transposon tagging. In another embodiment, the gene is disrupted by mutagenizing plants using random or targeted mutagenesis and screening for plants that have an increased yield.

In one embodiment of the invention, transposon tagging is used to reduce or eliminate the CCR activity of the CCR polypeptide. Transposon tagging comprises inserting a transposon within an endogenous CCR gene to reduce or eliminate expression of the CCR polypeptide. In this embodiment, the expression of the CCR polypeptide is reduced or eliminated by inserting a transposon within a regulatory region or coding region of the gene encoding the CCR polypeptide. A transposon that is within an exon, intron, 5' or 3' untranslated sequence, a promoter or any other regulatory sequence of a CCR gene may be used to reduce or eliminate the expression and/or activity of the encoded CCR polypeptide.

Methods for the transposon tagging of specific genes in plants are well known in the art. See, for example, Meissner, et al (2000) Plant J. 22:265-21. In addition, the TUSC process for selecting Mu insertions in selected genes has been described in US5962764, which is herein incorporated by reference.

Additional methods for decreasing or eliminating the expression of endogenous genes in plants are also known in the art and can be similarly applied to the instant invention. These methods include other forms of mutagenesis, such as ethyl methanesulfonate-induced mutagenesis, deletion mutagenesis and fast neutron deletion mutagenesis used in a reverse genetics sense (with PCR) to identify plant lines in which the endogenous gene has been deleted. For examples of these methods see, Ohshima, et al, (1998) Virology 243:472-481 ; Okubara, et al, (1994) Genetics 137:867-874 and Quesada, et al, (2000) Genetics 154:421 -436, each of which is herein incorporated by reference. In addition, a fast and automatable method for screening for chemically induced mutations, TILLING (Targeting Induced Local Lesions in Genomes), using denaturing HPLC or selective endonuclease digestion of selected PCR products is also applicable to the instant invention. See, McCallum, et al, (2000) Nat. Biotechnol 18:455-457, herein incorporated by reference. Mutations that impact gene expression or that interfere with the function of the encoded protein are well known in the art. Insertional mutations in gene exons usually result in null-mutants. Mutations in conserved residues are particularly effective in inhibiting the activity of the encoded protein. Conserved residues of plant CCR polypeptide suitable for mutagenesis with the goal to eliminate CCR activity have been described. Such mutants can be isolated according to well-known procedures. In yet another embodiment protein interference as described in the patent application WO2007071789 (means and methods for mediating protein interference) can be used to downregulate a gene product. The latter technology is a knock-down technology which in contrast to RNAi acts at the post-translational level (i.e. it works directly on the protein level by inducing a specific protein aggregation of a chosen target). Protein aggregation is essentially a misfolding event which occurs through the formation of intermolecular beta-sheets resulting in a functional knockout of a selected target. Through the use of a dedicated algorithm it is possible to accurately predict which amino acidic stretches in a chosen target protein sequence have the highest self-associating tendency (Fernandez-Escamilla A. M. et al (2004) Nat Biotechnol 22(10): 1302-6. By expressing these specific peptides in the cells the protein of interest can be specifically targeted by inducing its irreversible aggregation and thus its functional knock-out.

In the present invention a "vessel-specific plant promoter" comprises regulatory elements, which mediate the expression of a coding sequence segment in plant vessel cells. Plant vessels comprise metaxylem and protoxylem vessels.

The term "operably linked" as used herein refers to a functional linkage between the vessel- specific promoter sequence and the gene encoding CCR, such that the promoter sequence is able to initiate transcription of the gene of interest.

In the chimeric genes of the invention the promoter is a vessel-specific promoter. For the identification of functionally equivalent plant vessel-specific promoters (for example in other plant genera or other plant species), the promoter strength and/or expression pattern of a candidate vessel-specific promoter (for example the Arabidopsis XCP1 promoter) may be analyzed for example by operably linking the promoter to a reporter gene and assaying the expression level and pattern of the reporter gene in the plant. Suitable well-known reporter genes include for example beta-glucuronidase; beta-galactosidase or any fluorescent protein. The promoter activity is assayed by measuring the enzymatic activity of the beta-glucuronidase or beta-galactosidase. Alternatively, promoter strength may also be assayed by quantifying mRNA levels or by comparing mRNA levels of the nucleic acid, with mRNA levels of housekeeping genes such as 18S rRNA, using methods known in the art, such as Northern blotting with densitometric analysis of autoradiograms, quantitative real-time PCR or RT- PCR (Heid et al., 1996 Genome Methods 6: 986-994).

A transgenic plant for the purposes of the invention is thus understood as meaning, as above, that the nucleic acids used in the method of the invention are not present in, or originating from, the genome of said plant, or are present in the genome of said plant but not at their natural locus in the genome of said plant, it being possible for the nucleic acids to be expressed homologously or heterologously. However, as mentioned, transgenic also means that, while the nucleic acids according to the invention or used in the inventive method are at their natural position in the genome of a plant, the sequence has been modified with regard to the natural sequence, and/or that the regulatory sequences of the natural sequences have been modified. Transgenic is preferably understood as meaning the expression of the nucleic acids according to the invention at an unnatural locus in the genome, i.e. homologous or, heterologous expression of the nucleic acids takes place. Preferred transgenic plants are mentioned herein.

The term "introduction" or "transformation" as referred to herein encompass the transfer of an exogenous polynucleotide into a host cell, irrespective of the method used for transfer. Plant tissue capable of subsequent clonal propagation, whether by organogenesis or embryogenesis, may be transformed with a genetic construct of the present invention and a whole plant regenerated there from. The particular tissue chosen will vary depending on the clonal propagation systems available for, and best suited to, the particular species being transformed. Exemplary tissue targets include leaf disks, pollen, embryos, cotyledons, hypocotyls, megagametophytes, callus tissue, existing meristematic tissue (e.g., apical meristem, axillary buds, and root meristems), and induced meristem tissue (e.g., cotyledon meristem and hypocotyl meristem). The polynucleotide may be transiently or stably introduced into a host cell and may be maintained non-integrated, for example, as a plasmid. Alternatively, it may be integrated into the host genome. The resulting transformed plant cell may then be used to regenerate a transformed plant in a manner known to persons skilled in the art.

The transfer of foreign genes into the genome of a plant is called transformation. Transformation of plant species is now a fairly routine technique. Advantageously, any of several transformation methods may be used to introduce the gene of interest into a suitable ancestor cell. The methods described for the transformation and regeneration of plants from plant tissues or plant cells may be utilized for transient or for stable transformation. Transformation methods include the use of liposomes, electroporation, chemicals that increase free DNA uptake, injection of the DNA directly into the plant, particle gun bombardment, transformation using viruses or pollen and microprojection. Methods may be selected from the calcium/polyethylene glycol method for protoplasts (Krens, F.A. et al., (1982) Nature 296, 72-74; Negrutiu I et al. (1987) Plant Mol Biol 8: 363- 373); electroporation of protoplasts (Shillito R.D. et al. (1985) Bio/Technol 3, 1099-1 102); microinjection into plant material (Crossway A et al., (1986) Mol. Gen Genet 202: 179- 185); DNA or RNA-coated particle bombardment (Klein TM et al., (1987) Nature 327: 70) infection with (non-integrative) viruses and the like. Transgenic plants, including transgenic crop plants, are preferably produced via Agrobacterium-mediated transformation. An advantageous transformation method is the transformation in planta. To this end, it is possible, for example, to allow the agrobacteria to act on plant seeds or to inoculate the plant meristem with agrobacteria. It has proved particularly expedient in accordance with the invention to allow a suspension of transformed agrobacteria to act on the intact plant or at least on the flower primordia. The plant is subsequently grown on until the seeds of the treated plant are obtained (Clough and Bent, Plant J. (1998) 16, 735-743). Methods for Agrobacterium-mediated transformation of rice include well known methods for rice transformation, such as those described in any of the following: European patent application EP1 198985, Aldemita and Hodges (Planta 199: 612-617, 1996); Chan et al. (Plant Mol Biol 22 (3): 491 -506, 1993), Hiei et al. (Plant J 6 (2): 271 -282, 1994), which disclosures are incorporated by reference herein as if fully set forth. In the case of corn transformation, the preferred method is as described in either Ishida et al. (Nat. Biotechnol 14(6): 745-50, 1996) or Frame et al. (Plant Physiol 129(1 ): 13-22, 2002), which disclosures are incorporated by reference herein as if fully set forth. Said methods are further described by way of example in B. Jenes et al., Techniques for Gene Transfer, in: Transgenic Plants, Vol. 1 , Engineering and Utilization, eds. S.D. Kung and R. Wu, Academic Press (1993) 128-143 and in Potrykus Annu. Rev. Plant Physiol. Plant Molec. Biol. 42 (1991 ) 205-225). The nucleic acids or the construct to be expressed is preferably cloned into a vector, which is suitable for transforming Agrobacterium tumefaciens, for example pBin19 (Bevan et al (1984) Nucl. Acids Res. 12-871 1 ). Agrobacteria transformed by such a vector can then be used in known manner for the transformation of plants, such as plants used as a model, like Arabidopsis (Arabidopsis thaliana is within the scope of the present invention not considered as a crop plant), or crop plants such as, by way of example, tobacco plants, for example by immersing bruised leaves or chopped leaves in an agrobacterial solution and then culturing them in suitable media. The transformation of plants by means of Agrobacterium tumefaciens is described, for example, by Hofgen and Willmitzer in Nucl. Acid Res. (1988) 16, 9877 or is known inter alia from F.F. White, Vectors for Gene Transfer in Higher Plants; in Transgenic Plants, Vol. 1 , Engineering and Utilization, eds. S.D. Kung and R. Wu, Academic Press, 1993, pp. 15-38.

In addition to the transformation of somatic cells, which then have to be regenerated into intact plants, it is also possible to transform the cells of plant meristems and in particular those cells which develop into gametes. In this case, the transformed gametes follow the natural plant development, giving rise to transgenic plants. Thus, for example, seeds of Arabidopsis are treated with agrobacteria and seeds are obtained from the developing plants of which a certain proportion is transformed and thus transgenic [Feldman, KA and Marks MD (1987). Mol Gen Genet 208:1 -9; Feldmann K (1992). In: C Koncz, N-H Chua and J Shell, eds, Methods in Arabidopsis Research. Word Scientific, Singapore, pp. 274-289]. Alternative methods are based on the repeated removal of the inflorescences and incubation of the excision site in the center of the rosette with transformed agrobacteria, whereby transformed seeds can likewise be obtained at a later point in time (Chang (1994). Plant J. 5: 551 -558; Katavic (1994). Mol Gen Genet, 245: 363-370). However, an especially effective method is the vacuum infiltration method with its modifications such as the "floral dip" method. In the case of vacuum infiltration of Arabidopsis, intact plants under reduced pressure are treated with an agrobacterial suspension [Bechthold, N (1993). CR Acad Sci Paris Life Sci, 316: 1 194-1 199], while in the case of the "floral dip" method the developing floral tissue is incubated briefly with a surfactant-treated agrobacterial suspension [Clough, SJ and Bent AF (1998) The Plant J. 16, 735-743]. A certain proportion of transgenic seeds are harvested in both cases, and these seeds can be distinguished from non-transgenic seeds by growing under the above-described selective conditions. In addition the stable transformation of plastids is of advantages because plastids are inherited maternally is most crops reducing or eliminating the risk of transgene flow through pollen. The transformation of the chloroplast genome is generally achieved by a process which has been schematically displayed in Klaus et al., 2004 [Nature Biotechnology 22 (2), 225-229]. Briefly the sequences to be transformed are cloned together with a selectable marker gene between flanking sequences homologous to the chloroplast genome. These homologous flanking sequences direct site specific integration into the plastome. Plastidal transformation has been described for many different plant species and an overview is given in Bock (2001 ) Transgenic plastids in basic research and plant biotechnology. J Mol Biol. 2001 Sep 21 ; 312 (3):425-38 or Maliga, P (2003) Progress towards commercialization of plastid transformation technology. Trends Biotechnol. 21 , 20-28. Further biotechnological progress has recently been reported in form of marker free plastid transformants, which can be produced by a transient co- integrated maker gene (Klaus et al., 2004, Nature Biotechnology 22(2), 225-229).

The genetically modified plant cells can be regenerated via all methods with which the skilled worker is familiar. Suitable methods can be found in the abovementioned publications by S.D. Kung and R. Wu, Potrykus or Hofgen and Willmitzer.

Generally after transformation, plant cells or cell groupings are selected for the presence of one or more markers which are encoded by plant-expressible genes co-transferred with the gene of interest, following which the transformed material is regenerated into a whole plant. To select transformed plants, the plant material obtained in the transformation is, as a rule, subjected to selective conditions so that transformed plants can be distinguished from untransformed plants. For example, the seeds obtained in the above-described manner can be planted and, after an initial growing period, subjected to a suitable selection by spraying. A further possibility consists in growing the seeds, if appropriate after sterilization, on agar plates using a suitable selection agent so that only the transformed seeds can grow into plants. Alternatively, the transformed plants are screened for the presence of a selectable marker such as the ones described above.

Following DNA transfer and regeneration, putatively transformed plants may also be evaluated, for instance using Southern analysis, for the presence of the gene of interest, copy number and/or genomic organisation. Alternatively or additionally, expression levels of the newly introduced DNA may be monitored using Northern and/or Western analysis, both techniques being well known to persons having ordinary skill in the art.

The generated transformed plants may be propagated by a variety of means, such as by clonal propagation or classical breeding techniques. For example, a first generation (or T1 ) transformed plant may be selfed and homozygous second-generation (or T2) transformants selected, and the T2 plants may then further be propagated through classical breeding techniques. The generated transformed organisms may take a variety of forms. For example, they may be chimeras of transformed cells and non-transformed cells; clonal transformants (e.g., all cells transformed to contain the expression cassette); grafts of transformed and untransformed tissues (e.g., in plants, a transformed rootstock grafted to an untransformed scion). The term "plant" as used herein encompasses whole plants, ancestors and progeny of the plants and plant parts, including seeds, shoots, stems, leaves, roots (including tubers), flowers, and tissues and organs, wherein each of the aforementioned comprise the gene/nucleic acid of interest. The term "plant" also encompasses plant cells, suspension cultures, callus tissue, embryos, meristematic regions, gametophytes, sporophytes, pollen and microspores, again wherein each of the aforementioned comprises the gene/nucleic acid of interest.

