WO2019043201A1 - Transcription factor znf471 as a therapeutic agent and a biomarker - Google Patents

Abstract

The present invention relates to the identification of Transcription Factor ZNF471 as a therapeutic agent and a biomarker in the field of dyslipidemia. In one aspect, the invention thus relates to therapeutic uses of ZNF471. In another aspect, the invention relates to diagnostic methods based on detecting alterations in the ZNF471 gene locus.

Description

TRANSCRIPTION FACTOR ZNF471 AS A THERAPEUTIC AGENT AND A BIOMARKER

Field of the invention

The present invention relates to the identification of Transcription Factor ZNF471 as a therapeutic agent and a biomarker in the field of dyslipidemia. In one aspect, the invention thus relates to therapeutic uses of ZNF471 . In another aspect, the invention relates to diagnostic methods based on detecting alterations in the ZNF471 gene locus.

Background of the invention

Dyslipidemia is a class of lipoprotein metabolism disorders characterized by increased or decreased levels of certain lipids or lipoproteins in plasma. Clinically, dyslipidemia has been closely linked to the patho-physiology of cardiovascular diseases (CVD).

Lipoproteins are high molecular weight aggregates composed of lipids and one or more specific apolipoproteins. Lipoproteins are the functional units of delivering water-insoluble lipids such as triglycerides (TG) and cholesterol via the circulation to cells for utilization or storage. While they show a common basic structure (polar groups of phospholipids, -OH groups of cholesterol at the outside, cholesterol esters and TG in the core), they vary largely in size and composition and are divided into five major classes, based on density : chylomicrons, very low-density lipoproteins (VLDL), intermediate-density lipoproteins (IDL), low-density lipoproteins (LDL), and high-density lipoproteins (HDL). Most triglycerides are transported in chylomicrons or VLDL, and most cholesterol is carried in LDL and HDL. Chylomicrons are the largest and most lipid-rich lipoproteins, whereas HDL are the smallest lipoproteins and contain the least amount of lipid.

Lipoprotein metabolism is the process by which hydrophobic lipids are transported within the interstitial fluid and plasma. It involves two pathways, which depend primarily on the source of the circulating lipids: dietary origin (the exogenous pathway) or hepatic origin (the endogenous pathway). Following a meal, dietary fat and cholesterol are absorbed and re-packaged by the enterocytes of the small intestine, and secreted into the lymphatics as chylomicrons - large TG-rich lipoprotein particles which eventually enter the bloodstream at the left subclavian vein. As they travel through the circulation, fatty acids (FA) are extracted from the chylomicron particles by peripheral cells through the action of Lipoprotein Lipase (LpL), leaving smaller, more dense Chylomicron Remnants that are eventually internalized by the liver. The liver also synthesizes cholesterol and TG and packages them into Very Low Density Lipoprotein (VLDL) particles, which are secreted into the circulation. Peripheral tissues can take what they require, and VLDLs are remodeled into Intermediate Density Lipoproteins (IDL), and finally the denser, cholesterol-rich LDL particles. The liver, as well as peripheral tissues, can also internalize whole lipoprotein particles. High Density Lipoprotein (HDL) particles mediate a process known as reverse cholesterol transport (RCT), in which the smaller, denser HDL particles acquire cholesterol from peripheral tissues and transport it back to the liver. Importantly, HDL can mediate this same process in atherosclerotic plaques, removing cholesterol and fat from the vessel wall and returning it to the liver.

Atherosclerosis and CVD are overwhelmingly linked to abnormal lipoprotein metabolism. For example, atherosclerosis is a slowly progressive disease characterized by the accumulation of lipids within the arterial wall, eventually producing degenerative changes and obstruction of blood flow. Large epidemiological studies (Kannel et al. 1971. Ann Intern Med.; 74:1-12, Ference et al. 2017. European Heart Journal 0, 1-14 ; Ko et al. 2016. J Am Coll Cardiol. 8;68(19):2073-2083) have consistently shown that high levels of LDL cholesterol (LDL-C), as well as low levels of HDL cholesterol (HDL-C), are associated with increased CVD risk. A causative role of LDL in CVD risk has been supported by the success of LDL-lowering therapy with statins, currently the most prescribed class of drugs for the treatment of hyper- cholesterolemia and atherosclerosis.

Due to the success of statins, additional LDL-lowering therapeutic strategies, such as PCSK9 antagonism, are being actively pursued in pharmaceutical development. However, it seems that there might be limits to the degree of benefit that can be achieved by lowering LDL- cholesterol levels alone, which has led to increased interest in targeting other lipid-related risk factors for cardiovascular disease, such as low levels of HDL-C. The development of two inhibitors of cholesteryl ester transport protein (CETP) was stopped due to adverse events and a lack of efficacy in large phase III trials. In this context, lipid-modifying strategies are still needed.

Summary of the invention

The inventors have now identified a transcription factor, hereinafter referred to as "ZNF471 ", which is involved in the control of lipid metabolism. Indeed, the inventors have shown that the expression of a vector coding for human ZNF471 in a murine model downregulates hepatic expression of CETP, Lpl Pltp and Abcgl genes and results in a phenotype of reduced plasma circulating cholesterol levels and increased circulating HDL-C levels. On this basis, they propose to use said factor in therapy, more particularly for use in treating a dyslipidemia, or a disease associated with dyslipidemia. More generally, the inventors propose to use any agent that decreases the hepatic expression of all four CETP, Pltp, Abcgl and Lpl genes in treating dyslipidemia, or a disease associated with dyslipidemia.

Accordingly, in a first aspect, the present invention relates to a polypeptide comprising amino acid sequence SEQ ID NO:1 (ZNF471 ) or a homologous amino acid sequence, for use as a medicament, wherein the homologous amino acid sequence is defined as showing at least 80% identity with respect to SEQ ID NO:1 , while keeping the property of decreasing the hepatic expression of all four CETP. Pltp, Abcgl and Lpl genes when administered to a mammal subject.

In a second aspect, the present invention relates to a nucleid acid encoding the polypeptide defined herein, or an expression vector comprising the said nucleic acid for use as a medicament.

Preferably, the vector for use according to the invention is selected from the group consisting of a lentivirus, HIV, SIV, FIV, EAIV, CIV, alphavirus, adenovirus, adeno associated virus, baculovirus, HSV, coronavirus, Bovine papilloma virus, and o-MLV.

In a third aspect, the present invention relates to the polypeptide, acid nucleic, or vector of the invention for use in treating a dyslipidemia or a disease associated with dyslipidemia.

Preferably, the disease associated with dyslipidemia is a cardiovascular disease.

In a fourth aspect, the present invention relates to an agent for use in treating dyslipidemia or a disease associated with dyslipidemia in a subject, wherein said agent decreases the hepatic expression of all four CETP, Pltp, Abcgl and Lpl genes.

Preferably, the agent for use according to the invention increases methylation of human CETP, more preferably it increases methylation of human CETP at CpG#1 (cg09889350), CpG#2 (cg12564453), CpG#3 (cg16660091 ) or/and CpG#4 (cg26624021 ) site(s).

In a preferred embodiment, the agent for use according to the present invention is a polypeptide.

In a fifth aspect, the invention relates to diagnostic methods based on detecting alterations of the ZNF471 gene locus.

In an embodiment, it is provided an in vitro method for determining the likelihood for a subject to respond to a treatment with a CETP inhibitor, which method comprises identifying, in a biological sample of the subject, the presence of an alteration in the genetic sequence of the ZNF471 gene locus or in the ZNF471 expression or ZNF471 protein activity, wherein the presence of the said alteration is indicative of a subject being likely to respond to the treatment.

In another embodiment, it is also provided an in vitro method for determining or adjusting the dosage or regimen of a CETP inhibitor in treating a subject afflicted with a dyslipidemia or a disease associated with dyslipidemia, which method comprises identifying, in a biological sample of the subject, the presence of an alteration in the genetic sequence of the Z F471 gene locus or in the ZNF471 expression or ZNF471 protein activity, wherein a patient for whom an alteration in the genetic sequence of the ZNF471 gene locus or in the ZNF471 expression or ZNF471 protein activity is identified requires a higher dosage of the CETP inhibitor than a patient for whom such alteration is not detected.

Legends to the Figures

Figure 1 shows that the ZNF471 nSNP (rs62123030) is associated with whole blood DNA methylation levels at CETP CpG#1 (cg09889350) site in the MARTHA (Figure 1 A) and ECTIM (Figure 1 B) studies. In the ECTIM study, association was performed on normalized values adjusting for age and case-control status. Only males were studied.

Figure 2 shows that the CETP CpG#1 (cg09889350) level is associated with arterial thrombosis (A) and smoking (B) in the ECTIM study.

Figures 3A to 3C show that the expression of an expression vector coding for ZNF471 (hZNF471 ) in ApoB/CETP mice results in a reduction of plasma circulating cholesterol levels, an increase in circulating HDL-C levels and an increase in capacity of serum to promote macrophage cholesterol efflux 7 days following the injection. Figures 3A and 3B respectively represent total cholesterol plasma level and HDL-C plasma level (mg/dl) 7 days following the injection. Figure 3C is a graph showing capacity of serum to promote macrophage cholesterol efflux.

Figures 4A to 4C show that the expression of an expression vector coding for ZNF471 (hZNF471 ) in ApoB/CETP mice results in an increased methylation at CETP CpG#4 (cg26624021 ) site, a decreased hepatic CETP expression and activity in mice expressing ZNF471 7 days following the injection. Figure 4A shows hepatic expression following retro- orbitally injection of ApoB/CETP mice with hZNF471 or a control vector (Ctrl). Figure 4B is a graph showing analysis of CETP#4 promoter CpG site methylation by bisulfite conversion. In mice, the expression of hZNF471 increased the methylation of a CETP CpG site which is distinct from the 3 CETP CpG sites identified in MARTHA. Figure 4C is a graph showing a quantification of hepatic CETP mRNA levels (C,□), and measurement of plasma CETP activity (C, ·) 7 days following the injection.

Figures 5 A, 5B and 5C show that the expression of an expression vector coding for ZNF471 (hZNF471 ) in ApoB/CETP mice results in a decrease hepatic expression of Lpl, Pltp, and Abcgl genes.

Detailed description of the invention:

The inventors herein demonstrated that ZNF471 is involved in lipoprotein metabolism. As shown in the Examples, this transcription factor is able to increase HDL-C plasma levels and to decrease total cholesterol plasma levels. The inventors further found that the ZNF471 transcription factor was able to increase HDL-mediated marcrophage cholesterol efflux. ZNF471 transcription factor shows a strong impact on circulating cholesterol levels and is thus particularly advantageous for use as a medicament, especially useful in treating or preventing a dysiipidemia or a disease associated with dysiipidemia.

Definitions

Within the context of this invention, the term "dysiipidemia" refers to abnormal lipid or lipoprotein plasma levels (i.e. concentrations) which reflect one or several disorders in lipoprotein metabolism. Preferably, the term "dysiipidemia" includes, but is not limited to a condition in which at least one blood lipid or lipoprotein level in the blood deviate from a reference interval, wherein the blood lipid is selected from triglyceride (TG), total cholesterol (TC), VLDL cholesterol (VLDL-C), LDL cholesterol (LDL-C), or HDL cholesterol (HDL-C). Reference intervals are generally derived from the values measured within a sample of healthy individuals, not known to be at increased risk of disease. Sometimes, the determination of these reference intervals is also associated with a low, medium or high risk of cardiovascular disease. As blood lipids levels may be affected in a population by a number of factors such as age, sex, diet, socio-economic status, reference intervals obtained for one population may not be completely applicable to another one. Expert panels from western and eastern countries including National Cholesterol Education Programme (NCEP) of the United States of America have released reference intervals for their population. Reference intervals from NCEP Third Report of the Expert Panel on Detection, Evaluation, and Treatment of High Blood Cholesterol in Adults (Adult Treatment Panel III, or ATP III) are shown in Table 1.

