WO2019039863A2 - Method for preparing aptamer using surrogate virus - Google Patents

Abstract

The present invention relates to a method for preparing aptamer by performing modified SELEX, the method comprising a step of bringing a surrogate virus, in which a target protein is expressed on the envelope of the virus, into contact with a nucleic acid library.

Description

Method of manufacturing abatumer using surrogate virus

The present invention relates to a method of producing an extramammer by carrying out a modified SELEX comprising contacting a nucleic acid library with a surrogate virus expressing a target protein on the envelope of the virus. The present invention relates to a method for efficiently developing a plasmid having high binding specificity and specificity by alternately using a surrogate virus expressing a target protein and a target protein purely isolated.

An aptamer is a DNA, RNA, or derivative thereof of about 20 to 100 nucleotides in size with high affinity and specificity for a specific target. Compressors are used instead of antibodies for diagnostic or therapeutic purposes because they have strong, specific binding properties to target proteins such as antibodies (Jo, H and Ban, C. et al., Experimental & Molecular Medicine volume 48 e 230 (2016)). Since a production process is made through chemical synthesis, aptamer has advantages such as easy production, quality control, and stability at room temperature compared to antibody.

The method of extracting plumbers is generally done through SELEX (Systematic evolution of ligands by exponential enrichment). SELEX can be used to identify platamers that specifically bind to a variety of target proteins, but in order to find a platamer that has the desired characteristics, the basic SELEX method is changed to separate the platemers having the desired characteristics separately (enrichment ) Should be devised. Proteins present in the cytoplasm are overexpressed and then purely separated, making it relatively easy to use as a target protein for SELEX after pure isolation. However, the proteins present in the cell membrane are glycosylated and the hydrophobic moieties are exposed to the outside of the protein, making it difficult to purify in a natural state. Therefore, there is a great deal of difficulty in preparing the protein that can be used as a target for the SELEX process to condense compressors that bind well to the target protein in its natural state. In addition, in the process of developing aptamers for pathogenic viruses or protein targets on the surface of bacteria, infection is a concern when SELEX is used as a target for these pathogens. It is very difficult to have satisfactory conditions to develop.

In order to overcome this problem, there are many cases where SELEX is used as a target protein by expressing only the protein portion outside the cell membrane in the cell membrane protein, producing and separating the recombinant protein. However, in this case, since a new protein having a site across the cell membrane is used, a new protein surface that does not exist in nature is actually generated. In the case where the protein is present as a binding protein such as homo-dimer or trimer, May not be formed. Since the aptamer recognizes and combines the three - dimensional structure of the target, the structure of the target used in the ictalma screening process is very important for the binding force or specificity of the selected ictaloma. Therefore, if the modified SELEX proceeds, there is a high possibility of finding aptamer that does not bind to the actual protein, has a low binding force, or does not have good specificity.

The inventors of the present invention have made intensive researches to develop a method for producing an extramammer that binds in a condition similar to that of natural proteins more effectively. As a result, it has been found that when a surrogate virus is used, an extramammer having excellent specific binding property The present invention has been completed.

It is an object of the present invention to provide a method of producing an extramammary by performing a modified SELEX (Systematic evolution of ligands by exponential enrichment) comprising contacting a virus with a target virus to a nucleic acid library, .

Another object of the present invention is to provide an extruder manufactured from the method for manufacturing the extruder.

It is still another object of the present invention to provide a method for detecting influenza virus using the Abtamer.

Another object of the present invention is to provide a composition for detecting influenza virus comprising an umbilical cord consisting of nucleic acid sequences of SEQ ID NOS: 1 to 9, which specifically binds to influenza virus.

Another object of the present invention is to provide a kit for the diagnosis of an influenza virus infection comprising the platemaker.

It is still another object of the present invention to provide a pharmaceutical composition for treating or preventing influenza virus infection, which comprises an umbilical cord comprising the nucleic acid sequence of SEQ ID NO: 1 to SEQ ID NO: 9, which specifically binds to influenza virus.

By using the modified SELEX method of the present invention, it is possible to produce aptamer having high specificity and binding ability to an actual protein.

Fig. 1 shows the results of confirming the degree of binding between the surrogate virus prepared by recombinant baculovirus and various beads by Sypro ruby staining.

Figure 2 shows the results of Sypro ruby staining for the maximal binding rate between the surrogate virus prepared by recombinant baculovirus and various beads.

Figure 3 shows the result of Sypro ruby staining to confirm whether the surrogate virus retained its binding to Talon beads even in the presence of 2 mM NaOH.

Figure 4 shows the results of Sypro ruby staining to confirm whether the surrogate virus retains its binding with Streptavidin Ultralink beads even in the presence of 2 mM NaOH.

Figure 5 shows the results of finding conditions that inhibit nonspecific binding between a surrogate virus and a single-stranded nucleic acid library.

Figure 6 shows the results of finding the appropriate DxSO ₄ conditions for SELEX using surrogate viruses.

Fig. 7 shows the binding affinity of the eDNA obtained through SELEX using the surrogate virus to the surrogate virus.

8a. Western blot analysis confirmed the generation of surrogate virus

8b. Western blot analysis of polypeptides corresponding to the outer portion of the viral envelope of the target proteins produced and purified using the baculovirus expression system.

Fig. 9 shows the results of confirming the binding ability of the tympanic membrane to the target protein by the filter binding assay.

Fig. 10 shows the results of confirming the binding capacity of the target protein and the non-target protein by the filter binding assay as a result of showing the specificity of the tympanic membrane.

Figure 11 shows the results of confirming the binding capacity of the platemer against the target virus by the filter binding assay. Specifically, it was confirmed that a membrane virus not expressing the HA of the target A influenza virus binds only to the virus expressing the target without binding to the aptamer.

Figure 12 shows the results of confirming the binding capacity of platemaker against influenza A virus (H3N2) by filter binding assay.

Figure 13 shows the results of confirming the binding force of the tympanic membrane excised by the method of Example 3 to the target protein by the filter binding assay.

14 shows the results of confirming the binding ability of the target protein and the non-target protein by the filter binding assay as a result of showing the specificity of the tympanic membrane extracted by the method of Example 3. Fig.

15 shows the results of confirming that the aptamer unearthed by the lateral flow method binds to the actual virus as a result of showing the specificity of the tympanic membrane excavated by the method of Example 3.

16 is a schematic diagram schematically illustrating a SELEX method using a surrogate virus.

According to one aspect of the present invention, there is provided a modified SELEX (Systematic evolution of ligands by exponential enrichment) method comprising the step of bringing a surrogate virus expressing a target protein into the envelope of a virus, And to provide a method of manufacturing an abatumer.

When producing pluripotents specifically binding to various kinds of target proteins through general SELEX, separated or purified proteins are mostly used. In this case, it is difficult to purely separate the proteins present in the cell membrane in the form of a natural state. In the process of developing the plasmids for pathogenic viruses and protein targets on the surface of bacteria, these pathogens are used as targets In case of SELEX, there is a problem because infection is worried. However, in the case of using the method of manufacturing the compressed tablets by performing the modified SELEX according to the present invention, the compressed tablets can be produced using proteins having similar conditions to those of natural proteins, It is significant in that an extruder having specificity can be produced.

In the present invention, the term " SELEX (systematic evolution of ligands by exponential enrichment) " In general, in the case of the known method (Stoltenburg at al. Biomol Eng. 2007 Oct; 24 (4): 381-403, Epub 2007 Jun 16), the target protein is single stranded DNA containing oligonucleotides with random base sequences (single-stranded DNA = ssDNA) or single-stranded RNA (ssRNA) library and then precipitated separately from the target protein with DNA / RNA in an appropriate manner. Protein precipitates are rinsed to remove unbound nucleotides. After separating the proteins from the proteins, the proteins are amplified by PCR (polymerase chain reaction) for DNA and reverse transcription (RT-PCR) for RNA. In the case of RNA compressors, the amplified DNA is used as a template, synthesized using RNA polymerase, and the next step of SELEX is performed. The nucleotide-protein interaction, nucleotide-protein complex precipitation, washing, dissociation of nucleotide from protein, amplification of nucleotide ) Is repeated several times to find a tyramine that selectively binds to the target protein.

In the case of the present invention, the above-mentioned general SELEX method is modified and used, and a specific method thereof is described below.

For the purpose of the present invention, the surrogate virus is characterized in that a target protein is expressed in an envelope, and the target protein may be the same as or 75% or more similar to the target protein corresponding to the natural system, specifically 80% , 85%, 90%, 95% or more. Furthermore, the surrogate virus of the present invention can mimic the three-dimensional structure of a dimer, a multimer and the like existing in nature, or simulate it to about 75%, thereby efficiently producing a desired plasmid.