Plants that are particularly useful in the methods of the invention include in particular monocotyledonous and dicotyledonous plants including fodder or forage legumes, ornamental plants, food crops, trees or shrubs selected from the list comprising Acer spp., Actinidia spp., Abelmoschus spp., Agave sisalana, Agropyron spp., Agrostis stolonifera, Allium spp., Amaranthus spp., Ammophila arenaria, Ananas comosus, Annona spp., Apium graveolens, Arachis spp, Artocarpus spp., Asparagus officinalis, Avena spp. (e.g. Avena sativa, Avena fatua, Avena byzantina, Avena fatua var. sativa, Avena hybrida), Averrhoa carambola, Bambusa sp., Benincasa hispida, Bertholletia excelsea, Beta vulgaris, Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]), Cadaba farinosa, Camellia sinensis, Canna indica, Cannabis sativa, Capsicum spp., Carex elata, Carica papaya, Carissa macrocarpa, Carya spp., Carthamus tinctorius, Castanea spp., Ceiba pentandra, Cichorium endivia, Cinnamomum spp., Citrullus lanatus, Citrus spp., Cocos spp., Coffea spp., Colocasia esculenta, Cola spp., Corchorus sp., Coriandrum sativum, Corylus spp., Crataegus spp., Crocus sativus, Cucurbita spp., Cucumis spp., Cynara spp., Daucus carota, Desmodium spp., Dimocarpus longan, Dioscorea spp., Diospyros spp., Echinochloa spp., Elaeis (e.g. Elaeis guineensis, Elaeis oleifera), Eleusine coracana, Eragrostis tef, Erianthus sp., Eriobotrya japonica, Eucalyptus sp., Eugenia uniflora, Fagopyrum spp., Fagus spp., Festuca arundinacea, Ficus carica, Fortunella spp., Fragaria spp., Ginkgo biloba, Glycine spp. (e.g. Glycine max, Soja hispida or Soja max), Gossypium hirsutum, Helianthus spp. (e.g. Helianthus annuus), Hemerocallis fulva, Hibiscus spp., Hordeum spp. (e.g. Hordeum vulgare), Ipomoea batatas, Juglans spp., Lactuca sativa, Lathyrus spp., Lens culinaris, Linum usitatissimum, Litchi chinensis, Lotus spp., Luffa acutangula, Lupinus spp., Luzula sylvatica, Lycopersicon spp. (e.g. Lycopersicon esculentum, Lycopersicon lycopersicum, Lycopersicon pyriforme), Macrotyloma spp., Malus spp., Malpighia emarginata, Mammea americana, Mangifera indica, Manihot spp., Manilkara zapota, Medicago sativa, Melilotus spp., Mentha spp., Miscanthus sinensis, Momordica spp., Morus nigra, Musa spp., Nicotiana spp., Olea spp., Opuntia spp., Ornithopus spp., Oryza spp. (e.g. Oryza sativa, Oryza latifolia), Panicum miliaceum, Panicum virgatum, Passiflora edulis, Pastinaca sativa, Pennisetum sp., Persea spp., Petroselinum crispum, Phalaris arundinacea, Phaseolus spp., Phleum pratense, Phoenix spp., Phragmites australis, Physalis spp., Pinus spp., Pistacia vera, Pisum spp., Poa spp., Populus spp., Prosopis spp., Prunus spp., Psidium spp., Punica granatum, Pyrus communis, Quercus spp., Raphanus sativus, Rheum rhabarbarum, Ribes spp., Ricinus communis, Rubus spp., Saccharum spp., Salix sp., Sambucus spp., Secale cereale, Sesamum spp., Sinapis sp., Solanum spp. (e.g. Solanum tuberosum, Solanum integrifolium or Solanum lycopersicum), Sorghum bicolor, Spinacia spp., Syzygium spp., Tagetes spp., Tamarindus indica, Theobroma cacao, Trifolium spp., Tripsacum dactyloides, Triticosecale rimpaui, Triticum spp. (e.g. Triticum aestivum, Triticum durum, Triticum turgidum, Triticum hybernum, Triticum macha, Triticum sativum, Triticum monococcum or Triticum vulgare), Tropaeolum minus, Tropaeolum majus, Vaccinium spp., Vicia spp., Vigna spp., Viola odorata, Vitis spp., Zea mays, Zizania palustris, Ziziphus spp., amongst others.

The choice of suitable control plants is a routine part of an experimental setup and may include corresponding wild type plants or corresponding plants without the gene of interest. The control plant is typically of the same plant species or even of the same variety as the plant to be assessed. The control plant may also be a nullizygote of the plant to be assessed. Nullizygotes are individuals missing the transgene by segregation. A "control plant" as used herein refers not only to whole plants, but also to plant parts, including seeds and seed parts.

The following non-limiting Examples describe methods and means according to the invention. Unless stated otherwise in the Examples, all techniques are carried out according to protocols standard in the art. The following examples are included to illustrate embodiments of the invention. Those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.

Examples

1 .The artificial SNBE promoter confers vessel-specific expression in both the proto- and metaxylem of Arabidopsis

In this example we aimed to restore the integrity of the vessels and the growth of ccrl mutants by using a vessel-specific promoter that conferred a high expression pattern in the vessels. We reasoned that since the artificial SNBE promoter (pSNBE) is bound by both VND6 and VND7, this promoter was a promising candidate for our intended complementation approach (McCarthy, Zhong, and Ye 201 1 ; Zhong, Lee, and Ye 2010). The pSNBE used here is composed of three tandem repeats of the cis-regulatory SNBE1 originating from the Arabidopsis XYLEM CYSTEIN PROTEASE 1 (XCP1) promoter, fused with the CaMV35S minimal promoter (Fig 1 A). T eXCPI gene has been shown to be specifically expressed in vessel cells of Arabidopsis, where the corresponding protein is involved in vessel autolysis during xylogenesis (Ohashi-lto, Oda, and Fukuda 2010; Zhong, Lee, and Ye 2010; McCarthy, Zhong, and Ye 201 1 ). In addition, pSNBE was also shown to direct expression of reporter genes to xylem vessel cells of the inflorescence stem in Arabidopsis (McCarthy, Zhong, and Ye 201 1 ).

To investigate whether pSNBE directs expression in the vessels throughout the xylem (including proto- and metaxylem), but also to examine if this promoter confers expression in other parts of the plant, we fused pSNBE to the β-GLUCURONIDASE (GUS) reporter gene and transformed this reporter construct into wild-type Arabidopsis plants. Next, the expression pattern was studied in various organs of the resulting plants. GUS staining was detected in the xylem, but was lacking in interfascicular fibers or pith cells of Arabidopsis inflorescence stems (Fig. 1 B, Fig. 1 C). Detailed examination of pSNBE:GUS lines revealed GUS activity in developing vessels of both proto- and metaxylem (Fig. 1 B, Fig. 1 C). In addition, GUS activity was found in the vasculature of roots, flowers, siliques and rosette leaves (Fig 1 D-G). As described for pXCP1:GUS plants, GUS activity of pSNBE:GUS plants appeared to be discontinuous throughout the vasculature, with cells lacking GUS activity alternating with those showing GUS activity (Fig. 1 ) (Funk et al. 2002). This discontinuous staining pattern could be a reflection of the degradation of the GUS protein at the vacuole or protoplast degeneration stage occurring during vessel maturation. As a result, cells which passed this stage will lack the GUS signal. Since pSNBE was found to restrict expression to both the proto- and metaxylem vessel cells of the stem, this promoter was further used for the envisioned complementation strategy.

2.The reintroduction of CCR1 expression under control of pSNBE restores the dwarfed phenotype of Arabidopsis ccrl mutants

To restrict lignin biosynthesis to the vessel cells, pSNBE was used to drive expression of the CCR1 gene in both ccr1-3 and ccr1-6 mutant Arabidopsis backgrounds. Next, ccr1-3 and ccrl- 6 lines harboring the pSNBE:CCR1 construct were selected and two independent, homozygous and single locus lines per ccrl background were used for further analyses. To first evaluate whether the pSNBE:CCR1 constructs successfully restored plant growth, the ccrl pSNBE:CCR1 lines were grown alongside their respective ccrl background and the wild type under short-day conditions for 6 weeks, after which they were moved to long-day conditions. These growth conditions allowed the development of large rosettes and tall inflorescence stems to maximize secondary cell wall thickening (Vanholme, Storme, et al. 2012). Whereas the ccrl rosettes were smaller when compared to the wild type, the rosette size has fully recovered in ccrl pSNBE:CCR1 plants (Fig. 2A-B). The final heights of the primary inflorescence stem of ccrl pSNBE:CCR1 lines were equal to those of the wild type, and approximately two-fold higher than their respective ccrl mutant (Fig. 2C-D, Table 1 ). The final dry weights of the primary (main) inflorescence stem (devoid of siliques and leaves) of the ccr1-6 pSNBE:CCR1 lines and ccr1-3 pSNBE:CCR1 line 2 were not significantly different from that of the wild type, while they were significantly heavier (78-105%) than that of their resp. ccrl background (Table 1 ). The final dry weight of the primary inflorescence stem of ccr1-3 pSNBE:CCR1 line 1 was even increased when compared to that of the wild type (by 19%) and the ccr1-3 background (by 124%) (Table

1 )-

Although the ccrl pSNBE:CCR1 plants were recovered in rosette and primary inflorescence stem biomass, some phenotypic differences with the wild type were noted. First, it was observed that the ccrl pSNBE:CCR1 plants had more secondary inflorescence stems in comparison with the wild type (Fig. 2C-D). Hence, we determined the weight and number of secondary inflorescence stems directly originating from (i) the rosette and (ii) the primary inflorescence stem. The ccrl pSNBE:CCR1 plants had more secondary inflorescence stems originating from the rosette and an increase in secondary inflorescence stem biomass of 49-75% in comparison to wild type (Table 1 ). The increase in the number of secondary inflorescences was also observed in ccr1-6 mutants, but not in the ccr1-3 mutants (Table 1 ). In comparison with that of the wild type, ccr1-3 and ccr1-6 total (primary and secondary) stem biomass was reduced by 45% and 22%, respectively, while the ccrl pSNBE:CCR1 plants had an increase of 42-59% in total stem biomass. A second phenotypic difference between ccrl pSNBE:CCR1 and wild type was a perturbation in seed development in ccrl pSNBE:CCR1 lines. As previously noticed, ccrl mutants had a reduced number of seeds (Mir Derikvand et al. 2008). Here, ccr1-3 and ccr1-6 mutants also had a lower number of seeds (-90% and -82%, respectively), while the individual seeds were heavier (+27% and +25%, respectively) and the total seed mass was reduced with 89% and 76%, respectively, when compared to wild type (Table 1 ). Although less severe than in their respective ccrl backgrounds, the ccr1-3 pSNBE:CCR1 and ccr1-6 pSNBE:CCR1 lines still had a lower number of seeds (-49% and -54%, respectively), while also having heavier seeds (+14% and +21 %, respectively), leading to a decrease in total seed biomass of -45% and -30% respectively. The total plant biomass (=aerial part of the plant, without the rosette) of the ccrl pSNBE:CCR1 lines was equal or higher when compared to the wild type, while those of ccrl was significantly reduced to more than half that of the wild type (Table 1 ). Since the ccr1-3 pSNBE:CCR1 lines and ccr1-6 pS/VS£:CCR1 lines were phenotypically identical (Table 1 , Fig. 2), we mainly focused further efforts on the analysis of the ccr1-6 background.

We hypothesized that the increase in the number of secondary inflorescence stems, and hence the total stem biomass, could have been a secondary consequence of the impaired seed development in the ccrl pSNBE:CCR1 lines. To test this hypothesis, immature siliques were systematically removed from the wild type, ccr1-6 and ccr1-6 pSNBE:CCR1 lines, throughout development, with a frequency of 3 times a week. As been described before, the removal of siliques resulted in delayed senescence and the outgrowth of more secondary inflorescences for all lines examined compared to the control (Table 2) (Hensel et al. 1994; Wuest et al. 2016). The ccr1-6 pSNBE:CCR1 lines were now equal to wild type in both the number of secondary inflorescences (originating from both the rosette and the main stem) and total stem biomass (Table 2). These results suggest a role for seed development signals in the increase of lignocellulosic biomass in the ccrl pSNBE:CCR1 lines. Finally, the stiffness of the stems of wild type, ccr1-6 and the ccr1-6 pSNBE:CCR1 lines was determined via a two-point bending test (Table 9). While wild-type stems had a bending modulus of 1 12.5 kPa, ccr1-6 pSNBE:CCR1 line 1 and 2 had significantly reduced bending moduli of 49.4 and 60.2 kPa, respectively. Similarly, the bending modulus of ccr1-6 was also significantly reduced when compared to wild type, to a value of 25.7 kPa. Based on this, we could conclude that the stiffness of the stems of ccr1-6 pSNBE:CCR1 lines was partially restored when compared to that of ccr1-6, but was still decreased when compared to that of the wild type.