Near Optimal 100-129 mg/dL

2,6-3,3 mmol/L

Borderline high 130-159 mg/dL

3,4-4, 1 mmol/L

High 160-189 mg/dL

4, 1-4,9 mmol/L

Very high 190 mg/dL or higher

4,9 mmol/L or higher

VLDL-cholesterol Optimal 30 mg/dL or less

0,78 mmol/L or less

Triglycerides Normal (desirable) <150 mg/dL

<1 ,7 mmol/L

Borderline high 150-199 mg/dL

1 ,7-2,3 mmol/L

High 200-499 mg/dL

2,3-5,6 mmol/L

Table 1 - NCEP ATPIII reference intervals

For instance, the term "Hyperlipidemia" refers to a class of dyslipidemia characterized by an abnormally high level of lipid or lipoprotein in the blood. Hyperlipidemia can be subdivised according to which type of blood lipid or lipoprotein level is abnormally elevated. Most common hyperlipidemia are hypercholesterolemia (i.e. presence of high levels of cholesterol in the blood), hypertriglyceridemia (i.e. presence of high levels of triglycerides in the blood) or combined hyperlipidemia (i.e. presence of high LDL and TG levels, often accompanied by decreased HDL). Following NCEP ATP III, hypercholesterolemia and hypertriglyceridemia may be respectively defined as conditions wherein the total cholesterol level exceeds 240 mg/dL or triglyceride levels exceed 200 mg/dL. The term " ypo-HDL-emia" or "Low HDL Cholesterol" refers to dyslipidemia characterized by an abnormally low level of HDL-C in the blood. A low HDL cholesterol level is thought to accelerate the development of atherosclerosis. Following NCEP ATP III, hypo-HDL-emia may be defined as a condition wherein the HDL-C is less than 40 mg/dL.

Another way to analyze the dyslipidemia profile of a patient is to classify it as either familial (i.e. caused by genetic abnormalities) or acquired dyslipidemia. Familial dyslipedmia are classified according to the Fredrickson classification. This widely accepted classification is based on the pattern of lipoproteins on electrophoresis or ultracentrifugation (Frederickson & Lee, 1965, Circulation 31 : 321 -7). This classification does not directly account for HDL. The Fredrickson classification includes 8 phenotypes (i.e., la, lb, lc, lla, lib, III, IV and V) as shown in Table 2. Hyperlipidemia Synonym Defect Increased lipoprotein

Type la Buerger-Gruetz syndrome or Decreased LPL Chylomicrons familial hyperchylomicronemia

Type lb Familial apoprotein Cll Altered ApoC2 Chylomicrons deficiency

Type lc LPL inhibitor in blood Chylomicrons

Type lla Familial hypercholesterolemia LDL receptor deficiency LDL

Type lib Familial combined Decreased LDL receptor and LDL and

hyperlipidemia increased ApoB VLDL

Type III Familial dysbetalipoproteinemia Defect in Apo E 2 synthesis IDL

Type IV Familial hypertriglyceridemia Increased VLDL production VLDL

and decreased elimination

Type V Increased VLDL production VLDL and and decreased LPL chybmicrons

Table 2 - Frederickson classification of dysiipidemia.

Within the context of the invention, the term "secondary dysiipidemia^'' is used to describe a dysiipidemia that follows and results from an earlier disease that is not due to a disorder of lipid metabolism. In an embodiment, the secondary dysiipidemia is secondary to an autominue disease such as Crohn disease or Lupus. In another embodiment, the secondary dysiipidemia is secondary to an inflammatory disease such as sepsis or rheumatoid arthritis.

Within the context of the invention, the term "disease associated with dysiipidemia" refers to any disease or disorder associated with an abnormal lipid profile component. Preferably, diseases associated with dysiipidemia include, but are not limited to, cardiovascular diseases. "Cardiovascular disease" (CVD) or "cardiovascular disorder" are terms used to classify numerous conditions affecting the heart, heart valves, and vasculature (e.g., arteries and veins) of the body and encompasses diseases and conditions including, but not limited to arteriosclerosis, atherosclerosis, myocardial infarction, acute coronary syndrome, primary hypertension, stroke, transient ischemic attack, coronary heart disease (CHD), peripheral vascular disease, coronary artery disease (CAD), peripheral artery disease (PAD). As used herein, the term "atherosclerotic cardiovascular disease" or "disorder" refers to a subset of cardiovascular diseases that include atherosclerosis as a component or precursor to the particular type of cardiovascular disease and includes, without limitation, CHD, CAD, and PAD. Atherosclerosis is a chronic inflammatory response that occurs in the walls of arterial blood vessels. It involves the formation of atheromatous plaques that can lead to narrowing ("stenosis") of the artery, and can eventually lead to partial or complete closure of the arterial opening and/or plaque ruptures. Thus atherosclerotic diseases or disorders include the consequences of atheromatous plaque formation and rupture including, without limitation, stenosis or narrowing of arteries, heart failure, aneurysm formation including aortic aneurysm, aortic dissection, and ischemic events such as myocardial infarction and stroke.

Within the context of this invention, the term "treatment", "treat" or "treating" refers to any act intended to ameliorate the health status of patients such as therapy, prevention, prophylaxis and retardation of the disease. In certain embodiments, such term refers to the amelioration or eradication of a disease or symptoms associated with a disease. In a particular embodiment, such term refers to the prevention of diseases associated with dyslipidemia, such as CVD. In other embodiments, this term refers to minimizing the spread or worsening of the disease resulting from the administration of one or more therapeutic agents to a subject with such a disease.

Within the context of this invention, the term "subject" or "patient" refers to an animal preferably to a mammal, even more preferably to a human. The patient may be affected with dyslipidemia or a disease associated with dyslipidemia. In an embodiment, dyslipidemia is a secondary dyslipidemia.

Within the context of this invention, the terms "peptide", "oligopeptide", "polypeptide" and "protein" are employed interchangeably and refer to a chain of amino acids linked by peptide bonds, regardless of the number of amino acids forming said chain.

Within the context of this invention, the term "sequence identity" or "identity" refers to the number (%) of matches (identical amino acid residues) in positions from an alignment of two polypeptide sequences. The sequence identity is determined by comparing the sequences when aligned so as to maximize overlap and identity while minimizing sequence gaps. In particular, sequence identity may be determined using any of a number of mathematical global or local alignment algorithms, depending on the length of the two sequences. Sequences of similar lengths are preferably aligned using a global alignment algorithms (e.g. Needleman and Wunsch algorithm; Needleman et Wunsch, 1970, J. Mol. Biol., 48, 443-453) which aligns the sequences optimally over the entire length, while sequences of substantially different lengths are preferably aligned using a local alignment algorithm (e.g. Smith and Waterman algorithm (Smith and Waterman. Comparison of biosequences, Adv. Appl. Math 2 : 482, 1981 .) or Altschul algorithm (Altschul et al., Nucleic Acids Res., vol. 25, 1997, pages 3389). Alignment for purposes of determining percent amino acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software available on internet web sites such as http:blast.ncbi.nlm.nih.gov/ or http://www.ebi.ac.uk/Tools/emboss/). Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. Preferably, for purposes herein, % amino acid sequence identity values refer to values generated using the pair wise sequence alignment program EMBOSS Needle that creates an optimal global alignment of two sequences using the Needleman-Wunsch algorithm, wherein all search parameters are set to default values, i.e. Scoring matrix = BLOSUM62, Gap open = 10, Gap extend = 0.5, End gap penalty = false, End gap open = 10 and End gap extend = 0.5.

Within the context of this invention, the term "responder, "responsive to a treatment^'' or "patient positive response to a treatment" refers to a subject in whom the onset of at least one of the symptoms is delayed or prevented, upon or after treatment, or whose symptoms or at least one of the symptoms stabilize, diminish or disappear.

Within the context of this invention, the term "CETP inhibitor" refers to a class of drugs designed to decrease cholesterylester transfer protein (CETP) activity and/or expression. Such drugs are generally intended to treat and/or prevent dyslipidemia and diseases associated with dyslipidemia such as cardiovascular disease. The CETP inhibitor may be any natural or synthetic substance such as a small molecule or a polymer. In a particular embodiment, the CETP inhibitor may be a polypeptide, a nucleic acid, or a vector as described herein. In an embodiment, the CETP inhibitor is a small molecule selected from a list comprising anacetrapib, obicetrapib, torcetrapib, dalcetrapib, evacetrapib.

Within the context of this invention, "the ZNF471 gene locus" designates all sequences or products in a cell or organism, including ZNF471 coding sequences, ZNF471 non-coding sequences (e.g., introns), ZNF471 regulatory sequences controlling transcription and/or translation (e.g., promoter, enhancer, terminator, etc.), all corresponding expression products, such as ZNF471 RNAs (e.g., mRNAs) and ZNF471 polypeptides (e.g., a preprotein and a mature protein): as well as surrounding sequences of 20 kb region, preferably 15 kb region, more preferably 10 kb region, even more preferably 6 kb region upstream the starting codon of the ZNF471 gene and 20 kb region, preferably 15 kb region, more preferably 10 kb, even more preferably 5 kb downstream the untranslated region (3^'UTR) of the ZNF471 gene.

Within the context of the invention, "Linkage disequilibrium" (LD) is defined as the non- random association of alleles at different loci across the genome. Alleles at two or more loci are in LD if their combination occurs more or less frequently than expected by chance in the population. When there is a causal locus in a DNA region, due to LD, one or more SNPs nearby are likely associated with the trait too. Therefore, any SNPs in strong LD (yielding a r²>0.8) with a first SNP associated with a DNA methylation at the CETP locus will be associated with this trait. Identification of additional SNPs in linkage disequilibrium with a given SNP involves: (a) amplifying a fragment from the genomic region comprising or surrounding a first SNP from a plurality of individuals; (b) identifying of second SNPs in the genomic region harboring or surrounding said first SNP; (c) conducting a linkage disequilibrium analysis between said first SNP and second SNPs; and (d) selecting said second SNPs as being in linkage disequilibrium with said first marker. Subcombinations comprising steps (b) and (c) are also contemplated. Methods to identify SNPs and to conduct linkage disequilibrium analysis can be carried out by the skilled person without undue experimentation by using well-known methods. It is well known that many SNPs have alleles that show strong LD with other nearby SNP alleles and in regions of the genome with strong LD, a selection of evenly spaced SNPs, or those chosen on the basis of their LD with other SNPs (proxy SNPs or Tag SNPs), can capture most of the genetic information of SNPs, which are not genotyped with only slight loss of statistical power. In association studies, this region of LD is adequately covered using few SNPs (Tag SNPs) and a statistical association between a SNP and the phenotype under study means that the SNP is a causal variant or is in LD with a causal variant. The two metrics most commonly used to measure LD are D' and r² and can be written in terms of each other and allele frequencies. It is a general consensus that a proxy (or Tag SNP) is defined as a SNP in LD (r² > 0.8) with one or more other SNPs. The genotype of the proxy SNP could predict the genotype of the other SNP via LD and inversely. In particular, any SNP in LD with one of the SNPs used herein may be replaced by one or more proxy SNPs defined according to their LD as r² > 0.8. These SNPs in linkage disequilibrium can also be used in the methods according to the present invention.

Within the context on the invention, a "CpG site" designates a CpG dinucleotide locus based on the actual or contextual sequence of nucleotides in which the CpG dinucleotide is located. Reliable identification of CpG sites distributed throughout the genome has been detailed in, for example, "CpG Loci Identification^'' Pub. No. 270- 2007-006 current as of 1 February 2008 edited by lllumina Inc (USA) (retrievable from https://www.illumina.com/Documents/products/technotes/technote_cpg_loci_identification.pdf ). Briefly, a CpG loci identifier is based on a sequence of 60 bases 5' and 3' to the CpG dinucleotide locus (ie. a total of 122 base sequences). A unique "CpG cluster number" or cg# identifier is assigned to this sequence of 122 bp which contains the CpG of interest. Within such a CpG cluster, three pieces of information are used to track the CpG locus: Chromosome number (CHR#), genomic coordinate and genome build. Since a CpG locus contains two nucleotides, there are two genomic coordinates for a given site: one for C and the other for G. The lesser of of the two coordinates is used as the coordinate of the Cpg locus. Table 3A shows 4 CpG sites located in the CETP gene that were associated with alterations in the ZNF471 gene locus. Table 3B shows additional CpG sites located in various genes. The cg# identifier, chromosome number, genome build, DNA strand (reverse (R) or forward (F)), gene identification (ID) and symbol on which the CpG dinucleotide is located are provided.