Particularly, in the conventional SELEX method, when a separated or purified target protein is used, there is a problem that a complex in a form existing in nature is not formed. However, when the modified SELEX of the present invention using a surrogate virus proceeds, There is a high possibility of finding an excellent and highly specific aptamer.

In one embodiment of the present invention, it was also confirmed that the aptamer obtained using the novel modified SELEX method of the present invention exhibited high binding ability to the actual target virus (influenza virus subtype H3N2) (FIG. 12).

In the present invention, the term " surrogate virus " refers to a protein that expresses a target protein on the surface of the cell, instead of using a protein that is difficult to separate in a pure manner (e.g., viruses containing the Transmembrane domain and cell surface proteins) Viruses that can be infected. Surrogate viruses can bind to beads to perform modified SELEX.

The surrogate virus is characterized in that a target protein is expressed in an envelope.

The term " envelope " of a virus in the present invention means that it consists of a phospholipid bilayer. The virus is classified into a virus having a coat and a virus having no coat. For the purpose of the present invention, a surrogate virus may be a virus having a virus envelope, and the surrogate virus may contain a target protein But it is not limited thereto. The envelope carrying virus may be specifically classified as envelope-bearing DNA virus or envelope-bearing RNA virus.

Specifically, the envelope-retaining DNA virus may be at least one selected from the group consisting of Baculovirus, Hepadnavirus, Herpesvirus, poxvirus, and vaccinia virus. The envelope-bearing RNA viruses may be selected from the group consisting of Coronavirus, Flavivirus, Togavirus, Alphavirus, Arenavirus, Bunyavirus, Filovirus, But it may be at least one selected from the group consisting of Orthomyxovirus, Paramyxovirus, Rhabdovirus, Retrovirus, and Lentivirus, but it is not infectious to humans, A membrane capable of expressing proteins on the envelope of a cell membrane or virus consisting of a bilayer membrane The present invention is not limited thereto. More specifically, in the present invention, as an example, virus baculovirus which is not infectious to human body is used, but the present invention is not limited thereto.

The term " nucleic acid library " of the present invention means a library having various forms based on nucleic acids such as DNA or RNA. For purposes of the present invention, a nucleic acid library refers to a collection of nucleic acid constructs capable of binding to a variety of target proteins. Specifically, the nucleic acid library may include, but is not limited to, a single-stranded nucleic acid or a nucleic acid derivative, a double-stranded nucleic acid, or a nucleic acid derivative. The nucleic acid library can be easily selected by the manufacturer depending on the properties of the desired plasmapheresis.

In one embodiment of the present invention, a biotin-coupled antisense library was used to prepare a modified nucleic acid library suitable for the modified SELEX, through which a single-stranded nucleic acid library was extracted and used.

The method may further comprise the steps of: (a) contacting the separately isolated and purified target protein with the surrogate virus and contacting the selected nucleic acid library using a gene expression system using a virus, bacteria, or eukaryotic cell; Or (b) contacting the target protein with the nucleic acid library selected by contacting the target virus with the selected nucleic acid library, contacting the virus with a nucleic acid library containing the target protein expressed on the outer surface of the virus, But is not limited to, and may include additional commonly used SELEX procedures.

More specifically, the method comprises mass-producing a virus expressing a target protein in order to produce aptamer having an excellent binding property with a real protein and having high specificity, separating the target protein separated and purified from the mass- Contacting the selected target nucleic acid with the selected nucleic acid library, contacting the selected target nucleic acid with the selected nucleic acid library, contacting the target nucleic acid library with the selected nucleic acid library, A step of bringing into contact with a nucleic acid library a surrogate virus in which the target protein is expressed on the envelope, and a method of using the surrogate virus more than once. During such one or more iterations, the nucleic acid library may be a total collection of nucleic acids selected in the immediately preceding round.

Each step of the method of manufacturing the compressed thermometer by performing the modified SELEX will be described in detail as follows.

(a) is a step of bringing a target protein separated and purified separately into contact with a selected nucleic acid library by contacting with a surrogate virus using a gene expression system using a virus, bacteria, or eukaryotic cell.

In the present invention, the term " target protein " is a target substance that allows aptamers to bind with high affinity and specificity. For the purpose of the present invention, if the target protein is a target protein capable of binding to produce an extramammary, . The target protein can be mass-produced using a gene expression system using viruses, bacteria, and eukaryotic cells.

Specifically, it may be at least one selected from the group consisting of an animal cell membrane protein, a plant cell membrane protein, a cell membrane protein of a microorganism, and a virus protein, but is not limited thereto. In one embodiment of the present invention, an influenza virus subtype H3N2, HA, NA was used as a target protein to prepare an abdominal thermometer.

 (b) is a step of bringing the target protein into contact with the selected nucleic acid library in contact with the surrogate virus.

The target protein may be, but is not limited to, commercially purified, separately purified target proteins.

For the purpose of the present invention, (i) contacting a separately isolated and purified target protein with a surrogate virus using a gene expression system using a virus, bacteria, or eukaryotic cell to contact with a selected nucleic acid library, (ii) Wherein the target protein is contacted with the surrogate virus expressing the target protein in the envelope of the virus and is contacted with the selected nucleic acid library. In case of performing crossing, it is possible to bind to a protein in a natural state by using a target protein on the envelope of a surrogate virus, to bind to an actual protein, to produce aptamer having high binding force and specificity, In the case of using the separated target protein including the target protein, it is possible to exclude the non-specific binding to the site other than the target protein in the case of using the surrogate virus, so that the accuracy can be enhanced. Therefore, have. The repetition step may be repeated once, twice, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 11 times, 12 times, 13 times, 14 times, Can be carried out without limitation to the number of times that a high specificity pressure thermometer can be manufactured.

In addition, the method may further include selectively separating only the binding to the target protein from the structure bound by the contact, and selectively separating only the target protein not bound to the target protein from the structure bound by the contact Step < / RTI >

Specifically, a buffer containing a divalent cation can be used in the step of selectively separating only the binding to the target protein among the structures bound by the contact. The divalent cation may be one or more selected from the group consisting of Mg ^{2 +} , Ca ^{2 +} , Mn ^{2 +} , Cu ^{2 +} and Fe ^{2 +} , and the concentration of the buffer may be 0 mM to 1 M or less, But is not limited thereto.

In addition, the buffer solution may contain a negative charge polymer. Specifically, the negative charge polymer may include dextran sulfate, polyanionic cellulose, hyaluronic acid, polyanionic heparin, polysulfonate polymer, polyanionic dendrimer, carboxymethyl But are not limited to, one or more selected from the group consisting of dextran, heparin, aurin tricarboxylic acid, and suramin. The negative charge polymer may be contained at a concentration of 0 mM to 10 mM or less.

In the case of selectively separating only those not bound to the target protein among the structures bound by the contact, a buffer solution containing a negative charge polymer may be used. A buffer solution containing dextran sulfate (DxSO ₄₎ in a concentration of 0 mM to 50 mM or less may be used as the negative charge polymer. Specifically, when DxSO ₄ is added to the reaction solution to inhibit non-specific binding between the single-stranded nucleic acid library and the surrogate virus prior to SELEX, a nucleic acid library that binds non-specifically to the surrogate virus can be effectively removed .

The term " joined structure " of the present invention means a target protein that (i) massively produces a virus expressing a target protein and separates and purifies the target protein into the envelope of the virus, or (ii) , Which means platamer candidate molecules.

The combined structure may be one in which a surrogate virus is bound to a nucleic acid library having specificity in a state where the surrogate virus is immobilized by binding to magnetic beads or non-magnetic beads. Thereafter, only the structure bonded to the bead and immobilized is selected.

Specifically, the magnetic beads may be at least one selected from the group consisting of Talon, Dynabead, Agarose, Sepharose and Streptavidin. Non-magnetic beads may be Agarose, Sepharose, Streptavidin-Agarose, Streptavidin- Sepharose, and Zebex. More specifically, it may be, but is not limited to, talon, streptavidin-Sepharose.

In addition, for example, the binding ratio between the surrogate virus and the beads is effective when the amount of the beads and the virus is at most 10 pmoles, but it is not limited to the type of the beads or the type of the virus.

The method may further include a step of isolating and amplifying the nucleic acid from the selectively separated structure, and the method of SELEX commonly used may be added without limitation.