3.pSNBE:CCR1 reinforces the vascular system and partially restores lignin deposition in the xylem of ccrl mutants

To examine whether the vessel-specific expression of CCR1 in ccrl leads to vessel-specific lignification and restoration of vessel integrity, the lignin of fully grown wild type, ccrl and ccrl pSNBE:CCR1 plants was visualized with Wiesner and Maule staining and via autofluorescence (Fig. 3). In wild type, the xylem tissue -that contains large, open vessels- and the interfascicular fibers are heavily lignified. In accordance with previous reports, ccrl mutants showed an overall reduction in lignin deposition and developed irregularly shaped and collapsed vessels (Jones, Ennos, and Turner 2001 ; Goujon et al. 2003; Mir Derikvand et al. 2008). The xylem tissue of the ccrl pSNBE:CCR1 lines showed a strong coloration and contained large open vessels, similarly to those of the wild type. Remarkably, both vessels and xylary fibers of ccrl pSNBE:CCR1 lines appeared to be lignified. On the other hand, the interfascicular fibers of the ccrl pSNBE:CCR1 lines showed reduced lignin deposition similar to ccrl mutants. Since the previously described lignin visualization methods do not allow visualization of the macromolecular arrangement of the secondary cell walls, transmission electron microscopy (TEM) was performed for the different lines (Fig. 4). The secondary cell walls of the vessels and (xylary and interfascicular) fibers of the wild-type stems are organized, compact and display good cohesion. By contrast, the ccr1-6 mutant exhibited dramatic disorganization and loosening of the secondary walls in both vessels and fibers. The xylem tissue of ccr1-6 pSNBE:CCR1 lines appeared similar to that of the wild type, indicated by its proper organization and internal cohesion of the walls in both the vessels and xylary fibers. However, the phenotype of the interfascicular fibers of ccr1-6 pSNBE:CCR1 appeared to be similar to that of ccr1-6, inferred by loosening of the secondary cell wall. Additionally, the interfascicular fiber cells of wild type were devoid of cellular content, while those of the ccr1-6 and ccr1-6 pSNBE:CCR1 lines still contained cellular contents. These results indicated that ccr1-6 and ccr1-6 pSNBE:CCR1 did not complete programmed cell death at the time of harvest, despite the fact that all the lines were harvested at the same age.

Based on the lignin and cell wall visualization methods, the xylem of wild type and ccrl pSNBE:CCR1 lines appeared to be similar (Fig. 3, Fig. 4). Additionally, both the vessels and xylary fibers of ccrl pSNBE:CCR1 seemed to be lignified (Fig. 3). To investigate the degree of lignification in the different cell types, Raman microscopy was performed (Fig. 5). First, the distribution of components having aromatic ring structures, i.e. building blocks of the lignin polymer, were visualized by integrating the intensity of each spectrum in the range of 1650 cm^-1 to 1550 cm^-1 into 2D mappings (Fig. 5A). In the xylem, the intensity of the aromatic ring stretching was high in the wild type, intermediate in the ccr1-6 pSNBE:CCR1 lines and low in ccr1-6. In the interfascicular region, the mappings of ccr1-6 and ccr1-6 pSNBE:CCR1 lines showed a similar intensity, which is considerably lower compared to that of wild type. In the next step, a more detailed analysis was performed on the aromatic region of lignin (1700-1550 cm^-1) obtained from xylary vessels, xylary fibers and interfascicular fibers (Fig. 5B). In xylary vessels and xylary fibers, ccr1-6 mutants showed a drastic decrease in the aromatic stretching vibration of lignin at 1597 cm^-1 (Agarwal, Ralph, and Atalla 1997) when compared to wild type, while the ccr1-6 pSNBE:CCR1 lines had band intensities in between wild type and ccr1-6. First, these results indicated that the lignin levels in the vessels of ccr1-6 SNBE:CCR1 were not recovered to wild type levels, but rather were intermediate between the high levels found in wild type and the drastically reduced levels of ccr1-6. Second, we could conclude that the lignin content in the xylary fibers of ccrl -6 pSNBE:CCR1 lines was also partially recovered to levels in between those of wild type and ccr1-6. In concordance with the lignin staining data, the lignin content in interfascicular fibers (based on peak intensities for the lignin aromatic stretching at 1597 cm^-1) was similar between ccr1-6 and ccr1-6 pSNBE:CCR1 lines, and drastically reduced when compared to the wild type. Another difference was observed for the peak at 1657 cm^-1, which is assigned mainly to coniferyl alcohol (C=C stretching of coniferyl alcohol and C=0 stretching of coniferaldehyde) (Agarwal, McSweeny, and Ralph 201 1 ). While the wild type showed a high intensity for this peak in xylary vessels, xylary fibers and interfascicular fibers, it was absent in all regions of ccr1-6. In the xylary vessels and xylary fibers of ccr1-6 pSNBE:CCR1 lines, the intensity of the peak at 1657 cm^-1 was intermediate between wild type and ccr1-6, while in ccrl- 6 pSNBE:CCR1 interfascicular fibers, the peak at 1657 cm^-1 was absent. Interestingly, in the xylary vessels and xylary fibers of ccr1-6 a new band appeared at 1633 cm^-1. This band was also present in the interfascicular region of both ccr1-6 and ccr1-6 pSNBE:CCR1 lines and is known as C=C stretching of ferulic acid (Agarwal and Atalla 1990; Mateu et al. 2016; Meyer, Lupoi, and Smith 201 1 ; Prinsloo, du Plooy, and van der Merwe 2004).

4.The metabolism of ccr1 -6 pSNBE:CCR1 lines shows characteristics of ccr1 -6 mutants and of wild-type plants

The biomass penalty and vessel collapse provoked by the ccrl mutation was recovered in ccrl pSNBE:CCR1 lines (Table 1 , Fig. 3) . To examine whether the molecular phenotype of ccrl mutants was also recovered for ccr1-6 pSNBE:CCR1 lines, phenolic profiling of their inflorescence stems was performed via ultra-high performance liquid chromatography - mass spectrometry (UHPLC-MS). This procedure allows the detection of several classes of phenolic compounds and glucosinolates (Sundin et al. 2014; Vanholme, Cesarino, et al. 2013; Vanholme, Storme, et al. 2012). A total of 9746 peaks (m/z features) were integrated in the chromatograms of wild type, ccr1-6 and ccr1-6 pSNBE:CCR1 lines 1 and 2 (Supplemental Dataset 1 ). After applying stringent filters, 554 peaks were retained for statistical analysis (see materials and methods). Principal component analysis (PCA) shows that the metabolic profiles of ccr1-6 pSNBE:CCR1 plants were situated in between those of ccr1-6 mutants and wild type plants according the first principal component, which explains 33.5% of the variation (Fig. 6A). The second principal component, which explains 15.4% of the variation, reflects variation within the genotypes (and not in between genotypes) and can be attributed to biological and/or technical variation. One-way ANOVA analysis followed by post-hoc t-tests resulted in a list of 232 peaks with significantly different intensities between the ccr1-6 pSNBE:CCR1 lines and wild type and/or the ccr1-6 pSNBE:CCR1 lines and ccr1-6. Based on this, the metabolites were classified into eight different groups (Fig. 6B, Supplemental Dataset 1 ). Since no significant differences in peak intensity between ccr1-6 pSNBE:CCR1 line 1 and ccr1-6 pSNBE:CCR1 line 2 were found for these 232 peaks, the two ccr1-6 pSNBE:CCR1 lines were further treated as one group. In-depth analysis of the 232 peaks showed that these could be assigned to 172 compounds, of which 83 could be structurally characterized based on their mass-to-charge ratio (m/z), retention time and tandem mass spectrometry (MS/MS) fragmentation spectrum. The latter were biochemically classified and situated onto a metabolic map of the phenolic and glucosinolate metabolism in Arabidopsis stems.

Of the 83 structurally characterized metabolites, 53 belonged to the classes of ferulic acid, vanillic acid, sinapic acid and syringic acid coupling products and derivatives. Previously, ccrl mutants have been described to accumulate members of these metabolic classes (Vanholme, Storme, et al. 2012). The abundances of these metabolites were also higher in ccr1-6 pSNBE:CCR1 when compared to the wild type, of which 9 had levels that were even higher than those in ccr1-6 (group 1 ), 17 compounds had levels not significantly different from those in ccrl- 6 (group 2) and 27 compounds had levels lower than those in ccr1-6 (group 3). Further, 6 compounds were classified as oligolignols and hexosylated oligolignols. The abundance of these metabolic classes was severely reduced in ccr1-6 mutants when compared to wild type (Vanholme, Storme, et al. 2012). In the ccr1-6 pSNBE:CCR1 lines, the peak intensities of these metabolites were also reduced when compared to wild type, to levels higher than in ccr1-6 (1 hexosylated oligolignol in group 6), not significantly different than in ccr1-6 (2 hexosylated oligolignols and 2 oligolignols in group 7), or lower than in ccr1-6 (1 hexosylated oligolignol in group 8). Another class of phenylpropanoic acid-derived metabolites in Arabidopsis comprises coupling products of monolignols and ferulic acid or sinapic acid. Similar to (hexosylated) oligolignols, the abundance of monolignol-ferulic acid coupling products was reduced in ccr1-6 mutants (Vanholme, Storme, et al. 2012). In ccr1-6 pSNBE:CCR1 lines, the abundance of one monolignol-ferulic acid coupling product was not significantly different when compared to wild type and significantly increased as compared to ccr1-6 (group 4). However, the abundance of 14 monolignol-ferulic acid and -sinapic acid coupling products was still reduced in ccr1-6 pSNBE:CCR1 lines as compared to their abundance in wild type, of which 9 had abundances intermediate between wild type and ccr1-6 (group 6), 4 had abundances that were not significantly different from ccr1-6 (group 7) and 1 had an abundance lower than ccr1-6 (group 8). In addition, five glucosinolates that accumulated to high levels in ccr1-6, were (partially) restored to wild-type levels in ccr1-6 pSNBE:CCR1 (group 3 and 5). Furthermore, the abundances of /V-acetylphenylalanine and p-coumaroyl glutamate were decreased in the ccrl- 6 mutant when compared to wild type, while having levels intermediate between wild type and ccr1-6 in the ccr1-6 pSNBE:CCR1 lines (group 6). The abundance of p-coumaroyl hexose was increased to a similar level in ccr1-6 and ccr1-6 pSNBE:CCR1 lines when compared to wild type (group 2). Finally, caffeic acid 3/4-O-hexoside accumulated in ccr1-6 mutants when compared to wild type, but was reduced again to wild type levels in ccr1-6 pSNBE:CCR1 lines (group 5). Despite the notable exceptions, we found that the majority of metabolic shifts present in dwarfed ccr1-6 mutants were still largely present in the phenotypically fully recovered ccrl pSNBE:CCR1 lines.

5.The effect of ferulic acid content on cell proliferation and growth

It has been proposed that the dwarfed phenotype of ccrl mutants is caused by the dramatically increased level of ferulic acid (Xue et al. 2015). These high levels of ferulic acid were reported to delay the exit from cell proliferation, thereby reducing the average nuclear ploidy level and causing the observed growth defects of ccrl mutants (Xue et al. 2015). Elaborating on this reasoning, the ferulic acid levels of the growth restored ccr1-6 pSNBE:CCR1 lines should be reduced when compared to ccr1-6, leading to restoration of the cell cycle and growth. To test this hypothesis, we determined the ferulic acid levels and nuclear ploidy level of ccr1-6 pSNBE:CCR1 lines using wild type and ccr1-6 as a control. In analogy with Xue et al. (2015), all experiments were performed on the first pair of leaves of 15 and 25 day old plants. On both timepoints, the rosette sizes of ccr1-6 pSNBE:CCR1 plants were similar to those of wild type, while ccr1-6 rosettes were significantly smaller (Fig. 8). Additionally, the morphology of the vasculature of the first leaves was investigated via microscopy. Notably, wild type and ccr1-6 pSNBE:CCR1 plants had large and open vessels in the xylem, while the vessels of ccr1-6 mutants were collapsed.

In contrast to the findings of Xue and co-workers, the levels of soluble ferulic acid remained below the detection limit in all samples in our analysis. Therefore, a series of ferulic acid coupling products was used as a measure for the total ferulic acid content (Table 3). On day 15, the levels of all ferulic acid coupling products were increased in ccr1-6 pSNBE:CCR1 lines when compared to wild type, to levels equal to those in the ccr1-6 mutant (Table 3). The same trend was observed for seedlings on day 25. At this time point, the levels of ferulic acid coupling products were increased in the ccr1-6 pSNBE:CCR1 lines when compared to wild type, to levels equal or lower than in the ccr1-6 mutant (Table 3). In accordance with literature, the average nuclear ploidy level of cells from ccrl mutants was lower as compared to that of wild type at both time points (Xue et al. 2015)). However, the average ploidy level of cells in ccr1-6 pSNBE:CCR1 lines was similar to that of wild type and significantly higher as compared to that of the ccr1-6 mutant at both time points. Taken together, these results show that the overall level of ferulic acid was similar in both ccr1-6 and ccr1-6 pSNBE:CCR1 seedlings, while cells of the ccr1-6 mutant, but not those of ccr1-6 pSNBE:CCR1 , retained their mitotic state for a prolonged time. 6.The lignocellulosic composition of ccrl pSNBE:CCR1 is highly similar to that of the ccrl mutant