Table 3A - CpG locus associated with ZNF471 alterations

cg00222799 21 43655464 F NM_207628 ABCG1 cgO 1 176028 21 43653234 F NM_207628 ABCG1 cg02370100 21 43655256 R N __207628 ABCG1 cg05046272 21 43619510 R NM_207628 ABCG1 cg05639842 21 43639440 F NM_207628 ABCG1 cg06500161 21 43656587 F NM_207628 ABCG 1 cg07397296 21 43655316 R NM_207628 ABCG1 eg 1 1662315 21 43717310 R NM_207628 ABCG1 eg 14982472 21 43619651 F NM_207628 ABCG 1 cg20214535 21 43619310 R NM_207628 ABCG1 cg26768067 21 436391 19 F NM_207628 ABCG1 cg27243685 21 43642366 F NM__207628 ABCG1

Table 3B - Additional CpG locus associated with ZNF471 alterations (rs1 1667052)

Polypeptide

The ZNF471 finger protein is a protein belonging to the krueppel C?H?-type zinc-finger protein family that contains 15 C2H?-type zinc fingers and 1 KRAB domain. Zinc finger proteins are the largest transcription factor family in human genome. The diverse combinations and functions of zinc finger domains make zinc finger proteins versatile in biological processes, including development, differentiation, metabolism and autophagy. A zinc finger is a small, functional, independently folded domain that coordinates one or more zinc ions to stabilize its structure through cysteine and/or histidine residues. Zinc fingers are structurally diverse and exhibit a wide range of functions, from DNA- or RNA-binding to protein-protein interactions and membrane association. C2l-½-type zinc finger motif is the largest group of all zinc finger motif classes. C2H2-type zinc finger motif has two cysteine and two histidine residues fold into a finger-like structure of a two-stranded antiparallel β-sheet and an a-helix after interacting with zinc ions. The ZNF471 naturally occurring protein has an aminoacid sequence shown in NCBI, Genbank Reference Sequence: AAI25223.1 (SEQ ID NO: 1 ).

Accordingly, in a first aspect, the present invention relates to a polypeptide comprising amino acid sequence SEQ ID NO: 1 or an homologous amino acid sequence, for use as a medicament, wherein the homologous amino acid sequence is defined as showing at least 80% identity with respect to SEQ ID NO:1 , while keeping the property of decreasing the hepatic expression of all four CETP. Pltp, Abcgl and Lpl genes when administered to a mammal subject.

CETP, Lpl Pltp and Abcgl genes are involved in lipoprotein metabolism.

Cholesteryl ester transfer protein (CETP) gene encodes a transfer protein found in plasma, where it is involved in the transfer of cholesteryl ester from high density lipoprotein (HDL) to other lipoproteins.

Phospholipid transfer protein (Pltp) gene encodes a transfer protein which is secreted in circulation where it mediates the transfer of phospholipids from very low-density lipoprotein (VLDL) and LDL to HDL particles.

A TP-binding cassette transporter G1 (ABCG1) gene encodes a transmembrane regulator of cholesterol and phospholipid transport, which mediates cholesterol efflux from human macrophages to mature HDL particles. ABCG1 might then be involved in foam cell and atherosclerotic plaque formation.

Lipoprotein lipase (LPL) gene encodes lipoprotein lipase, which is expressed on endothelial cells in the heart, muscle, and adipose tissue. LPL functions as a homodimer, and has the dual functions of triglyceride hydrolase and ligand/bridging factor for receptor-mediated lipoprotein uptake. Through catalysis, VLDL is converted into IDL and then into LDL. The property of the polypeptide of the present invention to decrease the hepatic expression of all four CETP, Pltp, Abcgl and Lpl genes when administered to a mammal subject may be assessed by any method known by the skilled person. For instance, this activity may be assessed as described in the Examples.

Preferably, the polypeptide comprises, or consists of, an amino acid sequence having at least 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98 or 99% identity to SEQ ID NO: 1.

The present application also describes a polypeptide that comprises, or consists of, a sequence that differs from the sequence set forth in SEQ ID NO: 1 by 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19 or 20 substitutions, insertions and/or deletions of amino acid residues, preferably by 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14 or 15 substitutions, insertions and/or deletions of amino acid residues.

In another embodiment, the polypeptide comprises, or consists of a functional fragment of the polypeptide as defined above. As used herein, the term "functional fragment" refers to a fragment of the polypeptide as defined above, comprising at least 100, 150, 200, 250 or 300, 350, 400 contiguous amino acids of said polypeptide. In a particular embodiment, the term "functional fragment" refers to a fragment of the polypeptide having the amino acid sequence of SEQ ID NO: 1 , said fragment comprising at least 100, 150, 200, 250 or 300, 350, 400 contiguous amino acids of the amino acid sequence of SEQ ID NO: 1.

The N- and/or C-terminal ends of the polypeptide used in the present invention described herein may be optionally protected against proteolysis. For instance, the N-terminus may be in the form of an acetyl group, and/or the C-terminus may be in the form of an amide group. Internal modifications of the polypeptide to be resistant to proteolysis are also envisioned, e.g. wherein at least a -CONH- peptide bond is modified and replaced by a (CH2NH) reduced bond, a (NHCO) retro-inverso bond, a (CH2-O) methylene-oxy bond, a (CH2-S) thiomethylene bond, a (CH₂CH₂) carba bond, a (CO-CH₂) cetomethylene bond, a (CHOH-CH2) hydroxyethylene bond, a (N-N) bound, a E-alcene bond or also a -CH=CH-bond.

In another embodiment, the polypeptide may be modified by acetylation, acylation, amidation, crosslinking, cyclization, disulfide bond formation, formation of covalent cross-links, formation of cysteine, formation of pyroglutamate, formylation, gamma-carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristylation, oxidation, phosphorylation, and the like.

The polypeptides used according to the invention may comprise or be composed of amino acid(s) in D configuration, which render the peptides resistant to proteolysis. They may also be stabilized by intramolecular crosslinking, e.g. by modifying at least two amino acid residues with olefinic side chains, preferably Cs-Cs alkenyl chains, preferably penten-2-yl chains followed by chemical crosslinking of the chains, according to the so-called "staple" technology described in Walensky et al, 2014 (Walensky et al, Science, 2004, 305:1466-1470). For instance, amino acids at position i and i+4 to i+7 can be substituted by non-natural aminoacids that show reactive olefinic residues. All these proteolysis-resistant chemically-modified polypeptides are encompassed in the present invention.

The polypeptide used in the present invention may also be covalently bound to a polyethylene glycol (PEG) molecule by their C-terminal terminus or a lysine residue, notably a PEG of 1500 or 4000 MW, for a decrease in urinary clearance and in therapeutic doses used and for an increase of the ha If- life in blood plasma. Polypeptide half-life may also be increased by including the polypeptide in a biodegradable and biocompatible polymer material for drug delivery system forming microspheres. Polymers and copolymers are, for instance, poly(D,L- lactide-co-glycolide) (PLGA) (as illustrated in US2007/0184015, Hahn SK et al).

The polypeptide used in the present invention may be obtained by recombinant techniques known to those skilled in the art. In this case, a nucleic acid and/or a genetic construct comprising, or consisting of, a nucleotide sequence encoding the polypeptide of the invention may be expressed in a host cell and the polypeptide may be extracted from these host cells or from the culture medium.

The polypeptide used in the present invention can also be synthesized using standard synthetic methods known to those skilled in the art, for example chemical synthesis or enzymatic synthesis. Examples of chemical synthesis technologies are solid phase synthesis and liquid phase.

Nucleic acid

The present invention also relates to a nucleic acid encoding a polypeptide of the invention. The nucleic acid can be DNA (cDNA or gDNA), RNA, or a mixture of the two. It can be in single stranded form or in duplex form or a mixture of the two. It can comprise modified nucleotides, comprising for example a modified bond, a modified purine or pyrimidine base, or a modified sugar. It can be prepared by any method known to one skilled in the art, including chemical synthesis, recombination, and mutagenesis. The nucleic acid according to the invention may be deduced from the sequence of the polypeptide according to the invention and codon usage may be adapted according to the host cell in which the nucleic acid shall be transcribed. These steps may be carried out according to methods well known to one of skill in the art and some of which are described in the reference manual Sambrook et al. (Sambrook J, Russell D (2001 ) Molecular cloning: a laboratory manual, Third Edition Cold Spring Harbor).

In an embodiment, the nucleic acid that encodes the ZNF471 polypeptide comprises or consists of SEQ ID NO 2.

In a embodiment, the nucleic acid comprises, or consists of, a nucleotide sequence having at least 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98 or 99% identity to SEQ ID NO: 2.

In an embodiment, the nucleic acid is a variant of the nucleic acid of SEQ ID NO:2. The variants include, for instance, naturally-occurring variants due to allelic variations between individuals (e.g., polymorphisms), alternative splicing forms, etc. The term variant also includes ZNF471 gene sequences from other sources or organisms. Variants are preferably substantially homologous to SEQ ID NO:2, i.e., exhibit a nucleotide sequence identity of typically at least about 75%, preferably at least about 85%, more preferably at least about 90%, more preferably at least about 95% with SEQ ID NO:2.

Vector

The present invention also relates to a vector for use as a medicament, wherein the vector comprises a nucleic acid as described above. The term "vector" refers to a vehicle or other mechanism by which nucleic acid delivery can be accomplished. In certain embodiments, gene delivery or nucleic acid delivery can be achieved by a number of mechanisms including, for example, vectors derived from viral and non-viral sources, cation complexes, nanoparticles, liposomes, and the like.

In a preferred embodiment, the nucleic acid is carried by an expression vector.

As used herein, the term "expression vector" refers to the nucleic acid encoding the peptide of the invention encompassed in a genetic construct, i.e. an expression cassette, further comprising regulatory sequences (such as a suitable promoter(s), enhancer(s), terminator(s), etc.) allowing the expression (e.g. transcription and translation) of the encoded polypeptide (the polypeptide used in the present invention) in a host cell. The expression vector may be DNA or RNA, preferably cDNA, and is preferably double-stranded DNA. The expression vector may be in a form suitable for transformation of the intended host cell or host organism, in a form suitable for integration into the genomic DNA of the intended host cell or in a form suitable for independent replication, maintenance and/or inheritance in the intended host organism. Preferably, the expression vector comprises a promoter able to drive the expression of the peptide within the cells. Many viral promoters are appropriate for use in such an expression vector (e.g., retroviral ITRs, LTRs, immediate early viral promoters (lEp) (such as herpes virus lEp (e.g., ICP4-IEp and ICPO-IEp) and cytomegalovirus (CMV) lEp), and other viral promoters (e.g., late viral promoters, latency-active promoters (LAPs), Rous Sarcoma Virus (RSV) promoters, and Murine Leukemia Virus (MLV) promoters). Other suitable promoters are eukaryotic promoters, which contain enhancer sequences, constitutively active promoters, signal and/or tissue specific promoters, inducible and/or repressible promoters, etc.

In a preferred but non-limiting aspect, the expression vector comprises i) nucleic acid(s) encoding the polypeptide used in the present invention operably connected to ii) one or more regulatory elements, such as a promoter and optionally a suitable terminator; and optionally also iii) one or more further elements of genetic constructs such as 3'- or 5'-UTR sequences, leader sequences, selection markers, expression markers/reporter genes, and/or elements that may facilitate or increase (the efficiency of) transformation or integration.