The method of the present invention comprises the steps of: (a) contacting a surrogate virus expressing a target protein to the envelope of a virus with a nucleic acid library; (b) contacting (i) a target protein separated and purified from a virus expressing the target protein with a selected nucleic acid library in contact with the surrogate virus; Or (ii) contacting the target protein with a selected nucleic acid library in contact with said surrogate virus; (c) selectively separating only the binding to the target protein from the construct bound by the contact; (d) selectively removing only those not bound to the target protein among the structures bound by the contact; And (e) isolating and amplifying the nucleic acid from the selectively separated construct, and repeating the amplification step one or more times.

In one embodiment of the present invention, the recovered platemaker, eDNA, was used to repeat the modified SELEX step, i. In addition, it was confirmed through the filter binding analysis method that the eDNA was properly selected, and it was confirmed that the eDNAs synthesized in each round were well coupled to the surrogate virus (FIG. 7).

Further, as a result of confirming that aptamer obtained using the modified SELEX method of the present invention using Influenza virus as a target protein exhibits high binding force to the actual target protein influenza virus, it was found that binding to the target protein only and binding of other subtype influenza virus But not with similar proteins (Fig. 10 and Fig. 12).

According to another aspect of the present invention, there is provided a method for detecting a target protein, comprising the steps of: (a) contacting a surrogate virus expressing a target protein on the envelope of a virus with a nucleic acid library; (b) optionally (i) contacting a separately isolated and purified target protein with the surrogate virus using a gene expression system using a virus, bacteria or eukaryotic cell to contact the selected nucleic acid library; Or (ii) contacting the target protein with a selected nucleic acid library in contact with said surrogate virus; (c) selectively separating only the binding to the target protein from the construct bound by the contact; (d) selectively removing only those not bound to the target protein among the structures bound by the contact; And (e) separating and amplifying the nucleic acid from the selectively separated structure, and performing the steps (a) to (e) one or more times.

The aptamer is characterized in that it specifically binds to influenza virus. Specifically, the aptamer may be at least one selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 9, but is not limited thereto.

Another aspect of the present invention to attain the above object is an utterum comprising a nucleic acid sequence of SEQ ID NO: 1 to SEQ ID NO: 9, wherein the aptamer specifically binds to the influenza H3N2 virus , And a plumber.

The aptamer may include, but is not limited to, a nucleic acid sequence having at least 75% identity with any of SEQ ID NO: 1 to SEQ ID NO: 9. In addition, the aptamer may have one or more stem-loop structures, and one or more nucleotides may be modified.

Specifically, the aptamer may include, but is not limited to, a nucleic acid sequence of SEQ ID NO: 1 to SEQ ID NO: 9, or a nucleic acid sequence having at least 80% homology or identity thereto. Specifically, the amino acid is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% homologous or identical to SEQ ID NO: / RTI > and < RTI ID = 0.0 >

Homology and identity refers to the degree of association with two given nucleotide sequences and can be expressed as a percentage. The terms homology and identity are often used interchangeably.

Sequence homology or identity of conserved polynucleotides is determined by standard alignment algorithms and default gap penalties established by the program used can be used together. Substantially homologous or identical sequences generally have at least about 50%, 60%, 70%, 80% or 90% of the length of the sequence or the entire length of the sequence under moderate or high stringency conditions can be hybridized under stringent conditions. Polynucleotides containing degenerate codons instead of codons in hybridizing polynucleotides are also contemplated.

Whether any two polynucleotide sequences have homology, similarity or identity is described, for example, in Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85: 2444, using a default computer algorithm such as the " FASTA " program. Or as performed in EMBOSS (The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) Can be determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453). (GCG program package (Devereux, J. et al., Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] : 403 (1990); Guide to Huge Computers, Martin J. Bishop, ed., Academic Press, San Diego, 1994; and CARILLO ETA /. (1988) SIAM J Applied Math 48: 1073) For example, BLAST, or ClustalW, of the National Center for Biotechnology Information Database can be used to determine homology, similarity, or identity.

Homology, similarity or identity of polynucleotides can be found, for example, in Smith and Waterman, Adv. Appl. Math (1981) 2: 482, for example, in Needleman et al. (1970), J Mol Biol. 48: 443, by comparing the sequence information using a GAP computer program. In summary, the GAP program defines the total number of symbols in the shorter of the two sequences, divided by the number of similar aligned symbols (ie, nucleotides or amino acids). The default parameters for the GAP program are (1) a linear comparison matrix (containing 1 for identity and 0 for non-identity) and Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979), Gribskov et al (1986) Nucl. Acids Res. 14: 6745 (or EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap (or gap open penalty 10, gap extend penalty 0.5); And (3) no penalty for end gaps. Thus, as used herein, the term "homology" or "identity" refers to the relevance between sequences.

The aptamer according to the present invention can also be labeled with a detectable molecule such as, for example, a radioisotope, a fluorescent compound, a bioluminescent compound, a chemiluminescent compound, a metal chelator or an enzyme.

Thus, an aptamer according to the present invention can be labeled by incorporating a detectable label by a method selected from the group comprising spectroscopic, photochemical, fluorescent, biochemical, immunochemical or chemical means. Useful detection molecules include radioactive materials (32 ^P , 35 ^S , ³ H, ¹²⁵ I), fluorescent dyes (5-bromodesoxyuridine, fluorescein, actey laminofluorene, digoxygenin) or biotin.

The aptamers according to the present invention can be labeled at their 3'-terminal or 5'-terminal nucleotides without significantly altering the binding properties to influenza viruses, in particular influenza virus HA, NA proteins, But is not limited thereto, so long as the target protein can be expressed on the envelope of the surrogate virus using the surrogate virus.

According to another aspect of the present invention, there is provided a method for detecting influenza H3N2 virus, comprising the steps of: (i) contacting a sample to an individual with an aptamer specifically binding to influenza H3N2 virus; And (ii) detecting an influenza H3N2 virus in a sample associated with the squamous cell of step (i).

The term " sample " refers to all biological samples derived from a patient, subject, individual. Specifically include various sample types obtained from patients and can be used for diagnostic assays. In addition, the sample may include any type of sample, such as a sample of an individual, or a test sample including, but not limited to, laboratory culture fluid, non-aggressive washer fluid, spillway, respiratory tract swabs, throat swabs, tracheal, etc. Influenza H3N2 It may be a culture sample suspected of containing or containing virus.

Further, the method is further characterized in that the platemaker comprises a nucleic acid sequence of SEQ ID NO: 1 to SEQ ID NO: 9, wherein the aptamer specifically binds to the influenza H3N2 virus, Lt; / RTI >

The solid support may be, but is not limited to, gold nanoparticles, silver nanoparticles, fluorescent nanoparticles, or nanoparticles.

The method of detecting and / or quantifying using the pressure tester according to the present invention can be carried out in various ways. One example may include contacting a sample from a patient to remove undesirable proteins or detecting the presence of the influenza H3N2 virus in a sample selected from oligonucleotides such as salmon sperm DNA or polymers having charge have.

Specifically, the polymer having charge is selected from the group consisting of dextran sulfate, polyanionic cellulose polymer, hyaluronic acid, polyanionic heparin, polysulfonate polymer, , A polyanionic dendrimer, carboxymethyl-dextran, heparin, aurintricarboxylic acid, or suramin. The term " anionic " In addition, the average molecular weight of the polymer having charge may be greater than 1,000,000 Da. The concentration of the charge-carrying polymer may range from 0 to 10 mM. In particular, in order to effectively achieve the effect of reducing non-specific binding in a fluid sample, the concentration of the charge-carrying polymer in the fluid sample may be 0.01 to 10 mM, specifically 0.01 to 0.1 mM, more specifically 0.01 to 10 mM, 0.01 mM, but is not limited thereto.

Another aspect of the present invention to attain the above object is to provide a composition for detecting influenza virus comprising an abtamer consisting of a nucleic acid sequence of SEQ ID NO: 1 to SEQ ID NO: 9, which specifically binds to influenza H3N2 virus .

Another aspect of the present invention to attain the above object is to provide a kit for diagnosing influenza virus infection comprising the platemaker. In the present invention, the assay system for use in a kit includes, but is not limited to, an ELISA plate, a dip-stick device, an immunochromatography method and a spin-split immune assay device and a flow-through device, do. Specifically, a strip-type or device-type diagnostic kit using an immunochromatographic assay (ICA) can be used.

In a specific embodiment of the present invention, a side-flow method diagnostic kit is prepared using a plethora excavated by the method of the present invention, and a sample without a virus and a sample with a virus are treated respectively, Respectively. As a result, it was confirmed that no signal was labeled in the virus-free sample but a circular signal was marked in the center of the membrane in the virus-containing sample (FIG. 15).