Lignocellulosic biomass is recalcitrant towards deconstruction mainly because of the presence of lignin. Since ccrl pSNBE:CCR1 lines do not suffer from a yield penalty, but have a reduced amount of lignin in both the xylem and interfascicular fibers (Fig. 5), translation of this strategy in a bio-energy crop could be interesting for the bio-refinery. To study the lignocellulosic biomass composition of ccrl pSNBE:CCR1, the lignin content and composition and cellulose content of senesced inflorescence stems were determined (Table 4). First, soluble compounds were removed from the stems by applying a sequential extraction to produce cell wall residue (CWR) (Van Acker et al. 2013). In compliance with literature, ccr1-6 mutants had 12% less CWR, and thus relatively more soluble compounds, than the wild type (Van Acker et al. 2013). On average, the ccr1-6 pSNBE:CCR1 lines had 6% less CWR than the wild type. Second, the fraction of lignin in these prepared CWRs was determined via the Klason method. Based on this, the lignin amount of the ccr1-6 pSNBE:CCR1 lines did not significantly differ from that of ccr1-6 mutants, but was approximately half that of the wild type. Third, the lignin composition was analyzed via thioacidolysis, which allows quantification of the H, G, S and other minor units that are linked by β-Ο-4 interunit bonds in the lignin polymer. Lignins from both the ccr1-6 and ccr1-6 pSNBE:CCR1 lines released substantially less monomers (H + G + S) than the lignin from wild- type samples. This indicates that the lignins of the ccr1-6 and ccr1-6 pSNBE:CCR1 lines have fewer β-Ο-4 interunit bonds and thus are enriched in carbon-carbon (mainly β-5, β-β) interunit bonds. The H monomers were barely detectable in the wild type and comprised only 1.8% of the total identified thioacidolysis-released units. By contrast, the ccr1-6 and ccr1-6 pSNBE:CCR1 lines showed a relative increase in thioacidolysis-released H units by approximately threefold. Further, the S/G ratio was decreased for the ccr1-6 mutant when compared to that of the wild type. Interestingly, this decrease was even more strikingly pronounced for the ccr1-6 pSNBE:CCR1 lines. Incorporation of ferulic acid (FA), which is a known minor constituent of lignin, results in the release of three different units after thioacidolysis: two are linked via conventional β-Ο-4-structures (the β-Ο-4-FA-l and β-Ο-4-FA-ll units), while the third, derived from the bis-β-0-4-coupling of FA, results in a truncated side chain (Ralph, Kim, Lu, Grabber, Leple, et al. 2008). In agreement with previously reported results for plants deficient in CCR, the relative abundance of all three FA-units was increased in the ccr1-6 mutant when compared to the levels in the wild type (Goujon et al. 2003; Leple et al. 2007; Mir Derikvand et al. 2008; Ralph, Kim, Lu, Grabber, Leple, et al. 2008; Van Acker et al. 2014). Interestingly, also the ccr1-6 pSNBE:CCR1 lines showed a relative increase in all three thioacidolysis-released FA-units when compared to wild type, to levels not significantly different from those in the ccr1-6 mutants. Fourth, crystalline cellulose content was analyzed via the spectrophotometric phenol-sulfuric acid assay. In accordance with previously published results, ccr1-6 mutants had less crystalline cellulose than the wild type (with an average relative decrease of about 17%) (Van Acker et al. 2013). The crystalline cellulose content in the ccr1-6 pSNBE:CCR1 lines did not differ significantly from that of the ccr1-6 mutants, but was reduced as compared to that of the wild type. 7.The ccr1 pSNBE:CCR1 lines have a fourfold increase in total plant saccharification yield when compared to wild type

Cell wall analysis revealed that the lignin content of ccr1-6 pSNBE:CCR1 lines was reduced when compared to that of the wild type, to similar levels as for the ccr1-6 mutant (Table 4). Because lignin amount has a negative effect on the saccharification efficiency, the saccharification potential of ccr1-6 pSNBE:CCR1 biomass after either acid, alkali or no pretreatment was further investigated. As can be seen in Fig. 9, pretreatment (with acid or alkali) allowed the samples to reach the plateau much sooner (i.e. after 48h instead of 96h compared to of no pretreatment). Cellulose-to-glucose conversion for the ccr1-6 pSNBE:CCR1 lines was similar to that of the ccr1-6 lines, and much higher than the wild type, independent of the pretreatment (Fig. 7A, Fig. 9). More specifically, the cellulose-to-glucose conversion of the unpretreated samples had increased from 18% in the wild type to on average 65% in case of the ccr1-6 and ccr1-6 pSNBE:CCR1 lines (i.e. a relative increase of 261 %). In case of acid pretreatment, the conversion increased from 22% in the wild type to on average 81 % in the ccrl- 6 and ccr1-6 pSNBE:CCR1 lines (i.e. a relative increase of 268%). Finally, in case of an alkali pretreatment, the conversion increased from 17% in the wild type to on average 70% in the ccrl- 6 and ccr1-6 pSNBE:CCR1 lines (i.e. a relative increase of 312%).

The glucose yield after saccharification was also expressed per plant (i.e. total stem biomass) (Fig. 7B). In case of the dwarfed ccr1-6 mutants, the total glucose release per plant was increased by about two-fold in comparison with wild type for each of the tested pretreatments. Due to the combined effect of the increase in total inflorescence stem biomass and the increase in saccharification efficiency, the ccr1-6 pSNBE:CCR1 plants showed more than a fourfold increase in glucose yield per plant when compared to wild type, in each of the tested pretreatments.

8. CCR downregulation in poplar combined with vessel-specific expression of CCR

Knock-out of CCR2 results in a reduced lignin content, collapsed vessels and a dwarfed phenotype

Knock-out of CCR2 in poplar was achieved by using the CRISPR/Cas9 system. Here, a gRNA was chosen that targets the first exon of both CCR2 alleles present in the genome of P. tremula x P. alba (Figure 10). All examined plants carried biallelic modifications, ranging from deletions of up to 27 bp to 1 -bp insertions (Figure 10). These lines, along with their wild-type controls, were micropropagated and grown on MS medium for four months. When compared to wild type, the stems and leaves of ccr2 mutants were significantly smaller (Figure 1 1 ). Additionally, the leaves of ccr2 displayed a darker green coloration (Figure 1 1 ). When transferred to soil, only a small fraction of the ccr2 poplars recovered, while almost all wild-type plants survived. In contrast to wild-type plants, which could grow in normal greenhouse conditions, the surviving ccr2 plants had to be kept under a dome to create very humid conditions to keep them from dying. After another four months in their respective conditions, wild types developed tall stems and big leaves, while the surviving ccr2 mutants remained very small (Figure 12).

To be able to compare wild type and ccr2, all further analyses were performed on plants that were grown for four months on MS medium after propagation. To examine the structure of the vessels and study the lignification pattern, cross sections of the stem were treated with ethanol, Maijle and Wiesner staining or visualized via autofluorescence (Figure 13). After making cross- sections of the stems, ccr2 mutants showed the typical red coloration of the xylem. After removal of chlorophyll using an ethanol treatment, it was observed that this red coloration was restricted to the cell wall of xylem cells. Furthermore, the wild-type xylem tissue contained large, open vessels and was heavily lignified. In the ccr2 mutant, the vessels were irregularly shaped and collapsed. Although the red coloration of the xylem of ccr2 interfered with the lignin stainings, both Wiesner and Maijle stained stems showed an overall reduction in lignin deposition in the ccr2 lines when compared to wild type.

Finally, the lignocellulosic composition was studied in order to quantify the lignin amount and examine the lignin composition (Table 5). First, stems were harvested after being grown for four months on MS medium. After debarking, the stems were dried for 3 weeks. Next, soluble compounds were removed by applying a sequential extraction to produce cell wall residue (CWR) (Van Acker et al. 2013). As in Arabidopsis, poplar ccr2 mutants had 10% less CWR than the wild type. Subsequently, the lignin content was measured spectrophotometrically by the acetyl bromide (AcBr) method. Based on this, it was shown that the AcBr lignin amount of ccr2 was reduced with 32% when compared to wild type.

ProSNBE in poplar confers expression in (i) vessels or (ii) vessels and ray cells

ProSNBE used here for the complementation of ccr2 is composed of three tandem repeats of the cis-regulatory SNBE1 originating from the Arabidopsis XYLEM CYSTEINE PROTEASE 1 (XCP1) promoter, fused to the Cauliflower Mosaic Virus (CaMV) 35S minimal promoter (Figure 14A, De Meester et al., 2017). In Arabidopsis, ProSNBE has been shown to direct expression of reporter genes to proto- and metaxylem vessel cells (McCarthy, Zhong, and Ye 201 1 ) (De Meester et al., 2017). To investigate whether ProSNBE also confers a vessel-specific expression pattern in poplar, we fused ProSNBE to the GREEN FLUORESCENT PROTEIN (GFP) and β-GLUCURONIDASE (GUS) reporter genes and studied the expression pattern in poplar stems (Figure 14). Of the 14 examined independent lines, nine poplars showed GUS expression specifically in the vessels (Figure 14B), while five had expression of the reporter gene in both vessels and ray cells (Figure 14C).

Selection of ccr2 ProSNBE:AtCCR1 lines for further analysis To restore vessel integrity and growth of the dwarfed ccr2 poplars, ProSNBE was used to drive the expression of the Arabidopsis CCR1 gene in the ccr2 background. The ProSNBE:AtCCR1 construct was inserted into the p201 N-Cas9 vector already containing the gRNA previously used to generate the ccr2 mutants. After Agrobacterium-mediated transformation, 26 independent shoots could be generated that survived on kanamycin selective medium. Sequencing the PCR- amplified region targeted by the gRNA showed that nine shoots were chimeric, and these were not further analyzed. Furthermore, twelve shoots had biallelic frameshift mutations, carrying indels ranging from 1 bp insertions to 27 bp deletions. Finally, five shoots had one allele that carried a frameshift mutation while the other allele had an indel of (a multiple of) 3 bp (Table 6). The latter allele could still have (residual) CCR activity. All seventeen ccr2 ProSNBE:AtCCR1 shoots were grown and selection of the best lines was performed based on the following criteria: (i) biomass, (ii) lignin amount, (iii) sugar release after saccharification using no, acid or alkaline pretreatment. Note that for this screening only 1 plant per line was available. In total, six ccr2 ProSNBE:AtCCR1 lines were chosen for further analysis (Table 6). The selected lines had the lowest amounts of lignin and the highest amounts of sugar release after saccharification without suffering from (severe) yield penalties. Of these, ccr2 ProSNBE:AtCCR1 9 and 18 were the highest sugar yielding plants, but had a retardation in growth and a lower stem biomass when compared to wild type and the other ccr2 ProSNBE:AtCCR1 lines. They were also the only lines to exhibit an altered xylem coloration. Furthermore, three selected lines showed an increase in stem biomass, while still having an increase in saccharification efficiency (i.e. ccr2 ProSNBE:AtCCR1 1 , 3 and 10). Finally, ccr2 ProSNBE:AtCCR1 1 1 had a small biomass penalty, but a high increase in saccharification efficiency.

The introduction ofAtCCRI Expression under Control of ProSNBE in ccr2 mutant poplar (partially) restores plant height

The six selected ccr2 ProSNBE:AtCCR1 lines were propagated to obtain sufficient biological replicates for further analysis. As a control, both wild type and empty vector poplars were propagated. Unfortunately, none of the cuttings of ccr2 ProSNBE:AtCCR1 1 and 1 1 survived propagation. For the other four selected lines, six or more biological replicates were available which were grown for 5 months in the greenhouse. Plant height was followed weekly and showed no significant differences between the wild type, the empty vector control and ccr2 ProSNBE:AtCCR1 3 and 10 (Figure 15). By contrast, after growing for 4 months in the greenhouse, ccr2 ProSNBE:AtCCR1 9 and 18 started to show a reduction in height when compared to the wild type. After growing for 5 months, ccr2 ProSNBE:AtCCR1 9 and 18 had a reduction in growth of more than 12% when compared to the wild-type and empty-vector controls (Figure 15). Subsequently, the diameter of the stem was determined 10 cm above soil level (Table 7). Despite the growth retardation observed in both ccr2 ProSNBE:AtCCR1 9 and 18, only ccr2 ProSNBE:AtCCR1 9 showed a decreased stem diameter when compared to the controls. Also ccr2 ProSNBE:AtCCR1 3 and 10 had stem diameters similar to the wild-type and empty-vector lines. Next, the fresh stem weight and debarked stem weight of ccr2 ProSNBE:AtCCR1 3, 10 and 18 was not significantly different from that of the controls, whereas that of ccr2 ProSNBE:AtCCR1 9 was reduced by more than 30% when compared to the control and other transgenic lines. Further, the color of the xylem of ccr2 ProSNBE:AtCCR1 lines was evaluated on both cross-sections and debarked stems; ccr2 ProSNBE:AtCCR1 3 and 10 displayed a white coloration of the xylem, similar to that of the wild type (Figure 16). By contrast, ccr2 ProSNBE:AtCCR1 9 and 18, which also displayed growth perturbations, had an altered coloration of the xylem (Figure 16). More specifically, ccr2 ProSNBE:AtCCR1 9 had a pink coloration that appeared in patches along the stem, while the red color of ccr2 ProSNBE:AtCCR1 18 was uniformly distributed along the stem.

ProSNBE:CCR1 Reinforces the Vascular System and Partially Restores Lignin Deposition in the Xylem of ccr2 Mutants

To examine whether the ProSNBE-driven complementation of AtCCRI expression in ccr2 leads to the anticipated vessel-specific lignification and restoration of vessel integrity, the lignin in the stem of wild type and the selected lines was visualized with Maule staining and via autofluorescence (Figure 17). Similar as in the wild type, ccr2 ProSNBE:AtCCR1 3, 9, 10 and 18 showed round, open vessels. However, lignin was deposited uniformly over the xylem in all ccr2 ProSNBE:AtCCR1 lines, as indicated by staining or autofluorescence in both vessels and fibers. When compared to the wild type, the red coloration upon Maule staining of ccr2 ProSNBE:AtCCR1 9 and 18 was less intense, indicative of a reduction in lignin amount. In ccr2 ProSNBE:AtCCR1 3 and 10, the Maule staining seemed to be similar to the wild type.

Plant orthologous CCR genes In this example CCR genomic sequences are provided for different plant species.

P. tremula x P. alba

SEQ ID NO: 2 is allelel of the CCR2 genomic sequence(Pta.003G181400) SEQ ID NO: 3 is allele2 of the CCR2 genomic sequence (Pta.003G181400) Zea mays

SEQ ID NO: 4 is the >lcl|GRMZM2G131205 GRMZM2G131205 genomic sequence for CCR Eucalyptus gunnii

SEQ ID NO: 5 depicts the X97433.1 E.gunnii CCR1 gene

Miscanthus x giganteus SEQ ID NO: 6 depicts the Miscanthus x giganteus cinnamoyl-CoA reductase 2 complete cds. 10. Plant vessel-specific promotors

Sequences of vessel-specific promoters in Arabidopsis

VND6 and VND7

The expression of VND6 has been shown to be restricted to the metaxylem vessels, whereas VND7 had the highest expression level in protoxylem vessels (Kubo et al., 2005; Zhong et al., 2008; Vargas et al., 2016).