Any suitable expression vector can be so employed. For instance, the vector may be a naked DNA vector (such as oligonucleotide or plasmid), cosmid, YAC, a viral vector or a transposon.

A preferred vector for delivering the nucleic acid is a viral vector, such as a retroviral vector, for example a lentiviral vector, or a non-pathogenic viral vector.

Viruses useful as vectors include papovavirus, adenovirus, vaccinia virus, adeno-associated virus, herpesvirus, and retroviruses. Suitable retrovirases include the group consisting of HIV, SIV, FIV, EIAV, MoMLV. A further group of suitable retrovirases includes the group consisting of HIV, SIV, FIV, EAIV, CIV. Another group of preferred virus vectors includes the group consisting of alphaviras, adenoviras, adeno associated virus, baculoviras, HSV, coronavirus, Bovine papilloma virus, Mo- LV, preferably adeno associated virus.

In a preferred embodiment, the viral vector is an adeno-associated virus (AAV) vector.

AAV viruses are double-stranded DNA viruses that have already been approved for human use in gene therapy. Actually 12 different AAV serotypes (AAV1 to 12) are known, each with different tissue tropisms (Wu, Z ol Ther 2006; 14:316-27). Recombinant AAV are derived from the dependent parvovirus AAV2 (Choi, VW J Virol 2005; 79:6801 -07). The adeno- associated virus type 1 to 12 can be engineered to be replication deficient and is capable of infecting a wide range of cell types and species (Wu, Z Mol Ther 2006; 14:316-27). Among the favorable properties of the virus are its lack of association with any human disease, its ability to infect both dividing and non-dividing cells, and the wide range of cell lines derived from different tissues that can be infected.

The term "AAV vector" refers to a polynucleotide vector comprising one or more heterologous sequences (i.e., nucleic acid sequence not of AAV origin, e.g. a sequence encoding the polypeptide used in the present invention) that are flanked by at least one AAV inverted terminal repeat sequence (ITR), preferably two ITRs. Such AAV vectors can be replicated and packaged into infectious viral particles when present in a host cell that has been infected with a suitable helper virus (or that is expressing suitable helper functions) and that is expressing AAV rep and cap gene products (i.e. AAV Rep and Cap polypeptides). An "inverted terminal repeat" or "ITR" sequence is a term well understood in the art and refers to relatively short sequences found at the termini of viral genomes which are in opposite orientation. An "AAV inverted terminal repeat (ITR)" sequence is an approximately 145-nucleotide sequence that is present at both termini of the native single-stranded AAV genome. The outermost 125 nucleotides of the ITR can be present in either of two alternative orientations, leading to heterogeneity between different AAV genomes and between the two ends of a single AAV genome. The outermost 125 nucleotides also contains several shorter regions of self- complementarity (designated A, A', B, B', C, C and D regions), allowing intra-strand base- pairing to occur within this portion of the ITR. AAV ITRs may have a wild-type nucleotide sequence or may be altered by the insertion, deletion or substitution. The serotype of the inverted terminal repeats (ITRs) of the AAV vector may be selected from any known human or nonhuman AAV serotype.

The viral vector may be packaged into a virus capsid to generate a "viral particle".

In particular, the vector may be an AAV vector packaged into an AAV-derived capsid to generate an "adeno-associated viral particle" or "AAV particle" composed of at least one AAV capsid polypeptide and an encapsidated AAV vector genome. The capsid serotype determines the tropism range of the AAV particle. Multiple serotypes of adeno-associated virus (AAV), including 12 human serotypes and more than 100 serotypes from nonhuman primates have now been identified (Howarth al., 2010, Cell Biol Toxicol 26: 1 -10). Among these serotypes, human serotype 2 was the first AAV developed as a gene transfer vector. Other currently used AAV serotypes include, but are not limited to, AAV1 , AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAV9, AAV10, AAVrhI O, AAV1 1 , AAV12, AAVrh74 and AAVdj.

Agent decreasing the expression of all four CETP, Pltp, Abcg1 and Lpl genes.

In another aspect, the present invention relates to an agent for use in treating dyslipidemia or a disease associated with dyslipidemia in a subject, wherein said agent decreases the expression, preferably the hepatic expression, of all four CETP, Pltp, Abcgl and Lpl genes.

Preferably, the agent for use according to the invention increases methylation of human CETP.

More preferably, the agent increases methylation of human CETP at CpG#1 (cg09889350),

CpG#2 (cg12564453), CpG#3 (cg16660091 ) or/and CpG#4 (cg26624021 ) site(s). CpG cg09889350, cg12564453, cg16660091 and cg26624021 sites are known and described in

Table 3 A. The agent may be any natural or synthetic substance such a small molecule or a polymer. More preferably, the agent for use according to the present invention is a polypeptide.

Therapeutic methods and use

It is herein provided a method for treating a dyslipidemia or a disease associated with dyslipidemia in a patient, which method comprises administering a therapeutically effective amount of the polypeptide, acid nucleic, vector or CETP inhibitor agent as described above. The dyslipidemia may be a secondary dyslipidemia.

According to an embodiment, the polypeptide, nucleic acid, vector or agent is useful for the prevention and/or treatment of a dyslipidemia. Preferably, the dyslipidemia is a dyslipidemia wherein the plasma TC, HDL-C, LDL-C, VLDL-C, or TG level deviates from the desirable levels set by the NCEP ATPIII.

According to an embodiment, the polypeptide, the polynucleotide, or the vector is useful for the prevention and/or treatment of a hyperlipidemia, preferably selected from hypercholesterolemia and hypertriglyceridemia.

According to an embodiment, the polypeptide, nucleic acid, vector or agent is useful for the prevention and/or treatment of a hypo-HDL-emia.

In a preferred embodiment, the polypeptide, nucleic acid, vector or agent is useful for the prevention and/or treatment of hypercholesterolemia associated with hypo-HDL-emia. According to an embodiment, the polypeptide, nucleic acid, vector or agent is useful for the prevention and/or treatment of a familial dyslipidemia, preferably a familial dyslipidemia selected from the list comprising Type la, Type lb, Type lc, Type lla, Type lib, Type III, Type IV or Type V familial dyslipidemia.

According to an embodiment, the polypeptide, nucleic acid, vector or agent is useful for the prevention and/or treatment of a disease associated with a dyslipidemia such as a cardiovascular disease, preferably an atherosclerotic cardiovascular disease.

According to an embodiment, the polypeptide, nucleic acid, vector or agent is useful for the prevention and/or treatment of a secondary dyslipidemia.

Pharmaceutical compositions

In a further aspect, the present invention also provides a pharmaceutical composition comprising a polypeptide, or a nucleic acid, vector or viral particle as described above and encoding said polypeptide, and a pharmaceutically acceptable excipient.

As used herein, the term "pharmaceutically acceptable" means approved by a regulatory agency or recognized pharmacopeia such as European Pharmacopeia, for use in animals and/or humans. The term "excipient" refers to a diluent, adjuvant, carrier, or vehicle with which the therapeutic agent is administered. As is well known in the art, pharmaceutically acceptable excipients are relatively inert substances that facilitate administration of a pharmacologically effective substance and can be supplied as liquid solutions or suspensions, as emulsions, or as solid forms suitable for dissolution or suspension in liquid prior to use. For example, an excipient can give form or consistency, or act as a diluent. Suitable excipients include but are not limited to stabilizing agents, wetting and emulsifying agents, salts for varying osmolality, encapsulating agents, pH buffering substances, and buffers.

Preferably, the present invention relates to the pharmaceutical composition of the invention for use in treating dyslipidemia or a disease associated with dyslipidemia in a subject. Preferably, said the polypeptide, nucleic acid, vector or agent as described above decreases the hepatic expression of all four CETP, Pltp, Abcgl and Lpl genes.

When the pharmaceutical composition comprises a nucleic acid encoding a polypeptide used according to the present invention, the pharmaceutical composition may further contain a reagent for nucleic acid transfer in order to promote the transfer of the nucleic acid into a cell. Useful nucleic acid transfer reagents include cationic lipids such as lipofectin, lipofectamine, lipofectamine, invivofectamine. When a retrovirus is used as the expression vector, retronectin, fibronectin, polybrene and the like can be used as transfer reagents. The polypeptide, nucleic acid, vector or agent as described above may be administered by any suitable route. Possible pharmaceutical compositions include those suitable for oral or parenteral (including subcutaneous, intramuscular, intraspinal, intravenous and intradermal) administration. For these formulations, conventional excipient can be used according to techniques well known by those skilled in the art.

The compositions for parenteral administration are generally physiologically compatible sterile solutions or suspensions which can optionally be prepared immediately before use from solid or lyophilized form. Adjuvants such as a local anesthetic, preservative and buffering agents can be dissolved in the vehicle and a surfactant or wetting agent can be included in the composition to facilitate uniform distribution of the active ingredient.

For oral administration, the composition can be formulated into conventional oral dosage forms such as tablets, capsules, powders, granules and liquid preparations such as syrups, elixirs, and concentrated drops. Non toxic solid carriers or diluents may be used which include, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, talcum, cellulose, glucose, sucrose, magnesium, carbonate, and the like. For compressed tablets, binders, which are agents which impart cohesive qualities to powdered materials, are also necessary. For example, starch, gelatine, sugars such as lactose or dextrose, and natural or synthetic gums can be used as binders. Disintegrants are also necessary in the tablets to facilitate break-up of the tablet. Disintegrants include starches, clays, celluloses, algins, gums and crosslinked polymers. Moreover, lubricants and glidants are also included in the tablets to prevent adhesion to the tablet material to surfaces in the manufacturing process and to improve the flow characteristics of the powder material during manufacture. Colloidal silicon dioxide is most commonly used as a glidant and compounds such as talc or stearic acids are most commonly used as lubricants.

Vectors may be preferably delivered by a variety of parental, mucosal and topical routes. For example, a DNA plasmid can be injected by intramuscular, intradermal, subcutaneous, or other routes. It may also be administered by intranasal sprays or drops, rectal suppository and orally. It may also be administered into the epidermis or a mucosal surface using a gene-gun. The plasmids may be given in an aqueous solution, dried onto gold particles or in association with another DNA delivery system including but not limited to liposomes, dendrimers, cochleate and microencapsulation.

The dosage and regimen may be adjusted by the skilled person.

Diagnostic methods

Another purpose of the present invention is to provide diagnostic tools based on detecting alterations of the ZNF471 gene locus. According to the present invention, the ZNF471 gene locus Is herein identified as a locus which analysis can be informative with respect to a profile of response to a treatment with a CETP inhibitor. In other words, detecting an alteration in this locus can be useful to predict the response to a CETP inhibitor treatment in a patient suffering from a dyslipidemia or a disease associated with dyslipidemia. In another embodiment, detecting alterations in the ZNF471 gene locus may also be informative to adjust a CETP inhibitor treatment regimen in a patient.

The inventors more particularly found that alterations in the genetic sequence of the ZNF471 gene locus are associated with DNA methylation of at least three sites of the CETP locus. Without willing to be bound by any mechanism, it is proposed that some alterations in the ZNF471 gene locus modulates CETP expression and that, in this regard, assessing the presence (or absence) of these alterations in the ZNF471 gene locus can be used to predict levels of CETP expression and/or activity. Such information can be used to stratify the likelihood of a subject to respond to a CETP inhibitor. As an illustration, the inventors found that the most common allele at polymorphic site rs62123030 G was associated with increased DNA methylation at the CETP locus when compared to second most common allele rs62123030 C. Therefore, a subject carrying rs62123030 C is more likely to respond to a CETP inhibitor than a subject carrying rs62123030 G.

According to the invention, identifying an alteration of the Z F471 gene locus is useful as a biomarker for assessing the response of a subject to a CETP inhibitor treatment and/or setting a suitable dosing regimen of CETP inhibitor for a patient affected with dyslipidemia.