This suggests that the kit of the present invention comprising the platemaker can be very useful for the diagnosis of influenza virus infection.

In order to achieve the above object, another aspect of the present invention is a therapeutic or prophylactic agent for an influenza virus infection, which comprises an umbilical cord comprising a nucleic acid sequence of SEQ ID NO: 1 to SEQ ID NO: 9 specifically binding to influenza H3N2 virus To provide a pharmaceutical composition.

The term " prevention " in the present invention means all actions that inhibit or delay the onset of flu or flu caused by influenza virus by administration of the pharmaceutical composition according to the present invention, and " treatment " , The suspected flu or influenza caused by the influenza virus, and all the actions that alleviate or alleviate the symptoms of the affected individuals.

In the present invention, the prevention or treatment of a cold, a flu, a pandemic influenza, a viral pharyngitis, acute rhinitis and the like caused by an influenza virus can be prevented by the above-mentioned platum, By showing the mitigating effect of the symptom.

The pharmaceutical compositions of the present invention may further comprise suitable carriers, excipients or diluents conventionally used in the manufacture of pharmaceutical compositions. Specifically, the pharmaceutical composition may be formulated in the form of powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols and the like, oral preparations, suppositories and sterilized injection solutions according to a conventional method .

In the present invention, the carrier, excipient and diluent which may be contained in the pharmaceutical composition include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, Calcium silicate, cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. In the case of formulation, a diluent or excipient such as a filler, an extender, a binder, a wetting agent, a disintegrant, or a surfactant is usually used. Solid formulations for oral administration include tablets, pills, powders, granules, capsules and the like, which may contain at least one excipient such as starch, calcium carbonate, Sucrose, lactose, gelatin and the like. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid preparations for oral use may include various excipients such as wetting agents, sweetening agents, fragrances, preservatives, etc. in addition to water and liquid paraffin, which are simple diluents commonly used in suspension, liquid solutions, emulsions and syrups have. Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. Examples of the suspending agent include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like. Examples of the suppository base include witepsol, macrogol, tween 61, cacao butter, laurin, glycerogelatin and the like.

The content of the extruder contained in the pharmaceutical composition of the present invention is not limited as long as the pharmaceutical composition has a preventive or therapeutic effect on developmental disorder, but is preferably 0.0001 to 99.9% by weight, more preferably 0.01 By weight to 80% by weight.

The pharmaceutical composition of the present invention may be administered in a pharmaceutically effective amount. The term " pharmaceutically effective amount " of the present invention means an amount sufficient to treat or prevent a disease at a reasonable benefit / risk ratio applicable to medical treatment or prevention And the effective dose level is determined according to the severity of the disease, the activity of the drug, the age, body weight, health, sex, sensitivity of the patient to the drug, administration time of the composition of the present invention, , Factors including drugs used in combination with or co-used with the compositions of the present invention used, and other factors well known in the medical arts. The pharmaceutical composition of the present invention may be administered as an individual therapeutic agent or in combination with another therapeutic agent, and may be administered sequentially or simultaneously with a conventional therapeutic agent. And can be administered singly or multiply. It is important to take into account all of the above factors and administer an amount that will achieve the maximum effect in the least amount without side effects.

The dosage of the pharmaceutical composition of the present invention can be, for example, but not limited to, 0.1 to 500 mg / kg of body weight per day for an animal, including humans, containing the pharmaceutical composition of the present invention. The frequency of administration of the composition of the present invention is not particularly limited, but it may be administered once a day or divided into several doses. The dose is not intended to limit the scope of the invention in any way.

Another aspect of the present invention is a pharmaceutical composition comprising a pharmaceutically effective amount of the pharmaceutical composition as described above, wherein the pharmaceutical composition is administered to a subject suffering from, or susceptible to, a cold, influenza pandemic flu, viral nasopharyngitis or acute rhinitis which is caused by influenza virus A method for preventing or treating a cold, a flu-like influenza virus, a viral nasopharyngitis, an acute rhinitis, or the like caused by an influenza virus including a step of administering the influenza virus.

The prevention and treatment are as described above.

As described above, the aptamer provided in the present invention has the effect of preventing or treating a cold, influenza-influenza virus, viral nasopharyngitis, acute rhinitis and the like caused by influenza virus, Can be used to prevent or treat colds, flu-like flu, viral-type nasopharyngitis, acute rhinitis and the like.

The term " individual " of the present invention refers to all animals such as rats, livestock, and humans who are infected with influenza viruses, flu, or the like.

In a method for treating a cold, flu-like influenza, viral nasopharyngitis, acute rhinitis, or the like caused by the influenza virus of the present invention, the administration route of the pharmaceutical composition may be administered through any ordinary route May also be administered. The pharmaceutical composition of the present invention is not particularly limited, but may be administered by intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, intradermal administration, oral administration, intranasal administration, intrapulmonary administration, rectal administration and the like ≪ / RTI > However, since the aptamer can be denatured by gastric acid when orally administered, the oral composition should be formulated so as to coat the active agent or protect it from decomposition at the top. In addition, the composition may be administered by any device capable of transferring the active agent to the target cell.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are for further illustrating the present invention, and the scope of the present invention is not limited to these examples.

Example  One: Baculo  Using a virus-derived surrogate virus SELEX

Experiments were performed by selecting baculovirus as a representative surrogate virus capable of expressing the target protein on the envelope.

Using a protein expression system using baculovirus, a surrogate virus having a target protein on the baculovirus surface (envelope) was prepared using a recombinant method, and SELEX was performed using this surrogate virus. Specifically, a surrogate virus having wild type baculovirus and TNF (tumor necrosis factor) receptor protein was prepared and used as a control.

1-1. Baculo  Production, mass production and isolation of surrogate viruses that have modified viruses

The baculovirus expression vector pFastBac (ThermoFisher, Cat No.10359016) was cloned by inserting a His tag or a Flag tag and a target protein (TNF (tumor necrosis factor) receptor protein) gene into baculovirus bacmid, To prepare recombinant baculovirus DNA. Sf9 cells, insect-derived cells, were transfected to produce a baculovirus having a target protein. Thereafter, the baculovirus (surrogate virus) carrying the target protein was mass-cultured and then the viruses were separated and concentrated (Margine, I., Palese, P. and Krammer, F. (2013) E51112.).

1-2. Confirmation of association between surrogate virus and bead

In the SELEX procedure, a process of fractionating nucleic acids that do not bind to a nucleic acid that binds to a target substance in a nucleic acid library (DNA or RNA) is indispensable, and it is necessary to separate nucleic acids that bind effectively to the target protein There is a need for a method to separate target proteins to separate them. In general, SELEX uses a method of immobilizing a target protein on a bead.

Various beads (Streptavidin UltraLink Resin (Pierce), Dynabead Talon (Invitrogen), Streptavidin Mag Sepharose bead (GE healthcare)) were mixed with the same amount of beads in order to find appropriate beads to bind to the surrogate virus derived from baculovirus of Example 1-1 To the surrogate virus. In addition, the surrogate virus was covalently conjugated with biotin and the other was covalently conjugated to each bead.

As a result, it was confirmed that both biotinylated viruses and non-biotinylated viruses bind well to Streptavidin Ultralink Resin and Talon beads. Especially, when Talon beads were used, they were found to bind most effectively 1).

1-3. With surrogate virus With beads  Bond ratio

In order to know the maximum binding capacity between the surrogate virus and the bead, an experiment was conducted in which the amount of the Talon beads was fixed and the amounts of the viruses were varied.

As a result, when 10 pmole beads were used, it was confirmed that when the virus amount exceeded 10 pmole, the virus could no longer bind to the bead and remain in the mixture solution.

As a result, it can be seen that when beads and viruses are respectively 10 pmole, viruses bind to the beads at a maximum, and that less than 10 pmole should be used to efficiently fix viruses (FIG. 2).

1-4. Binding between the surrogate virus and the bead in the process of eluting the nucleic acid from the target protein

In general, 2 mM NaOH (pH 11) is used to separate the nucleic acid bound to the target protein from the target protein. Even at such a high pH, the target protein should be immobilized without detaching from the bead.

After attaching a target protein to a Talon bead, reacting with a nucleic acid library, washing the nucleic acids not binding to the target, washing the target with nucleic acid bound to the target using 2 mM NaOH (pH 11) , The bead was boiled to separate the bead and the virus, and the virus was isolated from the bead by electrophoresis.

As a result, it was confirmed that the virus continued to bind to beads even at a high pH (pH 11) (FIG. 3). This means that the method of eluting the platamer with NaOH can also be used in surrogate virus-based SELEX.