SEQ ID NO: 7 depicts the VND6 promoter, >ProVND6

SEQ ID NO: 8 depicts the VND7 promoter, >ProVND7

XCP1 and ProSNBE

A tracheary element expression pattern was detected for XCP1 (Funk et al., 2002). ProSNBE was found to restrict expression to both the proto- and metaxylem vessel cells (De Meester et al., 2018, Plant. Phys.)

SEQ ID NO: 9 depicts the XCP1 promoter, >ProXCP1

SEQ ID NO: 10 depicts the SNBE promoter, >ProSNBE

Materials and methods

Plant material and vector construction

Arabidopsis thaliana (ecotype Col-0) wild type, ccr1-3 (SALK_123689) and ccr1-6 (GABI_622C01 ) mutant plants were used as controls and for plant transformation (Mir Derikvand et al. 2008; Ruel et al. 2009; Van Acker et al. 2013; Vanholme, Storme, et al. 2012). The used SNBE promoter contained three copies of XCP1-SNBE1 linked with the CaMV 35S minimal promoter (from -46 to -1 ), as described in McCarthy et al. (2013) (Table 8). To clone this synthetic promoter, the 103 bp construct was first synthesized by Invitrogen (Life Technologies, St-Aubin, France). Next, the construct was PCR-amplified using primers containing the restriction sites for BamYW and Xho\ (Table 8). Subsequently, the PCR product was cloned into the Gateway pEN- L4-R1 vector using T4 DNA Ligase (Invitrogen) to generate the pSNBE entry vector pEN-L4- pSNBE-R1, whose identity was confirmed by sequencing. For the β-GLUCURONIDASE (GUS) and GREEN FLUORESCENT PROTEIN (GFP) reporter line, the pSNBE building block was introduced into the destination vector pMK7S^*NFm14GW by using LR Clonase (Invitrogen), which resulted in the pSNBE:NLS-GFP-GUS expression clone. For complementation, the ccrl- 3 and ccr1-6 mutants were transformed with the pSNBE:CCR1 construct. To this end, the coding sequence of CCR1 was PCR-amplified and cloned into the pDONR221 vector using BP Clonase (Invitrogen) (Table 8). The sequence identity was confirmed by sequencing. Subsequently, the two building blocks pEN-L4-pSNBE-R1 and pDONR221-L1 -CCR 1-L2 were introduced into the destination vector pK7m24GW-FAST via Multisite LR Clonase Plus (Invitrogen), which resulted in the pSNBE:CCR1 expression clone. All the recombinant plasmids were introduced into Agrobacterium tumefaciens strain C58C1 PMP90 by electroporation. After plant transformation using the floral dip method, the identification of transformed seeds was based on kanamycin resistance (pSNBE:NLS-GFP-GUS reporter lines) or seed fluorescence (ccr1 pSNBE:CCR1 lines) (Shimada, Shimada, and Hara-Nishimura 2010). For the reporter lines, thirty independent T1 plants were analyzed. For the ccr pSNBE:CCR1 lines, two independent, single locus, homozygous T3 lines per ccrl background were selected for further analysis.

Reporter gene analysis

For the reporter line analysis of the aerial parts, twenty independent T1 plants were cultivated in soil under short-day conditions (8h light/ 16h dark photoperiods, 21 °C, 55% humidity) during 6 weeks, after which they were transferred to long-day conditions (16h light/ 8h dark photoperiods, 21 °C, 55% humidity). After one month in long day, primary inflorescence stems and other plant organs were harvested for GUS analysis. The bottom of the inflorescence stem represents non- elongating internodes, while the top of the inflorescence stem represents elongating internodes. For the reporter line analysis of the root, ten independent T1 plants were grown for thirty-two- days on ½ MS-plates and analyzed for GUS activity.

For inflorescence stem cross-sections, the bottom 1 cm of the main stem was removed and the above 3 cm was embedded in 7% (w/v) agarose. Sections of 100 μm thick were made using a vibratome (Campden Instruments, Loughborough, United Kingdom) and subsequently stained for the presence of GUS by incubating at 37°C (in the dark) in a staining buffer containing 1 mM 5-bromo-4-chloro-3-indolyl β-D-glucopyranoside sodium salt (X-Gluc), 0.5 % Triton X-100, 1 mM 5 ethylenediaminotetraacetic acid (EDTA) pH 8.0, 0.5 mM potassium ferricyanide (K3Fe(CN)6), 0.5 potassium ferrocyanide (K₄Fe(CN)6) and 500 mM sodium phosphate buffer pH 7.0. The staining was performed for 1 to 2 h (depending on the amount of coloration) and subsequently stopped by replacing the staining buffer with 70% ethanol (overnight). Next, the sections were transferred to tap water and imaged using a Zeiss Axioskop 2 microscope with EC Plan- Neofluar 20X (0.5 dry) objective.

For the other organs, plant material was placed in GUS staining solution (as described above), vacuum-infiltrated for 1 min and subsequently incubated overnight at 37°C (in the dark). To terminate the reaction, the staining solution was removed and plants were incubated overnight in 70% ethanol. Next, the organs were incubated for 1 week in GUS destaining solution (50% glycerol, 25% lactic acid, 25% Milli-Q water). Images were obtained using a Nikon AZ100M microscope with AZ Plan Apo 0.5X (0.05) objective.

Plant Growth and Harvest

Unless otherwise mentioned, plants were grown as followed: ccrl pSNBE:CCR1 lines and their respective controls (being wild type and ccr1-3 or ccr1-6) were cultivated in soil under short-day conditions (8h light/ 16h dark photoperiods, 21 °C, 55% humidity) during 6 weeks, after which they were transferred to long-day conditions (16h light/ 8h dark photoperiods, 21 °C, 55% humidity). After one month in long-day conditions, main stems were harvested for lignin microscopy and bending tests. For phenolic profiling, main stems were harvested after 5 weeks in long day (with plants having a height of approximately 26 cm for ccrl and 50 cm for the other lines). For all other analyses, fully senesced plants/stems were used.

For the analysis of the first leaves, two ccr1-6 pSNBE:CCR1 lines, wild type and ccr1-6 mutants were grown on soil in long-day conditions (16h light/ 8h dark photoperiod, 21 °C, 55% humidity). Leaf 1 and leaf 2 were harvested 15 and/or 25 days post-stratification. Biomass measurements

Plants were fully senesced, on average, after 6 weeks in short-day conditions followed by 10 weeks in long-day conditions. The inflorescence of completely senesced plants was harvested in full. First, the primary inflorescence stem (=the main stem) was obtained by stripping off the leaves, axillary inflorescences and siliques, after which the weight and height were determined. The number of secondary (=axillary) inflorescence stems originating from the rosette and directly from the main stem was counted. Second, the secondary inflorescences weight was determined by stripping off the leaves and siliques. Third, seeds of the full plant were harvested for number and weight determinations. The total stem biomass is defined here as the weight of the primary and secondary inflorescences, without seeds, siliques and leaves. The total plant biomass is defined here as the weight of the harvested aerial part of the plant, including the seeds, siliques and cauline leaves, but without the rosette leaves.

For the biomass measurements on plants of which the developing siliques were repeatedly removed, the plants were grown as described above. With a frequency of three times per week, all siliques were removed from all plants. When the plants were fully senesced (after on average 6 weeks in short-day conditions and 10 (for the control) or 14 (for the plants of which the siliques were removed) weeks in long-day conditions), the number of secondary inflorescence stems originating from the rosette and main stem were determined, after which the total stem biomass was determined. Two-point bending tests

Bending tests were carried out on 7-cm long basal segments of primary inflorescence stems. To reduce the effect of turgor loss, stems were tested within 5 min of being harvested. The average cross-sectional area of the stem piece (A) was estimated by considering the cross section as a perfect circle using the formula A=TT.(D/2)². Here, D is the average of the diameter measured with a caliper at the basal and at the apical side of the 7-cm piece. Approximately 2 cm of the basal side of the stem was taped to a support, to keep the stem in a horizontal position. Then, a weight (here 0.001 kg) was attached to the apical side, after which the vertical deformation of the stem was measured. The bending modulus (Pa) was calculated as (F.L)/(A.Ax), where F is the force exerted by the weight on the stem segments (here F=m.g=0.0099 N), L is the distance between the support and the position of the weight (here L=0.05 m), A (m²) is the cross-sectional area through which the force is applied, and Δχ (m) is the vertical displacement of the stem as a consequence of the applied force.

Light and fluorescence microscopy After removing the bottom 1 cm of the main stem, the above 3 cm was embedded in 7% (w/v) agarose and slices of 100 μm thick were made using a vibratome (Campden Instruments, Loughborough, United Kingdom). Lignin staining with Wiesner and Maule reagents were performed as described in Sundin et al. (2014). Images were acquired using a Zeiss Axioskop 2 microscope with EC Plan- Neofluar 20X (0.5 dry) objective. Lignin autofluorescence was imaged using the Zeiss LSM 780 microscope with a Plan-Apochromat 10X (0.45 M27) objective. The fluorescence signal for lignin was obtained using 350 nm for excitation and the emission wavelength ranging from 407 to 479 nm.

For microscopy on 25 day-old first leaves, the harvested leaves were cut into small pieces and immersed in a fixative solution of 2.5% glutaraldehyde, 4% formaldehyde in 0.1 M Na-cacodylate buffer, placed in a vacuum oven for 30 min and then left rotating for 3 hours at room temperature. This solution was later replaced with fresh fixative and samples were left rotating overnight at 4°C. After washing, samples were post-fixed in 1 % Os0₄ with «3Fe(CN)6 in 0.1 M Na-cacodylate buffer, pH 7.2. Samples were dehydrated through a graded ethanol series, including a bulk staining with 2% uranyl acetate at the 50% ethanol step followed by embedding in Spurr's resin. Semi-thin sections were cut at 0.5 μm using the ultramicrotome Leica EM UC6 (Leica Microsystems, Diegem, Belgium) and stained with toluidine blue. Images were acquired using a Zeiss Axioskop 2 microscope with Plan- Neofluar 100X Ph 3 (1 .25 oil) objective. Transmission electron microscopy

After removing the bottom 1 cm of the main stem, the above 3 cm was fixated, dehydrated and embedded in Spurr's resin as described above for the first leaves. Ultrathin sections of a gold interference color were cut using the ultra-microtome Leica EM UC6 (Leica), followed by post- staining with uranyl acetate and lead citrate in a Leica EM AC20 and collected on formvar-coated copper slot grids. They were viewed with a JEM-1400plus transmission electron microscope (JEOL, Tokyo, Japan) operating at 60 kV.

Raman microscopy

After removing the bottom 1 cm of the main stem, the above 3 cm was embedded in polyethylene-glycol (PEG) matrix as previously described (n=3) (Gierlinger, Keplinger, and Harrington 2012). Next, 18-μm thick cross sections were cut using a rotary microtome (Leica RM2255, Leica, Germany). After PEG was removed by rinsing with water, the samples were placed with a drop of water on a glass slide and sealed with a coverslip and nail polish. For each biological replicate, 1 cross section was analyzed using a confocal Raman microscope (InVia, Renishaw, UK) equipped with a linearly polarized red laser (λ=633 nm). A 100x oil immersion lens was used for high spatial resolution. On each cross section, four Raman mappings were conducted: two in the xylem region, and two in the interfascicular region. For the mapping, full spectra were obtained with 0.3 μm step size. Integration time of one spectrum was set to 3 s using a 1800 l/mm grating and 18 mW laser power. After data acquisition, a cosmic ray removal was applied using the Wire software (Renishaw Inc., v3.7). The Raman spectra were further analyzed using Cytospec software (Cytospec Inc., v2.00.01 ). By integrating the intensity of the band in the range of 1550-1650 cm^-1 (which is assigned to the aromatic skeletal vibrations), cell corners, middle lamella and secondary cell walls could be distinguished. Then, a more detailed region of interest study was performed on the secondary cell wall of xylary vessels, xylary fibers and interfascicular fibers. Three regions of interest were chosen for each anatomical region on each mapping and an average spectrum was calculated for each region of interest. Consequently, a total number of eighteen average spectra was obtained for each anatomical region (xylary vessels, xylary fibers and interfascicular fibers) of each genotype. The average spectra were then baseline corrected and further analyzed using the software Opus (Bruker, Germany, v7).

Phenolic profiling

Of the main stem, the part ranging from 1 cm to 12 cm (relative to the base of the stem) was frozen and ground. Subsequently, the stem tissue was extracted in 2-ml tubes at 70°C by shaking for 15 min with 1 ml of methanol. After centrifugation, the supernatant was transferred to new 1.5-ml tubes and lyophilized. Subsequently, the pellet was resuspended in equal volumes of cyclohexane and ultrapure water (100 μΙ each). After vortexing, samples were centrifuged, and the aqueous phase was subjected to UHPLC-MS_^on a Waters Acquity UHPLC system (Waters Corporation, Milford, Massachusetts, USA) connected to a Synapt HDMS Q-TOF mass spectrometer (Waters) and further analyzed as described by Vanholme et al. (2013). In the chromatograms of wild type, ccr1-6 and the ccr1-6 pSNBE:CCR1 lines, a total of 9746 peaks were integrated and aligned via Progenesis Ql. For peak selection, the following filters were applied: (i) retention time > 2 min, (ii) value > 0 for at least all replicates in one line, (iii) average peak intensity > 5000 for at least one line. After this, 554 peaks were retained for further PCA and statistical analysis. PCA (auto-scaling) was performed in MetaboAnalyst (MetaboAnalyst software v3.0 (Xia and Wishart 2016)). For statistics, a one-way ANOVA was performed on arcsinh transformed peak areas, which resulted in a list of 274 peaks that were significantly different between at least two lines (p < 0.001 ). Additional post-hoc t-tests were used to find peaks with significantly different peak areas in the ccr1-6 pSNBE:CCR1 lines as compared to those in the wild type and as compared to those in the ccr1-6 mutants. Peaks that had a p-value <0.01 and a ratio of at least two-fold (>2 or <0.5) when compared to the wild type and/or ccr1-6 were considered as statistically significant. Another post-hoc t-test showed that there were no significant differences (p < 0.001 ) in peak intensity between ccr1-6 pSNBE:CCR1 line 1 and ccr1-6 pSNBE:CCR1 line 2 for these peaks. Therefore, the two ccr1-6 pSNBE:CCR1 lines were treated as one group for subsequent analysis. In total, 232 peaks were selected and classified into eight different groups (Fig. 6). The peaks that were significantly different as compared to both the wild type and ccr1-6, were classified accordingly in group 1 , 3, 6 and 8. Those that were only significantly different to the wild type, were re-classified at milder cut-off values when compared to ccr1-6: a 0.05 p-value irrespective of the fold-change. As such, additional compounds got classified in group 1 , 3, 6 and 8. Similarly, peaks that were only significantly different as compared to ccr1-6, were re-classified at milder cut-off values when compared to wild type: a 0.05 p-value irrespective of the fold-change. Again, additional compounds got classified in group 1 , 3, 6 and 8. The remaining peaks were classified accordingly into group 2, 4, 5 and 7.