In an embodiment, it is provided an in vitro method for determining the likelihood for a subject to respond to a treatment with a CETP inhibitor, which method comprises identifying, in a biological sample of the subject, the presence of an alteration in the genetic sequence of the ZNF471 gene locus or in the ZNF471 expression or ZNF471 protein activity, wherein the presence of the alteration is indicative of a subject being likely to respond to the treatment (i.e. the absence of such alteration being indicative of a subject being likely not to respond to the treatment).

In another embodiment, it is provided an in vitro method for setting a CETP inhibitor dosing regimen for a subject, which method comprises identifying, in a biological sample of the subject, the presence of an alteration in the genetic sequence of the ZNF471 gene locus or in the ZNF471 expression or ZNF471 protein activity, and setting the suitable dosing regimen so as a maximal dose is selected if the subject presents the alteration and a reduced dose is selected if the subject does not present the alteration.

Preferably, the subject is affected with dyslipidemia or a disease associated with dyslipidemia. Alterations

The alteration may be determined at the level of the ZNF471 DNA, NA or polypeptide. In an embodiment, the detection is performed by sequencing all or part of the ZNF471 gene locus or by selective hybridization or amplification of all or part of the ZNF471 gene locus. More preferably a ZNF471 gene locus specific amplification is carried out before the alteration identification step. An alteration in the ZNF471 gene locus may be any form of mutation(s), deletion(s), rearrangement(s) and/or insertions in the coding and/or non-coding region of the locus, alone or in various combination(s). Mutations more specifically include point mutations or single nucleotide polymorphisms (SNP). Deletions may encompass any region of two or more residues in a coding or non-coding portion of the gene locus, such as from two residues up to the entire gene or locus. Typical deletions affect smaller regions, such as domains (introns) or repeated sequences or fragments of less than about 50 consecutive base pairs, although larger deletions may occur as well. Insertions may encompass the addition of one or several residues in a coding or non-coding portion of the gene locus. Insertions may typically comprise an addition of between 1 and 50 base pairs in the gene locus. Rearrangement includes inversion of sequences. The gene locus alteration may result in the creation of stop codons, frameshift mutations, amino acid substitutions, particular RNA splicing or processing, product instability, truncated polypeptide production, etc. The alteration may result in the production of a polypeptide with altered function, stability, targeting or structure. The alteration may also cause a reduction in protein expression or, alternatively, an increase in said production. In a preferred embodiment, said alteration is a mutation, an insertion or a deletion of one or more bases. The alteration may also cause a reduction in protein expression or, alternatively, an increase in said production.

In a preferred embodiment, said alteration is a mutation, an insertion or a deletion of one or more bases. In a particular embodiment of the method according to the present invention, the alteration in the ZNF471 gene locus is selected from a point mutation, a deletion and an insertion in the ZNF471 gene or corresponding expression product, more preferably a point mutation and a deletion.

In a more preferred embodiment, said alteration is one or several single nucleotide polymorphism (SNP).

In a preferred embodiment, said alteration is SNP rs62123030 or any SNP in linkage desequlibrium yielding a r²>0.8 therewith. Preferably, the linkage disequilibrium yields a r²>0.90, 0.91 , 0.92, 0.93, 0.94, 0.95, 0.96, 0.97, 0.98, or 0.99. In a preferred embodiment, r²=1 (i.e. SNPs are in complete linkage disequilibrium). In a particular objet of the invention, the alteration is a SNP selected in the group consisting of rs35347939, rs1 1084452, rs66522479, rs16987295, rs12978999, rs12151254, rs12986047, rs61 144294, rs7245557, rs7250075, rs1 1671776, rs35664312, rs12151 151 , rs1 1667052, rs8109083, rs62123030, rs960997, rs3813141 , rs3813142, rs3813143, rs16987310, rs81 10306, rs 15507, rs1054409, rs4267437, rs34269477, rs77247784, rs145395393, rs76894169, rs62124070, rs36062917, rs35908973, rs2869891 , rs2215151 , rs2286422, rs917407, rs12981980. These SNPs are reported in the following Table 4.

Preferably, said SNP is rs62123030 or rs1 1667052.

In a most preferred embodiment, the alteration is the presence of the second most common allele at the SNP locus rs62123030 or the second most common allele of any SNP in linkage desequlibrium yielding a r²>0.8 (preferably r²>0.9) therewith.

For instance, the presence of a C allele with respect to SNP rs62123030, more particularly of a CC genotype, is indicative of a patient being likely to respond to the treatment. Preferably, the second most common allele genotype with respect to the said SNP(s) is a homozygote genotype.

Nucleotide position in r² D" SNP reference Most Second Sequence genomic sequence of common most reference chromosome 19 allele common

(hg38) allele

56529631 rs16987310 C T SEQ ID NO:23

56529834 rs81 10306 A T SEQ ID NO:24

56530015 ^{1 1} rs 15507 G A SEQ ID NO:25

56530153 rs 1054409 C T SEQ ID NO:26

56530878 0.99 rs4267437 C T SEQ ID NO:27

56531278 rs34269477 T c SEQ ID NO:28

56531489 rs77247784 A G SEQ ID NO:29

56531537 0.97 0.99 rs 145395393 C A SEQ ID NO:30

56531587 rs76894169 C A SEQ ID NO:31

56531683 rs62124070 G T SEQ ID NO:32

56531705 rs36062917 A G SEQ ID NO:33

56531902 rs35908973 A G SEQ ID NO:34

56531935 rs2869891 T G SEQ ID NO:35

56532612 rs2215151 G T SEQ ID NO:36

56536490 0.97 0.99 rs2286422 C T SEQ ID NO:37

56537025 0.99 0.99 rs917407 G A SEQ ID NO:38

56539279 0.88 0.95 rs12981980 G A SEQ ID NO:39

Table 4: SNPs in linkage disequilibrium yielding a r²>0,8 with rs62123030

As used herein, "common alleie" refers to the most frequent allele for a particular SNP locus.

As used herein, "second most common allele" refers to the minor allele in case of a biallelic variation or the second most frequent allele in presence of a muitiaiielic variant for a particular SNP locus.

In a preferred embodiment, the presence of a T allele with respect to rs35347939, a A allele with respect to rs1 1084452, a T allele with respect to rs66522479, a G allele with respect to rs16987295, a A allele with respect to rs12978999, a T allele with respect to rs12151254, a T allele with respect to rs12986047, a T alllele with respect to rs61 144294, a T allele with respect to rs7245557, a A allele with respect to rs7250075, a A allele with respect to rs1 1671776, a G allele with respect to rs35664312, a C allele with respect to rs12151 151 , a T allele with respect to rs1 1667052, a T allele with respect to rs8109083, a C allele with respect to rs62123030, a A allele with respect to rs960997, a T allele with respect to rs3813141 , a C allele with respect to rs3813142, a A allele with respect to rs3813143, a T allele with respect to rs16987310, a T allele with respect to rs81 10306, a A allele with respect to rs15507, a T allele with respect to rs1054409, a T allele with respect to rs4267437, a C allele with respect to rs34269477, a G allele with respect to rs77247784, a A allele with respect to rs145395393, a A allele with respect to rs76894169, a T allele with respect to rs62124070, a G allele with respect to rs36062917, a G allele with respect to rs35908973, a G allele with respect to rs2869891 , a T allele with respect to rs2215151 , a T allele with respect to rs2286422, a A allele with respect to rs917407, and/or A allele with respect to rs12981980, is indicative of a patient who is likely to respond to a treatment with a CETP inhibitor.

In a preferred embodiment, the presence of a CT or TT genotype with respect to rs35347939, a GA or AA genotype with respect to rs1 1084452, a GT or TT genotype with respect to rs66522479, a AG or GG genotype with respect to rs16987295, a CA or AA genotype with respect to rs12978999, a AT or TT genotype with respect to rs12151254, a TC or TT genotype with respect to rs12986047, a TG or TT genotype with respect to rs61 144294, a CT or TT genotype with respect to rs7245557, a TA or AA genotype with respect to rs7250075, a GA or AA genotype with respect to rs1 1671776, a AG or GG genotype with respect to rs35664312, a TC or CC genotype with respect to rs12151 151 , a GT or TT genotype with respect to rs1 1667052, a CT or TT genotype with respect to rs8109083, a GC or CC genotype with respect to rs62123030, a GA or AA genotype with respect to rs960997, a CT or TT genotype with respect to rs3813141 , a TC or CC genotype with respect to rs3813142, a GA or AA genotype with respect to rs3813143, a CT or TT genotype with respect to rs16987310, a AT or TT genotype with respect to rs81 10306, a GA or AA genotype with respect to rs15507, a CT or TT genotype with respect to rs1054409, a CT or TT genotype with respect to rs4267437, a TC or CC genotype with respect to rs34269477, a AG or GG genotype with respect to rs77247784, a CA or AA genotype with respect to rs145395393, a CA or AA genotype with respect to rs76894169, a GT or TT genotype with respect to rs62124070, a AG or GG genotype with respect to rs36062917, a AG or GG genotype with respect to rs35908973, a TG or GG genotype with respect to rs2869891 , a GT or TT genotype with respect to rs2215151 , a CT or TT genotype with respect to rs2286422, a GA or AA genotype with respect to rs917407, and/or a GA or AA genotype with respect to rs12981980, is indicative of a patient who is likely to respond to a treatment with a CETP inhibitor.

Biological sample

The biological sample may be any biological sample from a subject. Examples of such samples include fluids, tissues, cell samples, organs, biopsies, etc. Most preferred samples are blood, plasma, saliva, jugal cells, urine, seminal fluid, etc. The sample may be collected according to conventional techniques and used directly for diagnosis or stored. The sample may be treated prior to performing the method, in order to render or improve availability of nucleic acids or polypeptides for testing. Treatments include, for instant, lysis (e.g., mechanical, physical, chemical, etc.), centrifugation, etc. Also, the nucleic acids may be prepurified or enriched by conventional techniques, and/or reduced in complexity. Nucleic acids may also be treated with enzymes or other chemical or physical treatments to produce fragments thereof.

The sample is preferably contacted with reagents such as probes, or primers in order to assess the presence of an altered gene locus. Contacting may be performed in any suitable device, such as a plate, tube, well, glass, etc. In specific embodiments, the contacting is performed on a substrate coated with the reagent, such as a nucleic acid array. The substrate may be a solid or semi-solid substrate such as any support comprising glass, plastic, nylon, paper, metal, polymers and the like. The substrate may be of various forms and sizes, such as a slide, a membrane, a bead, a column, a gel, etc. The contacting may be made under any condition suitable for a complex to be formed between the reagent and the nucleic acids of the sample.

Detection of alterations

Alterations in the ZNF471 gene locus may be detected by determining the presence of an altered ZNF471 RNA expression. Altered RNA expression includes the presence of an altered RNA sequence, the presence of an altered RNA splicing or processing, the presence of an altered quantity of RNA, etc. These may be detected by various techniques known in the art, including by sequencing all or part of the ZNF471 RNA or by selective hybridisation or selective amplification of all or part of said RNA, for instance.

In a further variant, the method comprises detecting the presence of an altered ZNF471 polypeptide expression. Altered ZNF471 polypeptide expression includes the presence of an altered polypeptide sequence, the presence of an altered quantity of ZNF471 polypeptide, the presence of an altered tissue distribution, etc. These may be detected by various techniques known in the art, including by sequencing and/or binding to specific ligands (such as antibodies), for instance.