Also, when Streptavidin UltraLink Resin was used, it was confirmed that the virus binds well to the bead at a high pH (FIG. 4). Likewise, it means that Streptavidin UltraLink Resin can also be used in SELEX based surrogate viruses.

1-5. Coupling of surrogate virus with nucleic acid library

Prior to SELEX using the surrogate virus prepared in Example 1-1, nonspecific binding between the single-stranded nucleic acid library and the surrogate virus was confirmed by a filter binding assay (FIG. 5).

³² P-ATP (502A, PerkinElmer) was labeled with T4 PNK (T4 Polynucleotide Kinase, Takara) at the 5 'end of the single-stranded nucleic acid library. 1 pmole of eDNA, 0.25 ul of γ- ³² P-ATP (3.3 μM, PerkinElmer), 0.25 ul of T4 PNK and 10 × T4 PNK buffer were reacted in 10 μl of the reaction solution at 37 ° C for 30 minutes and then incubated at 70 ° C for 10 minutes And the enzyme was inactivated. The DNA labeled with ³² P was purified using a Microspin G-50 column (GE healthcare). Isotope labeled DNA (20,000 cpm) was added to 300 μl of selective buffer 1 (Selection Buffer 1: 40 mM HEPES, 102 mM NaCl, 5 mM KCl, 5 mM MgCl ₂ , 1 mM EDTA, 0.002% Tween 20 pH 7.5 at 37 ° C) The temperature was dropped to 37 DEG C at a rate of 0.1 DEG C / sec so that the structure of a suitable pressure thermometer was formed. Subsequently, surrogate virus was sequentially diluted from 10 nM into Selection Buffer 1 (Selection Buffer 1: 40 mM HEPES, 102 mM NaCl, 5 mM KCl, 5 mM MgCl 2, 1 mM EDTA, 0.002% Tween 20 pH 7.5 at 37 ° C) To investigate the effect of dextran sulfate (DxSO ₄ ) or salmon sperm DNA at different concentrations on binding to non - specific binding. In addition, ³² P-labeled platemers were counted, added at 2,000 cpm per well, and reacted at 37 ° C for 30 minutes. After the reaction, 5.5ul of Zorbax resin (0.4g / ml, Agilent) was added to each well. A mixture of the calibrator and the target protein reacted with a Durapore filter (0.45 um PVDF filer, Millipore) prewetted with the selection buffer 1 was added and vacuumed. The filter was then rinsed with selective buffer 1. The filter plate was exposed to the image plate of FLA-5100 overnight at -20 DEG C and the amount of radioisotope present in the filter was measured with FLA-5100 (Fuji) (Fig. 5).

As a result, it was confirmed that the non-specific binding between the surrogate virus and the library DNA was effectively inhibited when DxSO ₄ was added to the reaction solution (FIG. 5).

In order to effectively remove the DNA that binds nonspecifically to the target virus, DxSO ₄ was added to the SELEX process, and it was confirmed that the surrogate virus was not dissolved at a concentration of 1 uM to 10 mM DxSO ₄ (FIG. 6).

Example  2: Using surrogate virus SELEX

2-1. Modified nucleic acid library synthesis

A biotin-coupled antisense library was synthesized at the 5'-end to prepare a single-chain modified nucleic acid library required for SELEX. Of the anti-sense library 0.5mM dNTP (dATP, dGTP, dCTP , Bz-dU), 0.25U / the ul KOD enzyme, 10X extension buffer [ 1.2M Tris-HCl (pH7.8), 100mM KCl, 60mM (NH 4) Double helix DNA was prepared by reacting with 50 uM of reverse primer (SEQ ID NO: 11) at 70 ° C for 1 hour in a buffer solution (pH 7.0, ₂ SO ₄ , 70 mM MgSO ₄ , 1% Triton X-100, 1 mg / ml BSA). The single-stranded nucleic acid library was extracted with 20 mM NaOH and then neutralized with HCl. The prepared nucleic acid library was concentrated using Amicon Ultra-15 (Millipore) and then quantified with a UV spectrophotometer.

2-2. Binding to the target protein

1 nmole of the library synthesized in the above 2-1 was put into the selective buffer 1 and the temperature was dropped to 37 ° C at a rate of 0.1 ° C / sec from 95 ° C to allow the single-stranded nucleic acid library to react, Negative Selection) was mixed with 10 μl of protein competition buffer (10 μM prothrombin, 10 μM casein, 0.1% human serum albumin (HSA, Sigma), 0.05% Tween 20), and 6x histidine protein (Peptron) Were added to the combined Talon beads (20 ug / ml) and reacted at 37 ° C for 10 minutes. After the negative selection reaction, the supernatant was transferred to a new tube and reacted with Talon beads (50 pmole of the target protein) conjugated with the surrogate virus expressing the target protein bound with the His tag at 37 ° C for 1 hour. If necessary, this time, was put DxSO ₄ to inhibit non-specific binding of the single chain variant nucleic acid libraries. Talon Beads bound to the target protein with 200 ul of Selective Buffer 1 were washed five times. During the fifth wash, they were transferred to a new tube and then washed. After washing, 85 ul of 2 mM NaOH was added to extract the library bound to the target and neutralized with 20 ul of 8 mM HCl.

2-3. Quantitative PCR

The library binding to the target was amplified using Quantitative PCR (QPCR, IQ5 mulicolor real time PCR detection system, Bio-rad).

5 x KOD Buffer, 1 mM each dNTP, and 1 mM each dNTP using reverse primer (5 uM) (SEQ ID NO: 11) and biotin (5 uM) 25 mM MgCl ₂ , 5 x SYBR Green I, and 0.075 U / ul KOD enzyme were mixed to make a total volume of 25 ul, and the mixture was mixed with 100 ul of the library extracted in the previous step to make a total of 125 ul. The double-stranded library was prepared by repeating 30 times at 96 ° C for 15 seconds, 55 ° C for 10 seconds, 68 ° C for 30 minutes, and 96 ° C for 15 seconds and 72 ° C for 1 minute.

2-4. eDNA production

eDNA is an enzymatic DNA produced by DNA template and polymerase. The nucleic acid library prepared through QPCR was mixed with Dynabeads Myone SA bead C1 (Invitrogen) at room temperature for 10 minutes and fixed. (DATP, dGTP, dCTP, Bz-dU), 0.015 U / ul KOD enzyme, 10 x extension buffer (1.2 M Tris-HCL pH 7.8 _{, 100mM KCl, 60mM (NH 4} ) 2 SO 4, 70mM MgSO 4, 1% Triton X-100, 1mg / ml BSA) was reacted with 68 ℃, of 50uM forward primer (SEQ ID NO: 10) for 1 hour, the double helix on the DNA was prepared. After that, 85ul of 20mM NaOH was treated to make a single strand. Only 80ul of this was obtained and neutralized with 20ul of 80mM HCl. The synthesized DNA was used in the next round.

2-5. SELEX  Repeating rounds

From the second round, the experiment of 2-2 to 2-4 described above was repeated. The amount of surrogate virus was adjusted based on the amount of protein expressed on the surrogate virus surface. As the round progressed, the amount of target protein used in the next round was adjusted based on the delta Ct value of QPCR. After the QPCR was performed, the amount of target protein added to the next round was smaller as the difference in Ct value between the control and the control was larger. When the Ct value was smaller, the amount of target protein was the same or similar to that of the whole round. For more selective binding, appropriate amounts of DxSO ₄ were mixed at the time of binding of DNA and target material from round 2 to round 12.

2-6. SELEX  Progress result

In order to confirm whether the eDNA was properly selected in the SELEX using the surrogate virus as a material, it was confirmed through a filter binding assay.

Specifically, P32ATP (502A, PerkinElmer) was labeled using T4 PNK at the 5 'end of the selected eDNA. 1 pmole of eDNA, 0.25ul of γ- ³² P-ATP (3.3uM, PerkinElmer), 0.25ul of T4 PNK and 10 x T4 PNK buffer (Takara) were reacted at 37 ° C for 30 minutes in 10ul reaction volume, After incubation for a few minutes, the enzyme was inactivated.