For the analysis of the first leaves, two sets of leaves 1 and 2 were harvested 15 and 25 days post-stratification. Next, the harvested leaves were pooled per 2 and used for metabolite extraction. Hereby, the frozen ground tissue was extracted in 2-ml tubes at 70°C by shaking for 15 min with 500 μΙ of methanol. After centrifugation, the supernatant was transferred to new 1 .5- ml tubes and the methanol was evaporated. Subsequently, the pellet was resuspended in equal volumes of cyclohexane and ultrapure water (75 μΙ each). After vortexing, samples were centrifuged, and the aqueous phase was analyzed using Reversed Phase (RP) UHPLC coupled to Electrospray lonization-lon Mobility Separation-Quadrupole-Time of flight Mass Spectrometry (ESI-IMS-QTof-MS; Acquity UPLC-Vion IMS MS, Waters). Further analysis was performed as described in Vanholme et al. (2013). After targeted selection of the ferulic acid coupling products, the following filters were applied: (i) value > 0 for at least all replicates in one line, (ii) average peak intensity > 2 for at least one line. After performing a one-ANOVA on arcsinh transformed peak areas (p < 0.001 ), a post-hoc t-test showed that there were no significant differences (p < 0.001 ) in peak intensity between ccr1-6 pSNBE:CCR1 line 1 and ccr-6 pSNBE:CCR1 line 2 for the selected peaks. Therefore, the two ccr1-6 pSNBE:CCR1 lines were treated as one group for subsequent statistical analysis. Additional post-hoc t-tests were used to find significant differences between wild type, ccr1-6 and ccr1-6 pSNBE:CCR1 (p < 0.01 ).

Flow cytometry

Leaf 1 and 2 were harvested and snap-frozen in liquid nitrogen 15 and 25 days post-stratification, for a first and second set of plants, respectively. Subsequently, 15 day old leaves were pooled per 2, whereas 25 day old leaves were analyzed individually. First, the leaves were chopped with a razor blade. Second, the nuclei were isolated by adding 200 μΙ of Cystain UV Precise P nuclei extraction buffer and stained using 800 μΙ of Cystain UV Precise P staining buffer (Sysmex-Partec, Gorlitz, Germany) before filtering using a 30 μm mesh. Flow cytometry was performed using a Cyflow flow cytometer (Sysmex-Partec, Gorlitz, Germany) and the results were analyzed using the Cyflogic software v1.2.1 (Cyflogic, Turku, Finland).

Cell wall characterization and saccharification

For wild type and ccrl pSNBE:CCR1 lines, the bottom 36 cm of the main stem was chopped into pieces of 2 mm and samples were pooled per 3 individuals. For the ccr1-6 mutants, the bottom 18 cm of the main stem was chopped into pieces of 2 mm and samples were pooled per 6 individuals. Preparation of cell wall residue, cellulose quantification and thioacidolysis were performed as previously described in Van Acker et al. (2013). Saccharification assays were performed as described in (Van Acker et al. 2016). For the latter, measurements were performed at different time points after adding the saccharification enzymes: 3h, 7h, 24h, 48h and 197h. In case of no pretreatment, an extra time point at 97h was added to obtain more resolution. To calculate the total plant sugar yield, the saccharification efficiency of the primary inflorescence stem was used as representative for all inflorescences. Lignin content was measured using a modified Klason method (Van den Bosch et al. 2015), where the 4 h incubation with a soxhlet extractor was replaced by a 1 h incubation at 121 °C in an autoclave. Poplar experiment

Plant material and vector construction

Via the Aspen database (Zhou et al. (2015) New Phytologist, 208: 298-301 ); Xue et al. (2015) Tree genetics & genomes, 1 1 :82), a list of 30 protospacers with the N21 GG motif was extracted. Next, the possible protospacers were analyzed based on their position in the gene and the possible off-targets via the Aspen database (Xue et al. 2015; Zhou et al. 2015). Additionally, we considered the following requirements: (i) GC-content, (ii) no more than 4 continuous T's, (iii) the gRNA could not target the Arabidopsis CCR1 sequence. Based on this, the best suitable protospacer was chosen: GAAAAATGTGATCATTGCGGCGG, whereby we changed the first nucleotide (previous a C) into a G to fulfill the needs of the MtU6 promoter.

Cloning of the guide RNA (gRNA) in the p201 N-Cas9 vector was done as previous described (Jacobs et al. (2015) BMC biotechnology, 15: 16). The p201N Cas9 (Addgene plasmid # 59175) and the pUC gRNA Shuttle (Addgene plasmid # 47024) were a gift from Wayne Parrott. For the generation of the ccr2 poplars, the resulting p201 NCas9:gRNA_CCR2 vector was used. For the generation of the ccr2 ProSNBE:AtCCR1 poplars, the ProSNBE:AtCCR1 construct was cloned as described in De Meester et al. (2017). This expression clone was used to amplify ProSNBE:CCR1 using primers containing the Spe\ restriction site. Subsequently, the PCR product was cloned into the digested p201 N-Cas9:gRNA_CCR2 using T4 DNA Ligase (Invitrogen). The resulting p201N-Cas9:gRNA_CCR2:ProSNBE:AtCCR1 vector was used for further transformation.

The expression clones were all transferred into Agrobacterium tumefaciens strain C58C1 660 PMP90 by electroporation and positive colonies were selected via PCR. Agrobacterium- mediated transformation of P. tremula x P. alba 661 was performed according to (Leple et al. (1992) Plant Cell Reports, 1 1 : 137-41 ). Plant Growth and Harvest

The ccr2 plants and their wild-type control were propagated and grown for four months on half- strength Murashige and Skoog (½ MS) in long-day conditions (16-h light/ 8-h dark photoperiod, 21 °C, 55% humidity). For microscopy, fresh stems were used. For cell wall analysis, the harvested stems were debarked and dried for three weeks at room temperature. The ProSNBE:GFP:GUS lines were grown for four months in the greenhouse until they reached a height of approximately 2 meters. For microscopy analysis, pieces of 5 cm were harvested from (i) to bottom (10 cm above the soil level), (ii) the middle, (iii) the top of the stem.

The ccr2 ProSNBE:AtCCR1 lines plants were first propagated in the greenhouse. After four months of growth, they reached a height of approximately 2 meters. For microscopy, fresh stems were used. For cell wall analysis and saccharification, stems were cut 10 cm above soil level, debarked, left to air-dry for three weeks, and ground to powder.

Reporter gene analysis

The 5-cm pieces were embedded in 7% agarose, and sliced into stem sections of approximately 20 nm in thickness with a Reichert-Jung 2040 Autocut Microtome (Leica, Diegem, Belgium). After being cut, the sections were directly submerged in cold 70% ethanol to suppress the wound response. To screen for GUS-staining, the sections were incubated in the dark at 37°C for 30 minutes in freshly prepared X-Gluc solution (1 .0 mM X-Gluc; 0.5% dimethylformamide; 0.5% Trition X-100; 1 .0 mM EDTA (pH 8); 0.5 mM K₃Fe(CN)₆; 0.5 mM K₄Fe(CN)₆ in 500 mM Na₂P0₄- buffer (pH 7)), and analyzed with a binocular microscope (model Bino Leica MZ16, Leica, Diegem, Belgium).

Light and fluorescence microscopy

For the ccr2 lines and their control, the bottom 4 cm was embedded in 7% (w/v) agarose and slices of 100 μm thick were made using a vibratome (Campden Instruments, Loughborough, United Kingdom). The sections were imaged in four different conditions : (i) after incubation for 1 h in 100% ethanol, (ii and iii) after incubation with Maule and Wiesner reagents (as described in (Sundin et al. 2014)), (iv) via autofluorescence. For (i), (ii) and (iii) images were acquired using a Zeiss Axioskop 2 microscope with EC Plan- Neofluar 20X (0.5 dry) objective. Lignin autofluorescence (iv) was imaged using the Zeiss LSM 780 microscope with a Plan-Apochromat 10X (0.45 M27) objective. The fluorescence signal for lignin was obtained using 350 nm for excitation and the emission wavelength ranging from 407 to 479 nm.

For the ccr2 ProSNBE:AtCCR1 lines, the part ranging from 10-14 cm relative to the bottom was harvested and incubated in 70% ethanol for 1 h. Slices of 15 μm thick were made using a Reichert-Jung 2040 Autocut Microtome (Leica, Diegem, Belgium). The sections were imaged in two different conditions : (i) after Maule staining as described in Sundin et al. (2014), (ii) via autofluorescence. For (i) images were acquired using a Zeiss Axioskop 2 as described above. For (ii), images were captured using the Zeiss LSM 780 microscope as described above.

Cell wall characterization and saccharification

For the analysis of ccr2 and their wild-type controls, stems were harvested in full and chopped into pieces of 2 mm. For the ccr2 plants, samples were pooled per two individuals, while wild- type stems were analyzed individually. Preparation of cell wall residue, acetyl bromide and thioacidolysis were performed as previously described in Van Acker et al. (2013). For the analysis of the ccr2 AtProSNBE:CCR1 ground powder, preparation of the cell wall, Klason, thioacidolysis and cellulose measurements were performed as described in De Meester et al. (2017).

Tables

Table 1. Biomass measurements of ccrl pSNBE:CCR1 lines. Measurements were performed on fully senesced plants. For the stem measurements, the leaves, siliques and seeds were removed. The data represent the average value of 120 repeats for wild-type and the ccrl pSNBE:CCR1 lines, 40 repeats for the ccrl mutants, 212 repeats for wild-type and the ccrl pSNBE:CCR1 lines, 24 repeats for the ccrl mutants and 36 repeats for wild-type and the ccrl pSNBE:CCR1 lines, 12 repeats for the ccrl mutants (± standard deviation). Different letters represent significant differences at the 0.05 significance level (Dunnett-Hsu adjusted t-test). *Total plant biomass = biomass of the aerial part of the plant, just above the rosette.

Table 2. Stem biomass measurements of ccr1-6 pSNBE:CCR1 lines of which developing siliques were repeatedly removed during plant growth. Measurements were performed on fully senesced plants grown without (control) or with the removal of siliques. The data represent the average value of 12 repeats for wild type and the ccr1 -6 pSNBE:CCR1 lines, 18 repeats for the ccrl mutants (± standard deviation). Different letters represent significant differences per treatment at the 0.05 significance level (Dunnett-Hsu adjusted t-test).

Table 3. Analysis of ferulic acid content in leaves of 15 and 25 day old seedlings of wild type, ccr1-6 and ccr1-6 pSNBE:CCR1 lines. An overview of the identified ferulic acid coupling products and their average peak area ± standard error (SE) (n=5). Statistics are per compound and per time point (see Materials and methods). Different letters (a-c) represent significant differences at the 0.01 significance level (Dunnett-Hsu adjusted t-test). r.t., retention time; b.d., below detection limit. ompound detected as formic acid adduct.

Table 4. Cell wall characteristics. The cell wall residue (CWR) expressed as % dry weight was determined gravimetrically after a sequential extraction (n=6). Lignin content was determined with the Klason method and expressed as percentage CWR (n=3). Lignin composition was determined with thioacidolysis (n=6). The sum of H, G, and S is expressed in μmοΙ g-1 Klason lignin. The relative proportions of the different lignin units were calculated based on the total thioacidolysis yield (including the minor nonconventional lignin units). S/G was calculated based on the absolute values for S and G. β-Ο-4-FA-l: G-CH = CH-COOH; β-Ο-4-FA-ll: G-CHR-CH2- COOH; bis-β-O-4-FA: G-CHR-CHR2 (R = thioethyl). Cellulose was expressed as percentage CWR (n=6). Values given are the average ± standard deviation. Different letters represent significant differences at the 0.05 significance level (Dunnett-Hsu adjusted t-test).

Table 5: Cell wall characteristics of ccr2 mutants carrying biallelic frameshift mutations.

The cell wall residue (CWR) (expressed as % of the dry weight) was determined gravimetrically after a sequential extraction. Lignin content was determined with the AcBr assay and expressed as % of the CWR. Lignin composition was determined with thioacidolysis. The sum of H, G, and S units is expressed in μmοΙ g-1 AcBr lignin. The relative proportions of the different lignin units were calculated based on the total thioacidolysis yield (including the minor nonconventional lignin units). S/G was calculated based on the absolute values for S and G (expressed in μmοΙ g-1 AcBr lignin). All values are given as average ± standard deviation. Significance groups represent significant differences at the 0.05 significance level (Dunnett-Hsu adjusted t-test; n=5 for each group).

Table 6: Selection of the best performing ccr2 ProSNBE:AtCCR1 lines. Of the original 17 independent transgenic lines, six lines (shown in bold) were chosen for further analysis based on their biomass, lignin amount and sugar yield after saccharification using different pretreatments (n=1 for all the ccr2 ProSNBE:AtCCR1 lines and n=3 for wild type). All selected lines had a decrease in lignin amount and an increase in saccharification efficiency compared to wild type. Additionally, ccr2 ProSNBE:AtCCR1 1 , 10, 3 have an increase in biomass yield, while ccr2 ProSNBE:AtCCR1 18 and 9 had an altered xylem coloration and suffered from a yield penalty when compared to wild type. Finally, ccr2 ProSNBE:AtCCR1 1 1 was chosen due to its high sugar yield after saccharification.