As indicated above, various techniques known in the art may be used to detect or quantify an altered ZNF471 gene locus or RNA expression or sequence, including sequencing, hybridisation, amplification and/or binding to specific ligands (such as antibodies). 5' exonuclease activity or TaqMan® assay (Applied Biosystems) is based on the 5' nuclease activity of Taq polymerase that displaces and cleaves the oligonucleotide probes hybridized to the target DNA generating a fluorescent signal. It is necessary to have two probes that differ at the polymorphic site wherein one probe is complementary to the 'normal' sequence and the other to the mutation of interest. These probes have different fluorescent dyes attached to the 5' end and a quencher attached to the 3' end when the probes are intact the quencher interacts with the fluorophor by fluorescence resonance energy transfer (FRET) to quench the fluorescence of the probe. During the PGR annealing step the hybridization probes hybridize to target DNA. In the extension step the 5' fluorescent dye is cleaved by the 5' nuclease activity of Taq polymerase, leading to an increase in fluorescence of the reporter dye. Mismatched probes are displaced without fragmentation. The presence of a mutation in a sample is determined by measuring the signal intensity of the two different dyes. Other suitable methods include allele-specific oligonucleotide (ASO), allele-specific amplification, Southern blot (for DNAs), Northern blot (for RNAs), single-stranded conformation analysis (SSCA), PFGE, fluorescent in situ hybridization (FISH), gel migration, clamped denaturing gel electrophoresis, heteroduplex analysis, RNase protection, chemical mismatch cleavage, ELISA, radioimmunoassays (RIA) and immuno-enzymatic assays (IEMA) or restriction enzyme digestion such as restriction fragment length polymorphism (RFLP) strategy . Some of these approaches (e.g., SSCA and CGGE) are based on a change in electrophoretic mobility of the nucleic acids, as a result of the presence of an altered sequence. According to these techniques, the altered sequence is visualized by a shift in mobility on gels. The fragments may then be sequenced to confirm the alteration. Some others are based on specific hybridization between nucleic acids from the subject and a probe specific for wild-type or altered ZNF471 gene or RNA. The probe may be in suspension or immobilized on a substrate. The probe is typically labelled to facilitate detection of hybrids. Some of these approaches are particularly suited for assessing a polypeptide sequence or expression level, such as Northern blot, ELISA and RIA. These latter require the use of a ligand specific for the polypeptide, more preferably of a specific antibody.

The presence of an alteration in the ZNF471 gene locus may be detected by sequencing, selective hybridisation and/or selective amplification.

Sequencing

Sequencing can be carried out using techniques well known in the art, using automatic sequencers. The sequencing may be performed on the complete genes or, more preferably, on specific domains thereof, typically those known or suspected to carry deleterious mutations or other alterations.

Amplification

Amplification is based on the formation of specific hybrids between complementary nucleic acid sequences that serve to initiate nucleic acid reproduction. Amplification may be performed according to various techniques known in the art, such as by polymerase chain reaction (PGR), ligase chain reaction (LCR), strand displacement amplification (SDA) and nucleic acid sequence based amplification (NASBA). These techniques can be performed using commercially available reagents and protocols. Preferred techniques use allele-specific PGR or PCR-SSCP. Amplification usually requires the use of specific nucleic acid primers, to initiate the reaction. Another particular object of this invention resides in a nucleic acid primer useful for amplifying sequences from the ZNF471 gene or locus including surrounding regions. Such primers are preferably complementary to, and hybridize specifically to nucleic acid sequences in the ZNF471 gene locus. Particular primers are able to specifically hybridize with a portion of the ZNF471 gene locus that flank a target region of said locus, said target region being altered in as explained above.

In this regard, particular primers of this invention are specific for altered sequences in a ZNF471 gene locus or RNA. By using such primers, the detection of an amplification product indicates the presence of an alteration in the ZNF471 gene locus. In contrast, the absence of amplification product indicates that the specific alteration is not present in the sample.

The invention also concerns the use of a nucleic acid primer or a pair of nucleic acid primers as described above in an in vitro method for determining the lilkelihood for a patient affected with a dyslipidemia to respond to a treatment with a CETP inhibitor.

Hybridization

Hybridization detection methods are based on the formation of specific hybrids between complementary nucleic acid sequences that serve to detect nucleic acid sequence alteration(s).

A particular detection technique involves the use of a nucleic acid probe specific for wild type or altered gene, followed by the detection of the presence of a hybrid. The probe may be in suspension or immobilized on a substrate or support (as in nucleic acid array or chips technologies). The probe is typically labelled to facilitate detection of hybrids.

In preferred particular embodiment, an alteration in the gene locus is determined by DNA chip analysis. Such DNA chip or nucleic acid microarray consists of different nucleic acid probes that are chemically attached to a substrate, which can be a microchip, a glass slide or a microsphere-sized bead. A microchip may be constituted of polymers, plastics, resins, polysaccharides, silica or silica-based materials, carbon, metals, inorganic glasses, or nitrocellulose. Probes comprise nucleic acids such as cDNAs or oligonucleotides that may be about 10 to about 60 base pairs. To determine the alteration of the genes, a sample from a test subject is labelled and contacted with the microarray in hybridization conditions, leading to the formation of complexes between target nucleic acids that are complementary to probe sequences attached to the microarray surface. The presence of labelled hybridized complexes is then detected.

The present invention will be better understood with reference to the following examples. These examples are intended to representative of specific embodiments of the invention, and are not intended as limiting the scope of the invention.

EXAMPLES Examples 1 -2

Experimental procedures

ECTIM Study population

ECTIM ("Etude Cas-Temoins sur I'lnfarctus du Myocarde") is a case-control study of myocardial infarc- tion (Ml) that was set up to investigate the large differences in CHD incidence and mortality between the French centers of Strasbourg, Toulouse, and Lille and the Northern Irish center in Belfast. The study population has been described previously (Parra et al. 1992. Arterioscler Thromb 12:701 -707). Patients with Ml were recruited between 1989 and 1991 from four World Health Organization Monitoring in Cardiovascular Diseases (MONICA) registers in Belfast (Northern Ireland, UK) and in Lille, Strasbourg, and Toulouse (France). Men aged 25-64 years who survived a definite Ml (MONICA category I) were recruited 3-9 months after the infarction (n =640). Age-matched controls (n =719) were randomly sampled from the populations covered by the MONICA registers.

MARTHA study population The MARseille Thrombosis Association (MARTHA) study included 1592 unrelated venous thromboembolism patients of French origin, recruited between January 1994 and October 2005 from the Thrombophilia Center of La Timone Hospital, Marseille, France. The study was designed to investigate venous thromboembolism and quantitative traits related - or potentially related - to venous thromboembolism. Recruitment occurred at least 3 months after the venous thromboembolism event, which was objectively diagnosed by venography, Doppler ultrasound, angiography and/or ventilation/perfusion lung scan. Study subjects were free of chronic conditions, as well as any well-characterized strong genetic risk factors for venous thromboembolism. Medical and personal histories were obtained from physician interviews.

RNA extraction, reverse-transcription and quantitative-PCR. Total RNA from liver or isolated hepatocytes were extracted using the NucleoSpin RNA II kit (Macherey-Nagel) according to the manufacturer's instructions. Reverse transcription and realtime qPCR using a LightCycler LC480 (Roche) were performed as previously described (Larrede et al. 2009. Arteriosclerosis, thrombosis, and vascular biology. 29:1930-1936). Expression of mRNA levels was normalized to mouse hypoxanthine phosphoribosyltransferase 1 (Hprtl ), mouse non-POU domain containing, octamer-binding housekeeping gene (Nono), mouse heat shock protein 90kDa alpha (cytosolic), class B member 1 (Hsp90ab1 ) and mouse cyclophilin A (CycA). Data were expressed as a fold change in mRNA expression relative to control values. DNA methylation analyses in the MARTHA study.

We measured genome-wide DNA methylation in whole blood samples of 350 individuals of the MARTHA study using the dedicated lllumina HumanMethylation450 array. A detailed description of the quality controls and the normalization procedures applied to the methylation array data has previously been published (Dick et al. Lancet. 2014;383:1990-1998). Briefly, bisulfite conversion was performed on 1 μg genomic DNA for each sample using the Qiagen EpiTect 96 Bisulfite Kit and 200 ng of bisulfite-converted DNA at 50 ng/μΙ was independently amplified, labeled and hybridized to Infinium HumanMethylation450 BeadChip microarrays. For each sample, the intensities of the methylated and unmethylated signals were measured at 485,577 CpG sites using the lllumina iScan (with default settings). Three CpG sites at the CETP locus were investigated in the present work: cg09889350, cg12564453 and cg1660091. DNA methylation levels were expressed as a β-value, a continuous variable over the [0-1 ] interval, representing the percentage of methylation of a given CpG site.

Association of ZNF471 genotypes with CETP CpG levels was tested using a linear regression analysis adjusted for age and sex. Correlation analyses between CETP CpG and lipids levels were investigated while adjusting for age, sex and cell type composition determined by specific biological counts of lymphocytes, monocytes, neutrophils, eosinophils and basophils.

DNA methylation analysis of CETP CpG sites in the ECTIM study.

Sodium bisulfite conversion was performed from 300 ng genomic DNA using EZ-96 DNA Methylation kit (ZymoResearch). From the resulting bisulfite DNA, a relative quantitative PCR was performed using 2 TaqMan MGB probes (Life Technologies) specific to methylated or unmethylated studied CpG and specific labelled with FAM or VIC reporter. The primers and probes design was performed with Primer Express software from the bisulfite converted DNA sequence. The primers and probes were chosen with no CpG island in there sequence, except the one to study. The sequences of the probes and primers were : For CQ09889350 :

probe SEQ ID NO: 40 C ^5' AGTTTTATGTTTCGTG^3'(FAM)

probe SEQ ID NO: 41 T ^5' AGTTTTATGTTTTGTG^3' (VIC)

primer SEQ ID NO: 42 F ^5' TAAAAATGGTGTAGATGGTGG^3'

primer SEQ ID NO: 43 R ^5' C ATAATTATC AAAC AATAATATATAAATAAC C³. For eg 125644538 :

probe SEQ ID NO: 44 C ^5' AGTTTGGAGTTCGT^3'(FAM)

probe SEQ ID NO: 45 T ^5' TTAGTTTG GAGTTTGT^3' (VIC)

primer SEQ ID NO: 46 F ^5' GTGGGTGTTTATGAAAAGATTT^3'

primer SEQ ID NO: 47 R ^5' CTAAAAC C AAAAAAAC C CTACTAC³.

For ca16660091 :

Probe SEQ ID NO: 48 C ^5' TTAGGTTGAACGGT^3'(FAM)

Probe SEQ ID NO: 49 T ^5' TAGGTTGAATGGTT^3' (VIC)

primer SEQ ID NO: 50 F ^5' GGTGTAGATGGTGGAGGG³

primer SEQ ID NO: 51 R ^5' AACATAATTATCAAACAATAATATATAAATAAC^3'.

Relative quantitative PCR was performed on a ABIPRISM7000 instrument (Life Technology) with Rox Passive Reference from 1.5μΙ of bisulfite converted DNA in total volume of 14μΙ. The reaction mix contained 200 nM of each MGB probe (Life technologies), 900 nM of each primer (Sigma - HPLC purified), 0.1 mM dNTP, 5 mM MgCI2, 0.1X Rox (Euromedex), 0.4U Immolase Taq and 1 X ImmoBuffer (Bioline). The amplification program was : 95°C 10 min following by 45 cycles of 95°C 15sec - 58°C 1 min. For each sample, the Ct for the two probes were determined with the same threshold, this threshold being defined with control DNA for which methylated value was known. For each sample, the formula "% methylation = 100/[1 +2^(Ctmeth" ctunmet^h)]" _{was a}pp|j_ec| to calculate the methylated percentage of the studied CpG. Association of ZNF471 genotypes with CETP CpG levels was tested using a linear regression analysis adjusted for age.

Analysis of DNA methylation by bisulfite conversion and pyrosequencing in mouse liver.

Liver DNA from ApoB/CETP mice was extracted using the DNeasy Blood and Tissue kit (Qiagen) and converted through bisulfite treatment for methylation analysis using the Premium Bisulfite kit (Diagenode) according to the manufacturer's instructions. Amplification of a 366 bp fragment of the human CETP promoter gene encompassing 1 1 CpG sites and including the 4 incriminated CpG sites (cg09889350, cg12564453, cg16660091 and cg26624021 ) was carried out by polymerase chain reaction using the following primers (forward 5'- AAGACTCGGCAGCATCTCCATATTGATATTTATATATTAGGAGGGTAG-3' (SEQ ID NO: 52) and reverse : 5'-GCGATCGTCACTGTTCTCCAAAAACAAATAAAAATTAAAATACTCTTATT- 3' (SEQ ID NO: 53). Quality of amplicons was validated onto a 2% agarose gel and PCR products were pyrosequenced on a PyroMark Q96 MD system using the PyroMark Gold Q96 CDT reagent kit and Pyro Q-CpG software (Qiagen). Statistical analysis.