The DNA labeled with ³² P was purified using a Microspin G-50 column (GE healthcare). The isotope labeled DNA (20,000 cpm) was added to 300 μl of selective buffer 1 (Selection Buffer 1: 40 mM HEPES, 102 mM NaCl, 5 mM KCl, 5 mM MgCl ₂ , 1 mM EDTA) Lt; RTI ID = 0.0 > C < / RTI > Then, the selective virus 1 was diluted serially from 10 nM, and DxSO ₄ at the same concentration as that at the time of SELEX was mixed with the solution in which the surrogate virus and the library DNA were bound. 2,000 cpm of platamer was added to each well and reacted at 37 ° C for 30 minutes. After the reaction, 5.5ul of zorbax resin (0.4g / ml, Agilent) was added to each well. A mixture of the calibrator and the target protein reacted with a Durapore filter (0.45 um PVDF filer, Millipore) prewetted with the selection buffer 1 was added and vacuumed. The filter was then rinsed with selective buffer 1. The filter plate was exposed to the image plate of FLA-5100 overnight at -20 DEG C and the amount of radioisotope present in the filter was measured with FLA-5100 (Fuji) (Fig. 7).

As a result, it was confirmed that the eDNAs synthesized in each round bind well to the target surrogate virus (FIG. 7). Through the above Example 1, it was confirmed that SELEX can be carried out using only a surrogate virus, and eDNA can be selected.

Example  3: Baculo  Alternative viruses using a virus-based gene expression system and proteins separated and purified were alternately used SELEX

3-1. Baculo  Production of surrogate virus using a virus-based gene expression system and purification of the target protein

A baculovirus expression system was used to construct a surrogate virus expressing a target protein on the surface of the baculovirus (envelope). The same system was used to separate and purify the extracellular portion of the target protein (ectodomain). In the present invention, HA and NA proteins of influenza A virus were used as targets.

A His-tag, a Flag-tag and a gene of a target protein are inserted into the baculovirus expression vector, and the gene is cloned and then recombined in baculovirus bacmid in E. coli to generate recombinant baculovirus DNA . SF9 cells, insect-derived cells, are transfected to produce baculovirus having a target protein. Baculovirus expressing the target protein was mass-cultured and concentrated to prepare surrogate virus (FIG. 8A).

The baculovirus expression vector was cloned by inserting a His-tag, a Flag-tag, and a gene corresponding to the ectodomain of the target protein, and then transferred to baculovirus plasmid to prepare a recombinant baculovirus DNA . The baculovirus expressing the outer portion of the outer surface of the target protein was prepared by transfecting the insect-derived cell, SF9 cell. After the virus was mass-cultured, target proteins were separated and purified using Ni-NTA beads (FIG. 8B).

3-2. Baculo  Using a virus system and a prepared surrogate virus and target protein SELEX

SELEX was performed using the outer portion of the outer surface of the target protein separated and purified through the baculovirus system and the surrogate virus derived from baculovirus prepared in 3-1.

3-2-1. Modified nucleic acid library synthesis

A biotin-coupled antisense library was synthesized at the 5'-end to prepare a single-chain modified nucleic acid library required for SELEX. The sequence of the antisense library is as follows.

AB (Biotin) AB (Biotin) -TTTTTTTTCTGGGTGGCTGTCGGTG-N (40) -AAAGGCAGGACGCTCGA TATATAT

Of the anti-sense library 0.5mM dNTP (dATP, dGTP, dCTP , Bz-dU), 0.25U / the ul KOD enzyme, 10 x extension buffer [1.2M Tris-HCl (pH7.8), 100mM KCl, 60mM ( NH 4 _{) 2 SO 4, 70mM MgSO 4} , 1% Triton X-100, was 70 ℃, and a reverse primer of 50uM for 1 hour (SEQ ID NO: 11) on the reaction 1mg / ml BSA), to prepare a double helix DNA. The single-stranded nucleic acid library was extracted with 20 mM NaOH and then neutralized with HCl. The prepared nucleic acid library was concentrated using Amicon Ultra-15 (Millipore) and then quantified with a UV spectrophotometer.

3-2-2. Bond with target material

1 nmole of the synthesized library was put into Selection Buffer 2 (40 mM HEPES, 102 mM NaCl, 5 mM KCl, 5 mM MgCl _{2 ,} 0.05% Tween 20) and the temperature was dropped to 25 ° C. at a rate of 0.1 ° C./sec from 95 ° C. (10 μM prothrombin, 10 μM casein, 0.1% human serum albumin (HSA), and 10 μM human serum albumin for the negative selection. Sigma), 0.05% Tween20) were mixed and added to Talon beads (20 ug / ml) with 6 x histidine protein (Peptron) and allowed to react at 25 ℃ for 10 minutes.

After the negative selection reaction, only the supernatant was transferred to a new tube, and then reacted with Talon beads (50 pmole of target protein) bound to the His-tag-bound target protein at 25 ° C for 1 hour. Talon Beads bound to the target protein in 200 ul of Selective Buffer 2 were washed 5 times. During the fifth wash, they were transferred to a new tube and then washed. After washing, 85 ul of 2 mM NaOH was added to extract the library bound to the target and neutralized with 20 ul of 8 mM HCl.

3-2-3. Quantitative PCR

The target-binding library was amplified using QPCR (Quantitative PCR, IQ5 multicolor real-time PCR detection system, Bio-Rad). 5 x KOD Buffer, 1mM each dNTP , 25mM MgCl 2, 5 and above using the biotin (Biotin) and a reverse primer of 5uM (SEQ ID NO: 11) and reverse primer of 5uM (SEQ ID NO: 10), which comprises the use in the library prepared x SYBR Green I, 0.075 U / ul The total volume of the KOD enzyme was mixed to 25 ul, and mixed with 100 ul of the library extracted in the previous step to make a total of 125 ul. The double-stranded library was prepared by repeating 30 times at 96 ° C for 15 seconds, 55 ° C for 10 seconds, 68 ° C for 30 minutes, and 96 ° C for 15 seconds and 72 ° C for 1 minute.

3-2-4. eDNA production

The nucleic acid library prepared by the above QPCR was mixed with Dynabeads Myone SA bead C1 (Invitrogen) at room temperature for 10 minutes to bind. After washing the beads, 0.5 mM dNTP (dATP, dGTP, dCTP, Bz-dU), 0.015 U / ul KOD enzyme, 10 x extension buffer [1.2 M Tris after binding and -HCl (pH7.8), 100mM KCl, 60mM (NH 4) 2 SO 4, 15mM MgSO 4, 20% DMSO, 0.01% BSA) is the forward primer of 50uM (SEQ ID NO: 10) in a solution containing And reacted at 68 ° C for 1 hour to prepare double helix DNA. After that, 85 ul of 20 mM NaOH was added to make a single strand, and then 80 ul of the solution was obtained and neutralized by addition of 20 ul of 80 mM HCl. The synthesized DNA was used in the next round.

3-2-5. SELEX  Repeating rounds

From the second round, the experiment of 3-2-2 to 3-2-4 described above was repeated. The separated and purified protein prepared in Example 3-1 (FIG. 8B) and the surrogate virus (FIG. 8A) were alternately used as targets of SELEX. The amount of surrogate virus was adjusted based on the amount of protein expressed on the surrogate virus surface. As the round progressed, the amount of target protein used in the next round was adjusted based on the delta Ct value of QPCR. After the QPCR was performed, the amount of target protein added to the next round was smaller as the difference in Ct value between the control and the control was larger. When the Ct value was smaller, the amount of target protein was the same or similar to that of the whole round. For more selective binding, 0.1 uM DxSO ₄ was blended during DNA and target binding between rounds 2 and 12 rounds. When the surrogate virus was used to increase the specificity, negative selection was carried out using baculovirus having no target protein. In order to remove the DNA binding to the target protein having a similar structure, Negative selection was performed using a protein having a similar structure.

Table 1 shows the cross-SELEX example (H3N2 HA specific binding platemer excavation) using two materials, and the degree of SELEX formation in each round was checked to determine various conditions (type and amount of target material, reaction time, ) Were used.

Round	Material		Reaction Time
1 st Round		Protein 50 pmole	60 min at 25 ° C
2 nd Round		Protein 5 pmole	45 min at 25 ° C
3 rd Round		Protein 2 pmole	45 min at 25 ° C
4 th Round		Protein 1 pmole	45 min at 25 ° C
5 th Round	Virus 1pmole	30 min at 25 ° C	Negative selection by using Mock virus
6 th Round		Protein 1 pmole	15 min at 25 ° C	Negative selection by using non-target Protein
7 th Round	Protein 0.5 pmole	10 min at 25 ° C
8 th Round	Virus 0.5pmole	5 min at 25 ° C	Negative selection by using Mock virus
9 th Round	Protein 0.2 pmole	2 min at 25 ° C	Negative selection by using non-target Protein
10 th Round	Protein 0.1 pmole	2 min at 25 ° C
11 th Round	Protein 0.05 pmol	2 min at 25 ° C

3-2-6. eDNA  Sequencing

After 11 SELEX rounds, the result was amplified with double-stranded DNA, cloned and sequenced to obtain plasmid sequences (Solgent).