Table 7: Biomass measurements of ccr2 ProSNBE:AtCCR1 poplars. Measurements were performed on poplars grown for 5 months in the greenhouse. Stem diameter was determined 10 cm above soil level. Fresh weight of the stem (without leaves) was determined with and without bark. Different letters represent significant differences at the 0.05 significance level (Dunnett-Hsu adjusted t-test).

Table 8. Sequence information. All sequences, including primers, are shown in the 5' to 3' direction.

Table 9. Bending modulus determined by two-point bending tests. The bending modulus (± standard error) was determined to estimate the stiffness of the stems (n=5). Different letters represent significant differences at the 0.05 significance level (Dunnett-Hsu adjusted t-test).

Table 10. Statistical analysis of cellulose-to-glucose conversion efficiencies using different pretreatments. The p-values for Dunnett-Hsu adjusted t-tests are given.

References

Agarwal, U. P., and R. H. Atalla. 1990. 'Formation and Identification of Cis Trans Ferulic Acid in Photoyellowed White Spruce Mechanical Pulp', Journal of Wood Chemistry and Technology, 10: 169-90.

Agarwal, U. P., J. D. McSweeny, and S. A. Ralph. 201 1. 'FT-Raman Investigation of Milled-Wood Lignins: Softwood, Hardwood, and Chemically Modified Black Spruce Lignins', Journal of Wood Chemistry and Technology, 31 : 324-44.

Agarwal, U. P., S. A. Ralph, and R. H. Atalla. 1997. 'FT Raman spectroscopic study of softwood lignin', Iswpc - 9th International Symposium on Wood and Pulping Chemistry - Poster Presentations: 81 -84.

Anderson, N. A., N. D. Bonawitz, K. Nyffeler, and C. Chappie. 2015. 'Loss of FERULATE 5- HYDROXYLASE Leads to Mediator-Dependent Inhibition of Soluble Phenylpropanoid Biosynthesis in Arabidopsis', Plant Physiol, 169: 1557-67.

Bensussan, M., V. Lefebvre, A. Ducamp, J. Trouverie, E. Gineau, M. N. Fortabat, A. Guillebaux, A. Baldy, D. Naquin, S. Herbette, C. Lapierre, G. Mouille, C. Horlow, and M. Durand-

Tardif. 2015. 'Suppression of Dwarf and irregular xylem Phenotypes Generates Low- Acetylated Biomass Lines in Arabidopsis', Plant Physiol, 168: 452-63.

Besseau, S., L. Hoffmann, P. Geoffroy, C. Lapierre, B. Pollet, and M. Legrand. 2007. 'Flavonoid accumulation in Arabidopsis repressed in lignin synthesis affects auxin transport and plant growth', Plant Cell, 19: 148-62.

Boerjan, W., J. Ralph, and M. Baucher. 2003. 'Lignin biosynthesis', Annu Rev Plant Biol, 54:

519-46.

Bonawitz, N. D., and C. Chappie. 2013. 'Can genetic engineering of lignin deposition be accomplished without an unacceptable yield penalty?', Current Opinion in Biotechnology, 24: 336-43.

Bonawitz, N. D., J. I. Kim, Y. Tobimatsu, P. N. Ciesielski, N. A. Anderson, E. Ximenes, J. Maeda, J. Ralph, B. S. Donohoe, M. Ladisch, and C. Chappie. 2014. 'Disruption of Mediator rescues the stunted growth of a lignin-deficient Arabidopsis mutant', Nature, 509: 376-+. Brown, D. M., L. A. Zeef, J. Ellis, R. Goodacre, and S. R. Turner. 2005. 'Identification of novel genes in Arabidopsis involved in secondary cell wall formation using expression profiling and reverse genetics', Plant Cell, 17: 2281 -95.

Carroll, A., and C. Somerville. 2009. 'Cellulosic Biofuels', Annu Rev Plant Biol, 60: 165-82. Chen, F., and R. A. Dixon. 2007. 'Lignin modification improves fermentable sugar yields for biofuel production', Nat Biotechnol, 25: 759-61 .

Cosgrove, D. J. 2005. 'Growth of the plant cell wall', Nat Rev Mol Cell Biol, 6: 850-61 . Day, A., G. Neutelings, F. Nolin, S. Grec, A. Habrant, D. Cronier, B. Maher, C. Rolando, H. David, B. Chabbert, and S. Hawkins. 2009. 'Caffeoyl coenzyme A O-methyltransferase down-regulation is associated with modifications in lignin and cell-wall architecture in flax secondary xylem', Plant Physiol Biochem, 47: 9-19.

Del Carmen Martinez-Ballesta, M., D. A. Moreno, and M. Carvajal. 2013. 'The physiological importance of glucosinolates on plant response to abiotic stress in Brassica', Int J Mol Sci, 14: 1 1607-25.

Eudes, A., A. George, P. Mukerjee, J. S. Kim, B. Pollet, P. I. Benke, F. Yang, P. Mitra, L. Sun,

O. P. Cetinkol, S. Chabout, G. Mouille, L. Soubigou-Taconnat, S. Balzergue, S. Singh, B. M. Holmes, A. Mukhopadhyay, J. D. Keasling, B. A. Simmons, C. Lapierre, J. Ralph, and D. Loque. 2012. 'Biosynthesis and incorporation of side-chain-truncated lignin monomers to reduce lignin polymerization and enhance saccharification', Plant

Biotechnology Journal, 10: 609-20.

Eudes, A., N. Sathitsuksanoh, E. E. Baidoo, A. George, Y. Liang, F. Yang, S. Singh, J. D.

Keasling, B. A. Simmons, and D. Loque. 2015. 'Expression of a bacterial 3- dehydroshikimate dehydratase reduces lignin content and improves biomass saccharification efficiency', Plant Biotechnology Journal, 13: 1241 -50.

Eudes, A., N. Zhao, N. Sathitsuksanoh, E. E. Baidoo, J. Lao, G. Wang, S. Yogiswara, T. S. Lee,

S. Singh, J. C. Mortimer, J. D. Keasling, B. A. Simmons, and D. Loque. 2016. 'Expression of S-adenosylmethionine Hydrolase in Tissues Synthesizing Secondary Cell Walls Alters

Specific Methylated Cell Wall Fractions and Improves Biomass Digestibility', Front

Bioeng Biotech nol, 4: 58.

Fabre, N., V. Poinsot, L. Debrauwer, C. Vigor, J. Tulliez, I. Fouraste, and C. Moulis. 2007.

'Characterisation of glucosinolates using electrospray ion trap and electrospray quadrupole time-of-flight mass spectrometry', Phytochem Anal, 18: 306-19.

Franke, R., M. R. Hemm, J. W. Denault, M. O. Ruegger, J. M. Humphreys, and C. Chappie.

2002. 'Changes in secondary metabolism and deposition of an unusual lignin in the ref8 mutant of Arabidopsis', Plant Journal, 30: 47-59.

Franke, R., J. M. Humphreys, M. R. Hemm, J. W. Denault, M. O. Ruegger, J. C. Cusumano, and C. Chappie. 2002. 'The Arabidopsis REF8 gene encodes the 3-hydroxylase of phenylpropanoid metabolism', Plant Journal, 30: 33-45.

Funk, V., B. Kositsup, C. Zhao, and E. P. Beers. 2002. 'The Arabidopsis xylem peptidase XCP1 is a tracheary element vacuolar protein that may be a papain ortholog', Plant Physiol,

128: 84-94.

Gierlinger, N., T. Keplinger, and M. Harrington. 2012. 'Imaging of plant cell walls by confocal Raman microscopy', Nat Protoc, 7: 1694-708. Gorzsas, A., H. Stenlund, P. Persson, J. Trygg, and B. Sundberg. 201 1. 'Cell-specific chemotyping and multivariate imaging by combined FT-IR microspectroscopy and orthogonal projections to latent structures (OPLS) analysis reveals the chemical landscape of secondary xylerm', Plant Journal, 66: 903-14.

Goujon, T., V. Ferret, I. Mila, B. Pollet, K. Ruel, V. Burlat, J. P. Joseleau, Y. Barriere, C. Lapierre, and L. Jouanin. 2003. 'Down-regulation of the AtCCRI gene in Arabidopsis thaliana: effects on phenotype, lignins and cell wall degradability', Planta, 217: 218-28.

Hensel, L. L, M. A. Nelson, T. A. Richmond, and A. B. Bleecker. 1994. 'The fate of inflorescence meristems is controlled by developing fruits in Arabidopsis', Plant Physiol, 106: 863-76. Huang, J., M. Gu, Z. Lai, B. Fan, K. Shi, Y. H. Zhou, J. Q. Yu, and Z. Chen. 2010. 'Functional analysis of the Arabidopsis PAL gene family in plant growth, development, and response to environmental stress', Plant Physiol, 153: 1526-38.

Isikgor, F. H., and C. R. Becer. 2015. 'Lignocellulosic biomass: a sustainable platform for the production of bio-based chemicals and polymers', Polymer Chemistry, 6: 4497-559. Jackson, L. A., G. L. Shadle, R. Zhou, J. Nakashima, F. Chen, and R. A. Dixon. 2008. 'Improving

Saccharification Efficiency of Alfalfa Stems Through Modification of the Terminal Stages of Monolignol Biosynthesis', Bioenergy Research, 1 : 180-92.

Jones, L., A. R. Ennos, and S. R. Turner. 2001. 'Cloning and characterization of irregular xylem4

(irx4): a severely lignin-deficient mutant of Arabidopsis', Plant Journal, 26: 205-16. Kim, J. I., W. L. Dolan, N. A. Anderson, and C. Chappie. 2015. 'Indole Glucosinolate Biosynthesis

Limits Phenylpropanoid Accumulation in Arabidopsis thaliana', Plant Cell, 27: 1529-46. Kubo, M., M. Udagawa, N. Nishikubo, G. Horiguchi, M. Yamaguchi, J. Ito, T. Mimura, H. Fukuda, and T. Demura. 2005. 'Transcription switches for protoxylem and metaxylem vessel formation', Genes Dev, 19: 1855-60.

Laskar, D. D., M. Jourdes, A. M. Patten, G. L. Helms, L. B. Davin, and N. G. Lewis. 2006. 'The

Arabidopsis cinnamoyl CoA reductase irx4 mutant has a delayed but coherent (normal) program of lignification', Plant Journal, 48: 674-86.

Leple, J. C, R. Dauwe, K. Morreel, V. Storme, C. Lapierre, B. Pollet, A. Naumann, K. Y. Kang,

H. Kim, K. Ruel, A. Lefebvre, J. P. Joseleau, J. Grima-Pettenati, R. De Rycke, S. Andersson-Gunneras, A. Erban, I. Fehrle, M. Petit-Conil, J. Kopka, A. Polle, E. Messens,

B. Sundberg, S. D. Mansfield, J. Ralph, G. Pilate, and W. Boerjan. 2007. 'Downregulation of cinnamoyl-coenzyme A reductase in poplar: multiple-level phenotyping reveals effects on cell wall polymer metabolism and structure', Plant Cell, 19: 3669-91 .

Li, E. Y., A. Bhargava, W. Y. Qiang, M. C. Friedmann, N. Forneris, R. A. Savidge, L. A. Johnson, S. D. Mansfield, B. E. Ellis, and C. J. Douglas. 2012. 'The Class II KNOX gene KNAT7 negatively regulates secondary wall formation in Arabidopsis and is functionally conserved in Populus', New Phytologist, 194: 102-15. Mateu, B. P., M. T. Hauser, A. Heredia, and N. Gierlinger. 2016. 'Waterproofing in Arabidopsis: Following Phenolics and Lipids In situ by Confocal Raman Microscopy', Frontiers in Chemistry, 4.

McCarthy, R. L, R. Zhong, and Z. H. Ye. 201 1 . 'Secondary wall NAC binding element (SNBE), a key cis-acting element required for target gene activation by secondary wall NAC master switches', Plant Signal Behav, 6: 1282-5.

Meyer, M. W., J. S. Lupoi, and E. A. Smith. 201 1. Ί 064 nm dispersive multichannel Raman spectroscopy for the analysis of plant lignin', Analytica Chimica Acta, 706: 164-70. Miedes, E., R. Vanholme, W. Boerjan, and A. Molina. 2014. 'The role of the secondary cell wall in plant resistance to pathogens', Front Plant Sci, 5: 358.

Mir Derikvand, M., J. B. Sierra, K. Ruel, B. Pollet, C. T. Do, J. Thevenin, D. Buffard, L. Jouanin, and C. Lapierre. 2008. 'Redirection of the phenylpropanoid pathway to feruloyl malate in Arabidopsis mutants deficient for cinnamoyl-CoA reductase 1 ', Planta, 227: 943-56. Morreel, K., Y. Saeys, O. Dima, F. Lu, Y. Van de Peer, R. Vanholme, J. Ralph, B. Vanholme, and W. Boerjan. 2014. 'Systematic structural characterization of metabolites in

Arabidopsis via candidate substrate-product pair networks', Plant Cell, 26: 929-45. Ohashi-lto, K., Y. Oda, and H. Fukuda. 2010. 'Arabidopsis VASCULAR-RELATED NAC- DOMAIN6 Directly Regulates the Genes That Govern Programmed Cell Death and Secondary Wall Formation during Xylem Differentiation', Plant Cell, 22: 3461 -73.

Pauly, M., and K. Keegstra. 2010. 'Plant cell wall polymers as precursors for biofuels', Curr Opin Plant Biol, 13: 305-12.

Persson, S., K. H. Caffall, G. Freshour, M. T. Hilley, S. Bauer, P. Poindexter, M. G. Hahn, D.

Mohnen, and C. Somerville. 2007. 'The Arabidopsis irregular xylem8 mutant is deficient in glucuronoxylan and homogalacturonan, which are essential for secondary cell wall integrity', Plant Cell, 19: 237-55.