Data are shown as mean ± SEM. Experiments were performed in triplicate and values correspond to the mean from at least three independent experiments. Comparisons of 2 groups were performed by a 2-tailed Student's t test and comparisons of 3 or more groups were performed by ANOVA with Newman-Keuls post-test. All statistical analyses were performed using Prism software from GraphPad (San Diego, CA, USA).

In vivo expression of human ZNF471 in mice.

Twelve-week aged male Tg human Apolipoprotein B (ApoB) / CETP (ApoB/CETP) mice (In- house mouse model) fed on a standard chow diet were retro-orbitally injected with 40pg of either a hZNF471 expression vector (pCMV6-hZNF471 -GFP, Origene#RG215696) or a control pmax-GFP vector (Lonza) using an in vivo transfection reagent (PepJet DNA In Vivo Transfection Reagent, SignaGen Laboratories) (injected volume = 200μΙ) under isoflurane anesthesia. Seven days following injection, blood samples were collected in Microvette tubes (Sarstedt) by retro-orbital bleeding under isoflurane anesthesia. Mice were weighted, euthanized and livers were isolated for RNA extraction and DNA methylation analysis by bisulfite conversion and pyrosequencing. Plasma samples were analyzed with an Autoanalyzer (Konelab 20) using reagent kits from Roche (total cholesterol) and ThermoElectron (HDL-cholesterol). A liver piece was excised, minced and digested in Hank^'s balanced salt solution (HBSS, Gibco, Invitrogen, Cergy Pontoise, France) with 2.5 mg/mL collagenase D (Roche, Boulogne Billancourt, France) for 30 min at 37 C under shaking and dissociated through a 200 m pored cell strainer (Franklin lakes, NJ, USA). Hepatocytes were isolated following a brief centrifugation for 1 min at 1 ,000 rpm and stored at -80 C until use.

Cellular free cholesterol efflux assays.

Human THP-1 macrophages were labeled with 1 μΟί/η"ΐΙ [3H]cholesterol for 24 hours in the presence of 50μg ml acetylated LDL (acLDL) in a RPMI medium containing 2mM Glutamine, 50mM Glucose and 0.2% BSA (RGGB). Cells were then equilibrated in RGGB medium for an additional period of 16 hours. Cellular cholesterol efflux to 0.5% mouse serum was assayed in RGGB medium for a 4-hour chase period. Finally, culture media were harvested and cleared of cellular debris by brief centrifugation. Cell associated radioactivity was determined by extraction in hexan-isopropanol (3:2), evaporation of the solvent and liquid scintillation counting (Wallac Trilux 1450 Microbeta). The percentage of cholesterol efflux was calculated as 100 x (medium cpm) / (medium cpm + cell cpm). Results

Example 1 : rs62123030 and rs 11667052 polymorphism of ZNF471 are associated with DNA methylation at the CETP locus.

We identified a new transcription factor named ZNF471 (Zinc finger protein 471 ) that modulates the epigenetic regulation of CETP coding for Cholesterol Ester Transfer Protein, a key actor in lipid metabolism. In a sample of 350 patients with venous thrombosis from the MARTHA study (Germain et al. 2015. American journal of human genetics.; 96:532-542), whose whole blood DNA was epityped with the lllumina H450K DNA methylation array, we observed an association between the rs62123030 polymorphism of ZNF471 and whole blood DNA methylation levels at four CpG sites located in the CETP gene promoter (cg09889350, cg12564453, cg16660091 and cg26624021 ) As an illustration, the common ZNF471 rs62123030 G was associated with increased DNA methylation at CpG cg09889350 (Figure 1A). We replicated this association in an independent sample of 822 individuals part of the ECTIM study (Tregouet et al. 2004. Arteriosclerosis, thrombosis, and vascular biology. ;24:775- 781 ), a case-control study for arterial thrombosis. In the ECTIM sample composed of 361 patients with myocardial infarction and 461 healthy controls, all males, whole blood DNA methylation at CETP CpG sites were measured using a bisulfite PCR assay (see Experimental procedures). As shown in Figure 1 B, the common rs62123030 G allele was significantly (p = 0.0025) associated with increased CpG cg09889350 levels, consistently to what observed in the MARTHA cohort epityped for the H450K array. Similar patterns were obtained for the two other CETP CpG sites. Of note, this association was slightly enhanced in the sample of 361 cases (additive effect of the G allele β = +0.27, p = 0.02) than in the sample of 461 controls (β = +0.13, p = 0.10). Also of interest were the observations of lower CETP CpG cg09889350 levels in cases than in controls (p=5.83 10^"4) and in smokers compared to non-smoker individuals (p= 1 .25 10^"4) of the ECTIM study (Figure 2). Despite differences in study sampling scheme, DNA methylation measurements and data processing between the hypothesis- generating MARTHA study and the replication ECTIM study, those data provide strong support for ZNF471 genetic polymorphisms (the rs62123030 or any other variation in very strong linkage disequilibrium with it i.e r² >0.8) associated with whole blood DNA methylation levels at the CETP locus.

Interestingly, methylation levels at the CETP CpG sites were correlated to plasma HDL, LDL and total cholesterol in both MARTHA and ECTIM, and these correlations were modulated by the rs62123030 genotype. For example, in the ECTIM population, the correlation between CpG cg09889350 and HDL-C was p = 0.1 1 (p = 0.02) in the 459 carriers of the GG genotype and p = 0.01 (p =0.84) in the 330 carriers of the C allele. As CETP activity had been previously measured in ECTIM participants (Corbex et al. 2000. Genetic epidemiology. ;19:64-80), we investigated where this genotype also influences the correlation between CpG cg09889350 levels and CETP activity. In GG carriers, CpG levels and CETP activity were not correlated (p =0.05 ; p = 0.30) while they were negatively correlated in C carriers (p = -0.15 ; p = 4.72 10^"3).

Taken together, those data indicate that methylation of CETP CpG sites and plasma lipid levels are affected by a polymorphism located in the ZNF471 gene, suggesting that ZNF471 genetically influences the epigenetic regulation of CETP that further contributes to circulating lipid levels variability.

Example 2 : In vivo expression of human ZNF471 affects plasma lipid levels and macrophage cholesterol efflux.

In order to validate our findings in vivo, we evaluated the effect of the expression of human ZNF471 (hZNF471 ) in the Tg human Apolipoprotein B (ApoB) / CETP (ApoB/CETP) (as CETP is lacking in mice) mouse model which displays a "humanized" lipid metabolism more prone to reproduce effects expected on human lipid metabolism. Indeed, plasma cholesterol in mice is mostly carried by HDL (ApoA-l-containing lipoproteins) and not by LDL or VLDL (ApoB- containing lipoproteins) as it occurs in humans. Introduction of the human ApoB transgene in CETP Tg mice allows a plasma phenotype similar to that observed in humans, with a predominance of plasma cholesterol carried by ApoB-containing particles.

To achieve this goal, hZNF471 was expressed in ApoB/CETP mice following the retro-orbital injection (PepJet DNA In Vivo Transfection Reagent, SignaGen Laboratories) of a hZNF471 expression vector (pCMV6-hZNF471 -GFP). Retro-orbital injection of this cationic peptide (PepJet DNA In Vivo Transfection Reagent) was described to allow a high in vivo delivery efficiency to the liver which is the key organ controlling lipid metabolism.

Injection of the hZNF471 expression vector in ApoB/CETP mice led to a significant decrease of plasma total cholesterol levels as compared to control animals after 7 days (Figure 3A). More importantly, an increase of plasma HDL-C levels was observed following injection of hZNF471 whereas those of animals injected with the control vector were not significantly affected. In agreement with this marked increase of plasma HDL-C levels, capacity of plasmas from mice injected with the hZNF471 expression vector to promote cholesterol efflux from human THP-1 macrophages was enhanced by 35% (p<0.05) (Figure 3C) as compared to control animals. This result is of particular interest as plasma cholesterol efflux capacity from macrophages, a metric of HDL function, is strongly inversely associated with both carotid intima-media thickness and the likelihood of angiographic coronary artery disease (Khera et al. 201 1 .The New England journal of medicine.;364:127-135). In vivo experiments in a "humanized" lipid metabolism mouse model indicate that the expression of human ZNF471 is able to reduce the atherogenicity of plasma lipid phenotype.

Modulation of liver expression of key lipid metabolism genes following in vivo expression of human ZNF471. Seven days following the injection of the hZNF471 expression vector, a robust expression of hZNF471 mRNA levels was detected in hepatocytes isolated from livers of ApoB/CETP mice whereas endogeneous expression of the mouse orthologous Zfp78 expression was not altered (Figure 4A). In addition, liver expression of hZNF471 led to an increased methylation of a promoter CETP CpG site CpG#4 (cg26624021 ), a reduction of CETP mRNA levels together with a decrease of plasma CETP activity as compared to control animals (Figure 4B-C). Moreover, liver gene expression analysis revealed that the increased expression of hZNF471 represses not only CETP, but also three additional genes involved in lipid metabolism, PLTP, LPL and ABCG1 coding respectively for Phospholipid Transfer Protein, Lipoprotein Lipase and ATP-Binding Cassette G1 (Figure 5). Interestingly, DNA methylation of CETP, PLTP, LPL and ABCG1 genes was recently reported to contribute independently to plasma lipid levels in hypercholesterolemic individuals (Guay et al. 2014. Epigenetics.;9:718-729).

Example 3

Materials and Methods

Cardiogenics study population

Individuals included in this analysis have been collected as part of the Cardiogenics Consortium (Samani et al, Genomewide association analysis of coronary artery disease. The New England journal of medicine. 2007;357:443-453.) They were composed of 479 individuals of white European origin with (n=241 ) or without (n=238) a history of coronary artery disease and recruited in five centres (Cambridge and Leicester, UK; Lubeck and Regensburg, Germany; Paris, France). Fasting venous blood samples were collected from all the participants into EDTA. All patients have been typed for genome-wide genotypes from whole blood DNA using the Human Quad Custom 670 array (lllumina). mRNA expression from isolated CD14⁺ monocytes and derived macrophages were quantified using the HumanRef-8 v3 Beadchip array (lllumina) (Heinig et al, A trans-acting locus regulates an anti-viral expression network and type 1 diabetes risk. Nature. 2010;467:460-464). Large-scale analysis of methylation in whole blood DNA was previously conducted using the Infinium Human Methylation450K array (lllumina) (Dick et al, DNA methylation and body-mass index: A genome-wide analysis. Lancet. 2014;383:1990-1998). Expression quantitative trait loci (eQTL) and DNA methylation analysis

The effect of ZNF471 expression on DNA methylation was analyzed by selecting all CpG sites for CETP, LPL, ABCG1 and PLTP after adjustment for age, sex, centre, blood cell composition as fixed effects with batch and chip as random effects. Association of ZNF471 rs1 1667052 on gene expressions was tested using regression linear models under the assumption of additive allele effects with the same adjustments as above.