3-2-7. Identified sequence eDNA  synthesis

(SEQ ID NO: 11) and a forward primer (SEQ ID NO: 10) to which biotin was bound and repeating 30 times at 96 ° C for 15 seconds and 72 ° C for 1 minute using the cloning product obtained in 3-2-6 as a template To prepare a double-stranded library. The nucleic acid library prepared by QPCR was mixed with Dynabeads Myone SA bead C1 (Invitrogen) at room temperature for 10 minutes and fixed. (DATP, dGTP, dCTP, Bz-dU), 0.015 U / ul of KOD enzyme, and 10 x extension buffer at 68 ° C for 1 hour to a concentration of 50 uM And a forward primer (SEQ ID NO: 10) to prepare a double helix DNA.

Example  4: Abtamer  Binding property

A filter binding assay was conducted to investigate the binding force and specificity of the platemer found in Example 3 to the target.

4-1. Filter binding assay for target proteins

³² P-ATP (502A, PerkinElmer) was labeled with T4 PNK at the 5 'end of the selected platamer. (1 μg / ml), 1 pmole of platemaker, 0.25 ul of γ- ³² P-ATP (3.3 uM, PerkinElmer), 0.25 ul of T4 PNK (T4 Polynucleotide Kinase, Takara) and 10 x T4 PNK buffer Min and reacted at 70 ° C for 10 min to inactivate the enzyme. The labeled aptamers were purified using a Microspin G-50 column (GE healthcare).

20,000 cpm of the labeled calibrator was added to 300 μl of Selection Buffer 2 (40 mM HEPES, 102 mM NaCl, 5 mM KCl, 5 mM MgCl 2, 0.05% Tween 20) at a rate of 0.1 ° C./sec from 95 ° C. To make a stable pressure damper structure. Then, the target protein was diluted sequentially in the selective buffer from 100 nM to 7 points, at which time DxSO ₄ was added at the same concentration as in SELEX. Then, the target protein was sequentially diluted from 13.3 nM in the selective buffer solution 2, and DxSO ₄ at the same concentration as that at the time of SELEX was added to the solution in which the target protein and the library DNA were bound. 2,000 cpm of platamer was added to each well and reacted at 25 ° C for 30 minutes. After the reaction, 5.5ul of zorbax resin (0.4g / ml, Agilent) was added to each well. A mixture of the platamer and the target protein reacted with a Durapore filter (0.45 um PVDF filer, Millipore) prewetted with the selection buffer 2 was added and vacuumed. The filter was then rinsed with Selective Buffer 2. The filter plate was exposed to the image plate of FLA-5100 overnight at -20 ° C and the amount of radioisotope present in the filter was measured with FLA-5100 (Fuji).

As a result, it was confirmed that 17 aptamers out of 19 composites synthesized with high binding force to the target (FIG. 9 and Table 2). It was also confirmed that it binds only specifically to the target and does not bind to similar proteins of other subtype influenza (Fig. 10).

The coupling force (Kd) and the maximum coupling amount (Bmax)

Abtamer	Bonding force (Kd)	Maximum bond amount (Bmax)
NS3-1	0.11 nM	18%
NS3-2	0.12 nM	18%
NS3-3	0.63 nM	31%
NS3-4	0.48 nM	26%
NS3-5	0.20 nM	22%
NS3-6	0.14 nM	25%
NS3-7	-	-
NS3-8	0.28 nM	40%
NS3-9	-	-
NS3-10	0.30 nM	50%
NS3-11	0.25 nM	36%
NS3-12	0.22 nM	27%
NS3-13	0.44 nM	27%
NS3-14	0.33 nM	20%
NS3-15	0.11 nM	40%
NS3-16	0.05 nM	29%
NS3-17	0.12 nM	32%
NS3-18	0.10 nM	38%
NS3-19	0.12 nM	36%

4-3. Target Protein  For surrogate virus Abtamer's  Filter binding assay

In order to investigate the binding force and specificity of the platemer found in Example 3 on the target, a filter binding assay was performed on the surrogate virus expressing the target protein on the surface.

Five platamers showing high binding force and specificity among the plumbers uncovered in Example 3 were selected and subjected to a filter binding assay for the target virus in the same manner as described in 4-2 ).

As a result, it was confirmed that the aptamer discovered in Example 3 specifically binds to the target virus (Fig. 11).

In addition, the five aptamers specifically binding to the influenza subtype (H3N2 HA) virus obtained by the method of the present invention are shown in Table 3 below.

Aptamer	Base Sequence (5 '- > 3')	K D (nM)
HA3-1	CAGGUGUGAUAUGCCUUCUCCUCUAUAUGACCUCGGUUA	0.11
HA3-10	ACGAUGAACUGUUCUUGGAACUGCAUUUAUAAUGGUCUCA	0.30
HA3-15	UUCAAACGAUUUGUCGCAAGUCCUAUUUAUAAUUGGGCUCAACAC	0.11
HA3-16	UAUAUUGUCGUUAGUCCUAUUUAUUGAUUGGGAAAUGAAA	0.05
HA3-18	GAUAGGCUGUCAUGCAUCCAUGCUCGGUUACGGGUUUCA	0.10

* U means the modified nucleotide, and K _D means the equilibrium dissociation constant.

4-4. Abtamer's  Analysis of binding to influenza virus (Filter binding assay)

A filter binding assay was performed on the actual target virus (type A influenza virus) to investigate the binding force and specificity of the platemer found in Example 3 to the target.

As in Example 4-3, five platamers exhibiting high binding force and specificity among the platelets excavated in Example 3 were selected and subjected to the same procedure as described in 4-2, An essay was conducted.

As a result, it was confirmed that the aptamer obtained by SELEX by the novel method described in the present invention showed high binding force to the actual target virus (influenza virus subtype H3N2) (FIG. 12).

Example  5. Target protein ( H3N2  NA) < / RTI >

A filter binding assay was conducted to investigate the binding force and specificity to the target (H3N2 NA) of the plumbers unearthed in the same manner as in Example 3.

5-1. The target protein ( H3N2  NA) in a filter binding assay

³² P-ATP (502A, PerkinElmer) was labeled with T4 PNK at the 5 'end of the selected platamer. (1 μg / ml), 1 pmole of platemaker, 0.25 ul of γ- ³² P-ATP (3.3 uM, PerkinElmer), 0.25 ul of T4 PNK (T4 Polynucleotide Kinase, Takara) and 10 x T4 PNK buffer Min and reacted at 70 ° C for 10 min to inactivate the enzyme. The labeled aptamers were purified using a Microspin G-50 column (GE healthcare).

20,000 cpm of the labeled platamer was added to 300 ul of the selective buffer 2 and the temperature was dropped to 25 ° C. at a rate of 0.1 ° C./sec from 95 ° C. to obtain a stable pressure buffer structure. Then, the target protein was diluted sequentially from 100 nM in the selective buffer solution 2, and DxSO ₄ at the same concentration as that at the time of SELEX was mixed with the solution in which the target protein and the library DNA were bound. 2,000 cpm of platamer was added to each well and reacted at 25 ° C for 15 minutes. After the reaction, 5.5ul of zorbax resin (0.4g / ml, Agilent) was added to each well. A mixture of the platamer and the target protein reacted with a Durapore filter (0.45 um PVDF filer, Millipore) prewetted with the selection buffer 2 was added and vacuumed. And the filter was rinsed with selective buffer 2. The filter plate was exposed to the image plate of FLA-5100 overnight at -20 ° C and the amount of radioisotope present in the filter was measured with FLA-5100 (Fuji).

As a result, it was confirmed that the four aptamers synthesized were bound to the target with high binding force (FIG. 13, Table 4, and Table 5). It was also confirmed that it binds only specifically to the target and does not bind to similar proteins of other subtype influenza (Fig. 14).

The four overtamers specifically binding to the influenza subtype (H3N2 NA) virus obtained by the method of the present invention are shown in Table 4 below.

Aptamer	Base Sequence (5 '- > 3')	K D (nM)
NA8-14	UCAACGUUCUGUUACCAUAGUAUUCCCCUACUCUAUCAUU	15.82
NA8-15	UCCACACACUAAAGGAGAAGUUGUUUUUUUAGUCCCCUCCU	9.91
NA8-16	AAUUCGCUUCUUACGUUCAUACUUAAUAUAAUUCCACCCU	8.34
NA8-17	UUCGCUUCUUACGUUCUCAAUAAAUUAAAUUUGGCCCGCU	2.18

* U means the modified nucleotide, and K _D means the equilibrium dissociation constant.