Pesquet, E., B. Zhang, A. Gorzsas, T. Puhakainen, H. Serk, S. Escamez, O. Barbier, L. Gerber, C. Courtois-Moreau, E. Alatalo, L. Paulin, J. Kangasjarvi, B. Sundberg, D. Goffner, and H. Tuominen. 2013. 'Non-cell-autonomous postmortem lignification of tracheary elements in Zinnia elegans', Plant Cell, 25: 1314-28.

Petersen, P. D., J. Lau, B. Ebert, F. Yang, Y. Verhertbruggen, J. S. Kim, P. Varanasi, A.

Suttangkakul, M. Auer, D. Loque, and H. V. Scheller. 2012. 'Engineering of plants with improved properties as biofuels feedstocks by vessel-specific complementation of xylan biosynthesis mutants', Biotechnol Biofuels, 5.

Piquemal, J., C. Lapierre, K. Myton, A. O'Connell, W. Schuch, J. Grima-Pettenati, and A. M.

Boudet. 1998. 'Down-regulation of cinnamoyl-CoA reductase induces significant changes of lignin profiles in transgenic tobacco plants', Plant Journal, 13: 71 -83. Pradhan Mitra, P., and D. Loque. 2014. 'Histochemical staining of Arabidopsis thaliana secondary cell wall elements', J Vis Exp.

Prinsloo, L. C, W. du Plooy, and C. van der Merwe. 2004. 'Raman spectroscopic study of the epicuticular wax layer of mature mango (Mangifera indica) fruit', Journal of Raman Spectroscopy, 35: 561 -67.

Ralph, J., H. Kim, F. Lu, J. H. Grabber, J. C. Leple, J. Berrio-Sierra, M. M. Derikvand, L. Jouanin, W. Boerjan, and C. Lapierre. 2008. 'Identification of the structure and origin of a thioacidolysis marker compound for ferulic acid incorporation into angiosperm lignins (and an indicator for cinnamoyl CoA reductase deficiency)', Plant Journal, 53: 368-79. Ralph, J., H. Kim, F. Lu, J. H. Grabber, J. C. Leple, J. Berrio-Sierra, M. M. Derikvand, L. Jouanin, W. Boerjan, and C. Lapierre. 2008. 'Identification of the structure and origin of a thioacidolysis marker compound for ferulic acid incorporation into angiosperm lignins (and an indicator for cinnamoyl CoA reductase deficiency)', Plant Journal, 53: 368-79.

Ruel, K., J. Berrio-Sierra, M. M. Derikvand, B. Pollet, J. Thevenin, C. Lapierre, L. Jouanin, and J. P. Joseleau. 2009. 'Impact of CCR1 silencing on the assembly of lignified secondary walls in Arabidopsis thaliana', New Phytologist, 184: 99-1 13.

Shadle, G., F. Chen, M. S. S. Reddy, L. Jackson, J. Nakashima, and R. A. Dixon. 2007. 'Down- regulation of hydroxycinnamoyl CoA: Shikimate hydroxycinnamoyl transferase in transgenic alfalfa affects lignification, development and forage quality (vol 68, pg 1521 , 2007)', Phytochemistry, 68: 2023-23.

Shimada, T. L., T. Shimada, and I. Hara-Nishimura. 2010. Ά rapid and non-destructive screenable marker, FAST, for identifying transformed seeds of Arabidopsis thaliana', Plant Journal, 61 : 519-28.

Shinbo, Y., Y. Nakamura, M. Altaf-UI-Amin, H. Asahi, K. Kurokawa, M. Arita, K. Saito, D. Ohta, D. Shibata, and S. Kanaya. 2006. KNApSAcK: A Comprehensive Species-Metabolite

Relationship Database.

Smith, R. A., C. L. Cass, M. Mazaheri, R. S. Sekhon, M. Heckwolf, H. Kaeppler, N. de Leon, S.

D. Mansfield, S. M. Kaeppler, J. C. Sedbrook, S. D. Karlen, and J. Ralph. 2017.

'Suppression of CINNAMOYL-CoA REDUCTASE increases the level of monolignol ferulates incorporated into maize lignins', Biotechnol Biofuels, 10: 109.

Smith, R. A., M. Schuetz, S. D. Karlen, D. Bird, N. Tokunaga, Y. Sato, S. D. Mansfield, J. Ralph, and A. L. Samuels. 2017. 'Defining the Diverse Cell Populations Contributing to

Lignification in Arabidopsis Stems', Plant Physiol, 174: 1028-36.

Smith, R. A., M. Schuetz, M. Roach, S. D. Mansfield, B. Ellis, and L. Samuels. 2013. 'Neighboring Parenchyma Cells Contribute to Arabidopsis Xylem Lignification, while Lignification of

Interfascicular Fibers Is Cell Autonomous', Plant Cell, 25: 3988-99. Stout, J., and C. Chappie. 2004. 'The phenylpropanoid pathway in arabidopsis: Lessons learned from mutants in sinapate ester biosynthesis', Secondary Metabolism in Model Systems, 38: 39-67.

Sundin, L, R. Vanholme, J. Geerinck, G. Goeminne, R. Hofer, H. Kim, J. Ralph, and W. Boerjan.

2014. 'Mutation of the inducible ARABIDOPSIS THALIANA CYTOCHROME P450

REDUCTASE2 alters lignin composition and improves saccharification', Plant Physiol, 166: 1956-71 .

Taylor, N. G., W. R. Scheible, S. Cutler, C. R. Somerville, and S. R. Turner. 1999. 'The irregular xylem3 locus of Arabidopsis encodes a cellulose synthase required for secondary cell wall synthesis', Plant Cell, 1 1 : 769-80.

Thevenin, J., B. Pollet, B. Letarnec, L. Saulnier, L. Gissot, A. Maia-Grondard, C. Lapierre, and L. Jouanin. 201 1. 'The Simultaneous Repression of CCR and CAD, Two Enzymes of the Lignin Biosynthetic Pathway, Results in Sterility and Dwarfism in Arabidopsis thaliana', Mol Plant, 4: 70-82.

Tsai, C. J., and L. J. Xue. 2015. 'CRISPRing into the woods', Gm Crops & Food-Biotechnology in Agriculture and the Food Chain, 6: 206-15.

Turner, S. R., and C. R. Somerville. 1997. 'Collapsed xylem phenotype of Arabidopsis identifies mutants deficient in cellulose deposition in the secondary cell wall', Plant Cell, 9: 689- 701 .

Van Acker, R., J. C. Leple, D. Aerts, V. Storme, G. Goeminne, B. Ivens, F. Legee, C. Lapierre, K. Piens, M. C. E. Van Montagu, N. Santoro, C. E. Foster, J. Ralph, W. Soetaert, G. Pilate, and W. Boerjan. 2014. 'Improved saccharification and ethanol yield from field- grown transgenic poplar deficient in cinnamoyl-CoA reductase', Proceedings of the National Academy of Sciences of the United States of America, 1 1 1 : 845-50.

Van Acker, R., R. Vanholme, V. Storme, J. C. Mortimer, P. Dupree, and W. Boerjan. 2013. 'Lignin biosynthesis perturbations affect secondary cell wall composition and saccharification yield in Arabidopsis thaliana', Biotechnol Biofuels, 6: 46.

Van Acker, R.; , R.; Vanholme, K.; Piens, and W. Boerjan. 2016. 'Saccharification Protocol for Small-scale Lignocellulosic Biomass Samples to Test Processing of Cellulose into Glucose', Bio-protocol, 6: e1701.

Van den Bosch, S., W. Schutyser, R. Vanholme, T. Driessen, S. F. Koelewijn, T. Renders, B.

De Meester, W. J. J. Huijgen, W. Dehaen, C. M. Courtin, B. Lagrain, W. Boerjan, and B. F. Sels. 2015. 'Reductive lignocellulose fractionation into soluble lignin-derived phenolic monomers and dimers and processable carbohydrate pulps', Energy & Environmental Science, 8: 1748-63. Vanholme, B., T. Desmet, F. Ronsse, K. Rabaey, F. Van Breusegem, M. De Mey, W. Soetaert, and W. Boerjan. 2013. 'Towards a carbon-negative sustainable bio-based economy', Front Plant Sci, 4: 174.

Vanholme, R., I. Cesarino, K. Rataj, Y. G. Xiao, L. Sundin, G. Goeminne, H. Kim, J. Cross, K.

Morreel, P. Araujo, L. Welsh, J. Haustraete, C. McClellan, B. Vanholme, J. Ralph, G. G.

Simpson, C. Halpin, and W. Boerjan. 2013. 'Caffeoyl Shikimate Esterase (CSE) Is an Enzyme in the Lignin Biosynthetic Pathway in Arabidopsis', Science, 341 : 1 103-06.

Vanholme, R., B. Demedts, K. Morreel, J. Ralph, and W. Boerjan. 2010. 'Lignin biosynthesis and structure', Plant Physiol, 153: 895-905.

Vanholme, R., K. Morreel, C. Darrah, P. Oyarce, J. H. Grabber, J. Ralph, and W. Boerjan. 2012.

'Metabolic engineering of novel lignin in biomass crops', New Phytologist, 196: 978-1000.

Vanholme, R., V. Storme, B. Vanholme, L. Sundin, J. H. Christensen, G. Goeminne, C. Halpin, A. Rohde, K. Morreel, and W. Boerjan. 2012. Ά systems biology view of responses to lignin biosynthesis perturbations in Arabidopsis', Plant Cell, 24: 3506-29.

Vargas, L., I. Cesarino, R. Vanholme, W. Voorend, M. de Lyra Soriano Saleme, K. Morreel, and W. Boerjan. 2016. 'Improving total saccharification yield of Arabidopsis plants by vessel- specific complementation of caffeoyl shikimate esterase (cse) mutants', Biotechnol Biofuels, 9: 139.

Voelker, S. L., B. Lachenbruch, F. C. Meinzer, M. Jourdes, C. Y. Ki, A. M. Patten, L. B. Davin, N. G. Lewis, G. A. Tuskan, L. Gunter, S. R. Decker, M. J. Selig, R. Sykes, M. E. Himmel,

P. Kitin, O. Shevchenko, and S. H. Strauss. 2010. 'Antisense Down-Regulation of 4CL Expression Alters Lignification, Tree Growth, and Saccharification Potential of Field- Grown Poplar', Plant Physiol, 154: 874-86.

Weng, J. K., and C. Chappie. 2010. 'The origin and evolution of lignin biosynthesis', New Phytologist, 187: 273-85.

Weng, J. K., X. Li, N. D. Bonawitz, and C. Chappie. 2008. 'Emerging strategies of lignin engineering and degradation for cellulosic biofuel production', Curr Opin Biotechnol, 19: 166-72.

Wilkerson, C. G., S. D. Mansfield, F. Lu, S. Withers, J. Y. Park, S. D. Karlen, E. Gonzales-Vigil, D. Padmakshan, F. Unda, J. Rencoret, and J. Ralph. 2014. 'Monolignol Ferulate

Transferase Introduces Chemically Labile Linkages into the Lignin Backbone', Science, 344: 90-93.

Wuest, S. E., M. A. Philipp, D. Guthorl, B. Schmid, and U. Grossniklaus. 2016. 'Seed Production Affects Maternal Growth and Senescence in Arabidopsis', Plant Physiol, 171 : 392-404. Xia, J., and D.S. Wishart. 2016. 'Using MetaboAnalyst 3.0 for Comprehensive Metabolomics Data Analysis', Current Protocols in Bioinformatics, 55: 14.10.1 -14.10.91. Xue, J. S., D. X. Luo, D. Y. Xu, M. H. Zeng, X. F. Cui, L. G. Li, and H. Huang. 2015. 'CCR1 , an enzyme required for lignin biosynthesis in Arabidopsis, mediates cell proliferation exit for leaf development', Plant Journal, 83: 375-87.

Yang, F., P. Mitra, L. Zhang, L. Prak, Y. Verhertbruggen, J. S. Kim, L. Sun, K. J. Zheng, K. X.

Tang, M. Auer, H. V. Scheller, and D. Loque. 2013. 'Engineering secondary cell wall deposition in plants', Plant Biotechnology Journal, 1 1 : 325-35.

Zhong, R., C. Lee, and Z. H. Ye. 2010. 'Global analysis of direct targets of secondary wall NAC master switches in Arabidopsis', Mol Plant, 3: 1087-103.

Zhong, R., C. Lee, J. Zhou, R. L. McCarthy, and Z. H. Ye. 2008. Ά battery of transcription factors involved in the regulation of secondary cell wall biosynthesis in Arabidopsis', Plant Cell,

20: 2763-82.

Zhong, R. Q., W. H. Morrison, J. Negrel, and Z. H. Ye. 1998. 'Dual methylation pathways in lignin biosynthesis', Plant Cell, 10: 2033-45.

Zhou, X. H., T. B. Jacobs, L. J. Xue, S. A. Harding, and C. J. Tsai. 2015. 'Exploiting SNPs for biallelic CRISPR mutations in the outcrossing woody perennial Populus reveals 4- coumarate: CoA ligase specificity and redundancy', New Phytologist, 208: 298-301 .

Claims

1 . A plant having a gene disruption in cinnamoyl-coA reductase and having no detectable cinnamoyl-coA reductase activity and said plant comprises a chimeric gene comprising of (i) a vessel specific plant-expressible promotor, ii) a DNA region which when transcribed codes for a cinnamoyl-coA reductase protein involved in the lignin biosynthesis pathway and iii) a 3' end region involved in transcription termination and polyadenylation.

2. A plant according to claim 1 which plant is a crop.

3. A crop according to claim 2 which is a cereal plant.

4. A plant according to claim 1 which is a woody plant such as a pine, poplar or eucalyptus.

5. A seed or a plant cell derived from a plant according to any one of claims 1 to 4.

6. A method to increase the plant yield comprising transforming a plant with a gene disruption in cinnamoyl-coA reductase and having no detectable cinnamoyl-coA reductase activity with a chimeric gene comprising of (i) a vessel specific plant- expressible promotor, ii) a DNA region which when transcribed codes for a cinnamoyl- coA reductase protein involved in the lignin biosynthesis pathway and iii) a 3' end region involved in transcription termination and polyadenylation.