Results

We investigated whether the expression of the ZNF471 transcription factor was correlated with whole blood DNA methylation levels at CpG sites at the CETP locus as well as at those of candidate genes, LPL, ABCG1 and PLTP, identified following the in vivo expression of human ZNF471 in mice. Analysis of ZNF471 expression in human monocytes and derived macrophages from 479 individuals of the Cardiogenics Consortium indicated that the expression of ZNF471 in human monocytes was significantly correlated to whole blood methylation levels at CETP CpG sites (cg26624021 , cg01706698, cg03232842, cg09889350 and cg16660091 ) but also to those at CpG sites located in candidates genes {PLTP, cg20105087, cg26321644 and cg01236081 ; ABCG1, cg00222799 and cg26767954 and LPL, cg22108175 and cg04649769) (Table 5); the most significant effect being observed at the PLTP CpG site cg20105087 (p=0.002). Highly significant correlations were observed between ZNF471 expression in human macrophages and methylation levels at CETP CpG sites (cg09889350, cg26624021 , cg01706698, cg16660091 , cg03232842 and cg12564453) and to a lesser degree at the LPL CpG site cg07263235 (Table 5). However, no correlation was detected at CpG sites in the PLTP and ABCG1 genes in macrophages.

Table 5. Association between methylation levels at selected CETP, ABCG1, LPL and PLTP CpG sites and ZNF471 expression in human monocytes and derived macrophages. Estimates are for a unit increase in log2 ZNF471 expression (ILMN_2191720).

Cell type Methylation Gene P SE P Value probe

Monocyte cg20105087 PLTP 0.026 0.008 0.002 cg26624021 CETP 0.050 0.018 0.005 cg01706698 CETP 0.020 0.007 0.006 cg03232842 CETP 0.026 0.010 0.011 cg00222799 ABCG1 0.024 0.010 0.019 cg26767954 ABCG1 -0.004 0.002 0.020 cg22108175 LPL -0.029 0.013 0.022 cg04649769 LPL 0.017 0.007 0.022 cg26321644 PLTP -0.007 0.003 0.035 Cg09889350 CETP 0.027 0.013 0.039 cgl6660091 CETP 0.031 0.015 0.042 cg01236081 PLTP 0.014 0.007 0.045

Macrophage Cg09889350 CETP 0.041 0.011 1.18E-04 cg26624021 CETP 0.054 0.015 2.20E-04

Cg01706698 CETP 0.021 0.006 4.78E-04 cgl6660091 CETP 0.041 0.012 9.85E-04 cg03232842 CETP 0.028 0.009 1.29E-03 cgl2564453 CETP 0.023 0.009 0.011 cg07263235 LPL 0.022 0.011 0.044

In this subset of individuals of the Cardiogenics cohort, the non-synonymous ZNF471 rs1 1667052 variant (G/T : 0.76/0.24, Met→lle) which is in complete linkage disequilibrium (LD) with rs62123030 (r²=1 ) was associated with whole blood methylation levels at CETP (cg01706698, cg03232842, cg09889350, cg16660091 , cg26624021 , cg12564453, cg03186069), LPL (cg20435463) and ABCG1 (cg05639842) CpG sites (Table 6). Further analysis revealed an interaction between rs1 1667052 and ZNF471 expression on whole blood DNA methylation levels at CETP, ABCG1, LPL and PLTP CpG sites (Table 7).

Table 6. Association between methylation levels at selected CETP, ABCG1 and LPL CpG sites and the non-synonymous ZNF471 SNP rs11667052. Values are for the rs1 1667052 T allele.

METHYLATION Gene β SE P Value

PROBE

CG01706698 CETP -0.0234 0.0024 3.08E-23

CG03232842 CETP -0.0288 0.0034 1.56E-17

CG09889350 CETP -0.0306 0.0044 2.46E-12

CG16660091 CETP -0.0347 0.0051 9.68E-12

CG26624021 CETP -0.0373 0.0060 7.24E-10

CG12564453 CETP -0.0202 0.0037 7.04E-08

CG03186069 CETP -0.0031 0.0013 0.0169

CG20435463 LPL -0.0079 0.0035 0.0266

CG05639842 ABCG1 -0.0015 0.0008 0.0437

Table 7. P values of the interaction test between polymorphism and ZNF471 expression on whole blood DNA methylation levels at selected CETP, ABCG1, LPL and PLTP CpG sites. Cell type Methylation Gene P Value

probe

Monocyte cg01176028 ABCG1 0.008

cg07072366 LPL 0.018

cg23611945 PLTP 0.027

Cg03232842 CETP 0.038

cgl4982472 ABCG1 0.043

Cg08918749 LPL 0.046

cg22108175 LPL 0.046

cg01706698 CETP 0.047

cgll662315 ABCG1 0.049

Macrophage cg00222799 ABCG1 0.002

cg09863247 PLTP 0.002

cg06500161 ABCG1 0.007

cg05046272 ASCG 0.013

cg20214535 ABCG1 0.013

cg26768067 AS Gl 0.016

cg02370100 ABCG1 0.017

Cg08918749 LPL 0.019

cg07397296 ABCGl 0.020

cg07072366 LPL 0.024

cg23611945 PZ P 0.039

Cgl6125291 LPL 0.042

cg27243685 ABCG1 0.044

Taken together, those data revealed that both the ZNF471 rs1 1667052 (or any other variant in linkage disequilirum with it) and ZNF471 monocyte/macrophage expression are associated with whole blood DNA methylation at CETP CpG sites but also at CpG sites in LPL, ABCG1 and PLTP genes, indicating that ZNF471 is able to modulate the DNA methylation and potentially the expression of several genes involved in the lipid metabolism in humans. In addition, our findings support ZNF471 SNPs as valid indicators of the action of ZNF471 on the DNA methylation and the subsequent expression of key genes controlling lipid metabolism.

Claims

1 . A polypeptide comprising amino acid sequence SEQ ID NO:1 or a homologous amino acid sequence, for use as a medicament, wherein the homologous amino acid sequence is defined as showing at least 80% identity with respect to SEQ ID NO:1 , while keeping the property of decreasing the hepatic expression of all four CETP, Pltp, Abcgl and Lpl genes when administered to a mammal subject.

2. A nucleid acid for use as a medicament, which nucleic acid encodes the polypeptide as defined in claim 1 .

3. A vector for use as a medicament, which vector comprises a nucleic acid which encodes the polypeptide as defined in claim 1 , preferably wherein the vector is a viral vector, still preferably wherein said vector is a selected from the group consisting of a lentivirus, HIV, SIV, FIV, EAIV, CIV, alphavirus, adenovirus, adeno associated virus, baculovirus, HSV, coronavirus, Bovine papilloma virus, and Mo-MLV.

4. The polypeptide, acid nucleic, or vector as defined in any of claims 1 to 3, for use in treating a dyslipidemia or a disease associated with dyslipidemia, preferably wherein said disease associated with dyslipidemia is a cardiovascular disease.

5. An agent for use in treating dyslipidemia or a disease associated with dyslipidemia in a subject, wherein said agent decreases the expression, preferably the hepatic expression, of all four CETP, Pltp, Abcgl and Lpl genes.

6. The agent for use according to claim 5, wherein the agent increases methylation of human CETP, preferably at CpG#1 (cg09889350), CpG#2 (cg12564453), CpG#3 (cg16660091 ) or/and CpG#4 (cg26624021 ) site(s).

7. The agent for use according to claim 5 or 6, wherein the agent is a polypeptide.

8. An in vitro method for determining the likelihood for a subject to respond to a treatment with a CETP inhibitor, which method comprises identifying, in a biological sample of the subject, the presence of an alteration in the genetic sequence of the ZNF471 gene locus or in the ZNF471 expression or ZNF471 protein activity, wherein the presence of the said alteration is indicative of a subject being likely to respond to the treatment

9. An in vitro method for determining or adjusting the dosage or regimen of a CETP inhibitor in treating a subject afflicted with a dyslipidemia or a disease associated with dyslipidemia, which method comprises identifying, in a biological sample of the subject, the presence of an alteration in the genetic sequence of the ZNF471 gene locus or in the ZNF471 expression or ZNF471 protein activity, wherein a patient for whom an alteration in the genetic sequence of the ZNF471 gene locus or in the ZNF471 expression or ZNF471 protein activity is identified requires a higher dosage of the CETP inhibitor than a patient for whom such alteration is not detected.

10. The method of claim 8 or 9 wherein said alteration is a mutation, an insertion, or a deletion of one or more bases.

1 1 . The method of claim 10 wherein said alteration is at one or several single nucleotide polymorphism.

12. The method of claim 1 1 wherein said SNP is rs62123030 or any other SNP in linkage disequilibrium yielding a r²>0.8 therewith, preferably rs1 1667052.

13. The method according to claim 12, wherein said SNP is selected from the group consisting of rs35347939, rs1 1084452, rs66522479, rs16987295, rs12978999, rs12151254, rs12986047, rs61 144294, rs7245557, rs7250075, rs1 1671776, rs35664312, rs12151 151 , rs1 1667052, rs8109083, rs62123030, rs960997, rs3813141 , rs3813142, rs3813143, rs16987310, rs81 10306, rs15507, rs1054409, rs4267437, rs34269477, rs77247784, rs145395393, rs76894169, rs62124070, rs36062917, rs35908973, rs2869891 , rs2215151 , rs2286422, rs917407, rs12981980.

14. The method of claim 12 or 13 wherein the alteration is the presence of a T allele with respect to rs35347939, a A allele with respect to rs1 1084452, a T allele with respect to rs66522479, a G allele with respect to rs16987295, a A allele with respect to rs12978999, a T allele with respect to rs12 5 254, a T allele with respect to rs12986047, a T alllele with respect to rs61 144294, a T allele with respect to rs7245557, a A allele with respect to rs7250075, a A allele with respect to rs1 1671776, a G allele with respect to rs35664312, a C allele with respect to rs12151 151 , a T allele with respect to rs1 1667052, a T allele with respect to rs8109083, a C allele with respect to rs62123030, a A allele with respect to rs960997, a T allele with respect to rs3813141 , a C allele with respect to rs3813142, a A allele with respect to rs3813143, a T allele with respect to rs16987310, a T allele with respect to rs81 10306, a A allele with respect to rs 5507, a T allele with respect to rs1054409, a T allele with respect to rs4267437, a C allele with respect to rs34269477, a G allele with respect to rs77247784, a A allele with respect to rs145395393, a A allele with respect to rs76894169, a T allele with respect to rs62124070, a G allele with respect to rs36062917, a G allele with respect to rs35908973, a G allele with respect to rs2869891 , a T allele with respect to rs2215151 , a T allele with respect to rs2286422, a A allele with respect to rs917407, or a A allele with respect to rs 12981980.

15. The method of claim 12 to 14, wherein the alteration is the presence of a CT or TT genotype with respect to rs35347939, a GA or AA genotype with respect to rs1 1084452, a GT or TT genotype with respect to rs66522479, a AG or GG genotype with respect to rs16987295, a CA or AA genotype with respect to rs12978999, a AT or TT genotype with respect to rs1215 254, a TC or TT genotype with respect to rs12986047, a TG or TT genotype with respect to rs61 144294, a CT or TT genotype with respect to rs7245557, a TA or AA genotype with respect to rs7250075, a GA or AA genotype with respect to rs1 1671776, a AG or GG genotype with respect to rs35664312, a TC or CC genotype with respect to rs12151 151 , a GT or TT genotype with respect to rs1 1667052, a CT or TT genotype with respect to rs8109083, a GC or CC genotype with respect to rs62123030, a GA or AA genotype with respect to rs960997, a CT or TT genotype with respect to rs3813141 , a TC or CC genotype with respect to rs3813142, a GA or AA genotype with respect to rs3813143, a CT or TT genotype with respect to rs16987310, a AT or TT genotype with respect to rs81 10306, a GA or AA genotype with respect to rs15507, a CT or TT genotype with respect to rs1054409, a CT or TT genotype with respect to rs4267437, a TC or CC genotype with respect to rs34269477, a AG or GG genotype with respect to rs77247784, a CA or AA genotype with respect to rs145395393, a CA or AA genotype with respect to rs76894169, a GT or TT genotype with respect to rs62124070, a AG or GG genotype with respect to rs36062917, a AG or GG genotype with respect to rs35908973, a TG or GG genotype with respect to rs2869891 , a GT or TT genotype with respect to rs2215151 , a CT or TT genotype with respect to rs2286422, a GA or AA genotype with respect to rs917407, or a GA or AA genotype with respect to rs12981980.