The coupling force (Kd) and the maximum coupling amount (Bmax)

Abtamer	NS8-14	NS8-15	NS8-16	NS8-17
Bonding force (Kd)	15.82 nM	9.91 nM	8.34 nM	2.18 nM
Maximum bond amount (Bmax)	19%	15%	12%	21%

5-2. Target protein through lateral flow ( H3N2  NA) Abtamer's  Identify characteristics

Binding to the target protein was confirmed by lateral flow method using the plumbers unearthed in the same manner as in Example 3 (Fig. 15). In addition, a side - flow - type diagnostic kit based on the excavated pair of tympanomas was constructed, and virus - free samples and virus - containing samples were individually treated to confirm binding. In the virus-free sample, no signal was labeled, but in the virus-containing sample, a circular signal was marked in the center of the membrane.

These results suggest that the method of the present invention can be effectively used to identify platamers specifically binding to a target protein existing in the natural world.

From the above description, it will be understood by those skilled in the art that the present invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. In this regard, it should be understood that the above-described embodiments are to be considered in all respects as illustrative and not restrictive. The scope of the present invention should be construed as being included in the scope of the present invention without departing from the scope of the present invention as defined by the appended claims.

Claims (38)

1. A method of producing an extramammary by performing a modified SELEX (Systematic evolution of ligands by exponential enrichment) comprising contacting a virus with a target virus expressed in the envelope of the virus to a nucleic acid library.
2. The method according to claim 1,

   The method comprises the steps of: performing a modified SELEX to produce an extramamer, wherein the modified SELEX comprises the steps of:

    (a) contacting a separately isolated and purified target protein with a selected nucleic acid library in contact with said surrogate virus, using a gene expression system using a virus, bacteria, or eukaryotic cell; or

   (b) contacting the target protein with a selected nucleic acid library in contact with said surrogate virus.
3. 3. The method of claim 2,

   Further comprising selectively separating only the binding to the target protein from the construct bound by said contact. ≪ RTI ID = 0.0 > 8. < / RTI >
4. 3. The method of claim 2,

   And selectively removing only those that are not bound to the target protein among the structures bound by said contact. ≪ Desc / Clms Page number 20 >
5. The method of claim 3,

   Further comprising separating and amplifying the nucleic acid from said selectively separated construct. ≪ RTI ID = 0.0 > 8. < / RTI >
6. A method for producing an extramammer by performing a modified SELEX, wherein the step of any one of claims 1 to 4 is repeated using the isolated amplified nucleic acid library according to claim 5.
7. The method of claim 3,

   Wherein the step of separating comprises using a buffer comprising a negative charge polymer.
8. 8. The method of claim 7,

   Wherein the negative charge polymer is selected from the group consisting of dextran sulfate, polyanionic cellulose, hyaluronic acid, polyanionic heparin, polysulfonate polymer, polyanionic dendrimer, carboxymethyldextran, heparin, aurin tricarboxylic acid, Wherein the modified SELEX is at least one selected from the group consisting of < RTI ID = 0.0 > a < / RTI >
9. 8. The method of claim 7,

   Wherein the negative charge polymer is at a concentration of 0 mM to 50 mM or less.
10. The method according to claim 1,

    Wherein said surrogate virus is expressed in the envelope of a target protein.
11. 11. The method of claim 10,

    Wherein the target protein is at least 75% identical to the target protein corresponding to the natural system.
12. A method of making an extruder by performing a modified SELEX comprising recovering an extruder produced from the process of claim 6.
13. The method according to claim 1,

    Wherein said surrogate virus comprises a envelope-bearing DNA virus or a envelope-bearing RNA virus.
14. 14. The method of claim 13,

    Wherein the envelope-carrying DNA virus is at least one selected from the group consisting of Baculovirus, Hepadnavirus, Herpesvirus, poxvirus, and vaccinia virus. Gt; SELEX < / RTI >
15. 14. The method of claim 13,

    The envelope-bearing RNA virus may be selected from the group consisting of Coronavirus, Flavivirus, Togavirus, Alphavirus, Arenavirus, Bunyavirus, Filovirus, Wherein the modified SELEX is at least one selected from the group consisting of Orthomyxovirus, Paramyxovirus, Rhabdovirus, Retrovirus, and Lentivirus. A method of manufacturing a tamer.
16. The method according to claim 1,

    Wherein the target protein is at least one selected from the group consisting of an animal cell membrane protein, a plant cell membrane protein, a cell membrane protein of a microorganism, and a virus protein.
17. The method according to claim 1,

    Wherein the nucleic acid library is at least one of a single-stranded nucleic acid or a nucleic acid derivative, a double-stranded nucleic acid or a nucleic acid derivative.
18. The method of claim 3,

    Wherein the combined structure is immobilized by binding to magnetic beads or nonmagnetic beads. ≪ RTI ID = 0.0 > 15. < / RTI >
19. 19. The method of claim 18,

    Wherein the magnetic beads are at least one selected from the group consisting of Talon, Dynabead, Agarose, Sepharose, and Streptavidin.
20. 19. The method of claim 18,

    Wherein the non-magnetic beads are at least one selected from the group consisting of Agarose, Sepharose, Streptavidin-Agarose, Streptavar-Sepharose, and Govex.
21. The method of claim 3,

    Wherein the step of separating comprises using a buffer containing divalent cations.
22. 22. The method of claim 21,

    Wherein said buffer is at a concentration of 0 mM to 1 M or less.
23. 22. The method of claim 21,

    Wherein the divalent cation is producing a ^{Mg 2 +, Ca 2 +,} Mn 2 +, Cu 2 + , and an aptamer, by performing a modified SELEX is at least one selected from the group consisting of Fe ^{2 +.}
24. 22. The method of claim 21,

    Wherein said buffer comprises a negative charge polymer.
25. 25. The method of claim 24,

    Wherein the negative charge polymer is selected from the group consisting of dextran sulfate, polyanionic cellulose, hyaluronic acid, polyanionic heparin, polysulfonate polymer, polyanionic dendrimer, carboxymethyldextran, heparin, aurin tricarboxylic acid, Wherein the modified SELEX is at least one selected from the group consisting of < RTI ID = 0.0 > a < / RTI >
26. 25. The method of claim 24,

    Wherein the negative charge polymer is at a concentration of 0 mM to 10 mM or less.
27. (a) contacting a surrogate virus expressing a target protein to the envelope of the virus with a nucleic acid library;

    (b) optionally, (i) contacting the separately isolated and purified target protein with the surrogate virus using a gene expression system using a virus, bacteria or eukaryotic cell to contact the selected nucleic acid library; Or (ii) contacting the target protein with a selected nucleic acid library in contact with said surrogate virus;

    (c) selectively separating only the binding to the target protein from the construct bound by the contact;

    (d) selectively removing only those not bound to the target protein among the structures bound by the contact; And

    (e) isolating and amplifying the nucleic acid from the selectively separated construct; (A) to (e) are repeated one or more times.
28. 28. The method of claim 27,

     Wherein the aptamer specifically binds to an influenza virus.
29. 29. The method of claim 28,

    Wherein the aptamer is at least one selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 9.
30. A platemaker comprising a nucleic acid sequence of SEQ ID NO: 1 to SEQ ID NO: 9, wherein the aptamer specifically binds to an influenza virus.
31. 31. The method of claim 30,

    Wherein the aptamer comprises a nucleic acid sequence having at least 75% identity to any of SEQ ID NO: 1 to SEQ ID NO: 9.
32. 31. The method of claim 30,

    Wherein the aptamer has at least one stem-loop structure.
33. 31. The method of claim 30,

    Wherein the aptamer is a modified version of one or more nucleotides.
34. (i) contacting a sample to an individual with an aptamer according to claim 28 that specifically binds to the influenza H3N2 virus; And

    (ii) detecting an influenza H3N2 virus in a sample associated with the platemer of step (i).
35. A composition for detecting influenza virus comprising the nucleic acid sequence of SEQ ID NO: 1 to SEQ ID NO: 9, which specifically binds to the influenza H3N2 virus.
36. 29. A kit for diagnosing influenza virus infection, comprising the platamater of claim 30.
37. 36. The kit of claim 35, wherein the kit is in the form of a strip using immunochromatography.
38. 1 to SEQ ID NO: 9, which specifically binds to influenza H3N2 virus. 9. A pharmaceutical composition for the treatment or prevention of influenza virus infection, comprising:

Images